>Feature sequence01 2912 2739 gene locus_tag LOCUS_00010 2912 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3719 3441 gene locus_tag LOCUS_00020 3719 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4008 3760 gene locus_tag LOCUS_00030 4008 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4347 4030 gene locus_tag LOCUS_00040 4347 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4749 4555 gene locus_tag LOCUS_00050 4749 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5683 5282 gene locus_tag LOCUS_00060 5683 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6200 5823 gene locus_tag LOCUS_00070 6200 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 6691 6308 gene locus_tag LOCUS_00080 6691 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 6976 6731 gene locus_tag LOCUS_00090 6976 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7230 7304 gene locus_tag LOCUS_t00010 7230 7304 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8153 7893 gene locus_tag LOCUS_00100 8153 7893 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_00100 8365 8144 gene locus_tag LOCUS_00110 8365 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9637 8639 gene locus_tag LOCUS_00120 9637 8639 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965544.1 protein_id gnl|my_center|LOCUS_00120 10123 11181 gene locus_tag LOCUS_00130 10123 11181 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_00130 12555 11833 gene locus_tag LOCUS_00140 12555 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12841 13854 gene locus_tag LOCUS_00150 gene gldB 12841 13854 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_00150 15098 14340 gene locus_tag LOCUS_00160 15098 14340 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_00160 15857 15111 gene locus_tag LOCUS_00170 15857 15111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_00170 16151 17014 gene locus_tag LOCUS_00180 16151 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17389 19068 gene locus_tag LOCUS_00190 17389 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19919 19077 gene locus_tag LOCUS_00200 19919 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20092 20811 gene locus_tag LOCUS_00210 20092 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20973 21278 gene locus_tag LOCUS_00220 20973 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21672 21301 gene locus_tag LOCUS_00230 gene gldC 21672 21301 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_00230 22874 21696 gene locus_tag LOCUS_00240 22874 21696 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860104.1 protein_id gnl|my_center|LOCUS_00240 23636 23013 gene locus_tag LOCUS_00250 23636 23013 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_00250 24001 23651 gene locus_tag LOCUS_00260 24001 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25132 24005 gene locus_tag LOCUS_00270 25132 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00270 25900 25133 gene locus_tag LOCUS_00280 25900 25133 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_00280 26529 25918 gene locus_tag LOCUS_00290 26529 25918 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_00290 27103 26522 gene locus_tag LOCUS_00300 27103 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 27729 27187 gene locus_tag LOCUS_00310 27729 27187 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_00310 28740 27730 gene locus_tag LOCUS_00320 28740 27730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29467 28649 gene locus_tag LOCUS_00330 29467 28649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30053 29445 gene locus_tag LOCUS_00340 gene yihA 30053 29445 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_00340 30340 30975 gene locus_tag LOCUS_00350 30340 30975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 31233 34469 gene locus_tag LOCUS_00360 31233 34469 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_00360 34691 34542 gene locus_tag LOCUS_00370 34691 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34721 36442 gene locus_tag LOCUS_00380 34721 36442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 36583 37389 gene locus_tag LOCUS_00390 36583 37389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 37492 38133 gene locus_tag LOCUS_00400 37492 38133 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964101.1 protein_id gnl|my_center|LOCUS_00400 39313 38246 gene locus_tag LOCUS_00410 gene fbaA 39313 38246 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_00410 40315 39374 gene locus_tag LOCUS_00420 gene trxB 40315 39374 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_00420 41037 40498 gene locus_tag LOCUS_00430 41037 40498 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_00430 41412 41861 gene locus_tag LOCUS_00440 41412 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41877 42179 gene locus_tag LOCUS_00450 gene yajC 41877 42179 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_00450 42187 43113 gene locus_tag LOCUS_00460 42187 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 43244 44470 gene locus_tag LOCUS_00470 43244 44470 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963977.1 protein_id gnl|my_center|LOCUS_00470 44913 46805 gene locus_tag LOCUS_00480 44913 46805 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_00480 46810 48060 gene locus_tag LOCUS_00490 46810 48060 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_00490 48626 48138 gene locus_tag LOCUS_00500 48626 48138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_00500 49669 48929 gene locus_tag LOCUS_00510 gene fabG 49669 48929 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_00510 50648 49671 gene locus_tag LOCUS_00520 50648 49671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 50838 51677 gene locus_tag LOCUS_00530 50838 51677 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_00530 51866 52471 gene locus_tag LOCUS_00540 51866 52471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 52775 52990 gene locus_tag LOCUS_00550 52775 52990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 53645 53217 gene locus_tag LOCUS_00560 53645 53217 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_00560 54742 53789 gene locus_tag LOCUS_00570 gene ftsY 54742 53789 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_00570 55081 54911 gene locus_tag LOCUS_00580 55081 54911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 55272 55084 gene locus_tag LOCUS_00590 gene rpmG 55272 55084 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_00590 55546 55298 gene locus_tag LOCUS_00600 gene rpmB 55546 55298 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771445.1 protein_id gnl|my_center|LOCUS_00600 55653 55579 gene locus_tag LOCUS_t00020 55653 55579 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56069 58864 gene locus_tag LOCUS_00610 56069 58864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 59334 58942 gene locus_tag LOCUS_00620 59334 58942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 60119 60682 gene locus_tag LOCUS_00630 gene tnpA 60119 60682 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_00630 62580 61567 gene locus_tag LOCUS_00640 62580 61567 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_00640 63639 62629 gene locus_tag LOCUS_00650 gene nadA 63639 62629 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_00650 63944 64381 gene locus_tag LOCUS_00660 63944 64381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 65215 64385 gene locus_tag LOCUS_00670 65215 64385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 65456 65941 gene locus_tag LOCUS_00680 65456 65941 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_00680 66445 65987 gene locus_tag LOCUS_00690 66445 65987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 66906 66493 gene locus_tag LOCUS_00700 66906 66493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 67560 67048 gene locus_tag LOCUS_00710 67560 67048 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_00710 68403 67702 gene locus_tag LOCUS_00720 68403 67702 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_00720 69759 69010 gene locus_tag LOCUS_00730 gene rlmB 69759 69010 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_00730 69841 73380 gene locus_tag LOCUS_00740 69841 73380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 75696 74035 gene locus_tag LOCUS_00750 gene rny 75696 74035 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_00750 76115 75825 gene locus_tag LOCUS_00760 76115 75825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 76418 76119 gene locus_tag LOCUS_00770 76418 76119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 78928 76484 gene locus_tag LOCUS_00780 gene pheT 78928 76484 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_00780 80454 79264 gene locus_tag LOCUS_00790 80454 79264 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_00790 80648 81361 gene locus_tag LOCUS_00800 80648 81361 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_00800 82478 81372 gene locus_tag LOCUS_00810 82478 81372 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_00810 82867 83391 gene locus_tag LOCUS_00820 82867 83391 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_00820 83397 83831 gene locus_tag LOCUS_00830 83397 83831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 83860 84111 gene locus_tag LOCUS_00840 83860 84111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 84108 84314 gene locus_tag LOCUS_00850 84108 84314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 84804 84415 gene locus_tag LOCUS_00860 84804 84415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 86240 84840 gene locus_tag LOCUS_00870 86240 84840 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_00870 87076 86246 gene locus_tag LOCUS_00880 87076 86246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 87464 87865 gene locus_tag LOCUS_00890 87464 87865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 88027 89229 gene locus_tag LOCUS_00900 88027 89229 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163386057.1 protein_id gnl|my_center|LOCUS_00900 89311 89802 gene locus_tag LOCUS_00910 89311 89802 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_00910 89984 90868 gene locus_tag LOCUS_00920 gene rimK 89984 90868 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_00920 90880 91824 gene locus_tag LOCUS_00930 90880 91824 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_00930 92261 93721 gene locus_tag LOCUS_00940 gene dacB 92261 93721 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_00940 93785 94768 gene locus_tag LOCUS_00950 93785 94768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 94970 95314 gene locus_tag LOCUS_00960 94970 95314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 95287 95850 gene locus_tag LOCUS_00970 95287 95850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 96721 95852 gene locus_tag LOCUS_00980 96721 95852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 97083 97156 gene locus_tag LOCUS_t00030 97083 97156 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 98080 97379 gene locus_tag LOCUS_00990 98080 97379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 98220 98651 gene locus_tag LOCUS_01000 98220 98651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 98678 99037 gene locus_tag LOCUS_01010 98678 99037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01010 99329 100846 gene locus_tag LOCUS_01020 99329 100846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 100771 101154 gene locus_tag LOCUS_01030 100771 101154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 101151 102989 gene locus_tag LOCUS_01040 101151 102989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 103103 105172 gene locus_tag LOCUS_01050 103103 105172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 105324 107147 gene locus_tag LOCUS_01060 105324 107147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 107306 108298 gene locus_tag LOCUS_01070 107306 108298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 108400 108873 gene locus_tag LOCUS_01080 gene greA 108400 108873 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_01080 108880 109275 gene locus_tag LOCUS_01090 108880 109275 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_01090 109839 109282 gene locus_tag LOCUS_01100 gene ruvC 109839 109282 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_01100 110653 109913 gene locus_tag LOCUS_01110 gene kdsB 110653 109913 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963128.1 protein_id gnl|my_center|LOCUS_01110 110819 111781 gene locus_tag LOCUS_01120 110819 111781 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_01120 111843 114722 gene locus_tag LOCUS_01130 gene uvrA 111843 114722 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_01130 114908 114729 gene locus_tag LOCUS_01140 114908 114729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 115744 115502 gene locus_tag LOCUS_01150 115744 115502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 115725 119786 gene locus_tag LOCUS_01160 115725 119786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 120301 122403 gene locus_tag LOCUS_01170 120301 122403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 122369 123028 gene locus_tag LOCUS_01180 122369 123028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 123021 124475 gene locus_tag LOCUS_01190 123021 124475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 125164 124760 gene locus_tag LOCUS_01200 125164 124760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 126655 125549 gene locus_tag LOCUS_01210 126655 125549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 126772 127368 gene locus_tag LOCUS_01220 126772 127368 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_01220 127387 127863 gene locus_tag LOCUS_01230 127387 127863 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075144.1 protein_id gnl|my_center|LOCUS_01230 128015 128089 gene locus_tag LOCUS_t00040 128015 128089 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 128606 132262 gene locus_tag LOCUS_01240 128606 132262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 132623 132324 gene locus_tag LOCUS_01250 132623 132324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 133728 132613 gene locus_tag LOCUS_01260 gene recF 133728 132613 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_01260 134454 135467 gene locus_tag LOCUS_01270 gene pdhA 134454 135467 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_01270 135526 136950 gene locus_tag LOCUS_01280 135526 136950 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963534.1 protein_id gnl|my_center|LOCUS_01280 136950 138098 gene locus_tag LOCUS_01290 136950 138098 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963533.1 protein_id gnl|my_center|LOCUS_01290 139035 138100 gene locus_tag LOCUS_01300 139035 138100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_01300 139180 139620 gene locus_tag LOCUS_01310 139180 139620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 140504 139668 gene locus_tag LOCUS_01320 140504 139668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 140586 141026 gene locus_tag LOCUS_01330 140586 141026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 141065 141688 gene locus_tag LOCUS_01340 141065 141688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01340 142291 141920 gene locus_tag LOCUS_01350 142291 141920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 144349 142424 gene locus_tag LOCUS_01360 gene thrS 144349 142424 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_01360 145220 144435 gene locus_tag LOCUS_01370 145220 144435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 147436 145955 gene locus_tag LOCUS_01380 gene guaB 147436 145955 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_01380 147667 148110 gene locus_tag LOCUS_01390 147667 148110 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_01390 148251 148814 gene locus_tag LOCUS_01400 148251 148814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 150875 150189 gene locus_tag LOCUS_01410 150875 150189 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_01410 151543 150962 gene locus_tag LOCUS_01420 151543 150962 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_01420 152810 151983 gene locus_tag LOCUS_01430 152810 151983 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 153703 152876 gene locus_tag LOCUS_01440 153703 152876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 154168 153722 gene locus_tag LOCUS_01450 154168 153722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 154708 154301 gene locus_tag LOCUS_01460 154708 154301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 155370 154738 gene locus_tag LOCUS_01470 155370 154738 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_01470 155498 155422 gene locus_tag LOCUS_t00050 155498 155422 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 156395 155622 gene locus_tag LOCUS_01480 156395 155622 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_01480 157607 156414 gene locus_tag LOCUS_01490 157607 156414 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_01490 157872 158375 gene locus_tag LOCUS_01500 gene pyrR 157872 158375 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357409.1 protein_id gnl|my_center|LOCUS_01500 158379 158987 gene locus_tag LOCUS_01510 158379 158987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 159759 159307 gene locus_tag LOCUS_01520 159759 159307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 160112 159879 gene locus_tag LOCUS_01530 160112 159879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 160357 160109 gene locus_tag LOCUS_01540 160357 160109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 161787 160951 gene locus_tag LOCUS_01550 161787 160951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 162125 161808 gene locus_tag LOCUS_01560 162125 161808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 164279 162135 gene locus_tag LOCUS_01570 164279 162135 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_01570 164646 164272 gene locus_tag LOCUS_01580 164646 164272 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_01580 165606 165791 gene locus_tag LOCUS_01590 165606 165791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 165944 166315 gene locus_tag LOCUS_01600 165944 166315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 166367 167407 gene locus_tag LOCUS_01610 166367 167407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 167521 168813 gene locus_tag LOCUS_01620 167521 168813 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_01620 168819 168893 gene locus_tag LOCUS_t00060 168819 168893 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 169836 170744 gene locus_tag LOCUS_01630 169836 170744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 170765 171724 gene locus_tag LOCUS_01640 170765 171724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 171847 172947 gene locus_tag LOCUS_01650 171847 172947 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_01650 172962 175472 gene locus_tag LOCUS_01660 172962 175472 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_01660 175476 177734 gene locus_tag LOCUS_01670 175476 177734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 177859 179274 gene locus_tag LOCUS_01680 177859 179274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 179908 182439 gene locus_tag LOCUS_01690 179908 182439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 182364 182654 gene locus_tag LOCUS_01700 182364 182654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 182651 183127 gene locus_tag LOCUS_01710 182651 183127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 183111 183419 gene locus_tag LOCUS_01720 183111 183419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 183416 184315 gene locus_tag LOCUS_01730 183416 184315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01730 184324 185637 gene locus_tag LOCUS_01740 184324 185637 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_01740 185682 186035 gene locus_tag LOCUS_01750 185682 186035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 186004 186444 gene locus_tag LOCUS_01760 186004 186444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 186448 187065 gene locus_tag LOCUS_01770 186448 187065 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_01770 187067 189115 gene locus_tag LOCUS_01780 187067 189115 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_01780 189368 189700 gene locus_tag LOCUS_01790 189368 189700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 190251 189832 gene locus_tag LOCUS_01800 190251 189832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 190402 191064 gene locus_tag LOCUS_01810 190402 191064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 191957 191163 gene locus_tag LOCUS_01820 191957 191163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003613.1 protein_id gnl|my_center|LOCUS_01820 192134 193141 gene locus_tag LOCUS_01830 192134 193141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 193405 194556 gene locus_tag LOCUS_01840 193405 194556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 194563 194976 gene locus_tag LOCUS_01850 194563 194976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 195386 195102 gene locus_tag LOCUS_01860 195386 195102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 196185 195496 gene locus_tag LOCUS_01870 196185 195496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 196824 199499 gene locus_tag LOCUS_01880 196824 199499 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_01880 199573 199815 gene locus_tag LOCUS_01890 199573 199815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 200227 199835 gene locus_tag LOCUS_01900 200227 199835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 200471 200220 gene locus_tag LOCUS_01910 200471 200220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 200722 200492 gene locus_tag LOCUS_01920 200722 200492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 202760 200784 gene locus_tag LOCUS_01930 202760 200784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 204494 203079 gene locus_tag LOCUS_01940 204494 203079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01940 204847 204491 gene locus_tag LOCUS_01950 204847 204491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 205181 204894 gene locus_tag LOCUS_01960 205181 204894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 205885 205178 gene locus_tag LOCUS_01970 205885 205178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 207147 205891 gene locus_tag LOCUS_01980 207147 205891 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_01980 207656 207913 gene locus_tag LOCUS_01990 207656 207913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 208854 210635 gene locus_tag LOCUS_02000 208854 210635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 210700 211713 gene locus_tag LOCUS_02010 210700 211713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 212685 212044 gene locus_tag LOCUS_02020 212685 212044 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_02020 213549 212686 gene locus_tag LOCUS_02030 213549 212686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 214937 213747 gene locus_tag LOCUS_02040 214937 213747 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_02040 215190 214924 gene locus_tag LOCUS_02050 215190 214924 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_02050 215550 215272 gene locus_tag LOCUS_02060 215550 215272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 216954 215830 gene locus_tag LOCUS_02070 216954 215830 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_02070 217431 217000 gene locus_tag LOCUS_02080 217431 217000 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_02080 217875 217438 gene locus_tag LOCUS_02090 217875 217438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 219083 217881 gene locus_tag LOCUS_02100 219083 217881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 220849 219527 gene locus_tag LOCUS_02110 220849 219527 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_02110 221107 221727 gene locus_tag LOCUS_02120 221107 221727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 221799 222581 gene locus_tag LOCUS_02130 221799 222581 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_02130 224780 223449 gene locus_tag LOCUS_02140 224780 223449 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_02140 225869 224937 gene locus_tag LOCUS_02150 gene mdh 225869 224937 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_02150 226124 226894 gene locus_tag LOCUS_02160 226124 226894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 226861 227556 gene locus_tag LOCUS_02170 226861 227556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 227740 228945 gene locus_tag LOCUS_02180 gene sucC 227740 228945 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_02180 229886 229239 gene locus_tag LOCUS_02190 229886 229239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 232411 229910 gene locus_tag LOCUS_02200 232411 229910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 233978 232917 gene locus_tag LOCUS_02210 233978 232917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 234383 235084 gene locus_tag LOCUS_02220 234383 235084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 235026 235277 gene locus_tag LOCUS_02230 235026 235277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 235327 235725 gene locus_tag LOCUS_02240 235327 235725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 237111 235891 gene locus_tag LOCUS_02250 237111 235891 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_02250 238558 237206 gene locus_tag LOCUS_02260 gene glmM 238558 237206 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_02260 239130 238618 gene locus_tag LOCUS_02270 gene ftnA 239130 238618 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211092.1 protein_id gnl|my_center|LOCUS_02270 239667 239209 gene locus_tag LOCUS_02280 gene bcp 239667 239209 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_02280 240391 239681 gene locus_tag LOCUS_02290 240391 239681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 241370 240393 gene locus_tag LOCUS_02300 241370 240393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 242435 241437 gene locus_tag LOCUS_02310 gene meaB 242435 241437 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_02310 245144 242571 gene locus_tag LOCUS_02320 245144 242571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 245724 245344 gene locus_tag LOCUS_02330 245724 245344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 246077 245724 gene locus_tag LOCUS_02340 246077 245724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 246806 246396 gene locus_tag LOCUS_02350 246806 246396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 249249 247015 gene locus_tag LOCUS_02360 249249 247015 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_02360 250742 249252 gene locus_tag LOCUS_02370 250742 249252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 252669 251290 gene locus_tag LOCUS_02380 252669 251290 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 protein_id gnl|my_center|LOCUS_02380 253756 252698 gene locus_tag LOCUS_02390 253756 252698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 255036 253774 gene locus_tag LOCUS_02400 255036 253774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_02400 255411 256073 gene locus_tag LOCUS_02410 255411 256073 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461763.1 protein_id gnl|my_center|LOCUS_02410 256851 256129 gene locus_tag LOCUS_02420 256851 256129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_02420 257003 257650 gene locus_tag LOCUS_02430 257003 257650 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_02430 257980 259164 gene locus_tag LOCUS_02440 257980 259164 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_02440 259761 259183 gene locus_tag LOCUS_02450 259761 259183 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932644.1 protein_id gnl|my_center|LOCUS_02450 260090 259758 gene locus_tag LOCUS_02460 260090 259758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 260312 261382 gene locus_tag LOCUS_02470 260312 261382 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_02470 262039 264150 gene locus_tag LOCUS_02480 262039 264150 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_02480 264135 265043 gene locus_tag LOCUS_02490 264135 265043 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_02490 265218 265763 gene locus_tag LOCUS_02500 265218 265763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_02500 266086 266391 gene locus_tag LOCUS_02510 266086 266391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 266400 267497 gene locus_tag LOCUS_02520 266400 267497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 267716 269281 gene locus_tag LOCUS_02530 gene lepB 267716 269281 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_02530 269327 270103 gene locus_tag LOCUS_02540 269327 270103 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_02540 270343 271950 gene locus_tag LOCUS_02550 270343 271950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 272268 272059 gene locus_tag LOCUS_02560 272268 272059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 274059 272506 gene locus_tag LOCUS_02570 274059 272506 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_02570 274131 274946 gene locus_tag LOCUS_02580 274131 274946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 275027 275707 gene locus_tag LOCUS_02590 275027 275707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 275799 275999 gene locus_tag LOCUS_02600 275799 275999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 277611 276277 gene locus_tag LOCUS_02610 277611 276277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_02610 278320 277604 gene locus_tag LOCUS_02620 278320 277604 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_02620 279828 278329 gene locus_tag LOCUS_02630 gene purH 279828 278329 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_02630 279927 280847 gene locus_tag LOCUS_02640 279927 280847 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_02640 281011 281643 gene locus_tag LOCUS_02650 281011 281643 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_02650 281645 282229 gene locus_tag LOCUS_02660 gene coaE 281645 282229 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_02660 283025 282234 gene locus_tag LOCUS_02670 283025 282234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 283926 283339 gene locus_tag LOCUS_02680 283926 283339 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_02680 286600 283928 gene locus_tag LOCUS_02690 286600 283928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 287349 286897 gene locus_tag LOCUS_02700 287349 286897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 288041 287304 gene locus_tag LOCUS_02710 288041 287304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02710 288672 288004 gene locus_tag LOCUS_02720 288672 288004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 289165 288944 gene locus_tag LOCUS_02730 289165 288944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 289507 291300 gene locus_tag LOCUS_02740 289507 291300 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_02740 291403 292554 gene locus_tag LOCUS_02750 291403 292554 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_02750 292598 293743 gene locus_tag LOCUS_02760 292598 293743 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_02760 295142 294057 gene locus_tag LOCUS_02770 295142 294057 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_02770 296185 295355 gene locus_tag LOCUS_02780 296185 295355 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_02780 296336 296830 gene locus_tag LOCUS_02790 296336 296830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 298678 297266 gene locus_tag LOCUS_02800 298678 297266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 298865 301915 gene locus_tag LOCUS_02810 298865 301915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 301947 303479 gene locus_tag LOCUS_02820 301947 303479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 303639 306512 gene locus_tag LOCUS_02830 303639 306512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 306530 308059 gene locus_tag LOCUS_02840 306530 308059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 311216 308283 gene locus_tag LOCUS_02850 gene leuS 311216 308283 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_02850 312049 311639 gene locus_tag LOCUS_02860 312049 311639 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_02860 312480 312905 gene locus_tag LOCUS_02870 312480 312905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 313106 314491 gene locus_tag LOCUS_02880 313106 314491 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_02880 314556 315293 gene locus_tag LOCUS_02890 314556 315293 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_02890 315393 316904 gene locus_tag LOCUS_02900 gene cysS 315393 316904 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_02900 317092 317718 gene locus_tag LOCUS_02910 317092 317718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 317812 318432 gene locus_tag LOCUS_02920 317812 318432 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_02920 318555 318881 gene locus_tag LOCUS_02930 318555 318881 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_02930 318878 319936 gene locus_tag LOCUS_02940 318878 319936 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_02940 320631 319933 gene locus_tag LOCUS_02950 320631 319933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 321960 320677 gene locus_tag LOCUS_02960 321960 320677 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107140.1 protein_id gnl|my_center|LOCUS_02960 322292 322801 gene locus_tag LOCUS_02970 322292 322801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 325030 324440 gene locus_tag LOCUS_02980 325030 324440 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933381.1 protein_id gnl|my_center|LOCUS_02980 325280 325969 gene locus_tag LOCUS_02990 325280 325969 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879683.1 protein_id gnl|my_center|LOCUS_02990 326152 326688 gene locus_tag LOCUS_03000 326152 326688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 326716 326928 gene locus_tag LOCUS_03010 326716 326928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 327027 327413 gene locus_tag LOCUS_03020 327027 327413 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_03020 327596 328060 gene locus_tag LOCUS_03030 327596 328060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03030 327985 328599 gene locus_tag LOCUS_03040 327985 328599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03040 328725 329519 gene locus_tag LOCUS_03050 328725 329519 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_03050 329864 331282 gene locus_tag LOCUS_03060 329864 331282 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_03060 331325 334516 gene locus_tag LOCUS_03070 331325 334516 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_03070 334588 336006 gene locus_tag LOCUS_03080 gene nrfD 334588 336006 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_03080 336026 336556 gene locus_tag LOCUS_03090 336026 336556 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_03090 336572 337408 gene locus_tag LOCUS_03100 336572 337408 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_03100 337461 338747 gene locus_tag LOCUS_03110 337461 338747 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_03110 338851 339963 gene locus_tag LOCUS_03120 338851 339963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 339991 341841 gene locus_tag LOCUS_03130 339991 341841 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_03130 341867 342763 gene locus_tag LOCUS_03140 gene cyoE 341867 342763 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_03140 342765 343343 gene locus_tag LOCUS_03150 342765 343343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 343380 344180 gene locus_tag LOCUS_03160 343380 344180 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_03160 344226 344759 gene locus_tag LOCUS_03170 344226 344759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 344890 345405 gene locus_tag LOCUS_03180 344890 345405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 346065 346682 gene locus_tag LOCUS_03190 346065 346682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 347948 346737 gene locus_tag LOCUS_03200 347948 346737 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_03200 348045 349046 gene locus_tag LOCUS_03210 348045 349046 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533625.1 protein_id gnl|my_center|LOCUS_03210 349039 349752 gene locus_tag LOCUS_03220 349039 349752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 349780 351954 gene locus_tag LOCUS_03230 349780 351954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 356075 352392 gene locus_tag LOCUS_03240 356075 352392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 356557 358098 gene locus_tag LOCUS_03250 356557 358098 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_03250 358979 358257 gene locus_tag LOCUS_03260 358979 358257 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_03260 360964 358985 gene locus_tag LOCUS_03270 360964 358985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 361406 362500 gene locus_tag LOCUS_03280 361406 362500 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_03280 362514 362759 gene locus_tag LOCUS_03290 362514 362759 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015102.1 protein_id gnl|my_center|LOCUS_03290 362882 363697 gene locus_tag LOCUS_03300 gene pyrF 362882 363697 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_03300 364461 363718 gene locus_tag LOCUS_03310 gene fabG 364461 363718 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_03310 366021 364492 gene locus_tag LOCUS_03320 366021 364492 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_03320 367124 366279 gene locus_tag LOCUS_03330 367124 366279 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_03330 367594 367115 gene locus_tag LOCUS_03340 367594 367115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 367682 368677 gene locus_tag LOCUS_03350 367682 368677 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_03350 368911 369405 gene locus_tag LOCUS_03360 368911 369405 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_03360 369939 369406 gene locus_tag LOCUS_03370 gene hpt 369939 369406 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_03370 371257 369953 gene locus_tag LOCUS_03380 371257 369953 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_03380 371534 372100 gene locus_tag LOCUS_03390 371534 372100 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084757677.1 protein_id gnl|my_center|LOCUS_03390 372130 372360 gene locus_tag LOCUS_03400 372130 372360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 372382 373224 gene locus_tag LOCUS_03410 372382 373224 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103935.1 protein_id gnl|my_center|LOCUS_03410 373299 373661 gene locus_tag LOCUS_03420 373299 373661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 373658 374368 gene locus_tag LOCUS_03430 373658 374368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03430 375672 374632 gene locus_tag LOCUS_03440 gene holA 375672 374632 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_03440 376560 375706 gene locus_tag LOCUS_03450 376560 375706 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_03450 376673 378352 gene locus_tag LOCUS_03460 gene fadD 376673 378352 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 protein_id gnl|my_center|LOCUS_03460 378470 382264 gene locus_tag LOCUS_03470 378470 382264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 382798 383295 gene locus_tag LOCUS_03480 382798 383295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 383306 383686 gene locus_tag LOCUS_03490 383306 383686 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_03490 383951 386080 gene locus_tag LOCUS_03500 gene rpsA 383951 386080 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_03500 386287 388662 gene locus_tag LOCUS_03510 386287 388662 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_03510 388794 389426 gene locus_tag LOCUS_03520 388794 389426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03520 389368 389526 gene locus_tag LOCUS_03530 389368 389526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 389519 390817 gene locus_tag LOCUS_03540 389519 390817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03540 390856 391302 gene locus_tag LOCUS_03550 390856 391302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 391299 392048 gene locus_tag LOCUS_03560 391299 392048 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_03560 392668 392045 gene locus_tag LOCUS_03570 392668 392045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 393120 394226 gene locus_tag LOCUS_03580 393120 394226 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_03580 394239 395423 gene locus_tag LOCUS_03590 394239 395423 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_03590 395657 395517 gene locus_tag LOCUS_03600 395657 395517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 396307 395816 gene locus_tag LOCUS_03610 396307 395816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 398253 396658 gene locus_tag LOCUS_03620 398253 396658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 398809 398258 gene locus_tag LOCUS_03630 398809 398258 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_03630 398938 400278 gene locus_tag LOCUS_03640 gene hisS 398938 400278 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_03640 400742 401878 gene locus_tag LOCUS_03650 400742 401878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03650 402391 401954 gene locus_tag LOCUS_03660 402391 401954 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_03660 402797 402402 gene locus_tag LOCUS_03670 402797 402402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 403598 404377 gene locus_tag LOCUS_03680 403598 404377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 404537 408007 gene locus_tag LOCUS_03690 404537 408007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 408192 408497 gene locus_tag LOCUS_03700 408192 408497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 408499 408936 gene locus_tag LOCUS_03710 408499 408936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 410606 409335 gene locus_tag LOCUS_03720 410606 409335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03720 411001 410699 gene locus_tag LOCUS_03730 411001 410699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03730 411248 412108 gene locus_tag LOCUS_03740 411248 412108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 412156 414060 gene locus_tag LOCUS_03750 412156 414060 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_03750 414057 415163 gene locus_tag LOCUS_03760 414057 415163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 416541 415153 gene locus_tag LOCUS_03770 416541 415153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 421328 416544 gene locus_tag LOCUS_03780 421328 416544 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_03780 422288 421503 gene locus_tag LOCUS_03790 gene folP 422288 421503 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_03790 423244 422615 gene locus_tag LOCUS_03800 423244 422615 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_03800 423672 425699 gene locus_tag LOCUS_03810 423672 425699 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_03810 425874 426326 gene locus_tag LOCUS_03820 425874 426326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 426391 427338 gene locus_tag LOCUS_03830 426391 427338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 427340 427606 gene locus_tag LOCUS_03840 427340 427606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 429517 428987 gene locus_tag LOCUS_03850 429517 428987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 429714 429869 gene locus_tag LOCUS_03860 429714 429869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 431100 431570 gene locus_tag LOCUS_03870 431100 431570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 433508 431886 gene locus_tag LOCUS_03880 433508 431886 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_03880 434196 433621 gene locus_tag LOCUS_03890 434196 433621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 434664 434960 gene locus_tag LOCUS_03900 434664 434960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 436121 435480 gene locus_tag LOCUS_03910 436121 435480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 436456 436154 gene locus_tag LOCUS_03920 436456 436154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 437848 436748 gene locus_tag LOCUS_03930 437848 436748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03930 438982 437870 gene locus_tag LOCUS_03940 438982 437870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03940 440232 439018 gene locus_tag LOCUS_03950 gene hflX 440232 439018 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_03950 441343 440621 gene locus_tag LOCUS_03960 441343 440621 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_03960 442214 441492 gene locus_tag LOCUS_03970 442214 441492 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262283.1 protein_id gnl|my_center|LOCUS_03970 442822 442211 gene locus_tag LOCUS_03980 442822 442211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 443155 444618 gene locus_tag LOCUS_03990 443155 444618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 444630 445625 gene locus_tag LOCUS_04000 444630 445625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 445799 447082 gene locus_tag LOCUS_04010 445799 447082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 447573 447881 gene locus_tag LOCUS_04020 447573 447881 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608713.1 protein_id gnl|my_center|LOCUS_04020 448052 449983 gene locus_tag LOCUS_04030 gene glgB 448052 449983 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_04030 450049 452433 gene locus_tag LOCUS_04040 450049 452433 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_04040 454105 452438 gene locus_tag LOCUS_04050 454105 452438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 455312 454299 gene locus_tag LOCUS_04060 455312 454299 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_04060 455480 458065 gene locus_tag LOCUS_04070 455480 458065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 459693 458347 gene locus_tag LOCUS_04080 459693 458347 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_04080 460994 459864 gene locus_tag LOCUS_04090 460994 459864 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_04090 461519 461004 gene locus_tag LOCUS_04100 461519 461004 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_04100 463813 461606 gene locus_tag LOCUS_04110 463813 461606 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_04110 464781 464326 gene locus_tag LOCUS_04120 464781 464326 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_04120 465820 464810 gene locus_tag LOCUS_04130 465820 464810 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_04130 466606 465824 gene locus_tag LOCUS_04140 466606 465824 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_04140 466697 467263 gene locus_tag LOCUS_04150 466697 467263 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_04150 467574 468263 gene locus_tag LOCUS_04160 467574 468263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04160 468266 468820 gene locus_tag LOCUS_04170 468266 468820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04170 470189 468858 gene locus_tag LOCUS_04180 470189 468858 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946627.1 protein_id gnl|my_center|LOCUS_04180 471458 470193 gene locus_tag LOCUS_04190 gene kynU 471458 470193 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_04190 473250 471442 gene locus_tag LOCUS_04200 473250 471442 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_04200 474212 473583 gene locus_tag LOCUS_04210 gene recR 474212 473583 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_04210 476023 474404 gene locus_tag LOCUS_04220 476023 474404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 477522 476074 gene locus_tag LOCUS_04230 477522 476074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 477995 480955 gene locus_tag LOCUS_04240 477995 480955 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_04240 480959 482284 gene locus_tag LOCUS_04250 480959 482284 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_04250 482349 483647 gene locus_tag LOCUS_04260 482349 483647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 483743 484855 gene locus_tag LOCUS_04270 483743 484855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 484860 485720 gene locus_tag LOCUS_04280 484860 485720 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525046.1 protein_id gnl|my_center|LOCUS_04280 485812 487071 gene locus_tag LOCUS_04290 485812 487071 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_04290 487144 489441 gene locus_tag LOCUS_04300 487144 489441 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_04300 489444 489911 gene locus_tag LOCUS_04310 489444 489911 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_04310 490333 489986 gene locus_tag LOCUS_04320 490333 489986 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_04320 491178 490384 gene locus_tag LOCUS_04330 491178 490384 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_04330 491637 491179 gene locus_tag LOCUS_04340 491637 491179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 492868 491663 gene locus_tag LOCUS_04350 492868 491663 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_04350 494181 492910 gene locus_tag LOCUS_04360 494181 492910 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_04360 495674 494244 gene locus_tag LOCUS_04370 gene glgA 495674 494244 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546574.1 protein_id gnl|my_center|LOCUS_04370 495926 496960 gene locus_tag LOCUS_04380 gene ruvB 495926 496960 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_04380 497498 497181 gene locus_tag LOCUS_04390 497498 497181 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_04390 497637 499031 gene locus_tag LOCUS_04400 497637 499031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 499096 499638 gene locus_tag LOCUS_04410 499096 499638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 499755 501329 gene locus_tag LOCUS_04420 499755 501329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 501352 502446 gene locus_tag LOCUS_04430 501352 502446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 502487 503101 gene locus_tag LOCUS_04440 502487 503101 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_04440 503187 504104 gene locus_tag LOCUS_04450 gene gldA 503187 504104 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_04450 504112 504843 gene locus_tag LOCUS_04460 gene gldF 504112 504843 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_04460 504837 506579 gene locus_tag LOCUS_04470 gene gldG 504837 506579 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_04470 506620 507621 gene locus_tag LOCUS_04480 506620 507621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 507618 508853 gene locus_tag LOCUS_04490 507618 508853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 509044 510444 gene locus_tag LOCUS_04500 509044 510444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 510767 513592 gene locus_tag LOCUS_04510 510767 513592 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_04510 513627 515141 gene locus_tag LOCUS_04520 513627 515141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 515220 515540 gene locus_tag LOCUS_04530 515220 515540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 516210 515758 gene locus_tag LOCUS_04540 516210 515758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 520552 516218 gene locus_tag LOCUS_04550 520552 516218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 521553 520864 gene locus_tag LOCUS_04560 521553 520864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 522222 521653 gene locus_tag LOCUS_04570 522222 521653 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_04570 523131 522253 gene locus_tag LOCUS_04580 gene fabD 523131 522253 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_04580 523998 523285 gene locus_tag LOCUS_04590 523998 523285 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_04590 525796 524294 gene locus_tag LOCUS_04600 525796 524294 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_04600 525949 526935 gene locus_tag LOCUS_04610 525949 526935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 526964 528028 gene locus_tag LOCUS_04620 526964 528028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 528142 529374 gene locus_tag LOCUS_04630 528142 529374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 529409 532381 gene locus_tag LOCUS_04640 529409 532381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 533419 533021 gene locus_tag LOCUS_04650 533419 533021 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_04650 533623 534282 gene locus_tag LOCUS_04660 gene fsa 533623 534282 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_04660 534343 535011 gene locus_tag LOCUS_04670 534343 535011 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_04670 535259 535008 gene locus_tag LOCUS_04680 535259 535008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_04680 535430 536269 gene locus_tag LOCUS_04690 535430 536269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04690 536236 536400 gene locus_tag LOCUS_04700 536236 536400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04700 536403 536900 gene locus_tag LOCUS_04710 536403 536900 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_04710 537991 536897 gene locus_tag LOCUS_04720 537991 536897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 538016 539323 gene locus_tag LOCUS_04730 538016 539323 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_04730 539370 540170 gene locus_tag LOCUS_04740 539370 540170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 540268 540191 gene locus_tag LOCUS_t00070 540268 540191 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 540529 540329 gene locus_tag LOCUS_04750 540529 540329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 541806 540757 gene locus_tag LOCUS_04760 541806 540757 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_04760 543691 541838 gene locus_tag LOCUS_04770 gene yidC 543691 541838 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_04770 544267 543731 gene locus_tag LOCUS_04780 gene dcd 544267 543731 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_04780 544778 544332 gene locus_tag LOCUS_04790 gene rplI 544778 544332 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_04790 545068 544802 gene locus_tag LOCUS_04800 gene rpsR 545068 544802 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_04800 545585 545100 gene locus_tag LOCUS_04810 545585 545100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 546422 545997 gene locus_tag LOCUS_04820 546422 545997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 549187 546659 gene locus_tag LOCUS_04830 gene alaS 549187 546659 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_04830 549490 550467 gene locus_tag LOCUS_04840 549490 550467 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_04840 550552 552009 gene locus_tag LOCUS_04850 550552 552009 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_04850 553021 552533 gene locus_tag LOCUS_04860 553021 552533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 553269 553496 gene locus_tag LOCUS_04870 553269 553496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 553768 554787 gene locus_tag LOCUS_04880 553768 554787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 554848 555264 gene locus_tag LOCUS_04890 554848 555264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 555271 555501 gene locus_tag LOCUS_04900 555271 555501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 556324 559884 gene locus_tag LOCUS_04910 gene smc 556324 559884 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_04910 559987 560265 gene locus_tag LOCUS_04920 559987 560265 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_04920 560269 561474 gene locus_tag LOCUS_04930 560269 561474 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_04930 561476 562474 gene locus_tag LOCUS_04940 561476 562474 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_04940 562511 563737 gene locus_tag LOCUS_04950 gene xseA 562511 563737 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_04950 563738 563926 gene locus_tag LOCUS_04960 563738 563926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 564006 564734 gene locus_tag LOCUS_04970 564006 564734 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_04970 564803 565105 gene locus_tag LOCUS_04980 564803 565105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 565090 565431 gene locus_tag LOCUS_04990 565090 565431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04990 565428 566009 gene locus_tag LOCUS_05000 565428 566009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 566089 567153 gene locus_tag LOCUS_05010 566089 567153 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_05010 568163 567633 gene locus_tag LOCUS_05020 568163 567633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 569607 568174 gene locus_tag LOCUS_05030 569607 568174 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_05030 570428 569721 gene locus_tag LOCUS_05040 570428 569721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 571189 570971 gene locus_tag LOCUS_05050 571189 570971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 571980 572744 gene locus_tag LOCUS_05060 571980 572744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 573484 572903 gene locus_tag LOCUS_05070 573484 572903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05070 573992 573444 gene locus_tag LOCUS_05080 573992 573444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05080 576389 574332 gene locus_tag LOCUS_05090 576389 574332 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_05090 576589 577494 gene locus_tag LOCUS_05100 576589 577494 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_05100 578493 578984 gene locus_tag LOCUS_05110 578493 578984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 578995 589026 gene locus_tag LOCUS_05120 578995 589026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 589776 589159 gene locus_tag LOCUS_05130 589776 589159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 589949 590896 gene locus_tag LOCUS_05140 589949 590896 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_05140 591062 591217 gene locus_tag LOCUS_05150 591062 591217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 591222 591458 gene locus_tag LOCUS_05160 591222 591458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05160 591488 592750 gene locus_tag LOCUS_05170 591488 592750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 592788 593972 gene locus_tag LOCUS_05180 592788 593972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 593974 594549 gene locus_tag LOCUS_05190 593974 594549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 594569 594754 gene locus_tag LOCUS_05200 594569 594754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05200 594956 596080 gene locus_tag LOCUS_05210 594956 596080 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_05210 596107 596913 gene locus_tag LOCUS_05220 596107 596913 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292843.1 protein_id gnl|my_center|LOCUS_05220 598872 596920 gene locus_tag LOCUS_05230 598872 596920 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_05230 599366 598902 gene locus_tag LOCUS_05240 599366 598902 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_05240 601186 599369 gene locus_tag LOCUS_05250 gene lysS 601186 599369 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_05250 603603 601690 gene locus_tag LOCUS_05260 603603 601690 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_05260 604238 603735 gene locus_tag LOCUS_05270 604238 603735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 604764 604240 gene locus_tag LOCUS_05280 604764 604240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 605106 605762 gene locus_tag LOCUS_05290 605106 605762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 607937 605910 gene locus_tag LOCUS_05300 607937 605910 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_05300 608200 610392 gene locus_tag LOCUS_05310 608200 610392 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_05310 610499 612454 gene locus_tag LOCUS_05320 gene dnaG 610499 612454 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_05320 613976 612681 gene locus_tag LOCUS_05330 613976 612681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 614536 613976 gene locus_tag LOCUS_05340 614536 613976 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_05340 614738 615874 gene locus_tag LOCUS_05350 614738 615874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 615882 616253 gene locus_tag LOCUS_05360 615882 616253 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_05360 618386 616473 gene locus_tag LOCUS_05370 618386 616473 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_05370 619592 618459 gene locus_tag LOCUS_05380 619592 618459 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_05380 619894 619586 gene locus_tag LOCUS_05390 619894 619586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 620652 620014 gene locus_tag LOCUS_05400 620652 620014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05400 621677 620658 gene locus_tag LOCUS_05410 621677 620658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 625085 621852 gene locus_tag LOCUS_05420 625085 621852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 625090 625329 gene locus_tag LOCUS_05430 625090 625329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 629933 626136 gene locus_tag LOCUS_05440 629933 626136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 632103 630268 gene locus_tag LOCUS_05450 gene argS 632103 630268 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_05450 632276 632674 gene locus_tag LOCUS_05460 632276 632674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 634260 632902 gene locus_tag LOCUS_05470 634260 632902 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_05470 638340 634993 gene locus_tag LOCUS_05480 638340 634993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 638800 638465 gene locus_tag LOCUS_05490 638800 638465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 639059 638907 gene locus_tag LOCUS_05500 639059 638907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 639169 639456 gene locus_tag LOCUS_05510 639169 639456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 639945 639403 gene locus_tag LOCUS_05520 639945 639403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 641845 640085 gene locus_tag LOCUS_05530 641845 640085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 644128 641861 gene locus_tag LOCUS_05540 644128 641861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 644583 644239 gene locus_tag LOCUS_05550 644583 644239 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_05550 645848 644601 gene locus_tag LOCUS_05560 645848 644601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_05560 646725 645955 gene locus_tag LOCUS_05570 646725 645955 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_05570 646836 647549 gene locus_tag LOCUS_05580 646836 647549 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_05580 647696 648106 gene locus_tag LOCUS_05590 647696 648106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05590 648124 651492 gene locus_tag LOCUS_05600 648124 651492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05600 653022 652192 gene locus_tag LOCUS_05610 653022 652192 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_05610 653038 655488 gene locus_tag LOCUS_05620 653038 655488 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_05620 656445 656990 gene locus_tag LOCUS_05630 656445 656990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05630 658166 657180 gene locus_tag LOCUS_05640 gene wlbA 658166 657180 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_05640 658116 658289 gene locus_tag LOCUS_05650 658116 658289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 658436 660682 gene locus_tag LOCUS_05660 658436 660682 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_05660 661651 661016 gene locus_tag LOCUS_05670 661651 661016 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_05670 662131 661661 gene locus_tag LOCUS_05680 gene rlmH 662131 661661 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_05680 663796 662141 gene locus_tag LOCUS_05690 663796 662141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 663978 664466 gene locus_tag LOCUS_05700 663978 664466 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145486.1 protein_id gnl|my_center|LOCUS_05700 664463 664789 gene locus_tag LOCUS_05710 664463 664789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 666308 665034 gene locus_tag LOCUS_05720 666308 665034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 667474 666428 gene locus_tag LOCUS_05730 667474 666428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 668440 667592 gene locus_tag LOCUS_05740 668440 667592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 669010 668459 gene locus_tag LOCUS_05750 669010 668459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 669834 669055 gene locus_tag LOCUS_05760 669834 669055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 671139 669841 gene locus_tag LOCUS_05770 671139 669841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 671432 673084 gene locus_tag LOCUS_05780 671432 673084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 673136 673705 gene locus_tag LOCUS_05790 673136 673705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 675531 675446 gene locus_tag LOCUS_t00080 675531 675446 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 676345 675608 gene locus_tag LOCUS_05800 gene sodA 676345 675608 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_05800 676549 676625 gene locus_tag LOCUS_t00090 676549 676625 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 676764 678017 gene locus_tag LOCUS_05810 676764 678017 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_05810 678076 678450 gene locus_tag LOCUS_05820 678076 678450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 679985 679083 gene locus_tag LOCUS_05830 679985 679083 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_05830 682308 679987 gene locus_tag LOCUS_05840 682308 679987 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_05840 682733 682467 gene locus_tag LOCUS_05850 682733 682467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 684913 682760 gene locus_tag LOCUS_05860 684913 682760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05860 686659 685388 gene locus_tag LOCUS_05870 gene tyrS 686659 685388 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_05870 686731 688071 gene locus_tag LOCUS_05880 686731 688071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_05880 688194 688805 gene locus_tag LOCUS_05890 688194 688805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 689877 688816 gene locus_tag LOCUS_05900 689877 688816 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_05900 689946 691157 gene locus_tag LOCUS_05910 gene megL 689946 691157 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_05910 691648 692283 gene locus_tag LOCUS_05920 691648 692283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 692484 693005 gene locus_tag LOCUS_05930 692484 693005 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05930 693926 693027 gene locus_tag LOCUS_05940 693926 693027 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_05940 694353 693982 gene locus_tag LOCUS_05950 694353 693982 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_05950 696187 694517 gene locus_tag LOCUS_05960 gene ettA 696187 694517 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_05960 698376 696499 gene locus_tag LOCUS_05970 698376 696499 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_05970 698595 699455 gene locus_tag LOCUS_05980 698595 699455 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_05980 699608 699964 gene locus_tag LOCUS_05990 699608 699964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 699968 701089 gene locus_tag LOCUS_06000 699968 701089 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_06000 701412 702440 gene locus_tag LOCUS_06010 701412 702440 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_06010 702437 704413 gene locus_tag LOCUS_06020 gene ligA 702437 704413 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 protein_id gnl|my_center|LOCUS_06020 705191 704550 gene locus_tag LOCUS_06030 705191 704550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 705489 705112 gene locus_tag LOCUS_06040 705489 705112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 706387 705530 gene locus_tag LOCUS_06050 706387 705530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 707286 706429 gene locus_tag LOCUS_06060 707286 706429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 708344 707349 gene locus_tag LOCUS_06070 708344 707349 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026608922.1 protein_id gnl|my_center|LOCUS_06070 708617 709642 gene locus_tag LOCUS_06080 gene pheS 708617 709642 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_06080 710861 710268 gene locus_tag LOCUS_06090 gene hisIE 710861 710268 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_06090 711610 710852 gene locus_tag LOCUS_06100 gene hisF 711610 710852 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_06100 712317 711604 gene locus_tag LOCUS_06110 gene hisA 712317 711604 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_06110 712898 712317 gene locus_tag LOCUS_06120 gene hisH 712898 712317 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_06120 713986 712895 gene locus_tag LOCUS_06130 gene hisB 713986 712895 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789124.1 protein_id gnl|my_center|LOCUS_06130 714997 713987 gene locus_tag LOCUS_06140 gene hisC 714997 713987 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_06140 716291 714990 gene locus_tag LOCUS_06150 gene hisD 716291 714990 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_06150 717160 716303 gene locus_tag LOCUS_06160 gene hisG 717160 716303 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_06160 718251 717484 gene locus_tag LOCUS_06170 718251 717484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 719567 718248 gene locus_tag LOCUS_06180 719567 718248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 720160 719636 gene locus_tag LOCUS_06190 720160 719636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 720275 720547 gene locus_tag LOCUS_06200 720275 720547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 721397 720813 gene locus_tag LOCUS_06210 721397 720813 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_06210 722328 721399 gene locus_tag LOCUS_06220 722328 721399 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_06220 723237 722710 gene locus_tag LOCUS_06230 723237 722710 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_06230 723482 723243 gene locus_tag LOCUS_06240 723482 723243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 724032 723694 gene locus_tag LOCUS_06250 gene fdx 724032 723694 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656373.1 protein_id gnl|my_center|LOCUS_06250 724268 726895 gene locus_tag LOCUS_06260 724268 726895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 727174 727938 gene locus_tag LOCUS_06270 727174 727938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 729175 727994 gene locus_tag LOCUS_06280 729175 727994 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_06280 730461 729187 gene locus_tag LOCUS_06290 730461 729187 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_06290 730585 731169 gene locus_tag LOCUS_06300 730585 731169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 731294 731800 gene locus_tag LOCUS_06310 gene folK 731294 731800 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_06310 731950 732522 gene locus_tag LOCUS_06320 731950 732522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 733200 737030 gene locus_tag LOCUS_06330 733200 737030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06330 737094 738749 gene locus_tag LOCUS_06340 737094 738749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06340 740132 739107 gene locus_tag LOCUS_06350 740132 739107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 740262 740939 gene locus_tag LOCUS_06360 740262 740939 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_06360 741923 740961 gene locus_tag LOCUS_06370 741923 740961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 742334 741930 gene locus_tag LOCUS_06380 742334 741930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 743026 742331 gene locus_tag LOCUS_06390 743026 742331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 743750 743100 gene locus_tag LOCUS_06400 743750 743100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 744494 743814 gene locus_tag LOCUS_06410 744494 743814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 744784 745317 gene locus_tag LOCUS_06420 744784 745317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 745415 745951 gene locus_tag LOCUS_06430 745415 745951 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_06430 745991 746542 gene locus_tag LOCUS_06440 745991 746542 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_06440 746570 747115 gene locus_tag LOCUS_06450 746570 747115 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_06450 747263 748414 gene locus_tag LOCUS_06460 747263 748414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 748411 749355 gene locus_tag LOCUS_06470 748411 749355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 750222 749518 gene locus_tag LOCUS_06480 750222 749518 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_06480 750663 750229 gene locus_tag LOCUS_06490 750663 750229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 752098 750689 gene locus_tag LOCUS_06500 gene ccoG 752098 750689 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_06500 753047 752109 gene locus_tag LOCUS_06510 753047 752109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 755599 753488 gene locus_tag LOCUS_06520 gene ccoN 755599 753488 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_06520 758068 755768 gene locus_tag LOCUS_06530 758068 755768 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_06530 758654 758169 gene locus_tag LOCUS_06540 758654 758169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 759630 758962 gene locus_tag LOCUS_06550 759630 758962 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_06550 759797 760378 gene locus_tag LOCUS_06560 759797 760378 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_06560 761453 760443 gene locus_tag LOCUS_06570 gene murB 761453 760443 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_06570 761699 761454 gene locus_tag LOCUS_06580 761699 761454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 761987 761778 gene locus_tag LOCUS_06590 761987 761778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 763875 762094 gene locus_tag LOCUS_06600 763875 762094 CDS product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 protein_id gnl|my_center|LOCUS_06600 764730 763951 gene locus_tag LOCUS_06610 764730 763951 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404513.1 protein_id gnl|my_center|LOCUS_06610 764788 765495 gene locus_tag LOCUS_06620 764788 765495 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_06620 768050 766113 gene locus_tag LOCUS_06630 768050 766113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 770872 768080 gene locus_tag LOCUS_06640 770872 768080 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_06640 772350 771136 gene locus_tag LOCUS_06650 772350 771136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 772689 772381 gene locus_tag LOCUS_06660 772689 772381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 774316 773024 gene locus_tag LOCUS_06670 774316 773024 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_06670 775750 774326 gene locus_tag LOCUS_06680 gene miaB 775750 774326 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_06680 775911 776648 gene locus_tag LOCUS_06690 775911 776648 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_06690 776809 777390 gene locus_tag LOCUS_06700 776809 777390 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_06700 777436 778284 gene locus_tag LOCUS_06710 777436 778284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 779689 778541 gene locus_tag LOCUS_06720 779689 778541 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_06720 781730 780090 gene locus_tag LOCUS_06730 781730 780090 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_06730 783403 782102 gene locus_tag LOCUS_06740 783403 782102 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_06740 783543 784169 gene locus_tag LOCUS_06750 gene udk 783543 784169 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_06750 784223 785368 gene locus_tag LOCUS_06760 784223 785368 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_06760 785361 785855 gene locus_tag LOCUS_06770 gene purE 785361 785855 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_06770 785860 786306 gene locus_tag LOCUS_06780 785860 786306 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729724.1 protein_id gnl|my_center|LOCUS_06780 787758 786556 gene locus_tag LOCUS_06790 787758 786556 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_06790 788491 787769 gene locus_tag LOCUS_06800 788491 787769 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_06800 789995 788622 gene locus_tag LOCUS_06810 gene radA 789995 788622 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_06810 790331 791143 gene locus_tag LOCUS_06820 790331 791143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 791950 791468 gene locus_tag LOCUS_06830 791950 791468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 792738 792094 gene locus_tag LOCUS_06840 792738 792094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 794119 792731 gene locus_tag LOCUS_06850 794119 792731 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_06850 795125 794103 gene locus_tag LOCUS_06860 795125 794103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 795373 795104 gene locus_tag LOCUS_06870 795373 795104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 797067 795523 gene locus_tag LOCUS_06880 gene guaA 797067 795523 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_06880 798504 797116 gene locus_tag LOCUS_06890 798504 797116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 799567 798668 gene locus_tag LOCUS_06900 gene nusB 799567 798668 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_06900 801133 799661 gene locus_tag LOCUS_06910 801133 799661 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_06910 801949 804777 gene locus_tag LOCUS_06920 gene polA 801949 804777 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_06920 805568 805101 gene locus_tag LOCUS_06930 805568 805101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 805982 807469 gene locus_tag LOCUS_06940 805982 807469 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 807447 807812 gene locus_tag LOCUS_06950 807447 807812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06950 807803 809155 gene locus_tag LOCUS_06960 807803 809155 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_06960 810401 809667 gene locus_tag LOCUS_06970 810401 809667 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_06970 810501 810884 gene locus_tag LOCUS_06980 gene rsfS 810501 810884 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_06980 810916 812913 gene locus_tag LOCUS_06990 gene ftsH 810916 812913 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_06990 813262 813747 gene locus_tag LOCUS_07000 813262 813747 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966773.1 protein_id gnl|my_center|LOCUS_07000 813740 814753 gene locus_tag LOCUS_07010 813740 814753 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_07010 817129 814856 gene locus_tag LOCUS_07020 817129 814856 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_07020 817826 818014 gene locus_tag LOCUS_07030 817826 818014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 818283 819596 gene locus_tag LOCUS_07040 818283 819596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07040 819651 820064 gene locus_tag LOCUS_07050 819651 820064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 821042 820791 gene locus_tag LOCUS_07060 821042 820791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 821116 821283 gene locus_tag LOCUS_07070 821116 821283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 821743 821546 gene locus_tag LOCUS_07080 821743 821546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 827634 821704 gene locus_tag LOCUS_07090 827634 821704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 829316 827634 gene locus_tag LOCUS_07100 829316 827634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 833450 829317 gene locus_tag LOCUS_07110 833450 829317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 833663 834472 gene locus_tag LOCUS_07120 833663 834472 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_07120 834576 835091 gene locus_tag LOCUS_07130 834576 835091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 836522 835815 gene locus_tag LOCUS_07140 836522 835815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 838027 836594 gene locus_tag LOCUS_07150 838027 836594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 838241 838050 gene locus_tag LOCUS_07160 838241 838050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 838357 838959 gene locus_tag LOCUS_07170 838357 838959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 839487 840125 gene locus_tag LOCUS_07180 839487 840125 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963563.1 protein_id gnl|my_center|LOCUS_07180 840236 842755 gene locus_tag LOCUS_07190 840236 842755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 843829 846576 gene locus_tag LOCUS_07200 843829 846576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 847768 848409 gene locus_tag LOCUS_07210 847768 848409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 848529 849845 gene locus_tag LOCUS_07220 848529 849845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 850171 851478 gene locus_tag LOCUS_07230 850171 851478 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170201.1 protein_id gnl|my_center|LOCUS_07230 851559 852713 gene locus_tag LOCUS_07240 851559 852713 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_07240 854050 853505 gene locus_tag LOCUS_07250 854050 853505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 854256 855308 gene locus_tag LOCUS_07260 854256 855308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 856140 855499 gene locus_tag LOCUS_07270 856140 855499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 856274 856192 gene locus_tag LOCUS_t00100 856274 856192 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 858208 856376 gene locus_tag LOCUS_07280 858208 856376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 858349 859059 gene locus_tag LOCUS_07290 858349 859059 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_07290 859101 859352 gene locus_tag LOCUS_07300 gene purS 859101 859352 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_07300 859352 860083 gene locus_tag LOCUS_07310 gene rsmI 859352 860083 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_07310 862804 860516 gene locus_tag LOCUS_07320 862804 860516 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_07320 863432 863956 gene locus_tag LOCUS_07330 863432 863956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 866162 863967 gene locus_tag LOCUS_07340 866162 863967 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_07340 868590 867010 gene locus_tag LOCUS_07350 868590 867010 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_07350 869436 868729 gene locus_tag LOCUS_07360 869436 868729 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_07360 869566 870903 gene locus_tag LOCUS_07370 gene rseP 869566 870903 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_07370 870904 871416 gene locus_tag LOCUS_07380 gene hscB 870904 871416 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595975.1 protein_id gnl|my_center|LOCUS_07380 871447 871531 gene locus_tag LOCUS_t00110 871447 871531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 873098 871845 gene locus_tag LOCUS_07390 873098 871845 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761338.1 protein_id gnl|my_center|LOCUS_07390 874144 873278 gene locus_tag LOCUS_07400 874144 873278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07400 874478 874050 gene locus_tag LOCUS_07410 874478 874050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07410 874659 875645 gene locus_tag LOCUS_07420 874659 875645 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_07420 875734 876846 gene locus_tag LOCUS_07430 gene ald 875734 876846 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_07430 877361 876924 gene locus_tag LOCUS_07440 877361 876924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 878258 877494 gene locus_tag LOCUS_07450 878258 877494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07450 878950 878237 gene locus_tag LOCUS_07460 878950 878237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07460 879112 880179 gene locus_tag LOCUS_07470 879112 880179 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_07470 880184 883291 gene locus_tag LOCUS_07480 880184 883291 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_07480 883323 884612 gene locus_tag LOCUS_07490 883323 884612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 884643 885032 gene locus_tag LOCUS_07500 884643 885032 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_07500 886107 885070 gene locus_tag LOCUS_07510 886107 885070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 887250 886435 gene locus_tag LOCUS_07520 887250 886435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 887450 888406 gene locus_tag LOCUS_07530 887450 888406 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567061.1 protein_id gnl|my_center|LOCUS_07530 888495 889769 gene locus_tag LOCUS_07540 888495 889769 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_07540 889784 890161 gene locus_tag LOCUS_07550 889784 890161 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_07550 891626 890154 gene locus_tag LOCUS_07560 gene accC 891626 890154 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_07560 892445 891657 gene locus_tag LOCUS_07570 gene pabC 892445 891657 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 protein_id gnl|my_center|LOCUS_07570 893455 892787 gene locus_tag LOCUS_07580 gene mnmD 893455 892787 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_07580 893958 894029 gene locus_tag LOCUS_t00120 893958 894029 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 895918 894494 gene locus_tag LOCUS_07590 895918 894494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 896104 898218 gene locus_tag LOCUS_07600 896104 898218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 900644 898326 gene locus_tag LOCUS_07610 900644 898326 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_07610 900831 901466 gene locus_tag LOCUS_07620 900831 901466 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_07620 902188 902877 gene locus_tag LOCUS_07630 902188 902877 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962705.1 protein_id gnl|my_center|LOCUS_07630 902928 903326 gene locus_tag LOCUS_07640 902928 903326 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_07640 903350 904399 gene locus_tag LOCUS_07650 903350 904399 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_07650 905635 904400 gene locus_tag LOCUS_07660 gene fahA 905635 904400 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_07660 906600 905644 gene locus_tag LOCUS_07670 gene metF 906600 905644 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_07670 906700 907188 gene locus_tag LOCUS_07680 906700 907188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 908433 907597 gene locus_tag LOCUS_07690 gene prmC 908433 907597 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_07690 909344 908868 gene locus_tag LOCUS_07700 909344 908868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 909466 912135 gene locus_tag LOCUS_07710 gene mutS 909466 912135 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_07710 912448 912882 gene locus_tag LOCUS_07720 912448 912882 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_07720 912929 914671 gene locus_tag LOCUS_07730 912929 914671 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963071.1 protein_id gnl|my_center|LOCUS_07730 914677 915681 gene locus_tag LOCUS_07740 914677 915681 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963070.1 protein_id gnl|my_center|LOCUS_07740 915900 916355 gene locus_tag LOCUS_07750 915900 916355 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963068.1 protein_id gnl|my_center|LOCUS_07750 916356 916757 gene locus_tag LOCUS_07760 916356 916757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 916877 917599 gene locus_tag LOCUS_07770 gene ric 916877 917599 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_07770 917596 917949 gene locus_tag LOCUS_07780 917596 917949 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115283.1 protein_id gnl|my_center|LOCUS_07780 917946 918563 gene locus_tag LOCUS_07790 917946 918563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 919321 918887 gene locus_tag LOCUS_07800 919321 918887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 919781 919329 gene locus_tag LOCUS_07810 919781 919329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 919972 922227 gene locus_tag LOCUS_07820 919972 922227 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_07820 922625 922395 gene locus_tag LOCUS_07830 922625 922395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 922507 924180 gene locus_tag LOCUS_07840 gene sppA 922507 924180 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_07840 924208 924891 gene locus_tag LOCUS_07850 gene trmD 924208 924891 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_07850 927380 925161 gene locus_tag LOCUS_07860 927380 925161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 927478 928272 gene locus_tag LOCUS_07870 927478 928272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 928350 929582 gene locus_tag LOCUS_07880 928350 929582 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_07880 929587 930183 gene locus_tag LOCUS_07890 929587 930183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 930244 931197 gene locus_tag LOCUS_07900 930244 931197 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_07900 931194 931790 gene locus_tag LOCUS_07910 gene gmhA 931194 931790 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_07910 931774 932337 gene locus_tag LOCUS_07920 gene gmhB 931774 932337 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107287.1 protein_id gnl|my_center|LOCUS_07920 933866 933171 gene locus_tag LOCUS_07930 933866 933171 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_07930 935983 934022 gene locus_tag LOCUS_07940 935983 934022 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_07940 936140 936940 gene locus_tag LOCUS_07950 936140 936940 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_07950 937002 938390 gene locus_tag LOCUS_07960 937002 938390 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_07960 938409 939590 gene locus_tag LOCUS_07970 938409 939590 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_07970 939643 941898 gene locus_tag LOCUS_07980 939643 941898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 942861 942412 gene locus_tag LOCUS_07990 942861 942412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 943058 943429 gene locus_tag LOCUS_08000 943058 943429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 943471 946536 gene locus_tag LOCUS_08010 943471 946536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 946575 947588 gene locus_tag LOCUS_08020 946575 947588 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_08020 947607 948203 gene locus_tag LOCUS_08030 gene bioD 947607 948203 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_08030 948241 949545 gene locus_tag LOCUS_08040 gene bioA 948241 949545 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883674.1 protein_id gnl|my_center|LOCUS_08040 949655 951256 gene locus_tag LOCUS_08050 949655 951256 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_08050 952953 951535 gene locus_tag LOCUS_08060 952953 951535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 953423 952950 gene locus_tag LOCUS_08070 953423 952950 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_08070 955793 953526 gene locus_tag LOCUS_08080 955793 953526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 956018 956818 gene locus_tag LOCUS_08090 gene proC 956018 956818 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_08090 957325 958962 gene locus_tag LOCUS_08100 957325 958962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_08100 959252 960649 gene locus_tag LOCUS_08110 gene lpdA 959252 960649 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_08110 960685 962079 gene locus_tag LOCUS_08120 960685 962079 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_08120 962551 962180 gene locus_tag LOCUS_08130 962551 962180 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_08130 962981 963598 gene locus_tag LOCUS_08140 962981 963598 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_08140 963614 964948 gene locus_tag LOCUS_08150 963614 964948 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_08150 965038 966141 gene locus_tag LOCUS_08160 965038 966141 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_08160 966210 969653 gene locus_tag LOCUS_08170 966210 969653 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_08170 970376 969915 gene locus_tag LOCUS_08180 970376 969915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 971091 972734 gene locus_tag LOCUS_08190 971091 972734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 972739 973491 gene locus_tag LOCUS_08200 972739 973491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 973654 978675 gene locus_tag LOCUS_08210 973654 978675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08210 978759 980807 gene locus_tag LOCUS_08220 978759 980807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 980991 983819 gene locus_tag LOCUS_08230 980991 983819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 983800 984495 gene locus_tag LOCUS_08240 983800 984495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08240 984492 984824 gene locus_tag LOCUS_08250 984492 984824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 986214 985567 gene locus_tag LOCUS_08260 986214 985567 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_08260 986908 987792 gene locus_tag LOCUS_08270 986908 987792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 988091 988813 gene locus_tag LOCUS_08280 988091 988813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 988965 989366 gene locus_tag LOCUS_08290 gene mce 988965 989366 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_08290 989748 992882 gene locus_tag LOCUS_08300 989748 992882 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120701253.1 protein_id gnl|my_center|LOCUS_08300 993402 993590 gene locus_tag LOCUS_08310 993402 993590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 993913 994350 gene locus_tag LOCUS_08320 993913 994350 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_08320 994560 995225 gene locus_tag LOCUS_08330 994560 995225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 995273 995602 gene locus_tag LOCUS_08340 995273 995602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 995595 995921 gene locus_tag LOCUS_08350 995595 995921 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_08350 995918 996175 gene locus_tag LOCUS_08360 995918 996175 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_08360 996576 998153 gene locus_tag LOCUS_08370 996576 998153 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_08370 998160 998570 gene locus_tag LOCUS_08380 998160 998570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 999577 1000083 gene locus_tag LOCUS_08390 999577 1000083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1000745 1001704 gene locus_tag LOCUS_08400 1000745 1001704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1002056 1003000 gene locus_tag LOCUS_08410 1002056 1003000 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965860.1 protein_id gnl|my_center|LOCUS_08410 1003281 1004468 gene locus_tag LOCUS_08420 1003281 1004468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_08420 1004607 1005137 gene locus_tag LOCUS_08430 1004607 1005137 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060155.1 protein_id gnl|my_center|LOCUS_08430 1005572 1007065 gene locus_tag LOCUS_08440 1005572 1007065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1007163 1007441 gene locus_tag LOCUS_08450 1007163 1007441 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_08450 1007457 1007636 gene locus_tag LOCUS_08460 1007457 1007636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1007739 1007924 gene locus_tag LOCUS_08470 1007739 1007924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1007899 1008117 gene locus_tag LOCUS_08480 1007899 1008117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1008185 1008598 gene locus_tag LOCUS_08490 gene uraH 1008185 1008598 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852246.1 protein_id gnl|my_center|LOCUS_08490 1008963 1010081 gene locus_tag LOCUS_08500 1008963 1010081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1010181 1010444 gene locus_tag LOCUS_08510 1010181 1010444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1010447 1010683 gene locus_tag LOCUS_08520 1010447 1010683 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143643.1 protein_id gnl|my_center|LOCUS_08520 1010688 1011413 gene locus_tag LOCUS_08530 1010688 1011413 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 protein_id gnl|my_center|LOCUS_08530 1011507 1012100 gene locus_tag LOCUS_08540 1011507 1012100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1012660 1015062 gene locus_tag LOCUS_08550 1012660 1015062 CDS product G8 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257330.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08550 1015043 1015855 gene locus_tag LOCUS_08560 1015043 1015855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1016100 1019045 gene locus_tag LOCUS_08570 1016100 1019045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1019333 1020112 gene locus_tag LOCUS_08580 1019333 1020112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1020664 1020449 gene locus_tag LOCUS_08590 1020664 1020449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1026470 1020705 gene locus_tag LOCUS_08600 1026470 1020705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1027815 1026493 gene locus_tag LOCUS_08610 1027815 1026493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1029614 1027836 gene locus_tag LOCUS_08620 1029614 1027836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1030818 1031531 gene locus_tag LOCUS_08630 1030818 1031531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1031725 1032393 gene locus_tag LOCUS_08640 1031725 1032393 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_08640 1032429 1033760 gene locus_tag LOCUS_08650 1032429 1033760 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_08650 1033834 1034541 gene locus_tag LOCUS_08660 1033834 1034541 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_08660 1035338 1039666 gene locus_tag LOCUS_08670 1035338 1039666 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_08670 1039668 1040834 gene locus_tag LOCUS_08680 1039668 1040834 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_08680 1040841 1041317 gene locus_tag LOCUS_08690 1040841 1041317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_08690 1045035 1042585 gene locus_tag LOCUS_08700 1045035 1042585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1045869 1045066 gene locus_tag LOCUS_08710 1045869 1045066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1046349 1046921 gene locus_tag LOCUS_08720 1046349 1046921 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_08720 1047122 1048030 gene locus_tag LOCUS_08730 1047122 1048030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1048635 1049459 gene locus_tag LOCUS_08740 1048635 1049459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1050486 1049563 gene locus_tag LOCUS_08750 gene pycR 1050486 1049563 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_08750 1050580 1052016 gene locus_tag LOCUS_08760 1050580 1052016 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_08760 1052037 1052285 gene locus_tag LOCUS_08770 1052037 1052285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1052454 1052744 gene locus_tag LOCUS_08780 1052454 1052744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1052737 1053573 gene locus_tag LOCUS_08790 1052737 1053573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444911.1 protein_id gnl|my_center|LOCUS_08790 1053561 1053746 gene locus_tag LOCUS_08800 1053561 1053746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1053802 1054278 gene locus_tag LOCUS_08810 1053802 1054278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08810 1054300 1055355 gene locus_tag LOCUS_08820 1054300 1055355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08820 1055357 1056676 gene locus_tag LOCUS_08830 1055357 1056676 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_08830 1056676 1058070 gene locus_tag LOCUS_08840 1056676 1058070 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_08840 1058283 1058972 gene locus_tag LOCUS_08850 1058283 1058972 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_08850 1059517 1059338 gene locus_tag LOCUS_08860 1059517 1059338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1059673 1060116 gene locus_tag LOCUS_08870 1059673 1060116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1060828 1060349 gene locus_tag LOCUS_08880 1060828 1060349 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766771.1 protein_id gnl|my_center|LOCUS_08880 1061698 1060973 gene locus_tag LOCUS_08890 gene lipB 1061698 1060973 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_08890 1063333 1061711 gene locus_tag LOCUS_08900 1063333 1061711 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_08900 1063532 1064173 gene locus_tag LOCUS_08910 1063532 1064173 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_08910 1064177 1064968 gene locus_tag LOCUS_08920 1064177 1064968 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_08920 1065002 1065886 gene locus_tag LOCUS_08930 1065002 1065886 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_08930 1065959 1066516 gene locus_tag LOCUS_08940 1065959 1066516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1066828 1066508 gene locus_tag LOCUS_08950 1066828 1066508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1068253 1066910 gene locus_tag LOCUS_08960 gene tilS 1068253 1066910 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_08960 1068401 1068973 gene locus_tag LOCUS_08970 1068401 1068973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1069026 1069979 gene locus_tag LOCUS_08980 1069026 1069979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1069969 1071294 gene locus_tag LOCUS_08990 1069969 1071294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1072190 1071615 gene locus_tag LOCUS_09000 gene folE 1072190 1071615 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_09000 1072333 1072914 gene locus_tag LOCUS_09010 gene pnuC 1072333 1072914 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_09010 1072889 1073431 gene locus_tag LOCUS_09020 1072889 1073431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1074033 1073428 gene locus_tag LOCUS_09030 1074033 1073428 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_09030 1075277 1074036 gene locus_tag LOCUS_09040 gene rocD 1075277 1074036 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_09040 1078396 1075547 gene locus_tag LOCUS_09050 gene gcvP 1078396 1075547 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_09050 1080514 1078505 gene locus_tag LOCUS_09060 1080514 1078505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1081580 1080549 gene locus_tag LOCUS_09070 1081580 1080549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1081880 1082377 gene locus_tag LOCUS_09080 gene lysM 1081880 1082377 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_09080 1083748 1082465 gene locus_tag LOCUS_09090 1083748 1082465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_09090 1084479 1083745 gene locus_tag LOCUS_09100 1084479 1083745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_09100 1085488 1084487 gene locus_tag LOCUS_09110 1085488 1084487 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_09110 1085928 1085488 gene locus_tag LOCUS_09120 1085928 1085488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964366.1 protein_id gnl|my_center|LOCUS_09120 1086891 1085956 gene locus_tag LOCUS_09130 1086891 1085956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_09130 1087679 1086912 gene locus_tag LOCUS_09140 1087679 1086912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1087963 1089060 gene locus_tag LOCUS_09150 1087963 1089060 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_09150 1089177 1090046 gene locus_tag LOCUS_09160 1089177 1090046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1090432 1090049 gene locus_tag LOCUS_09170 1090432 1090049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1090993 1090481 gene locus_tag LOCUS_09180 1090993 1090481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1090929 1091123 gene locus_tag LOCUS_09190 1090929 1091123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1091259 1091927 gene locus_tag LOCUS_09200 1091259 1091927 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_09200 1092733 1092209 gene locus_tag LOCUS_09210 gene bstA 1092733 1092209 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_09210 1093917 1092745 gene locus_tag LOCUS_09220 1093917 1092745 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_09220 1096298 1093971 gene locus_tag LOCUS_09230 1096298 1093971 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_09230 1096464 1097375 gene locus_tag LOCUS_09240 1096464 1097375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1097504 1098835 gene locus_tag LOCUS_09250 1097504 1098835 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_09250 1098979 1099722 gene locus_tag LOCUS_09260 1098979 1099722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1100630 1099803 gene locus_tag LOCUS_09270 1100630 1099803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1100907 1101577 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggttttggtccacgcttacctgc 1103663 1102878 gene locus_tag LOCUS_09280 1103663 1102878 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109413831.1 protein_id gnl|my_center|LOCUS_09280 1106413 1103663 gene locus_tag LOCUS_09290 1106413 1103663 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_09290 1106634 1107053 gene locus_tag LOCUS_09300 gene mscL 1106634 1107053 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192898.1 protein_id gnl|my_center|LOCUS_09300 1107961 1107110 gene locus_tag LOCUS_09310 1107961 1107110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1108551 1107958 gene locus_tag LOCUS_09320 1108551 1107958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1109209 1108697 gene locus_tag LOCUS_09330 1109209 1108697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1110703 1109369 gene locus_tag LOCUS_09340 1110703 1109369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1111926 1110787 gene locus_tag LOCUS_09350 1111926 1110787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1112417 1111923 gene locus_tag LOCUS_09360 1112417 1111923 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823962.1 protein_id gnl|my_center|LOCUS_09360 1113475 1112783 gene locus_tag LOCUS_09370 1113475 1112783 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_09370 1114743 1113472 gene locus_tag LOCUS_09380 1114743 1113472 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100623.1 protein_id gnl|my_center|LOCUS_09380 1115884 1114868 gene locus_tag LOCUS_09390 1115884 1114868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1116521 1115952 gene locus_tag LOCUS_09400 1116521 1115952 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902930.1 protein_id gnl|my_center|LOCUS_09400 1118980 1116869 gene locus_tag LOCUS_09410 1118980 1116869 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_09410 1119187 1121277 gene locus_tag LOCUS_09420 1119187 1121277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09420 1121281 1122003 gene locus_tag LOCUS_09430 1121281 1122003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09430 1122136 1122209 gene locus_tag LOCUS_t00130 1122136 1122209 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1122368 1122565 gene locus_tag LOCUS_09440 1122368 1122565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1123048 1125294 gene locus_tag LOCUS_09450 1123048 1125294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1126819 1125362 gene locus_tag LOCUS_09460 1126819 1125362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1128617 1126935 gene locus_tag LOCUS_09470 1128617 1126935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1129628 1128741 gene locus_tag LOCUS_09480 1129628 1128741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1131192 1129897 gene locus_tag LOCUS_09490 1131192 1129897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1131465 1132700 gene locus_tag LOCUS_09500 1131465 1132700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1134353 1133325 gene locus_tag LOCUS_09510 1134353 1133325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1134993 1134361 gene locus_tag LOCUS_09520 1134993 1134361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1135851 1137524 gene locus_tag LOCUS_09530 1135851 1137524 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964427.1 protein_id gnl|my_center|LOCUS_09530 1137623 1137919 gene locus_tag LOCUS_09540 1137623 1137919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09540 1137919 1139118 gene locus_tag LOCUS_09550 1137919 1139118 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09550 1139212 1141068 gene locus_tag LOCUS_09560 1139212 1141068 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_09560 1141278 1141808 gene locus_tag LOCUS_09570 1141278 1141808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1141902 1142351 gene locus_tag LOCUS_09580 1141902 1142351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1142427 1142777 gene locus_tag LOCUS_09590 1142427 1142777 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_09590 1142949 1143386 gene locus_tag LOCUS_09600 1142949 1143386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1145991 1143457 gene locus_tag LOCUS_09610 1145991 1143457 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_09610 1146403 1146786 gene locus_tag LOCUS_09620 1146403 1146786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1146787 1147695 gene locus_tag LOCUS_09630 1146787 1147695 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_09630 1147893 1147966 gene locus_tag LOCUS_t00140 1147893 1147966 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1148344 1148763 gene locus_tag LOCUS_09640 1148344 1148763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1148949 1151450 gene locus_tag LOCUS_09650 1148949 1151450 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_09650 1151825 1152805 gene locus_tag LOCUS_09660 1151825 1152805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1152799 1153119 gene locus_tag LOCUS_09670 1152799 1153119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1153313 1154146 gene locus_tag LOCUS_09680 1153313 1154146 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_09680 1154280 1154690 gene locus_tag LOCUS_09690 1154280 1154690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1154695 1155105 gene locus_tag LOCUS_09700 1154695 1155105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1155102 1155479 gene locus_tag LOCUS_09710 1155102 1155479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1155486 1155884 gene locus_tag LOCUS_09720 1155486 1155884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1156143 1156361 gene locus_tag LOCUS_09730 1156143 1156361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1156386 1157036 gene locus_tag LOCUS_09740 1156386 1157036 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969623.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09740 1157235 1157408 gene locus_tag LOCUS_09750 1157235 1157408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1158289 1158540 gene locus_tag LOCUS_09760 1158289 1158540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1158537 1158950 gene locus_tag LOCUS_09770 1158537 1158950 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_09770 1159086 1159970 gene locus_tag LOCUS_09780 gene mnmH 1159086 1159970 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 1159931 1160119 gene locus_tag LOCUS_09790 1159931 1160119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1160112 1161071 gene locus_tag LOCUS_09800 gene selD 1160112 1161071 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 protein_id gnl|my_center|LOCUS_09800 1161356 1161772 gene locus_tag LOCUS_09810 1161356 1161772 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532348.1 protein_id gnl|my_center|LOCUS_09810 1161973 1163184 gene locus_tag LOCUS_09820 gene dinB 1161973 1163184 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_09820 1165812 1164484 gene locus_tag LOCUS_09830 1165812 1164484 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088280.1 protein_id gnl|my_center|LOCUS_09830 1167451 1165856 gene locus_tag LOCUS_09840 1167451 1165856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1167766 1169004 gene locus_tag LOCUS_09850 1167766 1169004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1169311 1170000 gene locus_tag LOCUS_09860 1169311 1170000 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_09860 1171231 1170386 gene locus_tag LOCUS_09870 1171231 1170386 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629595.1 protein_id gnl|my_center|LOCUS_09870 1171387 1172130 gene locus_tag LOCUS_09880 1171387 1172130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_09880 1172176 1172550 gene locus_tag LOCUS_09890 gene crcB 1172176 1172550 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_09890 1172562 1173218 gene locus_tag LOCUS_09900 1172562 1173218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1173241 1173726 gene locus_tag LOCUS_09910 1173241 1173726 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815474.1 protein_id gnl|my_center|LOCUS_09910 1175096 1174719 gene locus_tag LOCUS_09920 gene rbfA 1175096 1174719 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_09920 1175646 1175179 gene locus_tag LOCUS_09930 1175646 1175179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09930 1176902 1175655 gene locus_tag LOCUS_09940 1176902 1175655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09940 1177433 1176906 gene locus_tag LOCUS_09950 1177433 1176906 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_09950 1177759 1177433 gene locus_tag LOCUS_09960 1177759 1177433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09960 1179057 1177687 gene locus_tag LOCUS_09970 1179057 1177687 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09970 1179350 1180885 gene locus_tag LOCUS_09980 1179350 1180885 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_09980 1180894 1181187 gene locus_tag LOCUS_09990 1180894 1181187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1181215 1181943 gene locus_tag LOCUS_10000 1181215 1181943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1182127 1182942 gene locus_tag LOCUS_10010 1182127 1182942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1183502 1182996 gene locus_tag LOCUS_10020 1183502 1182996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1185271 1183643 gene locus_tag LOCUS_10030 1185271 1183643 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_10030 1185385 1185969 gene locus_tag LOCUS_10040 1185385 1185969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1186476 1186003 gene locus_tag LOCUS_10050 1186476 1186003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1187990 1187586 gene locus_tag LOCUS_10060 1187990 1187586 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 protein_id gnl|my_center|LOCUS_10060 1188229 1188837 gene locus_tag LOCUS_10070 1188229 1188837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1188834 1189727 gene locus_tag LOCUS_10080 gene era 1188834 1189727 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_10080 1190753 1190160 gene locus_tag LOCUS_10090 1190753 1190160 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_10090 1190895 1191989 gene locus_tag LOCUS_10100 gene ychF 1190895 1191989 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_10100 1192211 1193314 gene locus_tag LOCUS_10110 1192211 1193314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1193554 1193913 gene locus_tag LOCUS_10120 1193554 1193913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1195118 1193973 gene locus_tag LOCUS_10130 1195118 1193973 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_10130 1195648 1196022 gene locus_tag LOCUS_10140 1195648 1196022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1197278 1196916 gene locus_tag LOCUS_10150 1197278 1196916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1198655 1197366 gene locus_tag LOCUS_10160 1198655 1197366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1199039 1199350 gene locus_tag LOCUS_10170 1199039 1199350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1200146 1201147 gene locus_tag LOCUS_10180 1200146 1201147 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488875.1 protein_id gnl|my_center|LOCUS_10180 1202064 1201516 gene locus_tag LOCUS_10190 1202064 1201516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1203591 1202452 gene locus_tag LOCUS_10200 1203591 1202452 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_10200 1204937 1203666 gene locus_tag LOCUS_10210 1204937 1203666 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_10210 1207007 1205142 gene locus_tag LOCUS_10220 1207007 1205142 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_10220 1207430 1208356 gene locus_tag LOCUS_10230 gene ribD 1207430 1208356 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_10230 1208776 1208522 gene locus_tag LOCUS_10240 1208776 1208522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1209344 1208787 gene locus_tag LOCUS_10250 1209344 1208787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1210550 1209801 gene locus_tag LOCUS_10260 1210550 1209801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1210959 1210561 gene locus_tag LOCUS_10270 1210959 1210561 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_10270 1211392 1210982 gene locus_tag LOCUS_10280 1211392 1210982 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_10280 1213027 1211888 gene locus_tag LOCUS_10290 1213027 1211888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1214216 1213074 gene locus_tag LOCUS_10300 1214216 1213074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1215167 1214415 gene locus_tag LOCUS_10310 1215167 1214415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1215943 1215179 gene locus_tag LOCUS_10320 1215943 1215179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1216647 1216036 gene locus_tag LOCUS_10330 1216647 1216036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1217597 1217217 gene locus_tag LOCUS_10340 1217597 1217217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1218155 1217649 gene locus_tag LOCUS_10350 1218155 1217649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1219006 1218236 gene locus_tag LOCUS_10360 1219006 1218236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1219728 1220468 gene locus_tag LOCUS_10370 1219728 1220468 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_10370 1222218 1222144 gene locus_tag LOCUS_t00150 1222218 1222144 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1222418 1223170 gene locus_tag LOCUS_10380 gene kdsB 1222418 1223170 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_10380 1223647 1223165 gene locus_tag LOCUS_10390 gene cdd 1223647 1223165 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_10390 1223808 1225136 gene locus_tag LOCUS_10400 1223808 1225136 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_10400 1225133 1226461 gene locus_tag LOCUS_10410 1225133 1226461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1226652 1226464 gene locus_tag LOCUS_10420 1226652 1226464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1227154 1228065 gene locus_tag LOCUS_10430 1227154 1228065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1228082 1228300 gene locus_tag LOCUS_10440 1228082 1228300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1229569 1228424 gene locus_tag LOCUS_10450 1229569 1228424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1230202 1229636 gene locus_tag LOCUS_10460 1230202 1229636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1230552 1230469 gene locus_tag LOCUS_t00160 1230552 1230469 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1230647 1230572 gene locus_tag LOCUS_t00170 1230647 1230572 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1231566 1230889 gene locus_tag LOCUS_10470 1231566 1230889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10470 1232796 1231924 gene locus_tag LOCUS_10480 1232796 1231924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1233713 1232868 gene locus_tag LOCUS_10490 1233713 1232868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1234744 1233734 gene locus_tag LOCUS_10500 1234744 1233734 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_10500 1235012 1235407 gene locus_tag LOCUS_10510 1235012 1235407 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_10510 1235411 1236367 gene locus_tag LOCUS_10520 1235411 1236367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1236652 1237293 gene locus_tag LOCUS_10530 1236652 1237293 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_10530 1238333 1237494 gene locus_tag LOCUS_10540 gene prmA 1238333 1237494 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_10540 1239207 1238323 gene locus_tag LOCUS_10550 gene folD 1239207 1238323 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_10550 1239414 1239890 gene locus_tag LOCUS_10560 1239414 1239890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1239898 1240905 gene locus_tag LOCUS_10570 1239898 1240905 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_10570 1241872 1241444 gene locus_tag LOCUS_10580 1241872 1241444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1241979 1242920 gene locus_tag LOCUS_10590 gene fmt 1241979 1242920 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_10590 1243153 1242917 gene locus_tag LOCUS_10600 1243153 1242917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1245893 1243191 gene locus_tag LOCUS_10610 1245893 1243191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1246586 1245921 gene locus_tag LOCUS_10620 1246586 1245921 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_10620 1246948 1246712 gene locus_tag LOCUS_10630 1246948 1246712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1247119 1248336 gene locus_tag LOCUS_10640 1247119 1248336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1249557 1248343 gene locus_tag LOCUS_10650 1249557 1248343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1249726 1250376 gene locus_tag LOCUS_10660 1249726 1250376 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_10660 1250432 1251475 gene locus_tag LOCUS_10670 1250432 1251475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1251762 1253180 gene locus_tag LOCUS_10680 1251762 1253180 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_10680 1253241 1253729 gene locus_tag LOCUS_10690 1253241 1253729 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460302.1 protein_id gnl|my_center|LOCUS_10690 1253732 1254508 gene locus_tag LOCUS_10700 1253732 1254508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1256283 1254721 gene locus_tag LOCUS_10710 1256283 1254721 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_10710 1256520 1257743 gene locus_tag LOCUS_10720 1256520 1257743 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_10720 1257878 1258501 gene locus_tag LOCUS_10730 gene sodA 1257878 1258501 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_10730 1258565 1259308 gene locus_tag LOCUS_10740 1258565 1259308 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_10740 1259442 1260110 gene locus_tag LOCUS_10750 1259442 1260110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1260639 1265258 gene locus_tag LOCUS_10760 1260639 1265258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1265609 1265307 gene locus_tag LOCUS_10770 gene raiA 1265609 1265307 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_10770 1266558 1265653 gene locus_tag LOCUS_10780 1266558 1265653 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_10780 1266820 1266626 gene locus_tag LOCUS_10790 gene rpsU 1266820 1266626 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_10790 1267707 1266946 gene locus_tag LOCUS_10800 1267707 1266946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1267822 1268194 gene locus_tag LOCUS_tm00010 1267822 1268194 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1268483 1269355 gene locus_tag LOCUS_10810 1268483 1269355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1269690 1270856 gene locus_tag LOCUS_10820 gene gldK 1269690 1270856 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_10820 1270971 1271570 gene locus_tag LOCUS_10830 1270971 1271570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1271690 1273174 gene locus_tag LOCUS_10840 gene gldM 1271690 1273174 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_10840 1273203 1274258 gene locus_tag LOCUS_10850 1273203 1274258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1274881 1275282 gene locus_tag LOCUS_10860 1274881 1275282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1275718 1277112 gene locus_tag LOCUS_10870 1275718 1277112 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_10870 1277233 1279563 gene locus_tag LOCUS_10880 1277233 1279563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1279642 1281315 gene locus_tag LOCUS_10890 1279642 1281315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 1281336 1282028 gene locus_tag LOCUS_10900 1281336 1282028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 1282645 1282055 gene locus_tag LOCUS_10910 1282645 1282055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1283464 1282655 gene locus_tag LOCUS_10920 1283464 1282655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1285913 1284486 gene locus_tag LOCUS_10930 1285913 1284486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1286108 1288495 gene locus_tag LOCUS_10940 1286108 1288495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1288722 1288952 gene locus_tag LOCUS_10950 1288722 1288952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1288954 1291038 gene locus_tag LOCUS_10960 gene feoB 1288954 1291038 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_10960 1291172 1293178 gene locus_tag LOCUS_10970 1291172 1293178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1293208 1294314 gene locus_tag LOCUS_10980 gene gcvT 1293208 1294314 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_10980 1294386 1294886 gene locus_tag LOCUS_10990 1294386 1294886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1294935 1295834 gene locus_tag LOCUS_11000 1294935 1295834 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_11000 1296911 1295835 gene locus_tag LOCUS_11010 1296911 1295835 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_11010 1297320 1297000 gene locus_tag LOCUS_11020 1297320 1297000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11020 1297628 1297365 gene locus_tag LOCUS_11030 1297628 1297365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11030 1297649 1298269 gene locus_tag LOCUS_11040 1297649 1298269 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_11040 1298461 1298736 gene locus_tag LOCUS_11050 gene rpsO 1298461 1298736 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_11050 1298848 1300992 gene locus_tag LOCUS_11060 gene pnp 1298848 1300992 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_11060 1301424 1302041 gene locus_tag LOCUS_11070 1301424 1302041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1302058 1305243 gene locus_tag LOCUS_11080 1302058 1305243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1305950 1305240 gene locus_tag LOCUS_11090 1305950 1305240 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 protein_id gnl|my_center|LOCUS_11090 1306395 1309013 gene locus_tag LOCUS_11100 1306395 1309013 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_11100 1309268 1309612 gene locus_tag LOCUS_11110 1309268 1309612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 1309680 1310405 gene locus_tag LOCUS_11120 gene ubiE 1309680 1310405 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_11120 1310402 1311115 gene locus_tag LOCUS_11130 1310402 1311115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1312506 1311454 gene locus_tag LOCUS_11140 1312506 1311454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868767.1 protein_id gnl|my_center|LOCUS_11140 1313324 1312524 gene locus_tag LOCUS_11150 1313324 1312524 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_11150 1313684 1313349 gene locus_tag LOCUS_11160 1313684 1313349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1314610 1313729 gene locus_tag LOCUS_11170 1314610 1313729 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_11170 1316927 1315110 gene locus_tag LOCUS_11180 1316927 1315110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1317261 1317728 gene locus_tag LOCUS_11190 1317261 1317728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 1317707 1318324 gene locus_tag LOCUS_11200 1317707 1318324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11200 1318385 1318606 gene locus_tag LOCUS_11210 1318385 1318606 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_11210 1318666 1319346 gene locus_tag LOCUS_11220 gene cmk 1318666 1319346 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_11220 1319346 1319969 gene locus_tag LOCUS_11230 1319346 1319969 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963435.1 protein_id gnl|my_center|LOCUS_11230 1320009 1320659 gene locus_tag LOCUS_11240 gene upp 1320009 1320659 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_11240 1321659 1321021 gene locus_tag LOCUS_11250 1321659 1321021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1321891 1321616 gene locus_tag LOCUS_11260 1321891 1321616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1322277 1321924 gene locus_tag LOCUS_11270 1322277 1321924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1324942 1322408 gene locus_tag LOCUS_11280 1324942 1322408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1327766 1325103 gene locus_tag LOCUS_11290 1327766 1325103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1330018 1328084 gene locus_tag LOCUS_11300 1330018 1328084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1331020 1330670 gene locus_tag LOCUS_11310 1331020 1330670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1331318 1332820 gene locus_tag LOCUS_11320 1331318 1332820 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_11320 1332820 1334097 gene locus_tag LOCUS_11330 1332820 1334097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1335163 1334714 gene locus_tag LOCUS_11340 1335163 1334714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1335685 1336557 gene locus_tag LOCUS_11350 1335685 1336557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1337077 1336835 gene locus_tag LOCUS_11360 1337077 1336835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1337219 1337147 gene locus_tag LOCUS_t00180 1337219 1337147 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1337363 1338349 gene locus_tag LOCUS_11370 gene gap 1337363 1338349 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_11370 1339250 1338828 gene locus_tag LOCUS_11380 1339250 1338828 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618719.1 protein_id gnl|my_center|LOCUS_11380 1340145 1339222 gene locus_tag LOCUS_11390 gene miaA 1340145 1339222 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_11390 1340225 1341502 gene locus_tag LOCUS_11400 1340225 1341502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1341816 1342856 gene locus_tag LOCUS_11410 1341816 1342856 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252964.1 protein_id gnl|my_center|LOCUS_11410 1342873 1344378 gene locus_tag LOCUS_11420 1342873 1344378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_11420 1344980 1344375 gene locus_tag LOCUS_11430 1344980 1344375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1345185 1351502 gene locus_tag LOCUS_11440 1345185 1351502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1351736 1358050 gene locus_tag LOCUS_11450 1351736 1358050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1358500 1358177 gene locus_tag LOCUS_11460 1358500 1358177 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_11460 1359390 1358488 gene locus_tag LOCUS_11470 1359390 1358488 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_11470 1359562 1361220 gene locus_tag LOCUS_11480 gene pgi 1359562 1361220 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916643.1 protein_id gnl|my_center|LOCUS_11480 1361971 1361222 gene locus_tag LOCUS_11490 1361971 1361222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_11490 1363001 1362114 gene locus_tag LOCUS_11500 1363001 1362114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_11500 1363352 1365337 gene locus_tag LOCUS_11510 1363352 1365337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1365276 1366130 gene locus_tag LOCUS_11520 1365276 1366130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1366605 1366276 gene locus_tag LOCUS_11530 1366605 1366276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1367317 1367829 gene locus_tag LOCUS_11540 1367317 1367829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1369232 1367970 gene locus_tag LOCUS_11550 1369232 1367970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1370838 1369276 gene locus_tag LOCUS_11560 1370838 1369276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1372949 1370934 gene locus_tag LOCUS_11570 gene uvrB 1372949 1370934 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_11570 1373583 1372933 gene locus_tag LOCUS_11580 1373583 1372933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1374129 1374929 gene locus_tag LOCUS_11590 1374129 1374929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1374932 1375624 gene locus_tag LOCUS_11600 1374932 1375624 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_11600 1378041 1376185 gene locus_tag LOCUS_11610 1378041 1376185 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_11610 1378443 1378649 gene locus_tag LOCUS_11620 1378443 1378649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1379152 1378646 gene locus_tag LOCUS_11630 gene ribH 1379152 1378646 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_11630 1379904 1379248 gene locus_tag LOCUS_11640 1379904 1379248 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_11640 1380051 1381349 gene locus_tag LOCUS_11650 1380051 1381349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_11650 1381576 1382463 gene locus_tag LOCUS_11660 1381576 1382463 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_11660 1382471 1383733 gene locus_tag LOCUS_11670 1382471 1383733 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_11670 1384990 1383704 gene locus_tag LOCUS_11680 gene aroA 1384990 1383704 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_11680 1386085 1384994 gene locus_tag LOCUS_11690 1386085 1384994 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_11690 1386227 1386418 gene locus_tag LOCUS_11700 1386227 1386418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1386471 1386914 gene locus_tag LOCUS_11710 1386471 1386914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1386925 1387149 gene locus_tag LOCUS_11720 1386925 1387149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1387437 1388552 gene locus_tag LOCUS_11730 1387437 1388552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1388626 1390179 gene locus_tag LOCUS_11740 1388626 1390179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1390489 1390815 gene locus_tag LOCUS_11750 1390489 1390815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1391453 1393573 gene locus_tag LOCUS_11760 1391453 1393573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1393661 1393577 gene locus_tag LOCUS_t00190 1393661 1393577 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1393845 1394066 gene locus_tag LOCUS_11770 1393845 1394066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1394235 1394783 gene locus_tag LOCUS_11780 1394235 1394783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1397039 1395015 gene locus_tag LOCUS_11790 1397039 1395015 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_11790 1397774 1397139 gene locus_tag LOCUS_11800 gene queE 1397774 1397139 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189241.1 protein_id gnl|my_center|LOCUS_11800 1398060 1399058 gene locus_tag LOCUS_11810 1398060 1399058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1400831 1399314 gene locus_tag LOCUS_11820 1400831 1399314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1400968 1401279 gene locus_tag LOCUS_11830 1400968 1401279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1401314 1401571 gene locus_tag LOCUS_11840 gene rpmA 1401314 1401571 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_11840 1402130 1402630 gene locus_tag LOCUS_11850 1402130 1402630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1403312 1402662 gene locus_tag LOCUS_11860 1403312 1402662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 1403530 1403309 gene locus_tag LOCUS_11870 1403530 1403309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1403743 1406190 gene locus_tag LOCUS_11880 1403743 1406190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1408248 1406884 gene locus_tag LOCUS_11890 1408248 1406884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1408852 1408418 gene locus_tag LOCUS_11900 1408852 1408418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1409978 1410241 gene locus_tag LOCUS_11910 gene groES 1409978 1410241 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_11910 1410296 1411930 gene locus_tag LOCUS_11920 gene groL 1410296 1411930 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_11920 1412170 1413213 gene locus_tag LOCUS_11930 1412170 1413213 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence02 <1 1525 gene locus_tag LOCUS_11940 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962807.1:DNA topoisomerase IV subunit B 1717 2802 gene locus_tag LOCUS_11950 1717 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2824 4305 gene locus_tag LOCUS_11960 2824 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4346 5272 gene locus_tag LOCUS_11970 4346 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5708 6133 gene locus_tag LOCUS_11980 5708 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6236 12388 gene locus_tag LOCUS_11990 6236 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 12734 15724 gene locus_tag LOCUS_12000 12734 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 16721 16203 gene locus_tag LOCUS_12010 16721 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 17125 16784 gene locus_tag LOCUS_12020 17125 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 18611 17148 gene locus_tag LOCUS_12030 gene proS 18611 17148 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_12030 18848 19894 gene locus_tag LOCUS_12040 18848 19894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 20085 21572 gene locus_tag LOCUS_12050 20085 21572 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_12050 21742 23043 gene locus_tag LOCUS_12060 21742 23043 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_12060 23102 25189 gene locus_tag LOCUS_12070 23102 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 25193 25795 gene locus_tag LOCUS_12080 25193 25795 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_12080 26320 25832 gene locus_tag LOCUS_12090 26320 25832 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_12090 26438 27364 gene locus_tag LOCUS_12100 26438 27364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 27935 27354 gene locus_tag LOCUS_12110 27935 27354 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_12110 28169 30325 gene locus_tag LOCUS_12120 28169 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 30401 32569 gene locus_tag LOCUS_12130 30401 32569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 33193 35322 gene locus_tag LOCUS_12140 33193 35322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 35422 35781 gene locus_tag LOCUS_12150 gene rplS 35422 35781 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_12150 36105 36674 gene locus_tag LOCUS_12160 36105 36674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 36604 36828 gene locus_tag LOCUS_12170 36604 36828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 37600 38670 gene locus_tag LOCUS_12180 gene serC 37600 38670 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_12180 38786 39610 gene locus_tag LOCUS_12190 38786 39610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 40647 40150 gene locus_tag LOCUS_12200 40647 40150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 40964 40725 gene locus_tag LOCUS_12210 40964 40725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 41698 41150 gene locus_tag LOCUS_12220 41698 41150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 42150 41704 gene locus_tag LOCUS_12230 42150 41704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 42622 42140 gene locus_tag LOCUS_12240 42622 42140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 42945 42619 gene locus_tag LOCUS_12250 42945 42619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 43230 42946 gene locus_tag LOCUS_12260 43230 42946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 43633 43187 gene locus_tag LOCUS_12270 43633 43187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 43656 43865 gene locus_tag LOCUS_12280 43656 43865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 44588 43962 gene locus_tag LOCUS_12290 44588 43962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 44998 44585 gene locus_tag LOCUS_12300 44998 44585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12300 45497 44940 gene locus_tag LOCUS_12310 45497 44940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12310 46090 45530 gene locus_tag LOCUS_12320 46090 45530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 46319 46134 gene locus_tag LOCUS_12330 46319 46134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 48310 47630 gene locus_tag LOCUS_12340 48310 47630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 48873 48370 gene locus_tag LOCUS_12350 48873 48370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 49136 48864 gene locus_tag LOCUS_12360 49136 48864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 50556 49231 gene locus_tag LOCUS_12370 50556 49231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 52124 50592 gene locus_tag LOCUS_12380 52124 50592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 52339 52118 gene locus_tag LOCUS_12390 52339 52118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 52719 52462 gene locus_tag LOCUS_12400 52719 52462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 52833 53282 gene locus_tag LOCUS_12410 52833 53282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12410 53267 53932 gene locus_tag LOCUS_12420 53267 53932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12420 54025 54549 gene locus_tag LOCUS_12430 gene rsmG 54025 54549 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12430 54817 57285 gene locus_tag LOCUS_12440 54817 57285 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_12440 58334 57594 gene locus_tag LOCUS_12450 gene pgl 58334 57594 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_12450 60032 58530 gene locus_tag LOCUS_12460 gene zwf 60032 58530 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_12460 61097 60069 gene locus_tag LOCUS_12470 61097 60069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12470 61462 61169 gene locus_tag LOCUS_12480 61462 61169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12480 63811 61463 gene locus_tag LOCUS_12490 63811 61463 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_12490 63992 65419 gene locus_tag LOCUS_12500 63992 65419 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_12500 67542 66067 gene locus_tag LOCUS_12510 67542 66067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 68479 67922 gene locus_tag LOCUS_12520 68479 67922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 68739 68437 gene locus_tag LOCUS_12530 68739 68437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 68878 72198 gene locus_tag LOCUS_12540 gene secA 68878 72198 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_12540 72493 73005 gene locus_tag LOCUS_12550 72493 73005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 73038 73793 gene locus_tag LOCUS_12560 73038 73793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 74380 73799 gene locus_tag LOCUS_12570 74380 73799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 75915 74386 gene locus_tag LOCUS_12580 gene gpmI 75915 74386 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_12580 76029 76406 gene locus_tag LOCUS_12590 76029 76406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 77024 76590 gene locus_tag LOCUS_12600 77024 76590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 77626 77027 gene locus_tag LOCUS_12610 gene gmk 77626 77027 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_12610 77923 77627 gene locus_tag LOCUS_12620 77923 77627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 78489 78043 gene locus_tag LOCUS_12630 78489 78043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 79048 81471 gene locus_tag LOCUS_12640 79048 81471 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_12640 81628 83433 gene locus_tag LOCUS_12650 81628 83433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 85158 83743 gene locus_tag LOCUS_12660 85158 83743 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_12660 85671 86102 gene locus_tag LOCUS_12670 85671 86102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 86113 87036 gene locus_tag LOCUS_12680 86113 87036 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_12680 87275 88456 gene locus_tag LOCUS_12690 87275 88456 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_12690 90278 88737 gene locus_tag LOCUS_12700 90278 88737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 90280 90429 gene locus_tag LOCUS_12710 90280 90429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 92042 90426 gene locus_tag LOCUS_12720 92042 90426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 92651 92496 gene locus_tag LOCUS_12730 92651 92496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 92730 94478 gene locus_tag LOCUS_12740 92730 94478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_12740 94697 95725 gene locus_tag LOCUS_12750 94697 95725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 95866 96900 gene locus_tag LOCUS_12760 gene fni 95866 96900 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_12760 96974 98326 gene locus_tag LOCUS_12770 96974 98326 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_12770 98421 99347 gene locus_tag LOCUS_12780 98421 99347 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_12780 99614 100336 gene locus_tag LOCUS_12790 99614 100336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 102456 103070 gene locus_tag LOCUS_12800 102456 103070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 103656 104654 gene locus_tag LOCUS_12810 103656 104654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 104875 106305 gene locus_tag LOCUS_12820 104875 106305 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_12820 106379 107614 gene locus_tag LOCUS_12830 106379 107614 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973517.1 protein_id gnl|my_center|LOCUS_12830 108974 107832 gene locus_tag LOCUS_12840 gene mqnC 108974 107832 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_12840 112435 111017 gene locus_tag LOCUS_12850 gene dnaA 112435 111017 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_12850 113607 112684 gene locus_tag LOCUS_12860 113607 112684 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_12860 114378 113623 gene locus_tag LOCUS_12870 114378 113623 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_12870 115155 116291 gene locus_tag LOCUS_12880 115155 116291 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_12880 116371 117042 gene locus_tag LOCUS_12890 116371 117042 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 118246 118049 gene locus_tag LOCUS_12900 118246 118049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 119043 118264 gene locus_tag LOCUS_12910 119043 118264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_12910 119143 119649 gene locus_tag LOCUS_12920 119143 119649 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_12920 119869 120465 gene locus_tag LOCUS_12930 119869 120465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 121144 120788 gene locus_tag LOCUS_12940 121144 120788 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_12940 121846 121376 gene locus_tag LOCUS_12950 121846 121376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 122179 121913 gene locus_tag LOCUS_12960 122179 121913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 122840 122391 gene locus_tag LOCUS_12970 122840 122391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 124101 122962 gene locus_tag LOCUS_12980 124101 122962 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766357.1 protein_id gnl|my_center|LOCUS_12980 125336 124470 gene locus_tag LOCUS_12990 125336 124470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 126185 125622 gene locus_tag LOCUS_13000 126185 125622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 126748 126200 gene locus_tag LOCUS_13010 126748 126200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 127172 126696 gene locus_tag LOCUS_13020 127172 126696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 128926 127136 gene locus_tag LOCUS_13030 128926 127136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_13030 129437 130438 gene locus_tag LOCUS_13040 gene fbp 129437 130438 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_13040 131781 131206 gene locus_tag LOCUS_13050 131781 131206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 133260 131914 gene locus_tag LOCUS_13060 gene ahcY 133260 131914 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_13060 133693 133505 gene locus_tag LOCUS_13070 133693 133505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 133743 134621 gene locus_tag LOCUS_13080 133743 134621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 134611 135102 gene locus_tag LOCUS_13090 134611 135102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 135211 136335 gene locus_tag LOCUS_13100 135211 136335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 136943 137512 gene locus_tag LOCUS_13110 136943 137512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 137551 137958 gene locus_tag LOCUS_13120 137551 137958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 137948 138256 gene locus_tag LOCUS_13130 137948 138256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13130 138240 138503 gene locus_tag LOCUS_13140 138240 138503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13140 138844 139971 gene locus_tag LOCUS_13150 138844 139971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 140075 141445 gene locus_tag LOCUS_13160 140075 141445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 141842 143659 gene locus_tag LOCUS_13170 141842 143659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 145228 144161 gene locus_tag LOCUS_13180 gene arsB 145228 144161 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_13180 145887 145231 gene locus_tag LOCUS_13190 145887 145231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 146509 145880 gene locus_tag LOCUS_13200 146509 145880 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_13200 147067 146603 gene locus_tag LOCUS_13210 147067 146603 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_13210 147448 147116 gene locus_tag LOCUS_13220 147448 147116 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_13220 148673 147534 gene locus_tag LOCUS_13230 gene hemW 148673 147534 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_13230 148938 148660 gene locus_tag LOCUS_13240 148938 148660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13240 149277 148939 gene locus_tag LOCUS_13250 149277 148939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13250 149906 150985 gene locus_tag LOCUS_13260 149906 150985 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_13260 151002 152672 gene locus_tag LOCUS_13270 151002 152672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 152799 154811 gene locus_tag LOCUS_13280 152799 154811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 157278 155176 gene locus_tag LOCUS_13290 157278 155176 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_13290 158064 157459 gene locus_tag LOCUS_13300 158064 157459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 159594 158239 gene locus_tag LOCUS_13310 159594 158239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 161691 159664 gene locus_tag LOCUS_13320 161691 159664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 163483 161783 gene locus_tag LOCUS_13330 163483 161783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 164046 165797 gene locus_tag LOCUS_13340 164046 165797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 165814 166524 gene locus_tag LOCUS_13350 165814 166524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 166711 167196 gene locus_tag LOCUS_13360 166711 167196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 167259 168518 gene locus_tag LOCUS_13370 167259 168518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 168515 178129 gene locus_tag LOCUS_13380 168515 178129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 178138 180762 gene locus_tag LOCUS_13390 178138 180762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 180858 185051 gene locus_tag LOCUS_13400 180858 185051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 185284 185210 gene locus_tag LOCUS_t00200 185284 185210 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 185386 186300 gene locus_tag LOCUS_13410 185386 186300 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_13410 187217 186705 gene locus_tag LOCUS_13420 187217 186705 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 protein_id gnl|my_center|LOCUS_13420 188003 187584 gene locus_tag LOCUS_13430 188003 187584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 188548 188015 gene locus_tag LOCUS_13440 188548 188015 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_13440 190099 188570 gene locus_tag LOCUS_13450 190099 188570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 190544 190248 gene locus_tag LOCUS_13460 190544 190248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 191494 190625 gene locus_tag LOCUS_13470 gene pip 191494 190625 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_13470 192154 191615 gene locus_tag LOCUS_13480 192154 191615 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780585.1 protein_id gnl|my_center|LOCUS_13480 192651 192304 gene locus_tag LOCUS_13490 192651 192304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 193048 192749 gene locus_tag LOCUS_13500 gene trxA 193048 192749 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_13500 195338 193872 gene locus_tag LOCUS_13510 195338 193872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 196772 195399 gene locus_tag LOCUS_13520 196772 195399 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_13520 197071 197625 gene locus_tag LOCUS_13530 197071 197625 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_13530 199061 197691 gene locus_tag LOCUS_13540 199061 197691 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_13540 200731 199325 gene locus_tag LOCUS_13550 200731 199325 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_13550 202533 201178 gene locus_tag LOCUS_13560 202533 201178 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_13560 202442 202654 gene locus_tag LOCUS_13570 202442 202654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 203062 202655 gene locus_tag LOCUS_13580 203062 202655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13580 205665 202984 gene locus_tag LOCUS_13590 205665 202984 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13590 207004 205790 gene locus_tag LOCUS_13600 207004 205790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 207805 207017 gene locus_tag LOCUS_13610 207805 207017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 208583 207807 gene locus_tag LOCUS_13620 208583 207807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 210177 208669 gene locus_tag LOCUS_13630 210177 208669 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_13630 213254 210186 gene locus_tag LOCUS_13640 213254 210186 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_13640 214928 213399 gene locus_tag LOCUS_13650 214928 213399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 215376 218087 gene locus_tag LOCUS_13660 215376 218087 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_13660 219592 219212 gene locus_tag LOCUS_13670 219592 219212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 222565 219797 gene locus_tag LOCUS_13680 222565 219797 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_13680 224280 223981 gene locus_tag LOCUS_13690 224280 223981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 224485 225018 gene locus_tag LOCUS_13700 224485 225018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 226217 225807 gene locus_tag LOCUS_13710 226217 225807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 227262 226270 gene locus_tag LOCUS_13720 227262 226270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 227379 227738 gene locus_tag LOCUS_13730 227379 227738 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_13730 229649 228327 gene locus_tag LOCUS_13740 229649 228327 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_13740 232010 230451 gene locus_tag LOCUS_13750 232010 230451 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_13750 232733 232089 gene locus_tag LOCUS_13760 232733 232089 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_13760 236601 233104 gene locus_tag LOCUS_13770 236601 233104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 236948 236598 gene locus_tag LOCUS_13780 236948 236598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 237397 237245 gene locus_tag LOCUS_13790 237397 237245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 239090 237489 gene locus_tag LOCUS_13800 239090 237489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 240262 239219 gene locus_tag LOCUS_13810 240262 239219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 241112 240447 gene locus_tag LOCUS_13820 241112 240447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 242334 241123 gene locus_tag LOCUS_13830 242334 241123 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_13830 243720 242716 gene locus_tag LOCUS_13840 243720 242716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 244128 244895 gene locus_tag LOCUS_13850 244128 244895 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_13850 244947 245528 gene locus_tag LOCUS_13860 244947 245528 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_13860 245581 246342 gene locus_tag LOCUS_13870 245581 246342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 246433 247701 gene locus_tag LOCUS_13880 246433 247701 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_13880 247694 248101 gene locus_tag LOCUS_13890 gene ruvX 247694 248101 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_13890 248237 248794 gene locus_tag LOCUS_13900 gene def 248237 248794 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_13900 249547 248858 gene locus_tag LOCUS_13910 249547 248858 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_13910 249776 250216 gene locus_tag LOCUS_13920 249776 250216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 250331 251116 gene locus_tag LOCUS_13930 250331 251116 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_13930 251113 252141 gene locus_tag LOCUS_13940 251113 252141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 252414 253652 gene locus_tag LOCUS_13950 252414 253652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_13950 254887 253796 gene locus_tag LOCUS_13960 254887 253796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 255886 254969 gene locus_tag LOCUS_13970 gene xerD 255886 254969 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_13970 256480 256037 gene locus_tag LOCUS_13980 256480 256037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 256761 257309 gene locus_tag LOCUS_13990 256761 257309 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_13990 257623 258048 gene locus_tag LOCUS_14000 257623 258048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 258067 258609 gene locus_tag LOCUS_14010 258067 258609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 258788 259090 gene locus_tag LOCUS_14020 258788 259090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 259752 261974 gene locus_tag LOCUS_14030 259752 261974 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_14030 262182 263657 gene locus_tag LOCUS_14040 262182 263657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 263979 265652 gene locus_tag LOCUS_14050 263979 265652 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 protein_id gnl|my_center|LOCUS_14050 267021 267620 gene locus_tag LOCUS_14060 267021 267620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 267703 267984 gene locus_tag LOCUS_14070 267703 267984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 267936 269075 gene locus_tag LOCUS_14080 267936 269075 CDS product DUF4403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14080 269569 270219 gene locus_tag LOCUS_14090 gene deoC 269569 270219 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_14090 270225 270608 gene locus_tag LOCUS_14100 270225 270608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 270646 272055 gene locus_tag LOCUS_14110 gene rodA 270646 272055 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_14110 272064 273209 gene locus_tag LOCUS_14120 gene tgt 272064 273209 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_14120 273533 274348 gene locus_tag LOCUS_14130 273533 274348 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_14130 278079 274432 gene locus_tag LOCUS_14140 278079 274432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 279893 278388 gene locus_tag LOCUS_14150 279893 278388 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962400.1 protein_id gnl|my_center|LOCUS_14150 282796 280328 gene locus_tag LOCUS_14160 282796 280328 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503907.1 protein_id gnl|my_center|LOCUS_14160 284506 283226 gene locus_tag LOCUS_14170 gene purD 284506 283226 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_14170 285870 285196 gene locus_tag LOCUS_14180 285870 285196 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 protein_id gnl|my_center|LOCUS_14180 286297 285860 gene locus_tag LOCUS_14190 286297 285860 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_14190 286782 289526 gene locus_tag LOCUS_14200 286782 289526 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_14200 289819 290829 gene locus_tag LOCUS_14210 289819 290829 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_14210 292204 290906 gene locus_tag LOCUS_14220 292204 290906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 292955 292776 gene locus_tag LOCUS_14230 292955 292776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 294341 293472 gene locus_tag LOCUS_14240 294341 293472 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444152.1 protein_id gnl|my_center|LOCUS_14240 294927 294574 gene locus_tag LOCUS_14250 294927 294574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_14250 296134 294920 gene locus_tag LOCUS_14260 296134 294920 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_14260 296293 296877 gene locus_tag LOCUS_14270 296293 296877 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_14270 297759 297328 gene locus_tag LOCUS_14280 297759 297328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 298878 298063 gene locus_tag LOCUS_14290 298878 298063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_14290 300352 299855 gene locus_tag LOCUS_14300 300352 299855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 301029 300664 gene locus_tag LOCUS_14310 301029 300664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 301186 301019 gene locus_tag LOCUS_14320 301186 301019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 303505 301310 gene locus_tag LOCUS_14330 303505 301310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 303752 303477 gene locus_tag LOCUS_14340 303752 303477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 304571 304359 gene locus_tag LOCUS_14350 304571 304359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 305191 304568 gene locus_tag LOCUS_14360 305191 304568 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_14360 305870 305193 gene locus_tag LOCUS_14370 gene pth 305870 305193 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_14370 306066 308657 gene locus_tag LOCUS_14380 gene topA 306066 308657 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_14380 308660 309400 gene locus_tag LOCUS_14390 308660 309400 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_14390 311028 310123 gene locus_tag LOCUS_14400 311028 310123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 312035 311319 gene locus_tag LOCUS_14410 312035 311319 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_14410 313414 312083 gene locus_tag LOCUS_14420 313414 312083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 314022 315083 gene locus_tag LOCUS_14430 gene paaK 314022 315083 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329395.1 protein_id gnl|my_center|LOCUS_14430 315215 315778 gene locus_tag LOCUS_14440 315215 315778 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_14440 315831 316775 gene locus_tag LOCUS_14450 gene paaA 315831 316775 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 protein_id gnl|my_center|LOCUS_14450 316886 317248 gene locus_tag LOCUS_14460 316886 317248 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107654.1 protein_id gnl|my_center|LOCUS_14460 317463 317612 gene locus_tag LOCUS_14470 317463 317612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 317793 318554 gene locus_tag LOCUS_14480 gene paaC 317793 318554 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_14480 318557 319063 gene locus_tag LOCUS_14490 gene paaJ 318557 319063 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976333.1 protein_id gnl|my_center|LOCUS_14490 320387 319362 gene locus_tag LOCUS_14500 320387 319362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 322458 321181 gene locus_tag LOCUS_14510 322458 321181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 322760 323368 gene locus_tag LOCUS_14520 322760 323368 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_14520 323463 325901 gene locus_tag LOCUS_14530 gene priA 323463 325901 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_14530 327645 327097 gene locus_tag LOCUS_14540 327645 327097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 328727 327702 gene locus_tag LOCUS_14550 328727 327702 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_14550 329265 329873 gene locus_tag LOCUS_14560 329265 329873 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_14560 330184 331254 gene locus_tag LOCUS_14570 gene prfA 330184 331254 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_14570 332020 331265 gene locus_tag LOCUS_14580 332020 331265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 332479 332021 gene locus_tag LOCUS_14590 332479 332021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 333886 332738 gene locus_tag LOCUS_14600 333886 332738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 335647 334226 gene locus_tag LOCUS_14610 335647 334226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 336673 335942 gene locus_tag LOCUS_14620 336673 335942 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373624.1 protein_id gnl|my_center|LOCUS_14620 337770 336880 gene locus_tag LOCUS_14630 337770 336880 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_14630 337897 338454 gene locus_tag LOCUS_14640 337897 338454 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_14640 338520 339689 gene locus_tag LOCUS_14650 gene dnaJ 338520 339689 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_14650 341750 342193 gene locus_tag LOCUS_14660 341750 342193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 342532 343221 gene locus_tag LOCUS_14670 342532 343221 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_14670 343377 344609 gene locus_tag LOCUS_14680 343377 344609 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_14680 345848 344799 gene locus_tag LOCUS_14690 345848 344799 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_14690 347063 346080 gene locus_tag LOCUS_14700 347063 346080 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_14700 347298 350357 gene locus_tag LOCUS_14710 347298 350357 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_14710 350369 351802 gene locus_tag LOCUS_14720 350369 351802 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_14720 352005 355019 gene locus_tag LOCUS_14730 352005 355019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 355624 355247 gene locus_tag LOCUS_14740 355624 355247 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_14740 355815 355624 gene locus_tag LOCUS_14750 355815 355624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 356350 360393 gene locus_tag LOCUS_14760 356350 360393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 360446 361564 gene locus_tag LOCUS_14770 360446 361564 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_14770 361590 362867 gene locus_tag LOCUS_14780 361590 362867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871382.1 protein_id gnl|my_center|LOCUS_14780 362890 364635 gene locus_tag LOCUS_14790 362890 364635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 364808 366412 gene locus_tag LOCUS_14800 364808 366412 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928693.1 protein_id gnl|my_center|LOCUS_14800 367009 367530 gene locus_tag LOCUS_14810 367009 367530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 367532 369691 gene locus_tag LOCUS_14820 gene rnr 367532 369691 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_14820 370050 369742 gene locus_tag LOCUS_14830 370050 369742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 370298 371206 gene locus_tag LOCUS_14840 370298 371206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 371797 371709 gene locus_tag LOCUS_t00210 371797 371709 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 373381 372938 gene locus_tag LOCUS_14850 373381 372938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 374160 375119 gene locus_tag LOCUS_14860 374160 375119 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_14860 375306 375713 gene locus_tag LOCUS_14870 375306 375713 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_14870 375928 376128 gene locus_tag LOCUS_14880 375928 376128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 377630 376227 gene locus_tag LOCUS_14890 377630 376227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 377936 379132 gene locus_tag LOCUS_14900 377936 379132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 380256 379492 gene locus_tag LOCUS_14910 380256 379492 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_14910 381088 382320 gene locus_tag LOCUS_14920 381088 382320 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_14920 382421 383671 gene locus_tag LOCUS_14930 gene pepT 382421 383671 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_14930 384787 383984 gene locus_tag LOCUS_14940 384787 383984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 385127 384765 gene locus_tag LOCUS_14950 385127 384765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 385241 385612 gene locus_tag LOCUS_14960 385241 385612 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_14960 385852 385658 gene locus_tag LOCUS_14970 385852 385658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 387395 385866 gene locus_tag LOCUS_14980 gene gltX 387395 385866 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_14980 387904 387599 gene locus_tag LOCUS_14990 387904 387599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 388275 387844 gene locus_tag LOCUS_15000 388275 387844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 388331 389482 gene locus_tag LOCUS_15010 388331 389482 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266711.1 protein_id gnl|my_center|LOCUS_15010 390332 389742 gene locus_tag LOCUS_15020 390332 389742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 390533 391816 gene locus_tag LOCUS_15030 390533 391816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_15030 391912 393360 gene locus_tag LOCUS_15040 391912 393360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 393458 395011 gene locus_tag LOCUS_15050 393458 395011 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_15050 397060 395702 gene locus_tag LOCUS_15060 gene creD 397060 395702 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_15060 397424 397128 gene locus_tag LOCUS_15070 397424 397128 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_15070 398062 397442 gene locus_tag LOCUS_15080 398062 397442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_15080 399000 398317 gene locus_tag LOCUS_15090 399000 398317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 399877 399467 gene locus_tag LOCUS_15100 399877 399467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 400732 399896 gene locus_tag LOCUS_15110 400732 399896 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_15110 402200 400716 gene locus_tag LOCUS_15120 gene crtI 402200 400716 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_15120 402236 403021 gene locus_tag LOCUS_15130 402236 403021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 403511 403038 gene locus_tag LOCUS_15140 403511 403038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 403689 405383 gene locus_tag LOCUS_15150 403689 405383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 405731 406231 gene locus_tag LOCUS_15160 405731 406231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 406480 406956 gene locus_tag LOCUS_15170 406480 406956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 407352 407068 gene locus_tag LOCUS_15180 407352 407068 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405458.1 protein_id gnl|my_center|LOCUS_15180 407559 408452 gene locus_tag LOCUS_15190 407559 408452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 408449 409555 gene locus_tag LOCUS_15200 408449 409555 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_15200 409548 410252 gene locus_tag LOCUS_15210 409548 410252 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_15210 410242 411357 gene locus_tag LOCUS_15220 410242 411357 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_15220 411378 412124 gene locus_tag LOCUS_15230 411378 412124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 412753 414186 gene locus_tag LOCUS_15240 gene pyk 412753 414186 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_15240 414476 414910 gene locus_tag LOCUS_15250 gene dut 414476 414910 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_15250 415129 416745 gene locus_tag LOCUS_15260 415129 416745 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_15260 416771 417976 gene locus_tag LOCUS_15270 gene pcaF 416771 417976 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206899.1 protein_id gnl|my_center|LOCUS_15270 418013 418795 gene locus_tag LOCUS_15280 418013 418795 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_15280 418811 419410 gene locus_tag LOCUS_15290 gene paaY 418811 419410 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123453.1 protein_id gnl|my_center|LOCUS_15290 420337 419774 gene locus_tag LOCUS_15300 420337 419774 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_15300 421031 420519 gene locus_tag LOCUS_15310 421031 420519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 421687 422526 gene locus_tag LOCUS_15320 421687 422526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 422714 423670 gene locus_tag LOCUS_15330 422714 423670 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_15330 424025 425017 gene locus_tag LOCUS_15340 424025 425017 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_15340 428076 425638 gene locus_tag LOCUS_15350 428076 425638 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_15350 429013 428114 gene locus_tag LOCUS_15360 429013 428114 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_15360 429690 430184 gene locus_tag LOCUS_15370 429690 430184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 430303 431211 gene locus_tag LOCUS_15380 430303 431211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 431196 432260 gene locus_tag LOCUS_15390 431196 432260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 432288 433445 gene locus_tag LOCUS_15400 432288 433445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 433628 433846 gene locus_tag LOCUS_15410 433628 433846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15410 433895 435034 gene locus_tag LOCUS_15420 433895 435034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 435091 436143 gene locus_tag LOCUS_15430 435091 436143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 436499 437707 gene locus_tag LOCUS_15440 436499 437707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 437823 439457 gene locus_tag LOCUS_15450 437823 439457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15450 440779 442047 gene locus_tag LOCUS_15460 440779 442047 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_15460 442730 444124 gene locus_tag LOCUS_15470 442730 444124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 444128 448303 gene locus_tag LOCUS_15480 444128 448303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 448411 450285 gene locus_tag LOCUS_15490 448411 450285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 450282 450656 gene locus_tag LOCUS_15500 450282 450656 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085647.1 protein_id gnl|my_center|LOCUS_15500 450653 451687 gene locus_tag LOCUS_15510 450653 451687 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_15510 451705 453168 gene locus_tag LOCUS_15520 451705 453168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 455289 454360 gene locus_tag LOCUS_15530 455289 454360 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027774.1 protein_id gnl|my_center|LOCUS_15530 456261 455380 gene locus_tag LOCUS_15540 456261 455380 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_15540 456937 456464 gene locus_tag LOCUS_15550 456937 456464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 457119 457811 gene locus_tag LOCUS_15560 457119 457811 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814963.1 protein_id gnl|my_center|LOCUS_15560 459213 457993 gene locus_tag LOCUS_15570 459213 457993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 461453 460050 gene locus_tag LOCUS_15580 461453 460050 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_15580 462652 461903 gene locus_tag LOCUS_15590 462652 461903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 463432 462680 gene locus_tag LOCUS_15600 gene lmtA 463432 462680 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_15600 464009 464665 gene locus_tag LOCUS_15610 464009 464665 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_15610 464708 466684 gene locus_tag LOCUS_15620 464708 466684 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_15620 466753 467499 gene locus_tag LOCUS_15630 466753 467499 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_15630 467616 468368 gene locus_tag LOCUS_15640 467616 468368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 468349 468726 gene locus_tag LOCUS_15650 468349 468726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 468719 469231 gene locus_tag LOCUS_15660 468719 469231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 469343 469864 gene locus_tag LOCUS_15670 469343 469864 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_15670 469987 470892 gene locus_tag LOCUS_15680 469987 470892 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_15680 472136 471201 gene locus_tag LOCUS_15690 472136 471201 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_15690 473572 472145 gene locus_tag LOCUS_15700 gene rpoN 473572 472145 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_15700 474248 476029 gene locus_tag LOCUS_15710 474248 476029 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_15710 476650 476030 gene locus_tag LOCUS_15720 476650 476030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 477196 476966 gene locus_tag LOCUS_15730 477196 476966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 477374 477186 gene locus_tag LOCUS_15740 477374 477186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15740 478903 477635 gene locus_tag LOCUS_15750 478903 477635 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_15750 479103 480311 gene locus_tag LOCUS_15760 479103 480311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 482054 484828 gene locus_tag LOCUS_15770 482054 484828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 484901 485752 gene locus_tag LOCUS_15780 gene nadC 484901 485752 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_15780 486428 487105 gene locus_tag LOCUS_15790 gene pgmB 486428 487105 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_15790 487226 489544 gene locus_tag LOCUS_15800 487226 489544 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_15800 489758 491143 gene locus_tag LOCUS_15810 489758 491143 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_15810 491228 492757 gene locus_tag LOCUS_15820 491228 492757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265786.1 protein_id gnl|my_center|LOCUS_15820 492892 493851 gene locus_tag LOCUS_15830 492892 493851 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_15830 494011 494529 gene locus_tag LOCUS_15840 494011 494529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 494526 495425 gene locus_tag LOCUS_15850 gene dapA 494526 495425 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_15850 495512 495976 gene locus_tag LOCUS_15860 495512 495976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 496029 497834 gene locus_tag LOCUS_15870 496029 497834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 498932 497973 gene locus_tag LOCUS_15880 498932 497973 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973550.1 protein_id gnl|my_center|LOCUS_15880 499968 499138 gene locus_tag LOCUS_15890 499968 499138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 501378 500428 gene locus_tag LOCUS_15900 501378 500428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 501550 502206 gene locus_tag LOCUS_15910 501550 502206 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_15910 503480 502764 gene locus_tag LOCUS_15920 503480 502764 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_15920 503753 503484 gene locus_tag LOCUS_15930 503753 503484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 504229 503786 gene locus_tag LOCUS_15940 504229 503786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 505875 504226 gene locus_tag LOCUS_15950 505875 504226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 507274 506804 gene locus_tag LOCUS_15960 507274 506804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 507906 507334 gene locus_tag LOCUS_15970 507906 507334 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948438.1 protein_id gnl|my_center|LOCUS_15970 508329 507925 gene locus_tag LOCUS_15980 508329 507925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 508951 508577 gene locus_tag LOCUS_15990 508951 508577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 509663 511228 gene locus_tag LOCUS_16000 509663 511228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 512295 511480 gene locus_tag LOCUS_16010 512295 511480 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963736.1 protein_id gnl|my_center|LOCUS_16010 513186 512770 gene locus_tag LOCUS_16020 513186 512770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 514651 514076 gene locus_tag LOCUS_16030 514651 514076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_16030 515598 514738 gene locus_tag LOCUS_16040 515598 514738 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_16040 516233 515667 gene locus_tag LOCUS_16050 516233 515667 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_16050 516850 516401 gene locus_tag LOCUS_16060 516850 516401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 517188 517961 gene locus_tag LOCUS_16070 gene map 517188 517961 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_16070 518061 518369 gene locus_tag LOCUS_16080 518061 518369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 518369 519304 gene locus_tag LOCUS_16090 518369 519304 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_16090 519301 519594 gene locus_tag LOCUS_16100 519301 519594 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_16100 519776 520465 gene locus_tag LOCUS_16110 519776 520465 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_16110 520759 521298 gene locus_tag LOCUS_16120 520759 521298 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963886.1 protein_id gnl|my_center|LOCUS_16120 521395 522801 gene locus_tag LOCUS_16130 521395 522801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 522811 523731 gene locus_tag LOCUS_16140 gene rlmF 522811 523731 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109384.1 protein_id gnl|my_center|LOCUS_16140 523843 524109 gene locus_tag LOCUS_16150 523843 524109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 524135 524341 gene locus_tag LOCUS_16160 524135 524341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 524398 524700 gene locus_tag LOCUS_16170 524398 524700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 524921 526258 gene locus_tag LOCUS_16180 524921 526258 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_16180 527365 526385 gene locus_tag LOCUS_16190 527365 526385 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448438.1 protein_id gnl|my_center|LOCUS_16190 527535 528377 gene locus_tag LOCUS_16200 527535 528377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 528616 529455 gene locus_tag LOCUS_16210 528616 529455 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169648.1 protein_id gnl|my_center|LOCUS_16210 529461 529880 gene locus_tag LOCUS_16220 529461 529880 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_16220 530221 530601 gene locus_tag LOCUS_16230 530221 530601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 530604 530975 gene locus_tag LOCUS_16240 530604 530975 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_16240 531772 532425 gene locus_tag LOCUS_16250 531772 532425 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_16250 532422 532781 gene locus_tag LOCUS_16260 532422 532781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 533504 535576 gene locus_tag LOCUS_16270 533504 535576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 535740 536924 gene locus_tag LOCUS_16280 535740 536924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 536963 537670 gene locus_tag LOCUS_16290 536963 537670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 537677 538411 gene locus_tag LOCUS_16300 537677 538411 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_16300 538604 539524 gene locus_tag LOCUS_16310 538604 539524 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904003.1 protein_id gnl|my_center|LOCUS_16310 540712 541962 gene locus_tag LOCUS_16320 540712 541962 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946542.1 protein_id gnl|my_center|LOCUS_16320 542036 542683 gene locus_tag LOCUS_16330 542036 542683 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_16330 542735 544000 gene locus_tag LOCUS_16340 542735 544000 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_16340 544006 544944 gene locus_tag LOCUS_16350 544006 544944 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_16350 545451 545690 gene locus_tag LOCUS_16360 545451 545690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 545696 546373 gene locus_tag LOCUS_16370 545696 546373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 546370 547113 gene locus_tag LOCUS_16380 546370 547113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 547467 547829 gene locus_tag LOCUS_16390 547467 547829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 548222 549259 gene locus_tag LOCUS_16400 548222 549259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_16400 549410 550426 gene locus_tag LOCUS_16410 549410 550426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107327.1 protein_id gnl|my_center|LOCUS_16410 550590 551048 gene locus_tag LOCUS_16420 550590 551048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 552406 551210 gene locus_tag LOCUS_16430 552406 551210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 553309 552950 gene locus_tag LOCUS_16440 553309 552950 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_16440 553878 553321 gene locus_tag LOCUS_16450 553878 553321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 554452 553904 gene locus_tag LOCUS_16460 554452 553904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 554812 554519 gene locus_tag LOCUS_16470 554812 554519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 556059 555049 gene locus_tag LOCUS_16480 556059 555049 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_16480 556471 556079 gene locus_tag LOCUS_16490 556471 556079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 556826 557422 gene locus_tag LOCUS_16500 556826 557422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 557802 557428 gene locus_tag LOCUS_16510 557802 557428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 558070 558585 gene locus_tag LOCUS_16520 558070 558585 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_16520 559405 558818 gene locus_tag LOCUS_16530 559405 558818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 561623 560130 gene locus_tag LOCUS_16540 561623 560130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 562304 562086 gene locus_tag LOCUS_16550 562304 562086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 563385 562267 gene locus_tag LOCUS_16560 563385 562267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 566187 563449 gene locus_tag LOCUS_16570 566187 563449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 566717 566178 gene locus_tag LOCUS_16580 566717 566178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 568203 567901 gene locus_tag LOCUS_16590 568203 567901 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_16590 570278 569787 gene locus_tag LOCUS_16600 570278 569787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 570460 570639 gene locus_tag LOCUS_16610 570460 570639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 571201 570644 gene locus_tag LOCUS_16620 571201 570644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 571428 571198 gene locus_tag LOCUS_16630 571428 571198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 573406 574029 gene locus_tag LOCUS_16640 573406 574029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 575655 575903 gene locus_tag LOCUS_16650 575655 575903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 576310 576600 gene locus_tag LOCUS_16660 576310 576600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 576746 577024 gene locus_tag LOCUS_16670 576746 577024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 577036 577569 gene locus_tag LOCUS_16680 577036 577569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 578456 578160 gene locus_tag LOCUS_16690 578456 578160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 578728 578453 gene locus_tag LOCUS_16700 578728 578453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 579601 579149 gene locus_tag LOCUS_16710 579601 579149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16710 580000 579815 gene locus_tag LOCUS_16720 580000 579815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 580332 579997 gene locus_tag LOCUS_16730 580332 579997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 581063 580317 gene locus_tag LOCUS_16740 581063 580317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 581775 581068 gene locus_tag LOCUS_16750 581775 581068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 587804 581997 gene locus_tag LOCUS_16760 587804 581997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 588577 588062 gene locus_tag LOCUS_16770 588577 588062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 589670 589305 gene locus_tag LOCUS_16780 589670 589305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 590185 589784 gene locus_tag LOCUS_16790 590185 589784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 590852 590208 gene locus_tag LOCUS_16800 590852 590208 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_16800 592063 591008 gene locus_tag LOCUS_16810 592063 591008 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067003.1 protein_id gnl|my_center|LOCUS_16810 592797 592267 gene locus_tag LOCUS_16820 592797 592267 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229479.1 protein_id gnl|my_center|LOCUS_16820 594377 592974 gene locus_tag LOCUS_16830 594377 592974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 594793 596106 gene locus_tag LOCUS_16840 594793 596106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 596460 596197 gene locus_tag LOCUS_16850 596460 596197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 597148 596534 gene locus_tag LOCUS_16860 597148 596534 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_16860 597318 597509 gene locus_tag LOCUS_16870 597318 597509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 599319 597772 gene locus_tag LOCUS_16880 599319 597772 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_16880 600109 599672 gene locus_tag LOCUS_16890 600109 599672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 601547 600312 gene locus_tag LOCUS_16900 601547 600312 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197085735.1 protein_id gnl|my_center|LOCUS_16900 601906 601667 gene locus_tag LOCUS_16910 601906 601667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 602282 601992 gene locus_tag LOCUS_16920 602282 601992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16920 604477 602306 gene locus_tag LOCUS_16930 604477 602306 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 606578 604833 gene locus_tag LOCUS_16940 606578 604833 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_16940 607239 609281 gene locus_tag LOCUS_16950 gene paaZ 607239 609281 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096762.1 protein_id gnl|my_center|LOCUS_16950 609502 610266 gene locus_tag LOCUS_16960 609502 610266 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_16960 610270 610881 gene locus_tag LOCUS_16970 610270 610881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 611039 611833 gene locus_tag LOCUS_16980 611039 611833 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_16980 611893 612516 gene locus_tag LOCUS_16990 611893 612516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 612650 614530 gene locus_tag LOCUS_17000 612650 614530 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_17000 614756 616054 gene locus_tag LOCUS_17010 614756 616054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 616070 616711 gene locus_tag LOCUS_17020 gene can 616070 616711 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_17020 618304 616703 gene locus_tag LOCUS_17030 gene ade 618304 616703 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_17030 618927 619427 gene locus_tag LOCUS_17040 618927 619427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 619460 622288 gene locus_tag LOCUS_17050 619460 622288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 622519 622902 gene locus_tag LOCUS_17060 622519 622902 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_17060 622895 623581 gene locus_tag LOCUS_17070 622895 623581 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_17070 623645 624064 gene locus_tag LOCUS_17080 623645 624064 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768138.1 protein_id gnl|my_center|LOCUS_17080 624541 625836 gene locus_tag LOCUS_17090 624541 625836 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_17090 626159 626233 gene locus_tag LOCUS_t00220 626159 626233 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 626247 626330 gene locus_tag LOCUS_t00230 626247 626330 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 626370 626445 gene locus_tag LOCUS_t00240 626370 626445 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 626535 626607 gene locus_tag LOCUS_t00250 626535 626607 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 626736 627932 gene locus_tag LOCUS_17100 gene tuf 626736 627932 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963319.1 protein_id gnl|my_center|LOCUS_17100 628002 628075 gene locus_tag LOCUS_t00260 628002 628075 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 628089 628280 gene locus_tag LOCUS_17110 gene secE 628089 628280 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_17110 628280 628849 gene locus_tag LOCUS_17120 gene nusG 628280 628849 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_17120 628896 629339 gene locus_tag LOCUS_17130 gene rplK 628896 629339 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_17130 629439 630131 gene locus_tag LOCUS_17140 gene rplA 629439 630131 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_17140 630152 630679 gene locus_tag LOCUS_17150 gene rplJ 630152 630679 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_17150 630799 631179 gene locus_tag LOCUS_17160 gene rplL 630799 631179 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963313.1 protein_id gnl|my_center|LOCUS_17160 631436 635257 gene locus_tag LOCUS_17170 gene rpoB 631436 635257 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_17170 635336 639625 gene locus_tag LOCUS_17180 gene rpoC 635336 639625 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_17180 650462 640446 gene locus_tag LOCUS_17190 650462 640446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 650900 652171 gene locus_tag LOCUS_17200 650900 652171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 653064 652363 gene locus_tag LOCUS_17210 653064 652363 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_17210 654301 653072 gene locus_tag LOCUS_17220 654301 653072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 655164 654358 gene locus_tag LOCUS_17230 gene fdhD 655164 654358 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_17230 655258 656157 gene locus_tag LOCUS_17240 gene yedA 655258 656157 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 protein_id gnl|my_center|LOCUS_17240 659193 656365 gene locus_tag LOCUS_17250 659193 656365 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925895.1 protein_id gnl|my_center|LOCUS_17250 660255 659314 gene locus_tag LOCUS_17260 660255 659314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_17260 661358 660252 gene locus_tag LOCUS_17270 661358 660252 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_17270 661706 662461 gene locus_tag LOCUS_17280 661706 662461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 662473 663720 gene locus_tag LOCUS_17290 662473 663720 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_17290 663713 664678 gene locus_tag LOCUS_17300 gene rfaE1 663713 664678 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_17300 665273 667609 gene locus_tag LOCUS_17310 665273 667609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 668124 670493 gene locus_tag LOCUS_17320 668124 670493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 671428 672987 gene locus_tag LOCUS_17330 671428 672987 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_17330 673164 673724 gene locus_tag LOCUS_17340 673164 673724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 673777 676662 gene locus_tag LOCUS_17350 673777 676662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 676975 677349 gene locus_tag LOCUS_17360 gene rpsL 676975 677349 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_17360 677384 677851 gene locus_tag LOCUS_17370 gene rpsG 677384 677851 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_17370 677888 678214 gene locus_tag LOCUS_17380 677888 678214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17380 678383 679864 gene locus_tag LOCUS_17390 678383 679864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17390 679833 680021 gene locus_tag LOCUS_17400 679833 680021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 680389 684315 gene locus_tag LOCUS_17410 680389 684315 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_17410 684704 686410 gene locus_tag LOCUS_17420 684704 686410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 686529 689873 gene locus_tag LOCUS_17430 686529 689873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 689931 695486 gene locus_tag LOCUS_17440 689931 695486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 695545 698157 gene locus_tag LOCUS_17450 695545 698157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 698169 706607 gene locus_tag LOCUS_17460 698169 706607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 707047 707718 gene locus_tag LOCUS_17470 707047 707718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 708029 708562 gene locus_tag LOCUS_17480 708029 708562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 709086 709394 gene locus_tag LOCUS_17490 gene rpsJ 709086 709394 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_17490 709472 710101 gene locus_tag LOCUS_17500 gene rplC 709472 710101 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_17500 710098 710721 gene locus_tag LOCUS_17510 gene rplD 710098 710721 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_17510 710741 711040 gene locus_tag LOCUS_17520 gene rplW 710741 711040 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114354.1 protein_id gnl|my_center|LOCUS_17520 711080 711907 gene locus_tag LOCUS_17530 gene rplB 711080 711907 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_17530 711934 712200 gene locus_tag LOCUS_17540 gene rpsS 711934 712200 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_17540 712239 712598 gene locus_tag LOCUS_17550 gene rplV 712239 712598 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_17550 712629 713417 gene locus_tag LOCUS_17560 gene rpsC 712629 713417 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_17560 713513 713935 gene locus_tag LOCUS_17570 gene rplP 713513 713935 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_17570 713957 714214 gene locus_tag LOCUS_17580 713957 714214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 714257 714520 gene locus_tag LOCUS_17590 gene rpsQ 714257 714520 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_17590 714551 714916 gene locus_tag LOCUS_17600 gene rplN 714551 714916 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_17600 714927 715277 gene locus_tag LOCUS_17610 gene rplX 714927 715277 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_17610 715277 715825 gene locus_tag LOCUS_17620 gene rplE 715277 715825 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_17620 715850 716119 gene locus_tag LOCUS_17630 gene rpsN 715850 716119 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_17630 716166 716570 gene locus_tag LOCUS_17640 gene rpsH 716166 716570 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_17640 716601 717158 gene locus_tag LOCUS_17650 gene rplF 716601 717158 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_17650 717190 717543 gene locus_tag LOCUS_17660 gene rplR 717190 717543 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129924.1 protein_id gnl|my_center|LOCUS_17660 717564 718094 gene locus_tag LOCUS_17670 gene rpsE 717564 718094 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_17670 718103 718285 gene locus_tag LOCUS_17680 gene rpmD 718103 718285 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894509.1 protein_id gnl|my_center|LOCUS_17680 718310 718756 gene locus_tag LOCUS_17690 gene rplO 718310 718756 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_17690 718811 720178 gene locus_tag LOCUS_17700 gene secY 718811 720178 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_17700 720252 721079 gene locus_tag LOCUS_17710 gene map 720252 721079 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_17710 721107 721325 gene locus_tag LOCUS_17720 gene infA 721107 721325 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_17720 721489 721866 gene locus_tag LOCUS_17730 gene rpsM 721489 721866 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_17730 721901 722290 gene locus_tag LOCUS_17740 gene rpsK 721901 722290 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_17740 722324 722935 gene locus_tag LOCUS_17750 gene rpsD 722324 722935 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_17750 722994 723992 gene locus_tag LOCUS_17760 722994 723992 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_17760 724090 724749 gene locus_tag LOCUS_17770 724090 724749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 724940 725572 gene locus_tag LOCUS_17780 724940 725572 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_17780 725932 728073 gene locus_tag LOCUS_17790 725932 728073 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_17790 728268 730055 gene locus_tag LOCUS_17800 728268 730055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 731810 732145 gene locus_tag LOCUS_17810 731810 732145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 732537 733085 gene locus_tag LOCUS_17820 732537 733085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 733220 734041 gene locus_tag LOCUS_17830 733220 734041 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_17830 735012 734053 gene locus_tag LOCUS_17840 735012 734053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 735681 735031 gene locus_tag LOCUS_17850 735681 735031 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_17850 735919 737499 gene locus_tag LOCUS_17860 735919 737499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 738149 737496 gene locus_tag LOCUS_17870 738149 737496 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_17870 738662 739072 gene locus_tag LOCUS_17880 738662 739072 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957986.1 protein_id gnl|my_center|LOCUS_17880 739230 740012 gene locus_tag LOCUS_17890 739230 740012 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_17890 741078 740098 gene locus_tag LOCUS_17900 741078 740098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 741250 741984 gene locus_tag LOCUS_17910 741250 741984 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_17910 743076 742294 gene locus_tag LOCUS_17920 743076 742294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_17920 743322 743077 gene locus_tag LOCUS_17930 743322 743077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 743723 744340 gene locus_tag LOCUS_17940 743723 744340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 745066 745992 gene locus_tag LOCUS_17950 745066 745992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 746569 745985 gene locus_tag LOCUS_17960 746569 745985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 747037 748092 gene locus_tag LOCUS_17970 747037 748092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 748677 748474 gene locus_tag LOCUS_17980 748677 748474 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889079.1 protein_id gnl|my_center|LOCUS_17980 750048 749572 gene locus_tag LOCUS_17990 750048 749572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 750258 750635 gene locus_tag LOCUS_18000 750258 750635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18000 750638 752224 gene locus_tag LOCUS_18010 750638 752224 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18010 752922 752221 gene locus_tag LOCUS_18020 752922 752221 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 755087 753147 gene locus_tag LOCUS_18030 gene scpA 755087 753147 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_18030 755246 756247 gene locus_tag LOCUS_18040 gene aroC 755246 756247 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_18040 756978 756463 gene locus_tag LOCUS_18050 756978 756463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 758010 757279 gene locus_tag LOCUS_18060 758010 757279 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_18060 758384 758689 gene locus_tag LOCUS_18070 758384 758689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 758758 760161 gene locus_tag LOCUS_18080 758758 760161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 760202 761023 gene locus_tag LOCUS_18090 760202 761023 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_18090 764751 761404 gene locus_tag LOCUS_18100 gene mfd 764751 761404 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_18100 765024 765356 gene locus_tag LOCUS_18110 765024 765356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 766681 766010 gene locus_tag LOCUS_18120 766681 766010 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962995.1 protein_id gnl|my_center|LOCUS_18120 767875 766685 gene locus_tag LOCUS_18130 767875 766685 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_18130 768243 767989 gene locus_tag LOCUS_18140 768243 767989 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_18140 768898 768527 gene locus_tag LOCUS_18150 768898 768527 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_18150 769448 770080 gene locus_tag LOCUS_18160 gene pdxH 769448 770080 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_18160 770081 771229 gene locus_tag LOCUS_18170 770081 771229 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065081.1 protein_id gnl|my_center|LOCUS_18170 771406 772509 gene locus_tag LOCUS_18180 gene ribB 771406 772509 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402803.1 protein_id gnl|my_center|LOCUS_18180 772832 772599 gene locus_tag LOCUS_18190 772832 772599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 776354 774270 gene locus_tag LOCUS_18200 776354 774270 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_18200 776908 776357 gene locus_tag LOCUS_18210 776908 776357 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_18210 778075 776942 gene locus_tag LOCUS_18220 gene chrA 778075 776942 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_18220 778463 782038 gene locus_tag LOCUS_18230 gene dnaE 778463 782038 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_18230 782130 782378 gene locus_tag LOCUS_18240 782130 782378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 782947 782441 gene locus_tag LOCUS_18250 782947 782441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 783465 784739 gene locus_tag LOCUS_18260 783465 784739 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_18260 784956 786056 gene locus_tag LOCUS_18270 gene mnmA 784956 786056 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_18270 786097 786831 gene locus_tag LOCUS_18280 786097 786831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 786848 787387 gene locus_tag LOCUS_18290 gene rimM 786848 787387 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_18290 788684 787506 gene locus_tag LOCUS_18300 788684 787506 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_18300 788882 791284 gene locus_tag LOCUS_18310 788882 791284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 791349 791422 gene locus_tag LOCUS_t00270 791349 791422 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 791542 792537 gene locus_tag LOCUS_18320 gene dusB 791542 792537 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_18320 792549 793982 gene locus_tag LOCUS_18330 792549 793982 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_18330 794085 794558 gene locus_tag LOCUS_18340 794085 794558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 794627 794953 gene locus_tag LOCUS_18350 794627 794953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 796103 794988 gene locus_tag LOCUS_18360 796103 794988 CDS product lmo2826 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990083.1 protein_id gnl|my_center|LOCUS_18360 796658 796452 gene locus_tag LOCUS_18370 796658 796452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 801066 796639 gene locus_tag LOCUS_18380 801066 796639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 801476 801916 gene locus_tag LOCUS_18390 801476 801916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 801971 802909 gene locus_tag LOCUS_18400 801971 802909 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_18400 805249 803621 gene locus_tag LOCUS_18410 805249 803621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 807673 805358 gene locus_tag LOCUS_18420 807673 805358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18420 808452 807703 gene locus_tag LOCUS_18430 808452 807703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 808777 809337 gene locus_tag LOCUS_18440 808777 809337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 809321 810583 gene locus_tag LOCUS_18450 809321 810583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 810644 812395 gene locus_tag LOCUS_18460 810644 812395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 812507 813019 gene locus_tag LOCUS_18470 812507 813019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 813965 813237 gene locus_tag LOCUS_18480 813965 813237 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_18480 813988 814320 gene locus_tag LOCUS_18490 813988 814320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18490 814311 814952 gene locus_tag LOCUS_18500 814311 814952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18500 815036 815752 gene locus_tag LOCUS_18510 815036 815752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 815752 816939 gene locus_tag LOCUS_18520 815752 816939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 816942 817937 gene locus_tag LOCUS_18530 816942 817937 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_18530 817943 819277 gene locus_tag LOCUS_18540 817943 819277 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_18540 821436 820792 gene locus_tag LOCUS_18550 821436 820792 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_18550 823995 822079 gene locus_tag LOCUS_18560 gene dnaK 823995 822079 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_18560 825097 824147 gene locus_tag LOCUS_18570 825097 824147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 825287 826102 gene locus_tag LOCUS_18580 gene panB 825287 826102 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_18580 826159 827190 gene locus_tag LOCUS_18590 gene mltG 826159 827190 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_18590 827472 828869 gene locus_tag LOCUS_18600 gene fumC 827472 828869 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_18600 829105 829401 gene locus_tag LOCUS_18610 829105 829401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 830329 829982 gene locus_tag LOCUS_18620 830329 829982 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_18620 830549 830310 gene locus_tag LOCUS_18630 830549 830310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 832399 831110 gene locus_tag LOCUS_18640 832399 831110 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_18640 833785 832907 gene locus_tag LOCUS_18650 833785 832907 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_18650 834027 837224 gene locus_tag LOCUS_18660 834027 837224 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_18660 837252 838826 gene locus_tag LOCUS_18670 837252 838826 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_18670 838850 839899 gene locus_tag LOCUS_18680 838850 839899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 840106 841398 gene locus_tag LOCUS_18690 840106 841398 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_18690 841425 842546 gene locus_tag LOCUS_18700 841425 842546 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_18700 842543 844378 gene locus_tag LOCUS_18710 842543 844378 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_18710 844392 845639 gene locus_tag LOCUS_18720 844392 845639 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_18720 845854 847071 gene locus_tag LOCUS_18730 845854 847071 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_18730 847068 849296 gene locus_tag LOCUS_18740 847068 849296 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_18740 851316 850111 gene locus_tag LOCUS_18750 851316 850111 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204630977.1 protein_id gnl|my_center|LOCUS_18750 851893 851423 gene locus_tag LOCUS_18760 851893 851423 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_18760 852409 851906 gene locus_tag LOCUS_18770 852409 851906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 853324 852629 gene locus_tag LOCUS_18780 853324 852629 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 protein_id gnl|my_center|LOCUS_18780 854945 853383 gene locus_tag LOCUS_18790 854945 853383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 856468 854996 gene locus_tag LOCUS_18800 856468 854996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 856688 856473 gene locus_tag LOCUS_18810 856688 856473 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108348.1 protein_id gnl|my_center|LOCUS_18810 857228 856692 gene locus_tag LOCUS_18820 857228 856692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 857920 857564 gene locus_tag LOCUS_18830 857920 857564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 857946 858287 gene locus_tag LOCUS_18840 857946 858287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 859114 858911 gene locus_tag LOCUS_18850 859114 858911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 859676 859320 gene locus_tag LOCUS_18860 859676 859320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 859995 859669 gene locus_tag LOCUS_18870 859995 859669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 861109 860537 gene locus_tag LOCUS_18880 861109 860537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 861699 861187 gene locus_tag LOCUS_18890 861699 861187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18890 864044 863814 gene locus_tag LOCUS_18900 864044 863814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 864196 864047 gene locus_tag LOCUS_18910 864196 864047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 865683 865540 gene locus_tag LOCUS_18920 865683 865540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence03 1672 1857 gene locus_tag LOCUS_18930 1672 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2068 2244 gene locus_tag LOCUS_18940 2068 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2400 2615 gene locus_tag LOCUS_18950 2400 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18950 2677 2946 gene locus_tag LOCUS_18960 2677 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 3184 3417 gene locus_tag LOCUS_18970 3184 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18970 3369 3632 gene locus_tag LOCUS_18980 3369 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18980 4163 4360 gene locus_tag LOCUS_18990 4163 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 4707 4513 gene locus_tag LOCUS_19000 4707 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19000 5521 5880 gene locus_tag LOCUS_19010 5521 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6994 6440 gene locus_tag LOCUS_19020 6994 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 8267 7035 gene locus_tag LOCUS_19030 8267 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 9811 8489 gene locus_tag LOCUS_19040 9811 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 10644 9892 gene locus_tag LOCUS_19050 10644 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19050 10934 10680 gene locus_tag LOCUS_19060 10934 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 12128 11535 gene locus_tag LOCUS_19070 12128 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 13432 12260 gene locus_tag LOCUS_19080 13432 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 14200 13457 gene locus_tag LOCUS_19090 14200 13457 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_19090 14549 16105 gene locus_tag LOCUS_19100 14549 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 16594 17106 gene locus_tag LOCUS_19110 16594 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 17181 17654 gene locus_tag LOCUS_19120 17181 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 24442 17777 gene locus_tag LOCUS_19130 24442 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 26261 24423 gene locus_tag LOCUS_19140 26261 24423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 26527 26294 gene locus_tag LOCUS_19150 26527 26294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19150 27675 27298 gene locus_tag LOCUS_19160 27675 27298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 29447 28239 gene locus_tag LOCUS_19170 29447 28239 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108952.1 protein_id gnl|my_center|LOCUS_19170 32040 29629 gene locus_tag LOCUS_19180 32040 29629 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_19180 32471 32055 gene locus_tag LOCUS_19190 32471 32055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 33328 32600 gene locus_tag LOCUS_19200 33328 32600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 34672 33380 gene locus_tag LOCUS_19210 34672 33380 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_19210 35343 34669 gene locus_tag LOCUS_19220 35343 34669 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_19220 36518 35472 gene locus_tag LOCUS_19230 36518 35472 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 protein_id gnl|my_center|LOCUS_19230 36672 36920 gene locus_tag LOCUS_19240 36672 36920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 37456 38184 gene locus_tag LOCUS_19250 37456 38184 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_19250 38756 39328 gene locus_tag LOCUS_19260 gene nudK 38756 39328 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_19260 39675 40064 gene locus_tag LOCUS_19270 39675 40064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 40126 40737 gene locus_tag LOCUS_19280 40126 40737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 40749 41153 gene locus_tag LOCUS_19290 40749 41153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 41765 41238 gene locus_tag LOCUS_19300 41765 41238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 41909 42304 gene locus_tag LOCUS_19310 41909 42304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 44113 42716 gene locus_tag LOCUS_19320 44113 42716 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010429677.1 protein_id gnl|my_center|LOCUS_19320 44944 44162 gene locus_tag LOCUS_19330 44944 44162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 45035 45283 gene locus_tag LOCUS_19340 45035 45283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 45288 45605 gene locus_tag LOCUS_19350 gene trxA 45288 45605 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_19350 45675 46133 gene locus_tag LOCUS_19360 45675 46133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 46144 46392 gene locus_tag LOCUS_19370 46144 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963931.1 protein_id gnl|my_center|LOCUS_19370 46694 47623 gene locus_tag LOCUS_19380 46694 47623 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_19380 48199 48579 gene locus_tag LOCUS_19390 48199 48579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 49651 48920 gene locus_tag LOCUS_19400 49651 48920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 50247 49798 gene locus_tag LOCUS_19410 50247 49798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 50930 52018 gene locus_tag LOCUS_19420 50930 52018 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679796.1 protein_id gnl|my_center|LOCUS_19420 52162 54432 gene locus_tag LOCUS_19430 52162 54432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 56596 54863 gene locus_tag LOCUS_19440 56596 54863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_19440 57742 58512 gene locus_tag LOCUS_19450 57742 58512 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_19450 58807 59934 gene locus_tag LOCUS_19460 58807 59934 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_19460 59956 60327 gene locus_tag LOCUS_19470 59956 60327 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496878.1 protein_id gnl|my_center|LOCUS_19470 60415 61074 gene locus_tag LOCUS_19480 60415 61074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 62358 61795 gene locus_tag LOCUS_19490 62358 61795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 64642 62372 gene locus_tag LOCUS_19500 64642 62372 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_19500 64799 65227 gene locus_tag LOCUS_19510 64799 65227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 65540 68599 gene locus_tag LOCUS_19520 65540 68599 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_19520 68618 69049 gene locus_tag LOCUS_19530 gene rpiB 68618 69049 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_19530 69074 70714 gene locus_tag LOCUS_19540 69074 70714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 70718 71419 gene locus_tag LOCUS_19550 gene tsaB 70718 71419 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_19550 71647 71985 gene locus_tag LOCUS_19560 71647 71985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 72238 72540 gene locus_tag LOCUS_19570 72238 72540 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_19570 74357 73122 gene locus_tag LOCUS_19580 gene odhB 74357 73122 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_19580 75025 74609 gene locus_tag LOCUS_19590 75025 74609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 76278 75979 gene locus_tag LOCUS_19600 76278 75979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 76262 76456 gene locus_tag LOCUS_19610 76262 76456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 77707 77123 gene locus_tag LOCUS_19620 gene nadD 77707 77123 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_19620 78253 77720 gene locus_tag LOCUS_19630 78253 77720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19630 78846 78247 gene locus_tag LOCUS_19640 78846 78247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19640 80022 79033 gene locus_tag LOCUS_19650 80022 79033 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_19650 81891 80050 gene locus_tag LOCUS_19660 81891 80050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963720.1 protein_id gnl|my_center|LOCUS_19660 83863 82229 gene locus_tag LOCUS_19670 83863 82229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 85245 83917 gene locus_tag LOCUS_19680 85245 83917 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_19680 87898 86477 gene locus_tag LOCUS_19690 87898 86477 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_19690 89373 88096 gene locus_tag LOCUS_19700 89373 88096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 89892 89383 gene locus_tag LOCUS_19710 89892 89383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 90616 89990 gene locus_tag LOCUS_19720 90616 89990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 90885 93086 gene locus_tag LOCUS_19730 gene bglX 90885 93086 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_19730 93093 93731 gene locus_tag LOCUS_19740 93093 93731 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_19740 93728 95020 gene locus_tag LOCUS_19750 93728 95020 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_19750 95438 95049 gene locus_tag LOCUS_19760 95438 95049 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483188.1 protein_id gnl|my_center|LOCUS_19760 95594 96160 gene locus_tag LOCUS_19770 gene frr 95594 96160 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_19770 96955 98403 gene locus_tag LOCUS_19780 96955 98403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 98393 99487 gene locus_tag LOCUS_19790 98393 99487 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_19790 99787 101175 gene locus_tag LOCUS_19800 99787 101175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 101200 102561 gene locus_tag LOCUS_19810 101200 102561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 103382 102654 gene locus_tag LOCUS_19820 103382 102654 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_19820 104653 104180 gene locus_tag LOCUS_19830 104653 104180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 104930 106921 gene locus_tag LOCUS_19840 104930 106921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 106918 109908 gene locus_tag LOCUS_19850 106918 109908 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_19850 109905 110411 gene locus_tag LOCUS_19860 109905 110411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 110571 112208 gene locus_tag LOCUS_19870 110571 112208 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_19870 114878 112281 gene locus_tag LOCUS_19880 114878 112281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 116785 115793 gene locus_tag LOCUS_19890 116785 115793 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19890 116964 116791 gene locus_tag LOCUS_19900 116964 116791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 117620 118747 gene locus_tag LOCUS_19910 117620 118747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 118958 119971 gene locus_tag LOCUS_19920 118958 119971 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19920 120488 120327 gene locus_tag LOCUS_19930 120488 120327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 121247 120540 gene locus_tag LOCUS_19940 121247 120540 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171029.1 protein_id gnl|my_center|LOCUS_19940 121890 122375 gene locus_tag LOCUS_19950 121890 122375 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_19950 122377 122892 gene locus_tag LOCUS_19960 122377 122892 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_19960 122889 123218 gene locus_tag LOCUS_19970 gene nuoK 122889 123218 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_19970 123226 125109 gene locus_tag LOCUS_19980 gene nuoL 123226 125109 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_19980 125116 126558 gene locus_tag LOCUS_19990 125116 126558 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_19990 127580 126594 gene locus_tag LOCUS_20000 127580 126594 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_20000 127903 127577 gene locus_tag LOCUS_20010 127903 127577 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_20010 128118 127900 gene locus_tag LOCUS_20020 128118 127900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 128676 128308 gene locus_tag LOCUS_20030 128676 128308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 129850 128807 gene locus_tag LOCUS_20040 129850 128807 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_20040 130456 132072 gene locus_tag LOCUS_20050 130456 132072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 132478 132852 gene locus_tag LOCUS_20060 gene phnB 132478 132852 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_20060 133320 133090 gene locus_tag LOCUS_20070 133320 133090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20070 136019 134679 gene locus_tag LOCUS_20080 gene ffh 136019 134679 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_20080 136371 137219 gene locus_tag LOCUS_20090 136371 137219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 137220 137450 gene locus_tag LOCUS_20100 137220 137450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20100 137559 137990 gene locus_tag LOCUS_20110 137559 137990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20110 137992 138318 gene locus_tag LOCUS_20120 137992 138318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 138318 139457 gene locus_tag LOCUS_20130 gene lpxB 138318 139457 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089240244.1 protein_id gnl|my_center|LOCUS_20130 140158 139778 gene locus_tag LOCUS_20140 140158 139778 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_20140 141681 141301 gene locus_tag LOCUS_20150 141681 141301 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_20150 142577 142221 gene locus_tag LOCUS_20160 142577 142221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 144607 143366 gene locus_tag LOCUS_20170 144607 143366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 144884 144672 gene locus_tag LOCUS_20180 144884 144672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 145691 145266 gene locus_tag LOCUS_20190 145691 145266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 145915 145688 gene locus_tag LOCUS_20200 145915 145688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 146898 146011 gene locus_tag LOCUS_20210 gene atpG 146898 146011 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_20210 148566 146980 gene locus_tag LOCUS_20220 gene atpA 148566 146980 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_20220 149135 148593 gene locus_tag LOCUS_20230 gene atpH 149135 148593 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_20230 149678 149169 gene locus_tag LOCUS_20240 gene atpF 149678 149169 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552096.1 protein_id gnl|my_center|LOCUS_20240 149963 149766 gene locus_tag LOCUS_20250 149963 149766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 151713 150532 gene locus_tag LOCUS_20260 gene atpB 151713 150532 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_20260 153315 152848 gene locus_tag LOCUS_20270 153315 152848 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_20270 154207 153404 gene locus_tag LOCUS_20280 154207 153404 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_20280 155828 154848 gene locus_tag LOCUS_20290 gene mutY 155828 154848 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291960.1 protein_id gnl|my_center|LOCUS_20290 156978 156370 gene locus_tag LOCUS_20300 156978 156370 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786945.1 protein_id gnl|my_center|LOCUS_20300 157292 158005 gene locus_tag LOCUS_20310 157292 158005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 159764 158190 gene locus_tag LOCUS_20320 159764 158190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 160968 159901 gene locus_tag LOCUS_20330 160968 159901 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_20330 161267 161037 gene locus_tag LOCUS_20340 161267 161037 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_20340 161370 161798 gene locus_tag LOCUS_20350 161370 161798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 162266 162192 gene locus_tag LOCUS_t00280 162266 162192 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 162898 163716 gene locus_tag LOCUS_20360 162898 163716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 164933 163818 gene locus_tag LOCUS_20370 164933 163818 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_20370 165853 164930 gene locus_tag LOCUS_20380 165853 164930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 167594 166038 gene locus_tag LOCUS_20390 167594 166038 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_20390 167728 168231 gene locus_tag LOCUS_20400 167728 168231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 168236 168964 gene locus_tag LOCUS_20410 gene bshB1 168236 168964 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_20410 170459 169446 gene locus_tag LOCUS_20420 170459 169446 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_20420 170758 171294 gene locus_tag LOCUS_20430 170758 171294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 171363 171887 gene locus_tag LOCUS_20440 171363 171887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 173393 172296 gene locus_tag LOCUS_20450 173393 172296 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_20450 173528 175222 gene locus_tag LOCUS_20460 gene ggt 173528 175222 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_20460 176064 176639 gene locus_tag LOCUS_20470 176064 176639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 178214 176754 gene locus_tag LOCUS_20480 178214 176754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 178404 178658 gene locus_tag LOCUS_20490 178404 178658 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_20490 179659 178718 gene locus_tag LOCUS_20500 179659 178718 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_20500 181119 180532 gene locus_tag LOCUS_20510 181119 180532 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_20510 182723 181425 gene locus_tag LOCUS_20520 182723 181425 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_20520 182989 184440 gene locus_tag LOCUS_20530 182989 184440 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_20530 184483 185394 gene locus_tag LOCUS_20540 184483 185394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 188327 185568 gene locus_tag LOCUS_20550 188327 185568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 189221 188709 gene locus_tag LOCUS_20560 189221 188709 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036581840.1 protein_id gnl|my_center|LOCUS_20560 189673 190503 gene locus_tag LOCUS_20570 189673 190503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 190734 191171 gene locus_tag LOCUS_20580 190734 191171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 191174 192226 gene locus_tag LOCUS_20590 191174 192226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 193163 192453 gene locus_tag LOCUS_20600 193163 192453 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_20600 193788 193156 gene locus_tag LOCUS_20610 193788 193156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 195291 194227 gene locus_tag LOCUS_20620 195291 194227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 195984 195325 gene locus_tag LOCUS_20630 195984 195325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 196780 196124 gene locus_tag LOCUS_20640 196780 196124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 198509 196788 gene locus_tag LOCUS_20650 198509 196788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 199735 198506 gene locus_tag LOCUS_20660 199735 198506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 200559 199822 gene locus_tag LOCUS_20670 200559 199822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 201612 200599 gene locus_tag LOCUS_20680 201612 200599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 202898 201633 gene locus_tag LOCUS_20690 202898 201633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 203809 202898 gene locus_tag LOCUS_20700 203809 202898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 204726 203851 gene locus_tag LOCUS_20710 204726 203851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 207079 204770 gene locus_tag LOCUS_20720 207079 204770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 208462 208115 gene locus_tag LOCUS_20730 gene ssb 208462 208115 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_20730 209453 208989 gene locus_tag LOCUS_20740 209453 208989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 209802 209428 gene locus_tag LOCUS_20750 209802 209428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 210090 209818 gene locus_tag LOCUS_20760 210090 209818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 210824 210144 gene locus_tag LOCUS_20770 210824 210144 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_20770 211780 211229 gene locus_tag LOCUS_20780 211780 211229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_20780 212568 212101 gene locus_tag LOCUS_20790 212568 212101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 213714 212611 gene locus_tag LOCUS_20800 213714 212611 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_20800 214489 215142 gene locus_tag LOCUS_20810 214489 215142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 215698 216600 gene locus_tag LOCUS_20820 215698 216600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 217728 216652 gene locus_tag LOCUS_20830 gene orr 217728 216652 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_20830 218880 217732 gene locus_tag LOCUS_20840 gene alr 218880 217732 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_20840 220003 218873 gene locus_tag LOCUS_20850 220003 218873 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_20850 220581 220147 gene locus_tag LOCUS_20860 220581 220147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 221754 222551 gene locus_tag LOCUS_20870 gene rsbQ 221754 222551 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_20870 222613 222894 gene locus_tag LOCUS_20880 222613 222894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 223873 223658 gene locus_tag LOCUS_20890 223873 223658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20890 224148 223882 gene locus_tag LOCUS_20900 224148 223882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20900 224603 224166 gene locus_tag LOCUS_20910 224603 224166 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_20910 225387 227390 gene locus_tag LOCUS_20920 225387 227390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 227736 227512 gene locus_tag LOCUS_20930 227736 227512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 229950 228088 gene locus_tag LOCUS_20940 gene mnmG 229950 228088 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_20940 230937 230257 gene locus_tag LOCUS_20950 230937 230257 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_20950 232826 230991 gene locus_tag LOCUS_20960 gene glmS 232826 230991 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_20960 234167 232857 gene locus_tag LOCUS_20970 234167 232857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 235013 234201 gene locus_tag LOCUS_20980 235013 234201 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_20980 235538 237316 gene locus_tag LOCUS_20990 235538 237316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 237412 237864 gene locus_tag LOCUS_21000 237412 237864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 237861 239294 gene locus_tag LOCUS_21010 237861 239294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 239916 239581 gene locus_tag LOCUS_21020 239916 239581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 240115 239906 gene locus_tag LOCUS_21030 240115 239906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 241657 240614 gene locus_tag LOCUS_21040 241657 240614 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_21040 243736 241787 gene locus_tag LOCUS_21050 243736 241787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 244685 246343 gene locus_tag LOCUS_21060 gene recN 244685 246343 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_21060 246382 247185 gene locus_tag LOCUS_21070 246382 247185 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_21070 247564 247938 gene locus_tag LOCUS_21080 247564 247938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 248551 249930 gene locus_tag LOCUS_21090 248551 249930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 250015 250545 gene locus_tag LOCUS_21100 250015 250545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 250670 251377 gene locus_tag LOCUS_21110 250670 251377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 251526 252230 gene locus_tag LOCUS_21120 251526 252230 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_21120 252214 253569 gene locus_tag LOCUS_21130 252214 253569 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657969.1 protein_id gnl|my_center|LOCUS_21130 255303 253963 gene locus_tag LOCUS_21140 gene accC 255303 253963 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_21140 255858 255373 gene locus_tag LOCUS_21150 gene accB 255858 255373 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_21150 256463 255900 gene locus_tag LOCUS_21160 gene efp 256463 255900 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_21160 257542 256547 gene locus_tag LOCUS_21170 257542 256547 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_21170 258587 257619 gene locus_tag LOCUS_21180 258587 257619 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_21180 259416 258778 gene locus_tag LOCUS_21190 259416 258778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 259760 261028 gene locus_tag LOCUS_21200 259760 261028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 261961 263483 gene locus_tag LOCUS_r00010 261961 263483 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 263851 263925 gene locus_tag LOCUS_t00290 263851 263925 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 264242 267139 gene locus_tag LOCUS_r00020 264242 267139 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 267341 267449 gene locus_tag LOCUS_r00030 267341 267449 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 267827 270625 gene locus_tag LOCUS_21210 267827 270625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 272048 270783 gene locus_tag LOCUS_21220 272048 270783 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_21220 272420 272911 gene locus_tag LOCUS_21230 272420 272911 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_21230 272938 274293 gene locus_tag LOCUS_21240 gene nuoF 272938 274293 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_21240 274337 275296 gene locus_tag LOCUS_21250 274337 275296 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_21250 275322 276347 gene locus_tag LOCUS_21260 gene nuoH 275322 276347 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_21260 276629 277432 gene locus_tag LOCUS_21270 276629 277432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 279236 277902 gene locus_tag LOCUS_21280 279236 277902 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_21280 279594 279986 gene locus_tag LOCUS_21290 279594 279986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 280063 281103 gene locus_tag LOCUS_21300 gene rlmN 280063 281103 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_21300 283995 281647 gene locus_tag LOCUS_21310 283995 281647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 286412 284031 gene locus_tag LOCUS_21320 286412 284031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 289020 286627 gene locus_tag LOCUS_21330 289020 286627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 290081 289314 gene locus_tag LOCUS_21340 290081 289314 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_21340 290398 292221 gene locus_tag LOCUS_21350 gene typA 290398 292221 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_21350 293038 292718 gene locus_tag LOCUS_21360 293038 292718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 293389 293051 gene locus_tag LOCUS_21370 293389 293051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 293732 293337 gene locus_tag LOCUS_21380 293732 293337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 294180 294416 gene locus_tag LOCUS_21390 294180 294416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 294406 294696 gene locus_tag LOCUS_21400 294406 294696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 295012 295227 gene locus_tag LOCUS_21410 295012 295227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 295217 295543 gene locus_tag LOCUS_21420 295217 295543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 295849 298398 gene locus_tag LOCUS_21430 295849 298398 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_21430 298894 298460 gene locus_tag LOCUS_21440 298894 298460 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_21440 299532 299125 gene locus_tag LOCUS_21450 299532 299125 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_21450 300712 300281 gene locus_tag LOCUS_21460 gene ybeY 300712 300281 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_21460 301132 300728 gene locus_tag LOCUS_21470 gene spoIIAB 301132 300728 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_21470 304497 301129 gene locus_tag LOCUS_21480 304497 301129 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_21480 304755 304591 gene locus_tag LOCUS_21490 304755 304591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 305858 305124 gene locus_tag LOCUS_21500 305858 305124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 306673 305855 gene locus_tag LOCUS_21510 306673 305855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 307111 306689 gene locus_tag LOCUS_21520 307111 306689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 307580 308023 gene locus_tag LOCUS_21530 gene rplM 307580 308023 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902658.1 protein_id gnl|my_center|LOCUS_21530 308037 308423 gene locus_tag LOCUS_21540 gene rpsI 308037 308423 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_21540 308478 309209 gene locus_tag LOCUS_21550 gene rpsB 308478 309209 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_21550 309264 310100 gene locus_tag LOCUS_21560 gene tsf 309264 310100 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_21560 310240 310953 gene locus_tag LOCUS_21570 gene pyrH 310240 310953 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_21570 311261 311647 gene locus_tag LOCUS_21580 gene apaG 311261 311647 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257425.1 protein_id gnl|my_center|LOCUS_21580 312077 313711 gene locus_tag LOCUS_21590 312077 313711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 313831 314412 gene locus_tag LOCUS_21600 313831 314412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 314607 315092 gene locus_tag LOCUS_21610 314607 315092 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_21610 315868 315125 gene locus_tag LOCUS_21620 315868 315125 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_21620 316089 317018 gene locus_tag LOCUS_21630 316089 317018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 317322 317651 gene locus_tag LOCUS_21640 317322 317651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 317706 318440 gene locus_tag LOCUS_21650 317706 318440 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_21650 318722 319756 gene locus_tag LOCUS_21660 318722 319756 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_21660 319916 319722 gene locus_tag LOCUS_21670 319916 319722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 319894 320880 gene locus_tag LOCUS_21680 319894 320880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 321529 322830 gene locus_tag LOCUS_21690 321529 322830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 323824 324213 gene locus_tag LOCUS_21700 323824 324213 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_21700 324289 324747 gene locus_tag LOCUS_21710 324289 324747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 325440 325207 gene locus_tag LOCUS_21720 325440 325207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 325820 325479 gene locus_tag LOCUS_21730 gene ssb 325820 325479 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_21730 326425 327591 gene locus_tag LOCUS_21740 gene ltaE 326425 327591 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_21740 327617 328162 gene locus_tag LOCUS_21750 327617 328162 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_21750 328219 328698 gene locus_tag LOCUS_21760 328219 328698 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_21760 329593 330132 gene locus_tag LOCUS_21770 329593 330132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 330116 330379 gene locus_tag LOCUS_21780 330116 330379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 330392 331030 gene locus_tag LOCUS_21790 330392 331030 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258672.1 protein_id gnl|my_center|LOCUS_21790 331229 332008 gene locus_tag LOCUS_21800 331229 332008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 332561 333166 gene locus_tag LOCUS_21810 332561 333166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_21810 333202 333654 gene locus_tag LOCUS_21820 333202 333654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965831.1 protein_id gnl|my_center|LOCUS_21820 333694 335421 gene locus_tag LOCUS_21830 333694 335421 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_21830 335627 336049 gene locus_tag LOCUS_21840 335627 336049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 336288 337067 gene locus_tag LOCUS_21850 336288 337067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 337064 339172 gene locus_tag LOCUS_21860 337064 339172 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038090.1 protein_id gnl|my_center|LOCUS_21860 339279 339677 gene locus_tag LOCUS_21870 339279 339677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 339772 340278 gene locus_tag LOCUS_21880 339772 340278 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_21880 340448 341182 gene locus_tag LOCUS_21890 340448 341182 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_21890 341279 342166 gene locus_tag LOCUS_21900 341279 342166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 342296 343030 gene locus_tag LOCUS_21910 342296 343030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 343127 344680 gene locus_tag LOCUS_21920 343127 344680 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_21920 344670 345941 gene locus_tag LOCUS_21930 344670 345941 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922229.1 protein_id gnl|my_center|LOCUS_21930 345946 346440 gene locus_tag LOCUS_21940 345946 346440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21940 346437 347975 gene locus_tag LOCUS_21950 346437 347975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207299.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 347978 348472 gene locus_tag LOCUS_21960 347978 348472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 348448 351867 gene locus_tag LOCUS_21970 348448 351867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 351873 352631 gene locus_tag LOCUS_21980 351873 352631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 352633 353448 gene locus_tag LOCUS_21990 352633 353448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 353555 354277 gene locus_tag LOCUS_22000 353555 354277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 355466 354351 gene locus_tag LOCUS_22010 gene leuB 355466 354351 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_22010 356068 355478 gene locus_tag LOCUS_22020 gene leuD 356068 355478 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_22020 357566 356160 gene locus_tag LOCUS_22030 gene leuC 357566 356160 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072959918.1 protein_id gnl|my_center|LOCUS_22030 358875 357712 gene locus_tag LOCUS_22040 358875 357712 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_22040 359057 360595 gene locus_tag LOCUS_22050 359057 360595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 361198 366345 gene locus_tag LOCUS_22060 361198 366345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 366338 368608 gene locus_tag LOCUS_22070 366338 368608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 369015 370346 gene locus_tag LOCUS_22080 369015 370346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 370509 371849 gene locus_tag LOCUS_22090 370509 371849 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048151.1 protein_id gnl|my_center|LOCUS_22090 372257 373474 gene locus_tag LOCUS_22100 372257 373474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 373531 374220 gene locus_tag LOCUS_22110 373531 374220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 375644 377050 gene locus_tag LOCUS_22120 375644 377050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 378212 377583 gene locus_tag LOCUS_22130 gene can 378212 377583 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_22130 378687 379055 gene locus_tag LOCUS_22140 378687 379055 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_22140 379062 380360 gene locus_tag LOCUS_22150 379062 380360 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_22150 380357 380911 gene locus_tag LOCUS_22160 380357 380911 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_22160 380954 381793 gene locus_tag LOCUS_22170 380954 381793 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_22170 381879 383222 gene locus_tag LOCUS_22180 381879 383222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 384385 383231 gene locus_tag LOCUS_22190 gene bshA 384385 383231 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_22190 384596 385432 gene locus_tag LOCUS_22200 384596 385432 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_22200 385554 386264 gene locus_tag LOCUS_22210 385554 386264 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_22210 386777 387751 gene locus_tag LOCUS_22220 386777 387751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 387690 388415 gene locus_tag LOCUS_22230 387690 388415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 388421 388774 gene locus_tag LOCUS_22240 388421 388774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 393187 390563 gene locus_tag LOCUS_22250 393187 390563 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_22250 393884 393345 gene locus_tag LOCUS_22260 393884 393345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 394105 396426 gene locus_tag LOCUS_22270 gene pbpC 394105 396426 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_22270 396655 397092 gene locus_tag LOCUS_22280 396655 397092 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_22280 397716 397210 gene locus_tag LOCUS_22290 397716 397210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 398755 398006 gene locus_tag LOCUS_22300 398755 398006 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_22300 398985 399485 gene locus_tag LOCUS_22310 gene resA 398985 399485 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_22310 399601 400398 gene locus_tag LOCUS_22320 399601 400398 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_22320 400404 401162 gene locus_tag LOCUS_22330 400404 401162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_22330 401344 402786 gene locus_tag LOCUS_22340 401344 402786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 403291 402887 gene locus_tag LOCUS_22350 403291 402887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 405883 404207 gene locus_tag LOCUS_22360 405883 404207 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_22360 406465 406956 gene locus_tag LOCUS_22370 406465 406956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 407419 407781 gene locus_tag LOCUS_22380 gene ndhC 407419 407781 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_22380 407820 408362 gene locus_tag LOCUS_22390 407820 408362 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_22390 408364 408870 gene locus_tag LOCUS_22400 408364 408870 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_22400 408879 410198 gene locus_tag LOCUS_22410 408879 410198 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_22410 411192 410356 gene locus_tag LOCUS_22420 411192 410356 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_22420 412149 411217 gene locus_tag LOCUS_22430 412149 411217 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_22430 412454 412149 gene locus_tag LOCUS_22440 412454 412149 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963681.1 protein_id gnl|my_center|LOCUS_22440 412648 413103 gene locus_tag LOCUS_22450 412648 413103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 413105 413521 gene locus_tag LOCUS_22460 413105 413521 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_22460 414120 414722 gene locus_tag LOCUS_22470 414120 414722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 415612 415133 gene locus_tag LOCUS_22480 415612 415133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 416421 415606 gene locus_tag LOCUS_22490 416421 415606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22490 417629 416493 gene locus_tag LOCUS_22500 gene carA 417629 416493 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_22500 418275 417718 gene locus_tag LOCUS_22510 418275 417718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 420047 418437 gene locus_tag LOCUS_22520 420047 418437 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_22520 420730 420209 gene locus_tag LOCUS_22530 420730 420209 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_22530 421687 420803 gene locus_tag LOCUS_22540 421687 420803 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_22540 422835 421810 gene locus_tag LOCUS_22550 422835 421810 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_22550 424002 422878 gene locus_tag LOCUS_22560 424002 422878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_22560 426620 424209 gene locus_tag LOCUS_22570 gene lon 426620 424209 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_22570 427639 426959 gene locus_tag LOCUS_22580 427639 426959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 428347 427754 gene locus_tag LOCUS_22590 428347 427754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 429784 428369 gene locus_tag LOCUS_22600 429784 428369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_22600 430000 430674 gene locus_tag LOCUS_22610 430000 430674 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_22610 433905 430759 gene locus_tag LOCUS_22620 433905 430759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 434107 434883 gene locus_tag LOCUS_22630 434107 434883 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237263.1 protein_id gnl|my_center|LOCUS_22630 434896 435345 gene locus_tag LOCUS_22640 434896 435345 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_22640 436152 435340 gene locus_tag LOCUS_22650 436152 435340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 436207 437514 gene locus_tag LOCUS_22660 436207 437514 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_22660 438014 438562 gene locus_tag LOCUS_22670 438014 438562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 439275 440624 gene locus_tag LOCUS_22680 439275 440624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 440997 442664 gene locus_tag LOCUS_22690 gene asnB 440997 442664 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_22690 443061 444587 gene locus_tag LOCUS_22700 443061 444587 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_22700 444776 445969 gene locus_tag LOCUS_22710 444776 445969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 446345 445989 gene locus_tag LOCUS_22720 446345 445989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 447676 447005 gene locus_tag LOCUS_22730 447676 447005 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947707.1 protein_id gnl|my_center|LOCUS_22730 448367 447654 gene locus_tag LOCUS_22740 448367 447654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 448988 449395 gene locus_tag LOCUS_22750 448988 449395 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790233.1 protein_id gnl|my_center|LOCUS_22750 449915 449472 gene locus_tag LOCUS_22760 449915 449472 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021829.1 protein_id gnl|my_center|LOCUS_22760 452665 450437 gene locus_tag LOCUS_22770 452665 450437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 453131 452679 gene locus_tag LOCUS_22780 453131 452679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 453412 453128 gene locus_tag LOCUS_22790 453412 453128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 454027 453560 gene locus_tag LOCUS_22800 454027 453560 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_22800 454990 454370 gene locus_tag LOCUS_22810 454990 454370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 457247 455649 gene locus_tag LOCUS_22820 gene pckA 457247 455649 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_22820 457600 458865 gene locus_tag LOCUS_22830 gene gltP 457600 458865 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208293.1 protein_id gnl|my_center|LOCUS_22830 459309 461897 gene locus_tag LOCUS_22840 459309 461897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 462813 463871 gene locus_tag LOCUS_22850 462813 463871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 464113 464532 gene locus_tag LOCUS_22860 464113 464532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 464522 467761 gene locus_tag LOCUS_22870 464522 467761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 467749 469767 gene locus_tag LOCUS_22880 467749 469767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 469829 472198 gene locus_tag LOCUS_22890 469829 472198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 472231 472710 gene locus_tag LOCUS_22900 472231 472710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 472689 474257 gene locus_tag LOCUS_22910 472689 474257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 474347 475576 gene locus_tag LOCUS_22920 474347 475576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 475586 476623 gene locus_tag LOCUS_22930 475586 476623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 476793 477245 gene locus_tag LOCUS_22940 476793 477245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 477342 477737 gene locus_tag LOCUS_22950 477342 477737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 477740 478387 gene locus_tag LOCUS_22960 477740 478387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 478759 478986 gene locus_tag LOCUS_22970 478759 478986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 479213 479995 gene locus_tag LOCUS_22980 479213 479995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 481074 481709 gene locus_tag LOCUS_22990 481074 481709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 481667 482617 gene locus_tag LOCUS_23000 481667 482617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 482979 483209 gene locus_tag LOCUS_23010 482979 483209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 483206 483541 gene locus_tag LOCUS_23020 483206 483541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 485754 484462 gene locus_tag LOCUS_23030 485754 484462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23030 486684 485767 gene locus_tag LOCUS_23040 486684 485767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23040 487655 487882 gene locus_tag LOCUS_23050 487655 487882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 489270 488713 gene locus_tag LOCUS_23060 489270 488713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 489841 489536 gene locus_tag LOCUS_23070 489841 489536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 490882 490685 gene locus_tag LOCUS_23080 490882 490685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence04 473 1624 gene locus_tag LOCUS_23090 473 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 8088 2023 gene locus_tag LOCUS_23100 8088 2023 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_23100 8998 8744 gene locus_tag LOCUS_23110 8998 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 9197 9000 gene locus_tag LOCUS_23120 9197 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 9393 11483 gene locus_tag LOCUS_23130 9393 11483 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657449.1 protein_id gnl|my_center|LOCUS_23130 11746 13080 gene locus_tag LOCUS_23140 gene purB 11746 13080 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_23140 14183 13077 gene locus_tag LOCUS_23150 14183 13077 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_23150 14746 14459 gene locus_tag LOCUS_23160 14746 14459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 14843 15535 gene locus_tag LOCUS_23170 gene ung 14843 15535 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206598.1 protein_id gnl|my_center|LOCUS_23170 16585 18057 gene locus_tag LOCUS_23180 16585 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 18129 19262 gene locus_tag LOCUS_23190 18129 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 19207 20244 gene locus_tag LOCUS_23200 19207 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 20342 21484 gene locus_tag LOCUS_23210 20342 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 22479 22108 gene locus_tag LOCUS_23220 22479 22108 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_23220 24741 22582 gene locus_tag LOCUS_23230 gene metG 24741 22582 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_23230 25633 26292 gene locus_tag LOCUS_23240 25633 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 26289 28229 gene locus_tag LOCUS_23250 26289 28229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 30123 28282 gene locus_tag LOCUS_23260 gene uvrC 30123 28282 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_23260 31186 30128 gene locus_tag LOCUS_23270 31186 30128 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_23270 31940 32935 gene locus_tag LOCUS_23280 31940 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 33507 32971 gene locus_tag LOCUS_23290 gene rsmD 33507 32971 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_23290 34340 33504 gene locus_tag LOCUS_23300 34340 33504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 34447 35448 gene locus_tag LOCUS_23310 gene tsaD 34447 35448 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_23310 36500 39880 gene locus_tag LOCUS_23320 36500 39880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_23320 40057 40449 gene locus_tag LOCUS_23330 40057 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 41968 40754 gene locus_tag LOCUS_23340 41968 40754 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_23340 42263 44695 gene locus_tag LOCUS_23350 42263 44695 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_23350 44719 44919 gene locus_tag LOCUS_23360 44719 44919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 45092 45256 gene locus_tag LOCUS_23370 45092 45256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 46910 45453 gene locus_tag LOCUS_23380 46910 45453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 48373 47192 gene locus_tag LOCUS_23390 48373 47192 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_23390 49300 48452 gene locus_tag LOCUS_23400 49300 48452 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_23400 49813 49310 gene locus_tag LOCUS_23410 49813 49310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 50204 49791 gene locus_tag LOCUS_23420 50204 49791 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_23420 52378 51134 gene locus_tag LOCUS_23430 gene ilvA 52378 51134 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_23430 53424 52381 gene locus_tag LOCUS_23440 gene ilvC 53424 52381 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962615.1 protein_id gnl|my_center|LOCUS_23440 54066 53479 gene locus_tag LOCUS_23450 gene ilvN 54066 53479 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_23450 55830 54067 gene locus_tag LOCUS_23460 gene ilvB 55830 54067 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_23460 57704 56025 gene locus_tag LOCUS_23470 gene ilvD 57704 56025 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905837.1 protein_id gnl|my_center|LOCUS_23470 58902 58162 gene locus_tag LOCUS_23480 58902 58162 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_23480 59826 58960 gene locus_tag LOCUS_23490 59826 58960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23490 61340 59730 gene locus_tag LOCUS_23500 61340 59730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23500 62079 62576 gene locus_tag LOCUS_23510 62079 62576 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_23510 63420 64319 gene locus_tag LOCUS_23520 gene tatC 63420 64319 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_23520 64359 64808 gene locus_tag LOCUS_23530 64359 64808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 66869 65757 gene locus_tag LOCUS_23540 66869 65757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 67428 67877 gene locus_tag LOCUS_23550 67428 67877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 67883 69379 gene locus_tag LOCUS_23560 67883 69379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 69482 69865 gene locus_tag LOCUS_23570 69482 69865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 70435 71223 gene locus_tag LOCUS_23580 70435 71223 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_23580 71230 71907 gene locus_tag LOCUS_23590 71230 71907 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_23590 72464 73513 gene locus_tag LOCUS_23600 72464 73513 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_23600 74182 73514 gene locus_tag LOCUS_23610 74182 73514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 74760 75035 gene locus_tag LOCUS_23620 74760 75035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 76082 74961 gene locus_tag LOCUS_23630 76082 74961 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_23630 76134 76313 gene locus_tag LOCUS_23640 76134 76313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 77168 76560 gene locus_tag LOCUS_23650 77168 76560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23650 78102 77224 gene locus_tag LOCUS_23660 78102 77224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23660 78626 82288 gene locus_tag LOCUS_23670 gene metH 78626 82288 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_23670 82725 83078 gene locus_tag LOCUS_23680 82725 83078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 83084 84631 gene locus_tag LOCUS_23690 83084 84631 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199604.1 protein_id gnl|my_center|LOCUS_23690 84628 85740 gene locus_tag LOCUS_23700 84628 85740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 85742 86929 gene locus_tag LOCUS_23710 85742 86929 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061285.1 protein_id gnl|my_center|LOCUS_23710 86916 87686 gene locus_tag LOCUS_23720 86916 87686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 87775 88080 gene locus_tag LOCUS_23730 87775 88080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23730 88089 89066 gene locus_tag LOCUS_23740 88089 89066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23740 89090 90022 gene locus_tag LOCUS_23750 89090 90022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23750 90041 90313 gene locus_tag LOCUS_23760 90041 90313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 90526 91068 gene locus_tag LOCUS_23770 90526 91068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964282.1 protein_id gnl|my_center|LOCUS_23770 91403 92068 gene locus_tag LOCUS_23780 91403 92068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 92799 93026 gene locus_tag LOCUS_23790 92799 93026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 93019 93474 gene locus_tag LOCUS_23800 93019 93474 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_23800 93520 94131 gene locus_tag LOCUS_23810 93520 94131 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_23810 94572 94997 gene locus_tag LOCUS_23820 94572 94997 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085998.1 protein_id gnl|my_center|LOCUS_23820 95006 96349 gene locus_tag LOCUS_23830 95006 96349 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_23830 96828 97604 gene locus_tag LOCUS_23840 gene nirQ 96828 97604 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_23840 97606 99150 gene locus_tag LOCUS_23850 97606 99150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 99089 99367 gene locus_tag LOCUS_23860 99089 99367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23860 99348 99974 gene locus_tag LOCUS_23870 99348 99974 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_23870 99976 100215 gene locus_tag LOCUS_23880 99976 100215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 100577 101560 gene locus_tag LOCUS_23890 100577 101560 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920871.1 protein_id gnl|my_center|LOCUS_23890 101745 102242 gene locus_tag LOCUS_23900 101745 102242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 102682 102446 gene locus_tag LOCUS_23910 102682 102446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 102998 102684 gene locus_tag LOCUS_23920 102998 102684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 103273 103010 gene locus_tag LOCUS_23930 103273 103010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 103490 103263 gene locus_tag LOCUS_23940 103490 103263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 104916 103492 gene locus_tag LOCUS_23950 104916 103492 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_23950 106289 105660 gene locus_tag LOCUS_23960 106289 105660 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_23960 106635 107738 gene locus_tag LOCUS_23970 106635 107738 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_23970 108473 109558 gene locus_tag LOCUS_23980 108473 109558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 109555 110814 gene locus_tag LOCUS_23990 109555 110814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_23990 110815 111498 gene locus_tag LOCUS_24000 110815 111498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963072.1 protein_id gnl|my_center|LOCUS_24000 111578 112348 gene locus_tag LOCUS_24010 111578 112348 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_24010 112812 114164 gene locus_tag LOCUS_24020 112812 114164 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_24020 114293 114649 gene locus_tag LOCUS_24030 114293 114649 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_24030 114646 114960 gene locus_tag LOCUS_24040 114646 114960 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_24040 115069 115758 gene locus_tag LOCUS_24050 115069 115758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 115976 119206 gene locus_tag LOCUS_24060 115976 119206 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_24060 119337 120041 gene locus_tag LOCUS_24070 119337 120041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24070 120053 120532 gene locus_tag LOCUS_24080 120053 120532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 120586 120861 gene locus_tag LOCUS_24090 120586 120861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24090 120996 122468 gene locus_tag LOCUS_24100 120996 122468 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861436.1 protein_id gnl|my_center|LOCUS_24100 122606 124939 gene locus_tag LOCUS_24110 122606 124939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 125386 127299 gene locus_tag LOCUS_24120 125386 127299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 127657 128040 gene locus_tag LOCUS_24130 127657 128040 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_24130 128056 128703 gene locus_tag LOCUS_24140 128056 128703 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460488.1 protein_id gnl|my_center|LOCUS_24140 128728 129396 gene locus_tag LOCUS_24150 128728 129396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 129719 131116 gene locus_tag LOCUS_24160 129719 131116 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_24160 131276 132736 gene locus_tag LOCUS_24170 131276 132736 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 protein_id gnl|my_center|LOCUS_24170 133141 134289 gene locus_tag LOCUS_24180 gene nhaA 133141 134289 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_24180 134342 135037 gene locus_tag LOCUS_24190 134342 135037 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964078.1 protein_id gnl|my_center|LOCUS_24190 135613 135224 gene locus_tag LOCUS_24200 135613 135224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 135879 135610 gene locus_tag LOCUS_24210 135879 135610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 136984 135854 gene locus_tag LOCUS_24220 136984 135854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24220 137710 137246 gene locus_tag LOCUS_24230 137710 137246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 138023 138832 gene locus_tag LOCUS_24240 gene kdsA 138023 138832 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_24240 138836 140413 gene locus_tag LOCUS_24250 138836 140413 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_24250 141115 140789 gene locus_tag LOCUS_24260 141115 140789 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_24260 141677 141258 gene locus_tag LOCUS_24270 gene iscU 141677 141258 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_24270 142965 141745 gene locus_tag LOCUS_24280 142965 141745 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_24280 143081 144049 gene locus_tag LOCUS_24290 143081 144049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 144521 144240 gene locus_tag LOCUS_24300 144521 144240 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946538.1 protein_id gnl|my_center|LOCUS_24300 148232 145545 gene locus_tag LOCUS_24310 148232 145545 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_24310 148406 149827 gene locus_tag LOCUS_24320 148406 149827 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_24320 151093 150170 gene locus_tag LOCUS_24330 151093 150170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 151698 151360 gene locus_tag LOCUS_24340 151698 151360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24340 152726 151674 gene locus_tag LOCUS_24350 152726 151674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24350 153644 152742 gene locus_tag LOCUS_24360 153644 152742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 155319 153628 gene locus_tag LOCUS_24370 155319 153628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 156134 155412 gene locus_tag LOCUS_24380 156134 155412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 156440 156153 gene locus_tag LOCUS_24390 156440 156153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 157646 156447 gene locus_tag LOCUS_24400 157646 156447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 157956 157657 gene locus_tag LOCUS_24410 157956 157657 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_24410 158222 160273 gene locus_tag LOCUS_24420 158222 160273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 160469 164824 gene locus_tag LOCUS_24430 160469 164824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 168741 165250 gene locus_tag LOCUS_24440 168741 165250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 171028 168743 gene locus_tag LOCUS_24450 171028 168743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 171458 171288 gene locus_tag LOCUS_24460 171458 171288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 172378 171473 gene locus_tag LOCUS_24470 172378 171473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 176312 172380 gene locus_tag LOCUS_24480 176312 172380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 176764 176309 gene locus_tag LOCUS_24490 176764 176309 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_24490 178594 176777 gene locus_tag LOCUS_24500 178594 176777 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_24500 179247 178597 gene locus_tag LOCUS_24510 179247 178597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 179423 179250 gene locus_tag LOCUS_24520 179423 179250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 179942 179436 gene locus_tag LOCUS_24530 179942 179436 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_24530 180394 179945 gene locus_tag LOCUS_24540 180394 179945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 180965 180513 gene locus_tag LOCUS_24550 180965 180513 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_24550 182647 181007 gene locus_tag LOCUS_24560 182647 181007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 183944 182931 gene locus_tag LOCUS_24570 183944 182931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 184734 184222 gene locus_tag LOCUS_24580 184734 184222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 184943 184731 gene locus_tag LOCUS_24590 184943 184731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 186621 185053 gene locus_tag LOCUS_24600 186621 185053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 187178 186621 gene locus_tag LOCUS_24610 187178 186621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 188145 187123 gene locus_tag LOCUS_24620 188145 187123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 190291 188147 gene locus_tag LOCUS_24630 190291 188147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 191501 190575 gene locus_tag LOCUS_24640 191501 190575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 192458 191502 gene locus_tag LOCUS_24650 192458 191502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 192505 193110 gene locus_tag LOCUS_24660 192505 193110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 193316 198565 gene locus_tag LOCUS_24670 193316 198565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 198645 199595 gene locus_tag LOCUS_24680 198645 199595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 199598 199822 gene locus_tag LOCUS_24690 199598 199822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 199831 200553 gene locus_tag LOCUS_24700 199831 200553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 200544 201164 gene locus_tag LOCUS_24710 200544 201164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24710 201168 204161 gene locus_tag LOCUS_24720 201168 204161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 205326 204691 gene locus_tag LOCUS_24730 205326 204691 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_24730 206344 205337 gene locus_tag LOCUS_24740 206344 205337 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_24740 206822 206403 gene locus_tag LOCUS_24750 206822 206403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 208150 206906 gene locus_tag LOCUS_24760 gene rimO 208150 206906 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_24760 208378 209046 gene locus_tag LOCUS_24770 208378 209046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 209315 210331 gene locus_tag LOCUS_24780 209315 210331 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_24780 211138 210488 gene locus_tag LOCUS_24790 211138 210488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_24790 211665 211237 gene locus_tag LOCUS_24800 211665 211237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 211861 212481 gene locus_tag LOCUS_24810 211861 212481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 214341 212554 gene locus_tag LOCUS_24820 214341 212554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24820 215449 214307 gene locus_tag LOCUS_24830 215449 214307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24830 216371 216832 gene locus_tag LOCUS_24840 216371 216832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 217717 217055 gene locus_tag LOCUS_24850 217717 217055 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_24850 219147 218272 gene locus_tag LOCUS_24860 219147 218272 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 protein_id gnl|my_center|LOCUS_24860 221262 219151 gene locus_tag LOCUS_24870 221262 219151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_24870 221864 221610 gene locus_tag LOCUS_24880 221864 221610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 221989 223116 gene locus_tag LOCUS_24890 221989 223116 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_24890 224079 223447 gene locus_tag LOCUS_24900 224079 223447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 225916 224117 gene locus_tag LOCUS_24910 gene lepA 225916 224117 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_24910 226116 227621 gene locus_tag LOCUS_24920 226116 227621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 227782 228486 gene locus_tag LOCUS_24930 gene clpP 227782 228486 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_24930 228559 229797 gene locus_tag LOCUS_24940 gene clpX 228559 229797 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_24940 229798 230529 gene locus_tag LOCUS_24950 gene truA 229798 230529 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_24950 230795 230526 gene locus_tag LOCUS_24960 230795 230526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 231721 231164 gene locus_tag LOCUS_24970 231721 231164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 231938 232273 gene locus_tag LOCUS_24980 231938 232273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 232279 232653 gene locus_tag LOCUS_24990 232279 232653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 232664 233122 gene locus_tag LOCUS_25000 232664 233122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 233189 233932 gene locus_tag LOCUS_25010 233189 233932 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_25010 234033 234431 gene locus_tag LOCUS_25020 234033 234431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 234428 234589 gene locus_tag LOCUS_25030 234428 234589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 234905 234621 gene locus_tag LOCUS_25040 234905 234621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 235713 235021 gene locus_tag LOCUS_25050 235713 235021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 236580 235732 gene locus_tag LOCUS_25060 236580 235732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 237607 236603 gene locus_tag LOCUS_25070 237607 236603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 240145 237788 gene locus_tag LOCUS_25080 240145 237788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 240455 241051 gene locus_tag LOCUS_25090 240455 241051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 241292 242557 gene locus_tag LOCUS_25100 241292 242557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 242557 243339 gene locus_tag LOCUS_25110 242557 243339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 243679 244254 gene locus_tag LOCUS_25120 243679 244254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 244312 249051 gene locus_tag LOCUS_25130 244312 249051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 249910 249566 gene locus_tag LOCUS_25140 gene rplT 249910 249566 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_25140 250211 250014 gene locus_tag LOCUS_25150 gene rpmI 250211 250014 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_25150 251502 250912 gene locus_tag LOCUS_25160 gene infC 251502 250912 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_25160 253297 251699 gene locus_tag LOCUS_25170 253297 251699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 254027 253419 gene locus_tag LOCUS_25180 254027 253419 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 protein_id gnl|my_center|LOCUS_25180 254524 254126 gene locus_tag LOCUS_25190 254524 254126 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_25190 254667 255998 gene locus_tag LOCUS_25200 254667 255998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 256449 256126 gene locus_tag LOCUS_25210 256449 256126 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_25210 256697 256440 gene locus_tag LOCUS_25220 256697 256440 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_25220 257118 260459 gene locus_tag LOCUS_25230 gene ileS 257118 260459 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_25230 263716 260765 gene locus_tag LOCUS_25240 263716 260765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 264327 263896 gene locus_tag LOCUS_25250 264327 263896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_25250 265118 264600 gene locus_tag LOCUS_25260 265118 264600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 266053 265154 gene locus_tag LOCUS_25270 266053 265154 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564975.1 protein_id gnl|my_center|LOCUS_25270 267224 266061 gene locus_tag LOCUS_25280 267224 266061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 268638 267814 gene locus_tag LOCUS_25290 268638 267814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 269340 268813 gene locus_tag LOCUS_25300 269340 268813 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_25300 269961 269416 gene locus_tag LOCUS_25310 269961 269416 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_25310 270217 271038 gene locus_tag LOCUS_25320 270217 271038 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_25320 272029 274140 gene locus_tag LOCUS_25330 272029 274140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 274381 275871 gene locus_tag LOCUS_25340 274381 275871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 276296 276502 gene locus_tag LOCUS_25350 276296 276502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 276499 276951 gene locus_tag LOCUS_25360 276499 276951 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_25360 278301 276967 gene locus_tag LOCUS_25370 278301 276967 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_25370 279419 278556 gene locus_tag LOCUS_25380 279419 278556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 279961 279470 gene locus_tag LOCUS_25390 279961 279470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 282927 280582 gene locus_tag LOCUS_25400 282927 280582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 283067 284359 gene locus_tag LOCUS_25410 283067 284359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 286076 285267 gene locus_tag LOCUS_25420 286076 285267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 protein_id gnl|my_center|LOCUS_25420 286628 286083 gene locus_tag LOCUS_25430 286628 286083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 287847 286780 gene locus_tag LOCUS_25440 287847 286780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 289483 287915 gene locus_tag LOCUS_25450 289483 287915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 290547 289522 gene locus_tag LOCUS_25460 290547 289522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 291260 290559 gene locus_tag LOCUS_25470 291260 290559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 291628 291948 gene locus_tag LOCUS_25480 291628 291948 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_25480 293686 292913 gene locus_tag LOCUS_25490 gene lpxA 293686 292913 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_25490 295083 293686 gene locus_tag LOCUS_25500 295083 293686 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_25500 296205 295159 gene locus_tag LOCUS_25510 gene lpxD 296205 295159 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_25510 297467 296319 gene locus_tag LOCUS_25520 gene nspC 297467 296319 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_25520 298951 297755 gene locus_tag LOCUS_25530 298951 297755 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_25530 299183 300124 gene locus_tag LOCUS_25540 299183 300124 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_25540 300157 301344 gene locus_tag LOCUS_25550 gene kbl 300157 301344 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_25550 301393 302979 gene locus_tag LOCUS_25560 gene bshC 301393 302979 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_25560 304295 303444 gene locus_tag LOCUS_25570 gene accD 304295 303444 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_25570 304513 305235 gene locus_tag LOCUS_25580 gene dapB 304513 305235 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_25580 307013 305979 gene locus_tag LOCUS_25590 gene porV 307013 305979 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_25590 311179 307295 gene locus_tag LOCUS_25600 gene porU 311179 307295 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_25600 311602 312615 gene locus_tag LOCUS_25610 311602 312615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 312846 314345 gene locus_tag LOCUS_25620 gene gldJ 312846 314345 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_25620 314415 315689 gene locus_tag LOCUS_25630 314415 315689 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_25630 316730 315669 gene locus_tag LOCUS_25640 316730 315669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 316869 318602 gene locus_tag LOCUS_25650 316869 318602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 318714 319928 gene locus_tag LOCUS_25660 318714 319928 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_25660 319952 321127 gene locus_tag LOCUS_25670 319952 321127 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_25670 322343 321138 gene locus_tag LOCUS_25680 322343 321138 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_25680 324197 322440 gene locus_tag LOCUS_25690 324197 322440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 324983 324327 gene locus_tag LOCUS_25700 324983 324327 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_25700 325119 326420 gene locus_tag LOCUS_25710 gene der 325119 326420 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_25710 326422 326973 gene locus_tag LOCUS_25720 gene rfbC 326422 326973 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_25720 326995 327876 gene locus_tag LOCUS_25730 gene rfbD 326995 327876 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_25730 327877 328653 gene locus_tag LOCUS_25740 327877 328653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 328623 329159 gene locus_tag LOCUS_25750 328623 329159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 330252 330464 gene locus_tag LOCUS_25760 330252 330464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 330458 331084 gene locus_tag LOCUS_25770 330458 331084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 331081 331335 gene locus_tag LOCUS_25780 331081 331335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 331611 332549 gene locus_tag LOCUS_25790 331611 332549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 332739 333761 gene locus_tag LOCUS_25800 332739 333761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 333847 334533 gene locus_tag LOCUS_25810 333847 334533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 334578 334859 gene locus_tag LOCUS_25820 334578 334859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 334893 335168 gene locus_tag LOCUS_25830 334893 335168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 335208 335483 gene locus_tag LOCUS_25840 335208 335483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 336077 337369 gene locus_tag LOCUS_25850 336077 337369 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_25850 337715 338731 gene locus_tag LOCUS_25860 337715 338731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 338982 340187 gene locus_tag LOCUS_25870 338982 340187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 340930 340238 gene locus_tag LOCUS_25880 340930 340238 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_25880 341321 342265 gene locus_tag LOCUS_25890 341321 342265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25890 342259 343542 gene locus_tag LOCUS_25900 342259 343542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25900 343572 344684 gene locus_tag LOCUS_25910 343572 344684 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_25910 345407 344826 gene locus_tag LOCUS_25920 345407 344826 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_25920 346021 345395 gene locus_tag LOCUS_25930 346021 345395 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_25930 346392 347153 gene locus_tag LOCUS_25940 346392 347153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 347233 348132 gene locus_tag LOCUS_25950 gene lipA 347233 348132 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_25950 348199 350358 gene locus_tag LOCUS_25960 348199 350358 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_25960 352784 351351 gene locus_tag LOCUS_25970 352784 351351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 353795 352857 gene locus_tag LOCUS_25980 353795 352857 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_25980 354277 353792 gene locus_tag LOCUS_25990 gene pyrR 354277 353792 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_25990 355478 354456 gene locus_tag LOCUS_26000 355478 354456 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26000 355671 355375 gene locus_tag LOCUS_26010 355671 355375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 356279 355731 gene locus_tag LOCUS_26020 356279 355731 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_26020 357302 356310 gene locus_tag LOCUS_26030 357302 356310 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_26030 357971 357456 gene locus_tag LOCUS_26040 357971 357456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 359593 358433 gene locus_tag LOCUS_26050 359593 358433 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_26050 360038 359733 gene locus_tag LOCUS_26060 360038 359733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 361944 360472 gene locus_tag LOCUS_26070 361944 360472 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_26070 362150 363145 gene locus_tag LOCUS_26080 362150 363145 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_26080 366034 363239 gene locus_tag LOCUS_26090 366034 363239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 366414 366701 gene locus_tag LOCUS_26100 366414 366701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 366829 368310 gene locus_tag LOCUS_26110 gene cls 366829 368310 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435010.1 protein_id gnl|my_center|LOCUS_26110 371738 368520 gene locus_tag LOCUS_26120 371738 368520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 374554 371837 gene locus_tag LOCUS_26130 374554 371837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 375237 374641 gene locus_tag LOCUS_26140 375237 374641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 375841 375377 gene locus_tag LOCUS_26150 375841 375377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence05 2406 2059 gene locus_tag LOCUS_26160 2406 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 7136 7333 gene locus_tag LOCUS_26170 7136 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 9245 9451 gene locus_tag LOCUS_26180 9245 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26180 9482 10159 gene locus_tag LOCUS_26190 9482 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26190 10929 11846 gene locus_tag LOCUS_26200 10929 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 11864 13234 gene locus_tag LOCUS_26210 11864 13234 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_26210 15217 14186 gene locus_tag LOCUS_26220 15217 14186 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963737.1 protein_id gnl|my_center|LOCUS_26220 15362 15841 gene locus_tag LOCUS_26230 15362 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 16136 16909 gene locus_tag LOCUS_26240 16136 16909 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_26240 20134 17135 gene locus_tag LOCUS_26250 20134 17135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 22035 20143 gene locus_tag LOCUS_26260 22035 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 23002 22121 gene locus_tag LOCUS_26270 23002 22121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 23118 24164 gene locus_tag LOCUS_26280 23118 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 24251 24694 gene locus_tag LOCUS_26290 24251 24694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 26246 25149 gene locus_tag LOCUS_26300 26246 25149 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_26300 26728 27735 gene locus_tag LOCUS_26310 26728 27735 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_26310 28579 30153 gene locus_tag LOCUS_26320 28579 30153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26320 30157 30696 gene locus_tag LOCUS_26330 30157 30696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 30878 31102 gene locus_tag LOCUS_26340 30878 31102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 31099 31305 gene locus_tag LOCUS_26350 31099 31305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 31500 34271 gene locus_tag LOCUS_26360 31500 34271 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 protein_id gnl|my_center|LOCUS_26360 35079 37583 gene locus_tag LOCUS_26370 35079 37583 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_26370 37901 38674 gene locus_tag LOCUS_26380 37901 38674 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186441.1 protein_id gnl|my_center|LOCUS_26380 38828 41398 gene locus_tag LOCUS_26390 38828 41398 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_26390 42401 41520 gene locus_tag LOCUS_26400 42401 41520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 43042 42398 gene locus_tag LOCUS_26410 43042 42398 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_26410 43937 43026 gene locus_tag LOCUS_26420 43937 43026 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_26420 44255 44542 gene locus_tag LOCUS_26430 44255 44542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 44552 45277 gene locus_tag LOCUS_26440 gene aat 44552 45277 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947494.1 protein_id gnl|my_center|LOCUS_26440 46171 45509 gene locus_tag LOCUS_26450 46171 45509 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 protein_id gnl|my_center|LOCUS_26450 51371 46365 gene locus_tag LOCUS_26460 51371 46365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 52085 51432 gene locus_tag LOCUS_26470 52085 51432 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_26470 52910 52092 gene locus_tag LOCUS_26480 52910 52092 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_26480 53827 52907 gene locus_tag LOCUS_26490 53827 52907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 53974 54720 gene locus_tag LOCUS_26500 53974 54720 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_26500 55033 58242 gene locus_tag LOCUS_26510 55033 58242 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_26510 58253 59683 gene locus_tag LOCUS_26520 58253 59683 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_26520 59809 60762 gene locus_tag LOCUS_26530 59809 60762 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_26530 60851 61063 gene locus_tag LOCUS_26540 60851 61063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 61121 61654 gene locus_tag LOCUS_26550 61121 61654 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784365.1 protein_id gnl|my_center|LOCUS_26550 62783 61656 gene locus_tag LOCUS_26560 gene dprA 62783 61656 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_26560 62897 63178 gene locus_tag LOCUS_26570 62897 63178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 63305 63544 gene locus_tag LOCUS_26580 63305 63544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 63549 64523 gene locus_tag LOCUS_26590 63549 64523 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_26590 65106 65567 gene locus_tag LOCUS_26600 65106 65567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 66221 65634 gene locus_tag LOCUS_26610 66221 65634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 66696 66232 gene locus_tag LOCUS_26620 66696 66232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 68729 66714 gene locus_tag LOCUS_26630 68729 66714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 69768 68887 gene locus_tag LOCUS_26640 69768 68887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 70826 69768 gene locus_tag LOCUS_26650 70826 69768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 74492 71064 gene locus_tag LOCUS_26660 74492 71064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 77391 75265 gene locus_tag LOCUS_26670 77391 75265 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_26670 77595 78437 gene locus_tag LOCUS_26680 77595 78437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 78464 79546 gene locus_tag LOCUS_26690 78464 79546 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_26690 79629 80381 gene locus_tag LOCUS_26700 79629 80381 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_26700 80469 81386 gene locus_tag LOCUS_26710 80469 81386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 81855 83234 gene locus_tag LOCUS_26720 81855 83234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 85340 83316 gene locus_tag LOCUS_26730 85340 83316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 85534 86607 gene locus_tag LOCUS_26740 85534 86607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 86645 87247 gene locus_tag LOCUS_26750 gene gldD 86645 87247 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_26750 87290 87772 gene locus_tag LOCUS_26760 87290 87772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 87735 89102 gene locus_tag LOCUS_26770 87735 89102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 90699 89635 gene locus_tag LOCUS_26780 gene aroB 90699 89635 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_26780 91418 91110 gene locus_tag LOCUS_26790 91418 91110 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_26790 93437 91848 gene locus_tag LOCUS_26800 93437 91848 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_26800 94219 93686 gene locus_tag LOCUS_26810 gene msrA 94219 93686 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_26810 94393 94707 gene locus_tag LOCUS_26820 94393 94707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 94747 95106 gene locus_tag LOCUS_26830 94747 95106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 95305 95790 gene locus_tag LOCUS_26840 95305 95790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 95844 96551 gene locus_tag LOCUS_26850 95844 96551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 96660 97364 gene locus_tag LOCUS_26860 96660 97364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 97451 98509 gene locus_tag LOCUS_26870 97451 98509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 99845 101629 gene locus_tag LOCUS_26880 99845 101629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 101736 102188 gene locus_tag LOCUS_26890 101736 102188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 102267 103730 gene locus_tag LOCUS_26900 102267 103730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 104317 105402 gene locus_tag LOCUS_26910 104317 105402 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_26910 105423 105914 gene locus_tag LOCUS_26920 105423 105914 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706473.1 protein_id gnl|my_center|LOCUS_26920 105957 106361 gene locus_tag LOCUS_26930 105957 106361 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_26930 106372 107043 gene locus_tag LOCUS_26940 106372 107043 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_26940 107642 108796 gene locus_tag LOCUS_26950 107642 108796 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_26950 108848 109972 gene locus_tag LOCUS_26960 gene hppD 108848 109972 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_26960 110738 112426 gene locus_tag LOCUS_26970 110738 112426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 114203 112530 gene locus_tag LOCUS_26980 114203 112530 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_26980 115312 114371 gene locus_tag LOCUS_26990 gene hemF 115312 114371 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_26990 116349 115321 gene locus_tag LOCUS_27000 gene hemE 116349 115321 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_27000 117046 116342 gene locus_tag LOCUS_27010 117046 116342 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_27010 117944 117027 gene locus_tag LOCUS_27020 gene hemC 117944 117027 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_27020 119224 117986 gene locus_tag LOCUS_27030 gene hemA 119224 117986 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_27030 119251 119469 gene locus_tag LOCUS_27040 119251 119469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 119596 120609 gene locus_tag LOCUS_27050 gene hemH 119596 120609 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_27050 120892 123063 gene locus_tag LOCUS_27060 120892 123063 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_27060 123099 123608 gene locus_tag LOCUS_27070 123099 123608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 123619 124083 gene locus_tag LOCUS_27080 123619 124083 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_27080 126822 124696 gene locus_tag LOCUS_27090 126822 124696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 128498 127464 gene locus_tag LOCUS_27100 gene thiL 128498 127464 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_27100 129176 128499 gene locus_tag LOCUS_27110 129176 128499 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_27110 129349 129176 gene locus_tag LOCUS_27120 129349 129176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 130952 129405 gene locus_tag LOCUS_27130 130952 129405 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_27130 134062 131441 gene locus_tag LOCUS_27140 134062 131441 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_27140 134320 135678 gene locus_tag LOCUS_27150 gene ampG 134320 135678 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098484.1 protein_id gnl|my_center|LOCUS_27150 135785 136531 gene locus_tag LOCUS_27160 135785 136531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 136790 138673 gene locus_tag LOCUS_27170 136790 138673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 139423 140076 gene locus_tag LOCUS_27180 139423 140076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 140733 141674 gene locus_tag LOCUS_27190 140733 141674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 141746 142273 gene locus_tag LOCUS_27200 141746 142273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 143607 146453 gene locus_tag LOCUS_27210 gene uvrA 143607 146453 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_27210 147071 147226 gene locus_tag LOCUS_27220 147071 147226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 148242 147265 gene locus_tag LOCUS_27230 148242 147265 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_27230 149833 148229 gene locus_tag LOCUS_27240 149833 148229 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_27240 150181 150939 gene locus_tag LOCUS_27250 gene rsmA 150181 150939 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_27250 150952 151398 gene locus_tag LOCUS_27260 150952 151398 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_27260 151717 152196 gene locus_tag LOCUS_27270 151717 152196 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_27270 152467 153051 gene locus_tag LOCUS_27280 152467 153051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 153312 154388 gene locus_tag LOCUS_27290 gene pdxA 153312 154388 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_27290 156514 154943 gene locus_tag LOCUS_27300 156514 154943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 157053 158063 gene locus_tag LOCUS_27310 gene lpxK 157053 158063 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_27310 159640 158204 gene locus_tag LOCUS_27320 gene rlmD 159640 158204 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_27320 161104 160151 gene locus_tag LOCUS_27330 161104 160151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 162460 161339 gene locus_tag LOCUS_27340 162460 161339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 163002 163442 gene locus_tag LOCUS_27350 163002 163442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_27350 164267 163854 gene locus_tag LOCUS_27360 164267 163854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27360 165265 164249 gene locus_tag LOCUS_27370 165265 164249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27370 166285 165266 gene locus_tag LOCUS_27380 gene obgE 166285 165266 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_27380 167103 166459 gene locus_tag LOCUS_27390 167103 166459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 168198 170870 gene locus_tag LOCUS_27400 gene clpB 168198 170870 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_27400 171643 172017 gene locus_tag LOCUS_27410 171643 172017 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_27410 172277 172852 gene locus_tag LOCUS_27420 172277 172852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 172836 173741 gene locus_tag LOCUS_27430 172836 173741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 173760 176729 gene locus_tag LOCUS_27440 173760 176729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 176786 179731 gene locus_tag LOCUS_27450 176786 179731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 180058 179864 gene locus_tag LOCUS_27460 180058 179864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 180057 182339 gene locus_tag LOCUS_27470 180057 182339 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_27470 182641 183123 gene locus_tag LOCUS_27480 182641 183123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 183120 185525 gene locus_tag LOCUS_27490 183120 185525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 185567 185854 gene locus_tag LOCUS_27500 185567 185854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 186149 189184 gene locus_tag LOCUS_27510 186149 189184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 189301 190296 gene locus_tag LOCUS_27520 189301 190296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 190458 192080 gene locus_tag LOCUS_27530 190458 192080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 192135 193181 gene locus_tag LOCUS_27540 192135 193181 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_27540 193890 193243 gene locus_tag LOCUS_27550 193890 193243 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408415.1 protein_id gnl|my_center|LOCUS_27550 194682 193894 gene locus_tag LOCUS_27560 194682 193894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 196040 195339 gene locus_tag LOCUS_27570 196040 195339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 196362 197369 gene locus_tag LOCUS_27580 196362 197369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 200321 197679 gene locus_tag LOCUS_27590 200321 197679 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_27590 201234 200413 gene locus_tag LOCUS_27600 201234 200413 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_27600 202374 201517 gene locus_tag LOCUS_27610 gene ygiD 202374 201517 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_27610 206092 203030 gene locus_tag LOCUS_27620 gene sbcC 206092 203030 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698867.1 protein_id gnl|my_center|LOCUS_27620 207221 206079 gene locus_tag LOCUS_27630 207221 206079 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_27630 208331 207720 gene locus_tag LOCUS_27640 208331 207720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 208870 208577 gene locus_tag LOCUS_27650 208870 208577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 209362 208880 gene locus_tag LOCUS_27660 209362 208880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 209743 209450 gene locus_tag LOCUS_27670 209743 209450 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_27670 210002 209754 gene locus_tag LOCUS_27680 210002 209754 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_27680 210163 212019 gene locus_tag LOCUS_27690 210163 212019 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_27690 212277 212498 gene locus_tag LOCUS_27700 212277 212498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 212495 212968 gene locus_tag LOCUS_27710 212495 212968 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_27710 213291 214100 gene locus_tag LOCUS_27720 213291 214100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_27720 214666 214271 gene locus_tag LOCUS_27730 214666 214271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 215589 214681 gene locus_tag LOCUS_27740 215589 214681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_27740 216120 215737 gene locus_tag LOCUS_27750 216120 215737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 218265 216403 gene locus_tag LOCUS_27760 218265 216403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 219997 218300 gene locus_tag LOCUS_27770 219997 218300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 221288 220470 gene locus_tag LOCUS_27780 221288 220470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 222175 221288 gene locus_tag LOCUS_27790 222175 221288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 222648 222199 gene locus_tag LOCUS_27800 222648 222199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 223493 222645 gene locus_tag LOCUS_27810 223493 222645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 224307 223510 gene locus_tag LOCUS_27820 224307 223510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 225150 224308 gene locus_tag LOCUS_27830 225150 224308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 225579 225349 gene locus_tag LOCUS_27840 225579 225349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 226501 230967 gene locus_tag LOCUS_27850 226501 230967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 231218 232093 gene locus_tag LOCUS_27860 231218 232093 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_27860 232191 233528 gene locus_tag LOCUS_27870 232191 233528 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_27870 234620 233754 gene locus_tag LOCUS_27880 234620 233754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 237350 234810 gene locus_tag LOCUS_27890 237350 234810 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_27890 237548 238351 gene locus_tag LOCUS_27900 237548 238351 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_27900 239235 239972 gene locus_tag LOCUS_27910 239235 239972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 240118 241506 gene locus_tag LOCUS_27920 240118 241506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 242595 241996 gene locus_tag LOCUS_27930 242595 241996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 243761 242604 gene locus_tag LOCUS_27940 243761 242604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27940 243965 245602 gene locus_tag LOCUS_27950 243965 245602 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_27950 246018 245653 gene locus_tag LOCUS_27960 246018 245653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 246435 246052 gene locus_tag LOCUS_27970 246435 246052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 246868 246512 gene locus_tag LOCUS_27980 246868 246512 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_27980 247959 246871 gene locus_tag LOCUS_27990 247959 246871 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047054668.1 protein_id gnl|my_center|LOCUS_27990 250147 248294 gene locus_tag LOCUS_28000 gene hscA 250147 248294 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261362.1 protein_id gnl|my_center|LOCUS_28000 250530 251153 gene locus_tag LOCUS_28010 250530 251153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 251331 251804 gene locus_tag LOCUS_28020 251331 251804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 251828 253066 gene locus_tag LOCUS_28030 gene nusA 251828 253066 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_28030 253211 256114 gene locus_tag LOCUS_28040 gene infB 253211 256114 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012779652.1 protein_id gnl|my_center|LOCUS_28040 256469 257731 gene locus_tag LOCUS_28050 256469 257731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 257728 257925 gene locus_tag LOCUS_28060 257728 257925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 257927 259312 gene locus_tag LOCUS_28070 257927 259312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 259258 259650 gene locus_tag LOCUS_28080 259258 259650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 259647 260426 gene locus_tag LOCUS_28090 259647 260426 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094988.1 protein_id gnl|my_center|LOCUS_28090 260752 261150 gene locus_tag LOCUS_28100 260752 261150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 261612 263483 gene locus_tag LOCUS_28110 261612 263483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 263955 264134 gene locus_tag LOCUS_28120 263955 264134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 264140 265399 gene locus_tag LOCUS_28130 264140 265399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 265284 267974 gene locus_tag LOCUS_28140 265284 267974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 268482 269144 gene locus_tag LOCUS_28150 268482 269144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 269141 269533 gene locus_tag LOCUS_28160 269141 269533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 269602 270606 gene locus_tag LOCUS_28170 269602 270606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 270701 274978 gene locus_tag LOCUS_28180 270701 274978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 275119 276909 gene locus_tag LOCUS_28190 275119 276909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 277003 277650 gene locus_tag LOCUS_28200 277003 277650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 278149 277961 gene locus_tag LOCUS_28210 278149 277961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 278415 279083 gene locus_tag LOCUS_28220 278415 279083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 279435 279160 gene locus_tag LOCUS_28230 279435 279160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28230 279668 279381 gene locus_tag LOCUS_28240 279668 279381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28240 279856 280206 gene locus_tag LOCUS_28250 279856 280206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 280240 280437 gene locus_tag LOCUS_28260 280240 280437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 281125 282126 gene locus_tag LOCUS_28270 281125 282126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 282253 282882 gene locus_tag LOCUS_28280 282253 282882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 282879 284009 gene locus_tag LOCUS_28290 282879 284009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 284418 284762 gene locus_tag LOCUS_28300 284418 284762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28300 284876 286330 gene locus_tag LOCUS_28310 284876 286330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 286417 286839 gene locus_tag LOCUS_28320 286417 286839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 286728 287462 gene locus_tag LOCUS_28330 286728 287462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 287437 288120 gene locus_tag LOCUS_28340 287437 288120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 288721 288948 gene locus_tag LOCUS_28350 288721 288948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 289394 289816 gene locus_tag LOCUS_28360 289394 289816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28360 290466 291122 gene locus_tag LOCUS_28370 290466 291122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 292332 291472 gene locus_tag LOCUS_28380 292332 291472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 292604 292347 gene locus_tag LOCUS_28390 292604 292347 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_28390 294361 293135 gene locus_tag LOCUS_28400 294361 293135 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_28400 295134 294406 gene locus_tag LOCUS_28410 gene mazG 295134 294406 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_28410 296293 295715 gene locus_tag LOCUS_28420 296293 295715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 296803 298602 gene locus_tag LOCUS_28430 296803 298602 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_28430 298895 299716 gene locus_tag LOCUS_28440 298895 299716 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_28440 299724 300296 gene locus_tag LOCUS_28450 299724 300296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 300266 300544 gene locus_tag LOCUS_28460 300266 300544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 300643 301407 gene locus_tag LOCUS_28470 300643 301407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 301412 302515 gene locus_tag LOCUS_28480 301412 302515 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_28480 302522 303928 gene locus_tag LOCUS_28490 302522 303928 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_28490 304366 305463 gene locus_tag LOCUS_28500 304366 305463 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_28500 305474 306709 gene locus_tag LOCUS_28510 305474 306709 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_28510 306912 308012 gene locus_tag LOCUS_28520 306912 308012 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223621.1 protein_id gnl|my_center|LOCUS_28520 308344 309252 gene locus_tag LOCUS_28530 308344 309252 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_28530 309392 310306 gene locus_tag LOCUS_28540 309392 310306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 310328 311029 gene locus_tag LOCUS_28550 gene purQ 310328 311029 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_28550 313509 311632 gene locus_tag LOCUS_28560 gene htpG 313509 311632 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_28560 313939 315072 gene locus_tag LOCUS_28570 313939 315072 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_28570 315094 316797 gene locus_tag LOCUS_28580 gene ricT 315094 316797 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_28580 316820 318223 gene locus_tag LOCUS_28590 gene lpdA 316820 318223 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_28590 318566 319201 gene locus_tag LOCUS_28600 318566 319201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 322287 319381 gene locus_tag LOCUS_28610 322287 319381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 322547 323872 gene locus_tag LOCUS_28620 322547 323872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 324615 325331 gene locus_tag LOCUS_28630 324615 325331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 325450 325692 gene locus_tag LOCUS_28640 325450 325692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 326016 327050 gene locus_tag LOCUS_28650 326016 327050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 327266 328069 gene locus_tag LOCUS_28660 327266 328069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 328319 328462 gene locus_tag LOCUS_28670 328319 328462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 328640 328449 gene locus_tag LOCUS_28680 328640 328449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 328612 329076 gene locus_tag LOCUS_28690 328612 329076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 329332 330105 gene locus_tag LOCUS_28700 329332 330105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 330106 330369 gene locus_tag LOCUS_28710 330106 330369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 330712 330377 gene locus_tag LOCUS_28720 330712 330377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 331099 330713 gene locus_tag LOCUS_28730 331099 330713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 333576 331096 gene locus_tag LOCUS_28740 333576 331096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 334903 335643 gene locus_tag LOCUS_28750 334903 335643 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_28750 335889 336242 gene locus_tag LOCUS_28760 335889 336242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 336405 337133 gene locus_tag LOCUS_28770 336405 337133 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963857.1 protein_id gnl|my_center|LOCUS_28770 337467 337673 gene locus_tag LOCUS_28780 337467 337673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 337718 338479 gene locus_tag LOCUS_28790 337718 338479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28790 338714 338490 gene locus_tag LOCUS_28800 338714 338490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 338972 339283 gene locus_tag LOCUS_28810 338972 339283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 339280 340191 gene locus_tag LOCUS_28820 339280 340191 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966630.1 protein_id gnl|my_center|LOCUS_28820 340195 341871 gene locus_tag LOCUS_28830 340195 341871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 342098 342391 gene locus_tag LOCUS_28840 342098 342391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 342388 343404 gene locus_tag LOCUS_28850 342388 343404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 345773 343710 gene locus_tag LOCUS_28860 345773 343710 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_28860 346398 348530 gene locus_tag LOCUS_28870 346398 348530 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_28870 348699 349061 gene locus_tag LOCUS_28880 348699 349061 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764746.1 protein_id gnl|my_center|LOCUS_28880 352137 351268 gene locus_tag LOCUS_28890 352137 351268 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_28890 352447 352830 gene locus_tag LOCUS_28900 352447 352830 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763744.1 protein_id gnl|my_center|LOCUS_28900 352883 354331 gene locus_tag LOCUS_28910 352883 354331 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_28910 355014 356204 gene locus_tag LOCUS_28920 355014 356204 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence06 <1 819 gene locus_tag LOCUS_28930 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114171.1:VanW family protein 1022 1483 gene locus_tag LOCUS_28940 1022 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28940 2096 3550 gene locus_tag LOCUS_28950 2096 3550 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_28950 3674 4693 gene locus_tag LOCUS_28960 3674 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 4690 6135 gene locus_tag LOCUS_28970 4690 6135 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_28970 6238 8556 gene locus_tag LOCUS_28980 6238 8556 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_28980 9021 9380 gene locus_tag LOCUS_28990 9021 9380 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_28990 9370 9690 gene locus_tag LOCUS_29000 9370 9690 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_29000 9764 10786 gene locus_tag LOCUS_29010 9764 10786 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765036.1 protein_id gnl|my_center|LOCUS_29010 11264 11503 gene locus_tag LOCUS_29020 11264 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 11500 11880 gene locus_tag LOCUS_29030 11500 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 12488 13768 gene locus_tag LOCUS_29040 12488 13768 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_29040 13960 14865 gene locus_tag LOCUS_29050 13960 14865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064981.1 protein_id gnl|my_center|LOCUS_29050 14866 15654 gene locus_tag LOCUS_29060 14866 15654 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228359.1 protein_id gnl|my_center|LOCUS_29060 16180 17208 gene locus_tag LOCUS_29070 16180 17208 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_29070 18029 19006 gene locus_tag LOCUS_29080 18029 19006 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434862.1 protein_id gnl|my_center|LOCUS_29080 19801 22143 gene locus_tag LOCUS_29090 19801 22143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 22836 23741 gene locus_tag LOCUS_29100 22836 23741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064981.1 protein_id gnl|my_center|LOCUS_29100 23742 24530 gene locus_tag LOCUS_29110 23742 24530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228359.1 protein_id gnl|my_center|LOCUS_29110 25102 25521 gene locus_tag LOCUS_29120 25102 25521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 26086 26655 gene locus_tag LOCUS_29130 26086 26655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 26606 26869 gene locus_tag LOCUS_29140 26606 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 27005 27391 gene locus_tag LOCUS_29150 27005 27391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29150 27400 27954 gene locus_tag LOCUS_29160 27400 27954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29160 28072 28653 gene locus_tag LOCUS_29170 28072 28653 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_29170 28931 29356 gene locus_tag LOCUS_29180 28931 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 29629 29477 gene locus_tag LOCUS_29190 29629 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 29767 30270 gene locus_tag LOCUS_29200 29767 30270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 30751 31377 gene locus_tag LOCUS_29210 30751 31377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 31495 32916 gene locus_tag LOCUS_29220 31495 32916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 33135 33968 gene locus_tag LOCUS_29230 33135 33968 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265971.1 protein_id gnl|my_center|LOCUS_29230 34041 34595 gene locus_tag LOCUS_29240 34041 34595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 35260 37449 gene locus_tag LOCUS_29250 35260 37449 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_29250 37542 37745 gene locus_tag LOCUS_29260 37542 37745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 37971 38615 gene locus_tag LOCUS_29270 37971 38615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 38612 39610 gene locus_tag LOCUS_29280 38612 39610 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_29280 39691 41328 gene locus_tag LOCUS_29290 39691 41328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 41344 42687 gene locus_tag LOCUS_29300 41344 42687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 49928 42912 gene locus_tag LOCUS_29310 49928 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 55485 50653 gene locus_tag LOCUS_29320 55485 50653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 56090 57490 gene locus_tag LOCUS_29330 gene xdhA 56090 57490 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640539.1 protein_id gnl|my_center|LOCUS_29330 57477 58517 gene locus_tag LOCUS_29340 57477 58517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29340 58505 59635 gene locus_tag LOCUS_29350 58505 59635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29350 59735 60709 gene locus_tag LOCUS_29360 59735 60709 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_29360 60952 60844 gene locus_tag LOCUS_r00040 60952 60844 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 64051 61153 gene locus_tag LOCUS_r00050 64051 61153 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 64436 64362 gene locus_tag LOCUS_t00300 64436 64362 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 66074 64555 gene locus_tag LOCUS_r00060 66074 64555 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 66877 67260 gene locus_tag LOCUS_29370 66877 67260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29370 67302 67574 gene locus_tag LOCUS_29380 67302 67574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29380 67761 68456 gene locus_tag LOCUS_29390 67761 68456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_29390 68740 69894 gene locus_tag LOCUS_29400 68740 69894 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_29400 69958 70620 gene locus_tag LOCUS_29410 69958 70620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_29410 72207 70660 gene locus_tag LOCUS_29420 72207 70660 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_29420 73001 72405 gene locus_tag LOCUS_29430 gene purN 73001 72405 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_29430 73492 72998 gene locus_tag LOCUS_29440 73492 72998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 73953 73492 gene locus_tag LOCUS_29450 73953 73492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29450 75127 73931 gene locus_tag LOCUS_29460 gene coaBC 75127 73931 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_29460 75513 75181 gene locus_tag LOCUS_29470 75513 75181 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_29470 76285 75476 gene locus_tag LOCUS_29480 gene bamD 76285 75476 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_29480 77902 76496 gene locus_tag LOCUS_29490 77902 76496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 78294 78764 gene locus_tag LOCUS_29500 gene coaD 78294 78764 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_29500 78983 80620 gene locus_tag LOCUS_29510 gene pruA 78983 80620 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_29510 81749 81366 gene locus_tag LOCUS_29520 81749 81366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 82172 81756 gene locus_tag LOCUS_29530 82172 81756 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_29530 82987 82466 gene locus_tag LOCUS_29540 82987 82466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29540 83229 82891 gene locus_tag LOCUS_29550 83229 82891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29550 84497 83415 gene locus_tag LOCUS_29560 gene bioB 84497 83415 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_29560 84686 85204 gene locus_tag LOCUS_29570 84686 85204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 85210 85710 gene locus_tag LOCUS_29580 85210 85710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 85741 87153 gene locus_tag LOCUS_29590 85741 87153 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_29590 88621 87950 gene locus_tag LOCUS_29600 88621 87950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 89292 88672 gene locus_tag LOCUS_29610 89292 88672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 89774 89346 gene locus_tag LOCUS_29620 89774 89346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 91544 90405 gene locus_tag LOCUS_29630 91544 90405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 92710 91541 gene locus_tag LOCUS_29640 92710 91541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 94584 92857 gene locus_tag LOCUS_29650 94584 92857 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_29650 95659 95012 gene locus_tag LOCUS_29660 95659 95012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 96416 95835 gene locus_tag LOCUS_29670 96416 95835 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_29670 97261 96695 gene locus_tag LOCUS_29680 97261 96695 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_29680 97556 98968 gene locus_tag LOCUS_29690 97556 98968 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_29690 98971 99591 gene locus_tag LOCUS_29700 98971 99591 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_29700 99593 100633 gene locus_tag LOCUS_29710 gene trpD 99593 100633 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_29710 100646 102103 gene locus_tag LOCUS_29720 gene trpCF 100646 102103 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141446.1 protein_id gnl|my_center|LOCUS_29720 102087 103271 gene locus_tag LOCUS_29730 gene trpB 102087 103271 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_29730 103279 104055 gene locus_tag LOCUS_29740 gene trpA 103279 104055 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_29740 105157 104762 gene locus_tag LOCUS_29750 105157 104762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 106063 105545 gene locus_tag LOCUS_29760 106063 105545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 107629 106151 gene locus_tag LOCUS_29770 107629 106151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 108331 107660 gene locus_tag LOCUS_29780 108331 107660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 110850 108844 gene locus_tag LOCUS_29790 110850 108844 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538435.1 protein_id gnl|my_center|LOCUS_29790 112957 111050 gene locus_tag LOCUS_29800 gene acs 112957 111050 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_29800 113987 116047 gene locus_tag LOCUS_29810 113987 116047 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_29810 116414 118693 gene locus_tag LOCUS_29820 116414 118693 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_29820 120528 119062 gene locus_tag LOCUS_29830 120528 119062 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_29830 120948 120580 gene locus_tag LOCUS_29840 120948 120580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 121139 121744 gene locus_tag LOCUS_29850 121139 121744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 123893 121800 gene locus_tag LOCUS_29860 123893 121800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 124174 127542 gene locus_tag LOCUS_29870 124174 127542 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964044.1 protein_id gnl|my_center|LOCUS_29870 128351 129379 gene locus_tag LOCUS_29880 128351 129379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 130150 129494 gene locus_tag LOCUS_29890 130150 129494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_29890 131109 130183 gene locus_tag LOCUS_29900 131109 130183 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_29900 133179 131185 gene locus_tag LOCUS_29910 133179 131185 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_29910 134237 133230 gene locus_tag LOCUS_29920 134237 133230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 135750 134320 gene locus_tag LOCUS_29930 135750 134320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 136720 135791 gene locus_tag LOCUS_29940 136720 135791 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_29940 138535 136799 gene locus_tag LOCUS_29950 gene lnt 138535 136799 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_29950 139329 139108 gene locus_tag LOCUS_29960 139329 139108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 140586 139549 gene locus_tag LOCUS_29970 140586 139549 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405436.1 protein_id gnl|my_center|LOCUS_29970 141521 140835 gene locus_tag LOCUS_29980 141521 140835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 143236 141560 gene locus_tag LOCUS_29990 143236 141560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29990 145002 144052 gene locus_tag LOCUS_30000 145002 144052 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_30000 145172 145690 gene locus_tag LOCUS_30010 145172 145690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 145741 146439 gene locus_tag LOCUS_30020 145741 146439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 146472 147458 gene locus_tag LOCUS_30030 146472 147458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 147466 148743 gene locus_tag LOCUS_30040 147466 148743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 149802 148885 gene locus_tag LOCUS_30050 149802 148885 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_30050 150263 149802 gene locus_tag LOCUS_30060 gene smpB 150263 149802 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_30060 151086 150427 gene locus_tag LOCUS_30070 151086 150427 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_30070 152001 151204 gene locus_tag LOCUS_30080 152001 151204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 152720 152016 gene locus_tag LOCUS_30090 152720 152016 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 protein_id gnl|my_center|LOCUS_30090 154072 152723 gene locus_tag LOCUS_30100 gene mtaB 154072 152723 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_30100 154732 155853 gene locus_tag LOCUS_30110 gene recA 154732 155853 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_30110 157791 156085 gene locus_tag LOCUS_30120 157791 156085 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_30120 158257 157802 gene locus_tag LOCUS_30130 158257 157802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 159957 158395 gene locus_tag LOCUS_30140 159957 158395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 160444 163020 gene locus_tag LOCUS_30150 gene ppc 160444 163020 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 protein_id gnl|my_center|LOCUS_30150 163569 163027 gene locus_tag LOCUS_30160 163569 163027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 165903 167696 gene locus_tag LOCUS_30170 165903 167696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 168518 169492 gene locus_tag LOCUS_30180 168518 169492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 169707 170750 gene locus_tag LOCUS_30190 169707 170750 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_30190 170760 172388 gene locus_tag LOCUS_30200 170760 172388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 172393 173145 gene locus_tag LOCUS_30210 172393 173145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762387.1 protein_id gnl|my_center|LOCUS_30210 173142 174710 gene locus_tag LOCUS_30220 173142 174710 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 protein_id gnl|my_center|LOCUS_30220 174711 175811 gene locus_tag LOCUS_30230 174711 175811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 177898 175826 gene locus_tag LOCUS_30240 177898 175826 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_30240 179581 178787 gene locus_tag LOCUS_30250 179581 178787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 180026 179586 gene locus_tag LOCUS_30260 180026 179586 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_30260 180671 180081 gene locus_tag LOCUS_30270 180671 180081 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_30270 181515 180910 gene locus_tag LOCUS_30280 181515 180910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 184359 182698 gene locus_tag LOCUS_30290 184359 182698 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203231.1 protein_id gnl|my_center|LOCUS_30290 185210 184368 gene locus_tag LOCUS_30300 185210 184368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 186845 185232 gene locus_tag LOCUS_30310 186845 185232 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_30310 189797 186864 gene locus_tag LOCUS_30320 189797 186864 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_30320 191174 190434 gene locus_tag LOCUS_30330 gene truB 191174 190434 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_30330 192181 191219 gene locus_tag LOCUS_30340 192181 191219 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_30340 193136 192231 gene locus_tag LOCUS_30350 193136 192231 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_30350 193589 193182 gene locus_tag LOCUS_30360 193589 193182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 195626 193785 gene locus_tag LOCUS_30370 gene mutL 195626 193785 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_30370 195972 196547 gene locus_tag LOCUS_30380 195972 196547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 197825 197226 gene locus_tag LOCUS_30390 197825 197226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 198096 198401 gene locus_tag LOCUS_30400 198096 198401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30400 198434 199753 gene locus_tag LOCUS_30410 gene glgP 198434 199753 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30410 199954 201156 gene locus_tag LOCUS_30420 199954 201156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_30420 202351 201581 gene locus_tag LOCUS_30430 gene cdaA 202351 201581 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_30430 202649 203512 gene locus_tag LOCUS_30440 202649 203512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 203519 204100 gene locus_tag LOCUS_30450 203519 204100 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_30450 204479 205426 gene locus_tag LOCUS_30460 204479 205426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 205602 205689 gene locus_tag LOCUS_t00310 205602 205689 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 205789 205864 gene locus_tag LOCUS_t00320 205789 205864 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 206615 205941 gene locus_tag LOCUS_30470 206615 205941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 206772 207560 gene locus_tag LOCUS_30480 206772 207560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 207947 207708 gene locus_tag LOCUS_30490 207947 207708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 208262 208618 gene locus_tag LOCUS_30500 208262 208618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 208812 209183 gene locus_tag LOCUS_30510 208812 209183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 209660 209289 gene locus_tag LOCUS_30520 209660 209289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 211288 210155 gene locus_tag LOCUS_30530 211288 210155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 211660 211322 gene locus_tag LOCUS_30540 211660 211322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 213087 211747 gene locus_tag LOCUS_30550 213087 211747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 214331 213087 gene locus_tag LOCUS_30560 214331 213087 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100257.1 protein_id gnl|my_center|LOCUS_30560 214630 214887 gene locus_tag LOCUS_30570 214630 214887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 214877 215518 gene locus_tag LOCUS_30580 214877 215518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 215811 216221 gene locus_tag LOCUS_30590 215811 216221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 218521 217730 gene locus_tag LOCUS_30600 218521 217730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 219134 222118 gene locus_tag LOCUS_30610 219134 222118 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_30610 222142 223680 gene locus_tag LOCUS_30620 222142 223680 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_30620 223810 224691 gene locus_tag LOCUS_30630 223810 224691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 224896 226146 gene locus_tag LOCUS_30640 gene fabF 224896 226146 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_30640 226276 226905 gene locus_tag LOCUS_30650 226276 226905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 226902 227858 gene locus_tag LOCUS_30660 226902 227858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 230016 228007 gene locus_tag LOCUS_30670 230016 228007 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_30670 230528 230046 gene locus_tag LOCUS_30680 230528 230046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_30680 230696 231727 gene locus_tag LOCUS_30690 230696 231727 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_30690 232284 231898 gene locus_tag LOCUS_30700 232284 231898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30700 232760 232338 gene locus_tag LOCUS_30710 232760 232338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 232937 233899 gene locus_tag LOCUS_30720 232937 233899 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_30720 233935 234612 gene locus_tag LOCUS_30730 233935 234612 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704560.1 protein_id gnl|my_center|LOCUS_30730 234707 234991 gene locus_tag LOCUS_30740 234707 234991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 234985 235209 gene locus_tag LOCUS_30750 234985 235209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30750 237074 236187 gene locus_tag LOCUS_30760 237074 236187 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_30760 237785 237165 gene locus_tag LOCUS_30770 237785 237165 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_30770 239474 237795 gene locus_tag LOCUS_30780 239474 237795 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_30780 240389 239499 gene locus_tag LOCUS_30790 240389 239499 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_30790 241590 240391 gene locus_tag LOCUS_30800 241590 240391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_30800 241750 242910 gene locus_tag LOCUS_30810 241750 242910 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_30810 242939 243730 gene locus_tag LOCUS_30820 242939 243730 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922506.1 protein_id gnl|my_center|LOCUS_30820 243947 244849 gene locus_tag LOCUS_30830 243947 244849 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_30830 244968 245312 gene locus_tag LOCUS_30840 244968 245312 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902561.1 protein_id gnl|my_center|LOCUS_30840 245375 245740 gene locus_tag LOCUS_30850 245375 245740 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_30850 247371 246493 gene locus_tag LOCUS_30860 gene sucD 247371 246493 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_30860 247781 247467 gene locus_tag LOCUS_30870 247781 247467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 248511 248795 gene locus_tag LOCUS_30880 248511 248795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 248743 249147 gene locus_tag LOCUS_30890 248743 249147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 249459 249908 gene locus_tag LOCUS_30900 249459 249908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 250846 251037 gene locus_tag LOCUS_30910 250846 251037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 251350 252264 gene locus_tag LOCUS_30920 251350 252264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 252320 253282 gene locus_tag LOCUS_30930 252320 253282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 253751 254203 gene locus_tag LOCUS_30940 253751 254203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 254101 254544 gene locus_tag LOCUS_30950 254101 254544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 254919 254758 gene locus_tag LOCUS_30960 254919 254758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 255148 256698 gene locus_tag LOCUS_30970 255148 256698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 256782 257291 gene locus_tag LOCUS_30980 256782 257291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 257460 257681 gene locus_tag LOCUS_30990 257460 257681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 257748 258056 gene locus_tag LOCUS_31000 257748 258056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 258325 258519 gene locus_tag LOCUS_31010 258325 258519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 258640 258846 gene locus_tag LOCUS_31020 258640 258846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 258773 258994 gene locus_tag LOCUS_31030 258773 258994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence07 740 414 gene locus_tag LOCUS_31040 740 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31040 2423 3394 gene locus_tag LOCUS_31050 2423 3394 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31050 4320 3682 gene locus_tag LOCUS_31060 4320 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 5628 4768 gene locus_tag LOCUS_31070 5628 4768 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_31070 5829 7148 gene locus_tag LOCUS_31080 5829 7148 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_31080 7155 7544 gene locus_tag LOCUS_31090 gene gcvH 7155 7544 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_31090 7544 7930 gene locus_tag LOCUS_31100 7544 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 8175 11756 gene locus_tag LOCUS_31110 8175 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 11766 14957 gene locus_tag LOCUS_31120 11766 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 15032 15817 gene locus_tag LOCUS_31130 15032 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 15881 18076 gene locus_tag LOCUS_31140 15881 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 19098 18475 gene locus_tag LOCUS_31150 gene tmk 19098 18475 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_31150 19346 20098 gene locus_tag LOCUS_31160 19346 20098 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_31160 20100 20810 gene locus_tag LOCUS_31170 20100 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 20930 23002 gene locus_tag LOCUS_31180 20930 23002 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_31180 23456 23148 gene locus_tag LOCUS_31190 23456 23148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 23917 23483 gene locus_tag LOCUS_31200 23917 23483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 25519 23957 gene locus_tag LOCUS_31210 25519 23957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 26132 28429 gene locus_tag LOCUS_31220 26132 28429 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796237.1 protein_id gnl|my_center|LOCUS_31220 30884 29802 gene locus_tag LOCUS_31230 30884 29802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 32883 31651 gene locus_tag LOCUS_31240 32883 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 33305 34657 gene locus_tag LOCUS_31250 33305 34657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 34686 35201 gene locus_tag LOCUS_31260 34686 35201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 35435 35923 gene locus_tag LOCUS_31270 35435 35923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 35939 36313 gene locus_tag LOCUS_31280 35939 36313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 36333 36884 gene locus_tag LOCUS_31290 36333 36884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 36904 38193 gene locus_tag LOCUS_31300 36904 38193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 38305 38991 gene locus_tag LOCUS_31310 38305 38991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 41117 39957 gene locus_tag LOCUS_31320 41117 39957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 44774 60109 gene locus_tag LOCUS_31330 44774 60109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 60119 64921 gene locus_tag LOCUS_31340 60119 64921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 64881 66701 gene locus_tag LOCUS_31350 64881 66701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 66732 67814 gene locus_tag LOCUS_31360 66732 67814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 69021 68080 gene locus_tag LOCUS_31370 69021 68080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 69621 70514 gene locus_tag LOCUS_31380 69621 70514 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_31380 70518 71477 gene locus_tag LOCUS_31390 70518 71477 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_31390 71490 72659 gene locus_tag LOCUS_31400 71490 72659 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_31400 73521 73805 gene locus_tag LOCUS_31410 73521 73805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 73802 74461 gene locus_tag LOCUS_31420 73802 74461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 74743 75603 gene locus_tag LOCUS_31430 74743 75603 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_31430 75615 76799 gene locus_tag LOCUS_31440 75615 76799 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_31440 76793 77632 gene locus_tag LOCUS_31450 76793 77632 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_31450 77867 78358 gene locus_tag LOCUS_31460 77867 78358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31460 78409 78957 gene locus_tag LOCUS_31470 78409 78957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31470 79839 80669 gene locus_tag LOCUS_31480 79839 80669 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_31480 80850 81449 gene locus_tag LOCUS_31490 80850 81449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 81461 82900 gene locus_tag LOCUS_31500 81461 82900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 82897 83790 gene locus_tag LOCUS_31510 82897 83790 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_31510 84039 84494 gene locus_tag LOCUS_31520 84039 84494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 85537 84899 gene locus_tag LOCUS_31530 85537 84899 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_31530 87403 85544 gene locus_tag LOCUS_31540 87403 85544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 87666 88157 gene locus_tag LOCUS_31550 87666 88157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 88169 90340 gene locus_tag LOCUS_31560 88169 90340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 91749 91444 gene locus_tag LOCUS_31570 91749 91444 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_31570 91754 91924 gene locus_tag LOCUS_31580 91754 91924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 92087 91914 gene locus_tag LOCUS_31590 92087 91914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 92056 93723 gene locus_tag LOCUS_31600 92056 93723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 93735 99347 gene locus_tag LOCUS_31610 93735 99347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 99436 100227 gene locus_tag LOCUS_31620 99436 100227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 100251 102257 gene locus_tag LOCUS_31630 100251 102257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 102301 104400 gene locus_tag LOCUS_31640 102301 104400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 104863 107208 gene locus_tag LOCUS_31650 104863 107208 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356699.1 protein_id gnl|my_center|LOCUS_31650 107192 114490 gene locus_tag LOCUS_31660 107192 114490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 114714 115454 gene locus_tag LOCUS_31670 114714 115454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 115439 116179 gene locus_tag LOCUS_31680 115439 116179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 116116 116712 gene locus_tag LOCUS_31690 116116 116712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 117375 116764 gene locus_tag LOCUS_31700 117375 116764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 119294 117432 gene locus_tag LOCUS_31710 119294 117432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 120131 119928 gene locus_tag LOCUS_31720 120131 119928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 120103 128895 gene locus_tag LOCUS_31730 120103 128895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 129208 130845 gene locus_tag LOCUS_31740 129208 130845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 130992 131174 gene locus_tag LOCUS_31750 130992 131174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 131278 131778 gene locus_tag LOCUS_31760 131278 131778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 131834 136867 gene locus_tag LOCUS_31770 131834 136867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 137229 138176 gene locus_tag LOCUS_31780 137229 138176 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_31780 140037 138331 gene locus_tag LOCUS_31790 140037 138331 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_31790 141826 140177 gene locus_tag LOCUS_31800 141826 140177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964295.1 protein_id gnl|my_center|LOCUS_31800 142784 141870 gene locus_tag LOCUS_31810 142784 141870 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_31810 143022 142786 gene locus_tag LOCUS_31820 143022 142786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 143944 143105 gene locus_tag LOCUS_31830 143944 143105 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_31830 144575 144018 gene locus_tag LOCUS_31840 144575 144018 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_31840 145238 144606 gene locus_tag LOCUS_31850 145238 144606 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_31850 146112 145300 gene locus_tag LOCUS_31860 146112 145300 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_31860 147264 146536 gene locus_tag LOCUS_31870 147264 146536 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_31870 147795 149441 gene locus_tag LOCUS_31880 147795 149441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 153188 150663 gene locus_tag LOCUS_31890 153188 150663 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_31890 153872 153222 gene locus_tag LOCUS_31900 gene rpe 153872 153222 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_31900 154744 154343 gene locus_tag LOCUS_31910 154744 154343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 155165 154749 gene locus_tag LOCUS_31920 155165 154749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 155783 155196 gene locus_tag LOCUS_31930 155783 155196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962857.1 protein_id gnl|my_center|LOCUS_31930 156661 155780 gene locus_tag LOCUS_31940 156661 155780 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_31940 157588 156869 gene locus_tag LOCUS_31950 157588 156869 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_31950 158075 157560 gene locus_tag LOCUS_31960 158075 157560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_31960 158748 158320 gene locus_tag LOCUS_31970 gene aroQ 158748 158320 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_31970 160948 158750 gene locus_tag LOCUS_31980 gene recQ 160948 158750 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_31980 164419 161186 gene locus_tag LOCUS_31990 164419 161186 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_31990 164945 165373 gene locus_tag LOCUS_32000 164945 165373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 165422 166783 gene locus_tag LOCUS_32010 165422 166783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 167120 170707 gene locus_tag LOCUS_32020 167120 170707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 170786 171280 gene locus_tag LOCUS_32030 170786 171280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 172239 171442 gene locus_tag LOCUS_32040 172239 171442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 172751 173407 gene locus_tag LOCUS_32050 172751 173407 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_32050 173717 174496 gene locus_tag LOCUS_32060 gene paaG 173717 174496 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_32060 174555 175691 gene locus_tag LOCUS_32070 174555 175691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 175688 176494 gene locus_tag LOCUS_32080 175688 176494 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_32080 176542 177924 gene locus_tag LOCUS_32090 176542 177924 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_32090 178071 178499 gene locus_tag LOCUS_32100 gene ssb 178071 178499 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_32100 178697 179257 gene locus_tag LOCUS_32110 178697 179257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 179278 181026 gene locus_tag LOCUS_32120 179278 181026 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_32120 181037 181585 gene locus_tag LOCUS_32130 181037 181585 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141799.1 protein_id gnl|my_center|LOCUS_32130 182736 182266 gene locus_tag LOCUS_32140 182736 182266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 182932 182771 gene locus_tag LOCUS_32150 182932 182771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 183857 182973 gene locus_tag LOCUS_32160 183857 182973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 185235 183997 gene locus_tag LOCUS_32170 185235 183997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 186453 185239 gene locus_tag LOCUS_32180 186453 185239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 186599 187912 gene locus_tag LOCUS_32190 gene murA 186599 187912 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790583.1 protein_id gnl|my_center|LOCUS_32190 188580 188879 gene locus_tag LOCUS_32200 188580 188879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 190322 191119 gene locus_tag LOCUS_32210 190322 191119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_32210 191097 191483 gene locus_tag LOCUS_32220 191097 191483 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_32220 192296 191610 gene locus_tag LOCUS_32230 192296 191610 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065753.1 protein_id gnl|my_center|LOCUS_32230 193123 192569 gene locus_tag LOCUS_32240 193123 192569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 194623 193583 gene locus_tag LOCUS_32250 194623 193583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 196142 194997 gene locus_tag LOCUS_32260 196142 194997 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684147.1 protein_id gnl|my_center|LOCUS_32260 197406 196255 gene locus_tag LOCUS_32270 197406 196255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041164968.1 protein_id gnl|my_center|LOCUS_32270 198202 197801 gene locus_tag LOCUS_32280 198202 197801 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_32280 198444 198199 gene locus_tag LOCUS_32290 198444 198199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 198701 198486 gene locus_tag LOCUS_32300 198701 198486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 198992 198810 gene locus_tag LOCUS_32310 198992 198810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32310 202107 199159 gene locus_tag LOCUS_32320 202107 199159 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205999.1 protein_id gnl|my_center|LOCUS_32320 202762 202100 gene locus_tag LOCUS_32330 202762 202100 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence08 744 73 gene locus_tag LOCUS_32340 744 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1452 1108 gene locus_tag LOCUS_32350 1452 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3499 2225 gene locus_tag LOCUS_32360 3499 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3911 3507 gene locus_tag LOCUS_32370 3911 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3935 4777 gene locus_tag LOCUS_32380 3935 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 6163 5537 gene locus_tag LOCUS_32390 6163 5537 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_32390 7549 6347 gene locus_tag LOCUS_32400 7549 6347 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_32400 8002 7562 gene locus_tag LOCUS_32410 gene tsaE 8002 7562 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_32410 8136 9593 gene locus_tag LOCUS_32420 8136 9593 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 protein_id gnl|my_center|LOCUS_32420 9974 11320 gene locus_tag LOCUS_32430 9974 11320 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_32430 11331 12791 gene locus_tag LOCUS_32440 11331 12791 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_32440 12788 14182 gene locus_tag LOCUS_32450 gene hydA 12788 14182 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_32450 14815 15681 gene locus_tag LOCUS_32460 14815 15681 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_32460 15823 17172 gene locus_tag LOCUS_32470 15823 17172 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_32470 17862 18449 gene locus_tag LOCUS_32480 17862 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32480 18473 19129 gene locus_tag LOCUS_32490 18473 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32490 19313 21274 gene locus_tag LOCUS_32500 gene gyrB 19313 21274 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_32500 21381 21746 gene locus_tag LOCUS_32510 21381 21746 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_32510 23090 21933 gene locus_tag LOCUS_32520 23090 21933 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_32520 24467 24967 gene locus_tag LOCUS_32530 24467 24967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 25190 26248 gene locus_tag LOCUS_32540 25190 26248 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_32540 27845 26676 gene locus_tag LOCUS_32550 27845 26676 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_32550 28471 28058 gene locus_tag LOCUS_32560 28471 28058 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_32560 29341 28577 gene locus_tag LOCUS_32570 29341 28577 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_32570 29735 30049 gene locus_tag LOCUS_32580 29735 30049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32580 30411 30139 gene locus_tag LOCUS_32590 30411 30139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32590 30556 30359 gene locus_tag LOCUS_32600 30556 30359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32600 31046 30690 gene locus_tag LOCUS_32610 31046 30690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 31503 31177 gene locus_tag LOCUS_32620 31503 31177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 32015 31518 gene locus_tag LOCUS_32630 32015 31518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 32874 32239 gene locus_tag LOCUS_32640 32874 32239 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_32640 34401 33139 gene locus_tag LOCUS_32650 34401 33139 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924346.1 protein_id gnl|my_center|LOCUS_32650 35456 34401 gene locus_tag LOCUS_32660 gene metX 35456 34401 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_32660 35711 35481 gene locus_tag LOCUS_32670 35711 35481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 36387 38441 gene locus_tag LOCUS_32680 36387 38441 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_32680 39895 39068 gene locus_tag LOCUS_32690 39895 39068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 41605 40397 gene locus_tag LOCUS_32700 41605 40397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 42721 41612 gene locus_tag LOCUS_32710 42721 41612 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967588.1 protein_id gnl|my_center|LOCUS_32710 43911 42742 gene locus_tag LOCUS_32720 43911 42742 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_32720 44343 44855 gene locus_tag LOCUS_32730 44343 44855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 44865 45032 gene locus_tag LOCUS_32740 44865 45032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 45142 45387 gene locus_tag LOCUS_32750 45142 45387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 45594 46439 gene locus_tag LOCUS_32760 45594 46439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_32760 46459 47433 gene locus_tag LOCUS_32770 gene pfkA 46459 47433 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_32770 48441 47731 gene locus_tag LOCUS_32780 48441 47731 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 protein_id gnl|my_center|LOCUS_32780 48898 50073 gene locus_tag LOCUS_32790 48898 50073 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_32790 50117 51973 gene locus_tag LOCUS_32800 50117 51973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 52126 54588 gene locus_tag LOCUS_32810 gene thrA 52126 54588 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_32810 54590 55522 gene locus_tag LOCUS_32820 54590 55522 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_32820 55530 56846 gene locus_tag LOCUS_32830 gene thrC 55530 56846 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_32830 57691 56933 gene locus_tag LOCUS_32840 57691 56933 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_32840 58878 57781 gene locus_tag LOCUS_32850 58878 57781 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_32850 59413 59868 gene locus_tag LOCUS_32860 gene dtd 59413 59868 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_32860 59865 60203 gene locus_tag LOCUS_32870 59865 60203 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_32870 60260 61084 gene locus_tag LOCUS_32880 60260 61084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 61113 62039 gene locus_tag LOCUS_32890 61113 62039 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_32890 62578 63786 gene locus_tag LOCUS_32900 62578 63786 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_32900 63874 66624 gene locus_tag LOCUS_32910 63874 66624 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_32910 67859 67287 gene locus_tag LOCUS_32920 67859 67287 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_32920 68269 69357 gene locus_tag LOCUS_32930 gene mvaD 68269 69357 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_32930 69369 69941 gene locus_tag LOCUS_32940 69369 69941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 70807 71325 gene locus_tag LOCUS_32950 70807 71325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 72155 71328 gene locus_tag LOCUS_32960 gene murI 72155 71328 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_32960 72708 72142 gene locus_tag LOCUS_32970 72708 72142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 73603 73091 gene locus_tag LOCUS_32980 73603 73091 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766991.1 protein_id gnl|my_center|LOCUS_32980 73853 75346 gene locus_tag LOCUS_32990 gene hutH 73853 75346 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_32990 75580 76143 gene locus_tag LOCUS_33000 75580 76143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 76188 76706 gene locus_tag LOCUS_33010 76188 76706 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_33010 76716 77600 gene locus_tag LOCUS_33020 gene panC 76716 77600 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764495.1 protein_id gnl|my_center|LOCUS_33020 77730 78284 gene locus_tag LOCUS_33030 77730 78284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 78367 78855 gene locus_tag LOCUS_33040 78367 78855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 79030 79344 gene locus_tag LOCUS_33050 79030 79344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 80225 79650 gene locus_tag LOCUS_33060 80225 79650 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849840.1 protein_id gnl|my_center|LOCUS_33060 80984 80448 gene locus_tag LOCUS_33070 80984 80448 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_33070 81977 81090 gene locus_tag LOCUS_33080 81977 81090 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_33080 82898 82317 gene locus_tag LOCUS_33090 82898 82317 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656972.1 protein_id gnl|my_center|LOCUS_33090 83051 83410 gene locus_tag LOCUS_33100 83051 83410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 84329 85009 gene locus_tag LOCUS_33110 84329 85009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 85247 86359 gene locus_tag LOCUS_33120 85247 86359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 86684 87715 gene locus_tag LOCUS_33130 86684 87715 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_33130 87743 88570 gene locus_tag LOCUS_33140 gene mreC 87743 88570 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_33140 88572 89093 gene locus_tag LOCUS_33150 gene mreD 88572 89093 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_33150 89097 90959 gene locus_tag LOCUS_33160 gene mrdA 89097 90959 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_33160 90956 91480 gene locus_tag LOCUS_33170 gene folA 90956 91480 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_33170 94249 91628 gene locus_tag LOCUS_33180 94249 91628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 94631 94461 gene locus_tag LOCUS_33190 94631 94461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 95340 94957 gene locus_tag LOCUS_33200 95340 94957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 96364 95345 gene locus_tag LOCUS_33210 96364 95345 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_33210 97340 96372 gene locus_tag LOCUS_33220 97340 96372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 97649 98002 gene locus_tag LOCUS_33230 97649 98002 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_33230 97999 100275 gene locus_tag LOCUS_33240 97999 100275 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_33240 101321 100860 gene locus_tag LOCUS_33250 101321 100860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 103453 102164 gene locus_tag LOCUS_33260 103453 102164 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071687.1 protein_id gnl|my_center|LOCUS_33260 103416 103574 gene locus_tag LOCUS_33270 103416 103574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 103908 103597 gene locus_tag LOCUS_33280 103908 103597 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909006.1 protein_id gnl|my_center|LOCUS_33280 105022 103913 gene locus_tag LOCUS_33290 105022 103913 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_33290 106144 105092 gene locus_tag LOCUS_33300 106144 105092 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_33300 107983 106157 gene locus_tag LOCUS_33310 107983 106157 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_33310 109659 107983 gene locus_tag LOCUS_33320 109659 107983 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_33320 110105 110476 gene locus_tag LOCUS_33330 110105 110476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 111020 110499 gene locus_tag LOCUS_33340 111020 110499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 111351 111013 gene locus_tag LOCUS_33350 111351 111013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 111751 112842 gene locus_tag LOCUS_33360 111751 112842 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_33360 112843 113562 gene locus_tag LOCUS_33370 112843 113562 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_33370 114121 115449 gene locus_tag LOCUS_33380 114121 115449 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_33380 116397 115933 gene locus_tag LOCUS_33390 116397 115933 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_33390 117045 116755 gene locus_tag LOCUS_33400 117045 116755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 118050 117700 gene locus_tag LOCUS_33410 118050 117700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096556.1 protein_id gnl|my_center|LOCUS_33410 118629 118057 gene locus_tag LOCUS_33420 118629 118057 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366547.1 protein_id gnl|my_center|LOCUS_33420 119425 118973 gene locus_tag LOCUS_33430 119425 118973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 120883 119819 gene locus_tag LOCUS_33440 120883 119819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 121079 120888 gene locus_tag LOCUS_33450 121079 120888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 121454 121603 gene locus_tag LOCUS_33460 121454 121603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 122029 123255 gene locus_tag LOCUS_33470 122029 123255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 123248 123946 gene locus_tag LOCUS_33480 123248 123946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_33480 124729 123986 gene locus_tag LOCUS_33490 124729 123986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 125624 124746 gene locus_tag LOCUS_33500 125624 124746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 126157 125621 gene locus_tag LOCUS_33510 126157 125621 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_33510 126332 129061 gene locus_tag LOCUS_33520 126332 129061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 129718 132069 gene locus_tag LOCUS_33530 129718 132069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 132585 132166 gene locus_tag LOCUS_33540 132585 132166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 133400 132921 gene locus_tag LOCUS_33550 133400 132921 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_33550 134336 133527 gene locus_tag LOCUS_33560 134336 133527 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_33560 135846 134611 gene locus_tag LOCUS_33570 135846 134611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 137661 136501 gene locus_tag LOCUS_33580 137661 136501 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_33580 138751 137762 gene locus_tag LOCUS_33590 138751 137762 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_33590 140286 139180 gene locus_tag LOCUS_33600 140286 139180 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_33600 140534 140986 gene locus_tag LOCUS_33610 gene tnpA 140534 140986 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_33610 141189 144518 gene locus_tag LOCUS_33620 141189 144518 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_33620 144669 145058 gene locus_tag LOCUS_33630 144669 145058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 145488 145060 gene locus_tag LOCUS_33640 145488 145060 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704672.1 protein_id gnl|my_center|LOCUS_33640 145753 145457 gene locus_tag LOCUS_33650 145753 145457 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_33650 146608 145826 gene locus_tag LOCUS_33660 146608 145826 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_33660 150328 146816 gene locus_tag LOCUS_33670 150328 146816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 150969 152243 gene locus_tag LOCUS_33680 150969 152243 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_33680 152283 153341 gene locus_tag LOCUS_33690 152283 153341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 153447 154727 gene locus_tag LOCUS_33700 153447 154727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33700 155058 155291 gene locus_tag LOCUS_33710 155058 155291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 155275 155571 gene locus_tag LOCUS_33720 155275 155571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 155579 155932 gene locus_tag LOCUS_33730 155579 155932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 155940 156101 gene locus_tag LOCUS_33740 155940 156101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 156566 158680 gene locus_tag LOCUS_33750 156566 158680 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767003.1 protein_id gnl|my_center|LOCUS_33750 159054 160253 gene locus_tag LOCUS_33760 159054 160253 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_33760 160255 161454 gene locus_tag LOCUS_33770 160255 161454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33770 161481 161699 gene locus_tag LOCUS_33780 161481 161699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 161730 162395 gene locus_tag LOCUS_33790 161730 162395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_33790 162710 163945 gene locus_tag LOCUS_33800 162710 163945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_33800 163942 165108 gene locus_tag LOCUS_33810 163942 165108 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_33810 165413 166795 gene locus_tag LOCUS_33820 165413 166795 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_33820 166959 168092 gene locus_tag LOCUS_33830 166959 168092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_33830 168272 170779 gene locus_tag LOCUS_33840 168272 170779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 171881 171267 gene locus_tag LOCUS_33850 171881 171267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 protein_id gnl|my_center|LOCUS_33850 173011 171908 gene locus_tag LOCUS_33860 gene hisC 173011 171908 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_33860 173474 173298 gene locus_tag LOCUS_33870 173474 173298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 173776 174771 gene locus_tag LOCUS_33880 173776 174771 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_33880 175316 176302 gene locus_tag LOCUS_33890 175316 176302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 176800 176471 gene locus_tag LOCUS_33900 176800 176471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 178436 176706 gene locus_tag LOCUS_33910 178436 176706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 179080 178904 gene locus_tag LOCUS_33920 179080 178904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 179882 179022 gene locus_tag LOCUS_33930 179882 179022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33930 180313 183177 gene locus_tag LOCUS_33940 180313 183177 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_33940 183244 183747 gene locus_tag LOCUS_33950 183244 183747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 183792 184082 gene locus_tag LOCUS_33960 183792 184082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 184104 184268 gene locus_tag LOCUS_33970 184104 184268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 184268 184756 gene locus_tag LOCUS_33980 184268 184756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 184783 185163 gene locus_tag LOCUS_33990 184783 185163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 185448 186014 gene locus_tag LOCUS_34000 185448 186014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 186677 187162 gene locus_tag LOCUS_34010 186677 187162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 187213 187452 gene locus_tag LOCUS_34020 187213 187452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 187804 187986 gene locus_tag LOCUS_34030 187804 187986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34030 188059 188385 gene locus_tag LOCUS_34040 188059 188385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 188375 188635 gene locus_tag LOCUS_34050 188375 188635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34050 188657 189658 gene locus_tag LOCUS_34060 gene dcm 188657 189658 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34060 189642 189947 gene locus_tag LOCUS_34070 189642 189947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 190008 190481 gene locus_tag LOCUS_34080 190008 190481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34080 190478 191023 gene locus_tag LOCUS_34090 190478 191023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34090 191991 193229 gene locus_tag LOCUS_34100 191991 193229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 194237 193764 gene locus_tag LOCUS_34110 194237 193764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 194781 194170 gene locus_tag LOCUS_34120 194781 194170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 195200 194778 gene locus_tag LOCUS_34130 195200 194778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 195797 196048 gene locus_tag LOCUS_34140 195797 196048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34140 196039 196926 gene locus_tag LOCUS_34150 196039 196926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34150 196987 197244 gene locus_tag LOCUS_34160 196987 197244 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_34160 197244 197681 gene locus_tag LOCUS_34170 197244 197681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34170 197926 198192 gene locus_tag LOCUS_34180 197926 198192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34180 198183 198335 gene locus_tag LOCUS_34190 198183 198335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34190 198755 198922 gene locus_tag LOCUS_34200 198755 198922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 >Feature sequence09 2917 1775 gene locus_tag LOCUS_34210 2917 1775 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_34210 3298 2918 gene locus_tag LOCUS_34220 3298 2918 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_34220 3385 4461 gene locus_tag LOCUS_34230 gene msrB 3385 4461 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796156.1 protein_id gnl|my_center|LOCUS_34230 4615 4890 gene locus_tag LOCUS_34240 4615 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 4983 6662 gene locus_tag LOCUS_34250 4983 6662 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_34250 6915 7751 gene locus_tag LOCUS_34260 6915 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 8121 9530 gene locus_tag LOCUS_34270 8121 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 9625 10683 gene locus_tag LOCUS_34280 9625 10683 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_34280 11310 12914 gene locus_tag LOCUS_34290 gene nadB 11310 12914 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_34290 14020 12923 gene locus_tag LOCUS_34300 14020 12923 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_34300 15302 14025 gene locus_tag LOCUS_34310 15302 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 16692 15346 gene locus_tag LOCUS_34320 16692 15346 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_34320 18612 16708 gene locus_tag LOCUS_34330 18612 16708 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_34330 19548 19473 gene locus_tag LOCUS_t00330 19548 19473 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21058 19637 gene locus_tag LOCUS_34340 21058 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 21218 22354 gene locus_tag LOCUS_34350 21218 22354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 23764 22418 gene locus_tag LOCUS_34360 23764 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 24847 24329 gene locus_tag LOCUS_34370 24847 24329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 24846 25244 gene locus_tag LOCUS_34380 24846 25244 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_34380 26157 26558 gene locus_tag LOCUS_34390 26157 26558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34390 26775 28079 gene locus_tag LOCUS_34400 26775 28079 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_34400 28222 29328 gene locus_tag LOCUS_34410 28222 29328 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_34410 29544 31121 gene locus_tag LOCUS_34420 29544 31121 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_34420 31213 34593 gene locus_tag LOCUS_34430 31213 34593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 35007 42353 gene locus_tag LOCUS_34440 35007 42353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 44572 43658 gene locus_tag LOCUS_34450 44572 43658 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328488.1 protein_id gnl|my_center|LOCUS_34450 44740 45045 gene locus_tag LOCUS_34460 44740 45045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 45135 45989 gene locus_tag LOCUS_34470 45135 45989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 47059 46421 gene locus_tag LOCUS_34480 47059 46421 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_34480 47157 50450 gene locus_tag LOCUS_34490 47157 50450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 50568 52931 gene locus_tag LOCUS_34500 50568 52931 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_34500 53957 53013 gene locus_tag LOCUS_34510 53957 53013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 54404 54072 gene locus_tag LOCUS_34520 54404 54072 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815797.1 protein_id gnl|my_center|LOCUS_34520 56096 54801 gene locus_tag LOCUS_34530 gene hemL 56096 54801 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_34530 56686 56390 gene locus_tag LOCUS_34540 56686 56390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 57257 56805 gene locus_tag LOCUS_34550 57257 56805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 57643 57290 gene locus_tag LOCUS_34560 57643 57290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 58793 57816 gene locus_tag LOCUS_34570 gene hemB 58793 57816 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_34570 61711 59306 gene locus_tag LOCUS_34580 61711 59306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 63331 61994 gene locus_tag LOCUS_34590 63331 61994 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_34590 64304 63663 gene locus_tag LOCUS_34600 64304 63663 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_34600 65274 64306 gene locus_tag LOCUS_34610 65274 64306 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_34610 67398 65680 gene locus_tag LOCUS_34620 67398 65680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 68061 67807 gene locus_tag LOCUS_34630 68061 67807 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_34630 68504 68253 gene locus_tag LOCUS_34640 gene rpsT 68504 68253 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_34640 68819 69100 gene locus_tag LOCUS_34650 68819 69100 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_34650 69386 70057 gene locus_tag LOCUS_34660 69386 70057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 70559 71122 gene locus_tag LOCUS_34670 70559 71122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 71301 72068 gene locus_tag LOCUS_34680 71301 72068 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_34680 72065 73012 gene locus_tag LOCUS_34690 gene rsgA 72065 73012 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_34690 74116 73424 gene locus_tag LOCUS_34700 gene trmB 74116 73424 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_34700 75955 74171 gene locus_tag LOCUS_34710 75955 74171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 76990 76043 gene locus_tag LOCUS_34720 76990 76043 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_34720 82072 77003 gene locus_tag LOCUS_34730 82072 77003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 84723 82078 gene locus_tag LOCUS_34740 84723 82078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 85041 86084 gene locus_tag LOCUS_34750 85041 86084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 86209 87795 gene locus_tag LOCUS_34760 86209 87795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 88741 89427 gene locus_tag LOCUS_34770 gene radC 88741 89427 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_34770 92584 89462 gene locus_tag LOCUS_34780 92584 89462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 93133 93870 gene locus_tag LOCUS_34790 93133 93870 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_34790 94369 95235 gene locus_tag LOCUS_34800 94369 95235 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_34800 95353 95700 gene locus_tag LOCUS_34810 95353 95700 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_34810 95697 96794 gene locus_tag LOCUS_34820 95697 96794 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_34820 96781 97248 gene locus_tag LOCUS_34830 96781 97248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 98132 99649 gene locus_tag LOCUS_34840 98132 99649 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387048.1 protein_id gnl|my_center|LOCUS_34840 100122 100850 gene locus_tag LOCUS_34850 100122 100850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 101655 102011 gene locus_tag LOCUS_34860 101655 102011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34860 102043 102591 gene locus_tag LOCUS_34870 102043 102591 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 protein_id gnl|my_center|LOCUS_34870 103768 102650 gene locus_tag LOCUS_34880 103768 102650 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_34880 105101 104355 gene locus_tag LOCUS_34890 105101 104355 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_34890 105711 105076 gene locus_tag LOCUS_34900 105711 105076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34900 107763 105766 gene locus_tag LOCUS_34910 107763 105766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 108083 107787 gene locus_tag LOCUS_34920 108083 107787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 109369 108578 gene locus_tag LOCUS_34930 109369 108578 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_34930 110762 109938 gene locus_tag LOCUS_34940 110762 109938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 113152 110807 gene locus_tag LOCUS_34950 113152 110807 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_34950 114065 114538 gene locus_tag LOCUS_34960 114065 114538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 114950 114753 gene locus_tag LOCUS_34970 114950 114753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 116487 115303 gene locus_tag LOCUS_34980 116487 115303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 118130 116538 gene locus_tag LOCUS_34990 118130 116538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 118963 121215 gene locus_tag LOCUS_35000 118963 121215 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_35000 121850 126382 gene locus_tag LOCUS_35010 121850 126382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 126968 130963 gene locus_tag LOCUS_35020 126968 130963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 131198 131824 gene locus_tag LOCUS_35030 131198 131824 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_35030 133128 131911 gene locus_tag LOCUS_35040 133128 131911 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_35040 134424 133516 gene locus_tag LOCUS_35050 134424 133516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 135502 134798 gene locus_tag LOCUS_35060 135502 134798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 136132 135575 gene locus_tag LOCUS_35070 136132 135575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 137133 136696 gene locus_tag LOCUS_35080 137133 136696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 137716 137162 gene locus_tag LOCUS_35090 137716 137162 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_35090 140085 137869 gene locus_tag LOCUS_35100 140085 137869 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_35100 140513 140169 gene locus_tag LOCUS_35110 140513 140169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 141563 140811 gene locus_tag LOCUS_35120 141563 140811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105573.1 protein_id gnl|my_center|LOCUS_35120 142873 142130 gene locus_tag LOCUS_35130 142873 142130 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_35130 143277 142990 gene locus_tag LOCUS_35140 143277 142990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 143688 143299 gene locus_tag LOCUS_35150 143688 143299 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_35150 144318 143692 gene locus_tag LOCUS_35160 144318 143692 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019011.1 protein_id gnl|my_center|LOCUS_35160 144770 144315 gene locus_tag LOCUS_35170 144770 144315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 145156 144770 gene locus_tag LOCUS_35180 145156 144770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 145838 145161 gene locus_tag LOCUS_35190 145838 145161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 146781 145795 gene locus_tag LOCUS_35200 146781 145795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 147373 146774 gene locus_tag LOCUS_35210 147373 146774 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_35210 147793 147386 gene locus_tag LOCUS_35220 147793 147386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 148999 148184 gene locus_tag LOCUS_35230 148999 148184 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 protein_id gnl|my_center|LOCUS_35230 149811 149065 gene locus_tag LOCUS_35240 149811 149065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 151023 150325 gene locus_tag LOCUS_35250 151023 150325 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_35250 151895 151083 gene locus_tag LOCUS_35260 151895 151083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 153120 152557 gene locus_tag LOCUS_35270 153120 152557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 153807 153193 gene locus_tag LOCUS_35280 153807 153193 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_35280 154497 153985 gene locus_tag LOCUS_35290 154497 153985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 154974 154516 gene locus_tag LOCUS_35300 gene arr 154974 154516 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_35300 155848 155345 gene locus_tag LOCUS_35310 155848 155345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 156165 155851 gene locus_tag LOCUS_35320 156165 155851 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_35320 157059 157310 gene locus_tag LOCUS_35330 157059 157310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 158760 157549 gene locus_tag LOCUS_35340 gene lysA 158760 157549 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_35340 160404 159160 gene locus_tag LOCUS_35350 gene hutI 160404 159160 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_35350 161366 160404 gene locus_tag LOCUS_35360 161366 160404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 162121 161486 gene locus_tag LOCUS_35370 162121 161486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 162336 163601 gene locus_tag LOCUS_35380 162336 163601 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_35380 163764 164525 gene locus_tag LOCUS_35390 163764 164525 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_35390 165314 170830 gene locus_tag LOCUS_35400 165314 170830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 172039 170960 gene locus_tag LOCUS_35410 gene wecB 172039 170960 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_35410 173295 172042 gene locus_tag LOCUS_35420 173295 172042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 174361 173288 gene locus_tag LOCUS_35430 174361 173288 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_35430 175633 174554 gene locus_tag LOCUS_35440 175633 174554 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_35440 175929 175669 gene locus_tag LOCUS_35450 175929 175669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 176282 176031 gene locus_tag LOCUS_35460 176282 176031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 176558 176337 gene locus_tag LOCUS_35470 176558 176337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 176724 176891 gene locus_tag LOCUS_35480 176724 176891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 177939 177004 gene locus_tag LOCUS_35490 177939 177004 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_35490 178556 178206 gene locus_tag LOCUS_35500 178556 178206 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_35500 179809 178652 gene locus_tag LOCUS_35510 gene gmd 179809 178652 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 protein_id gnl|my_center|LOCUS_35510 180658 179822 gene locus_tag LOCUS_35520 180658 179822 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_35520 181262 180651 gene locus_tag LOCUS_35530 181262 180651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_35530 182528 181539 gene locus_tag LOCUS_35540 gene wecB 182528 181539 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_35540 183817 182777 gene locus_tag LOCUS_35550 183817 182777 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_35550 185426 184026 gene locus_tag LOCUS_35560 185426 184026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 186374 185862 gene locus_tag LOCUS_35570 186374 185862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35570 187009 186467 gene locus_tag LOCUS_35580 187009 186467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35580 187976 187128 gene locus_tag LOCUS_35590 187976 187128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35590 188662 188273 gene locus_tag LOCUS_35600 188662 188273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 189792 189388 gene locus_tag LOCUS_35610 189792 189388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 190217 189843 gene locus_tag LOCUS_35620 190217 189843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35620 190924 190400 gene locus_tag LOCUS_35630 190924 190400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35630 191410 190931 gene locus_tag LOCUS_35640 191410 190931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 191594 191388 gene locus_tag LOCUS_35650 191594 191388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 191742 191557 gene locus_tag LOCUS_35660 191742 191557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 192168 191752 gene locus_tag LOCUS_35670 192168 191752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35670 192596 192225 gene locus_tag LOCUS_35680 192596 192225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35680 194441 193962 gene locus_tag LOCUS_35690 194441 193962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 195025 194588 gene locus_tag LOCUS_35700 195025 194588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 195498 195022 gene locus_tag LOCUS_35710 195498 195022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 196928 195876 gene locus_tag LOCUS_35720 196928 195876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35720 197198 196974 gene locus_tag LOCUS_35730 197198 196974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 197779 197168 gene locus_tag LOCUS_35740 197779 197168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 198465 198148 gene locus_tag LOCUS_35750 198465 198148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 198691 198449 gene locus_tag LOCUS_35760 198691 198449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 >Feature sequence10 294 533 gene locus_tag LOCUS_35770 294 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 1356 610 gene locus_tag LOCUS_35780 1356 610 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_35780 1595 1344 gene locus_tag LOCUS_35790 1595 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 2442 2897 gene locus_tag LOCUS_35800 2442 2897 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643508.1 protein_id gnl|my_center|LOCUS_35800 3498 4826 gene locus_tag LOCUS_35810 3498 4826 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_35810 5341 5790 gene locus_tag LOCUS_35820 5341 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 6584 6045 gene locus_tag LOCUS_35830 6584 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 7050 6703 gene locus_tag LOCUS_35840 7050 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 7213 7019 gene locus_tag LOCUS_35850 7213 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 7925 7407 gene locus_tag LOCUS_35860 7925 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 8310 7939 gene locus_tag LOCUS_35870 8310 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 9103 8432 gene locus_tag LOCUS_35880 9103 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 9789 9100 gene locus_tag LOCUS_35890 9789 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 11847 9814 gene locus_tag LOCUS_35900 11847 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 12752 11949 gene locus_tag LOCUS_35910 12752 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 16068 13189 gene locus_tag LOCUS_35920 16068 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 16738 17064 gene locus_tag LOCUS_35930 16738 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35930 17069 17887 gene locus_tag LOCUS_35940 17069 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35940 19595 17907 gene locus_tag LOCUS_35950 19595 17907 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_35950 21077 19695 gene locus_tag LOCUS_35960 21077 19695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 21824 21081 gene locus_tag LOCUS_35970 gene fabG 21824 21081 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_35970 22077 23573 gene locus_tag LOCUS_35980 22077 23573 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 protein_id gnl|my_center|LOCUS_35980 23577 24575 gene locus_tag LOCUS_35990 23577 24575 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_35990 24592 26082 gene locus_tag LOCUS_36000 24592 26082 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_36000 26114 26662 gene locus_tag LOCUS_36010 26114 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 26756 28327 gene locus_tag LOCUS_36020 26756 28327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 28420 29274 gene locus_tag LOCUS_36030 28420 29274 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419381.1 protein_id gnl|my_center|LOCUS_36030 30853 29573 gene locus_tag LOCUS_36040 30853 29573 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_36040 31750 31088 gene locus_tag LOCUS_36050 31750 31088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 32722 31835 gene locus_tag LOCUS_36060 32722 31835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 32903 34486 gene locus_tag LOCUS_36070 32903 34486 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_36070 34649 35419 gene locus_tag LOCUS_36080 gene lptB 34649 35419 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_36080 35419 35733 gene locus_tag LOCUS_36090 35419 35733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 35730 36152 gene locus_tag LOCUS_36100 35730 36152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 36231 38675 gene locus_tag LOCUS_36110 36231 38675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 39704 40030 gene locus_tag LOCUS_36120 39704 40030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 41889 40342 gene locus_tag LOCUS_36130 41889 40342 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_36130 42949 42140 gene locus_tag LOCUS_36140 42949 42140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 43259 42951 gene locus_tag LOCUS_36150 43259 42951 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_36150 44072 43458 gene locus_tag LOCUS_36160 44072 43458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 44308 45048 gene locus_tag LOCUS_36170 44308 45048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 45077 46015 gene locus_tag LOCUS_36180 45077 46015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 46052 46744 gene locus_tag LOCUS_36190 46052 46744 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_36190 47791 46745 gene locus_tag LOCUS_36200 47791 46745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 48693 47806 gene locus_tag LOCUS_36210 48693 47806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 50490 48772 gene locus_tag LOCUS_36220 50490 48772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 51609 50635 gene locus_tag LOCUS_36230 51609 50635 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_36230 52848 52144 gene locus_tag LOCUS_36240 52848 52144 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461640.1 protein_id gnl|my_center|LOCUS_36240 53911 52889 gene locus_tag LOCUS_36250 53911 52889 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_36250 54908 53934 gene locus_tag LOCUS_36260 54908 53934 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_36260 55896 54943 gene locus_tag LOCUS_36270 55896 54943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 56756 55893 gene locus_tag LOCUS_36280 56756 55893 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_36280 58052 56760 gene locus_tag LOCUS_36290 58052 56760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 59086 58091 gene locus_tag LOCUS_36300 59086 58091 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_36300 61413 60691 gene locus_tag LOCUS_36310 61413 60691 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36310 61595 61428 gene locus_tag LOCUS_36320 61595 61428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 61679 62254 gene locus_tag LOCUS_36330 61679 62254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 63273 62683 gene locus_tag LOCUS_36340 63273 62683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 64201 63416 gene locus_tag LOCUS_36350 64201 63416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 65086 65304 gene locus_tag LOCUS_36360 65086 65304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36360 65319 66161 gene locus_tag LOCUS_36370 65319 66161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36370 66884 66444 gene locus_tag LOCUS_36380 66884 66444 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_36380 67792 67364 gene locus_tag LOCUS_36390 67792 67364 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_36390 68578 68060 gene locus_tag LOCUS_36400 68578 68060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 69024 69248 gene locus_tag LOCUS_36410 69024 69248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 69786 70043 gene locus_tag LOCUS_36420 69786 70043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 70265 70657 gene locus_tag LOCUS_36430 70265 70657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 70866 72632 gene locus_tag LOCUS_36440 70866 72632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 74062 72683 gene locus_tag LOCUS_36450 74062 72683 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_36450 75446 74073 gene locus_tag LOCUS_36460 75446 74073 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_36460 75784 76734 gene locus_tag LOCUS_36470 75784 76734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 76930 77412 gene locus_tag LOCUS_36480 76930 77412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 77412 78221 gene locus_tag LOCUS_36490 77412 78221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 78223 79503 gene locus_tag LOCUS_36500 78223 79503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_36500 79500 79823 gene locus_tag LOCUS_36510 79500 79823 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_36510 79826 80257 gene locus_tag LOCUS_36520 79826 80257 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_36520 81415 82764 gene locus_tag LOCUS_36530 81415 82764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 85352 83751 gene locus_tag LOCUS_36540 85352 83751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 85455 86426 gene locus_tag LOCUS_36550 85455 86426 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36550 86441 86662 gene locus_tag LOCUS_36560 86441 86662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36560 87514 88701 gene locus_tag LOCUS_36570 87514 88701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 88791 92570 gene locus_tag LOCUS_36580 88791 92570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 92748 97301 gene locus_tag LOCUS_36590 92748 97301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 97529 97888 gene locus_tag LOCUS_36600 97529 97888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 98043 99221 gene locus_tag LOCUS_36610 98043 99221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 99483 101075 gene locus_tag LOCUS_36620 99483 101075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 102221 101451 gene locus_tag LOCUS_36630 102221 101451 CDS product response regulator transcription factor LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831505.1 protein_id gnl|my_center|LOCUS_36630 102669 102208 gene locus_tag LOCUS_36640 102669 102208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 104930 102900 gene locus_tag LOCUS_36650 104930 102900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 107266 106400 gene locus_tag LOCUS_36660 107266 106400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 107489 107415 gene locus_tag LOCUS_t00340 107489 107415 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 107797 107549 gene locus_tag LOCUS_36670 gene atpC 107797 107549 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_36670 109351 107834 gene locus_tag LOCUS_36680 gene atpD 109351 107834 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_36680 112300 110033 gene locus_tag LOCUS_36690 112300 110033 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_36690 112739 112389 gene locus_tag LOCUS_36700 112739 112389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 113254 112721 gene locus_tag LOCUS_36710 113254 112721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 116111 113172 gene locus_tag LOCUS_36720 116111 113172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 117464 116313 gene locus_tag LOCUS_36730 117464 116313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 118036 117698 gene locus_tag LOCUS_36740 118036 117698 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_36740 118319 118029 gene locus_tag LOCUS_36750 118319 118029 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_36750 118757 118596 gene locus_tag LOCUS_36760 118757 118596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36760 119075 118854 gene locus_tag LOCUS_36770 119075 118854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36770 120110 119436 gene locus_tag LOCUS_36780 120110 119436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36780 121207 120206 gene locus_tag LOCUS_36790 121207 120206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36790 122561 121704 gene locus_tag LOCUS_36800 122561 121704 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_36800 122832 122689 gene locus_tag LOCUS_36810 122832 122689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 123538 123098 gene locus_tag LOCUS_36820 123538 123098 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875754.1 protein_id gnl|my_center|LOCUS_36820 124506 123841 gene locus_tag LOCUS_36830 124506 123841 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36830 125607 125744 gene locus_tag LOCUS_36840 125607 125744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 126845 127087 gene locus_tag LOCUS_36850 126845 127087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36850 127048 127197 gene locus_tag LOCUS_36860 127048 127197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36860 >Feature sequence11 695 880 gene locus_tag LOCUS_36870 695 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 1510 1076 gene locus_tag LOCUS_36880 1510 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 2108 1800 gene locus_tag LOCUS_36890 2108 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 2554 2126 gene locus_tag LOCUS_36900 2554 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36900 2931 2578 gene locus_tag LOCUS_36910 2931 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36910 3615 3145 gene locus_tag LOCUS_36920 3615 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36920 4282 3845 gene locus_tag LOCUS_36930 4282 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36930 5267 4410 gene locus_tag LOCUS_36940 gene rfbA 5267 4410 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_36940 5784 5434 gene locus_tag LOCUS_36950 5784 5434 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_36950 6949 5984 gene locus_tag LOCUS_36960 gene pseI 6949 5984 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_36960 8291 7488 gene locus_tag LOCUS_36970 8291 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 9072 8278 gene locus_tag LOCUS_36980 9072 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36980 9766 9086 gene locus_tag LOCUS_36990 gene pseF 9766 9086 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_36990 10010 9759 gene locus_tag LOCUS_37000 10010 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37000 10748 10182 gene locus_tag LOCUS_37010 10748 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37010 10941 10804 gene locus_tag LOCUS_37020 10941 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37020 11419 11189 gene locus_tag LOCUS_37030 11419 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 11967 11479 gene locus_tag LOCUS_37040 11967 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37040 13383 12331 gene locus_tag LOCUS_37050 gene rfbB 13383 12331 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_37050 14356 13388 gene locus_tag LOCUS_37060 14356 13388 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_37060 15630 14353 gene locus_tag LOCUS_37070 15630 14353 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_37070 16104 15637 gene locus_tag LOCUS_37080 16104 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 16310 16101 gene locus_tag LOCUS_37090 16310 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 17611 16307 gene locus_tag LOCUS_37100 17611 16307 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_37100 18160 17786 gene locus_tag LOCUS_37110 18160 17786 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_37110 18860 18348 gene locus_tag LOCUS_37120 18860 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 19298 18864 gene locus_tag LOCUS_37130 19298 18864 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_37130 19979 19575 gene locus_tag LOCUS_37140 19979 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 20203 19928 gene locus_tag LOCUS_37150 20203 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 21350 20262 gene locus_tag LOCUS_37160 21350 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37160 22483 21506 gene locus_tag LOCUS_37170 22483 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37170 23224 22523 gene locus_tag LOCUS_37180 23224 22523 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_37180 24600 23320 gene locus_tag LOCUS_37190 gene serS 24600 23320 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_37190 24946 26748 gene locus_tag LOCUS_37200 gene rho 24946 26748 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107884.1 protein_id gnl|my_center|LOCUS_37200 27235 28053 gene locus_tag LOCUS_37210 27235 28053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 29098 29517 gene locus_tag LOCUS_37220 gene rnpA 29098 29517 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_37220 29507 30469 gene locus_tag LOCUS_37230 29507 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 30477 31091 gene locus_tag LOCUS_37240 30477 31091 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_37240 32799 31393 gene locus_tag LOCUS_37250 32799 31393 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_37250 32937 33722 gene locus_tag LOCUS_37260 gene dapF 32937 33722 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135464474.1 protein_id gnl|my_center|LOCUS_37260 34383 34060 gene locus_tag LOCUS_37270 34383 34060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 34817 35557 gene locus_tag LOCUS_37280 34817 35557 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_37280 35605 36567 gene locus_tag LOCUS_37290 35605 36567 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_37290 36656 37243 gene locus_tag LOCUS_37300 36656 37243 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_37300 38110 42810 gene locus_tag LOCUS_37310 38110 42810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 43838 42945 gene locus_tag LOCUS_37320 43838 42945 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_37320 44203 46122 gene locus_tag LOCUS_37330 44203 46122 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890750.1 protein_id gnl|my_center|LOCUS_37330 46112 46672 gene locus_tag LOCUS_37340 46112 46672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 46698 47717 gene locus_tag LOCUS_37350 gene galE 46698 47717 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_37350 48631 48374 gene locus_tag LOCUS_37360 48631 48374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37360 49822 48983 gene locus_tag LOCUS_37370 49822 48983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 51671 50034 gene locus_tag LOCUS_37380 51671 50034 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_37380 51873 51682 gene locus_tag LOCUS_37390 51873 51682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 55095 52195 gene locus_tag LOCUS_37400 55095 52195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37400 59567 55092 gene locus_tag LOCUS_37410 59567 55092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37410 60366 59806 gene locus_tag LOCUS_37420 gene ruvA 60366 59806 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_37420 61119 60556 gene locus_tag LOCUS_37430 61119 60556 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_37430 63655 61121 gene locus_tag LOCUS_37440 63655 61121 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107414.1 protein_id gnl|my_center|LOCUS_37440 64590 66050 gene locus_tag LOCUS_37450 64590 66050 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044930.1 protein_id gnl|my_center|LOCUS_37450 66412 66939 gene locus_tag LOCUS_37460 66412 66939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 68164 67937 gene locus_tag LOCUS_37470 68164 67937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 68513 70105 gene locus_tag LOCUS_37480 68513 70105 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_37480 70690 70902 gene locus_tag LOCUS_37490 70690 70902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 71574 72575 gene locus_tag LOCUS_37500 71574 72575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 72582 73835 gene locus_tag LOCUS_37510 72582 73835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 73848 74126 gene locus_tag LOCUS_37520 73848 74126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 74198 75001 gene locus_tag LOCUS_37530 74198 75001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 75109 75372 gene locus_tag LOCUS_37540 75109 75372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 75375 76049 gene locus_tag LOCUS_37550 75375 76049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 76061 76753 gene locus_tag LOCUS_37560 76061 76753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 76775 77101 gene locus_tag LOCUS_37570 76775 77101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence12 2218 1466 gene locus_tag LOCUS_37580 2218 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 3427 2660 gene locus_tag LOCUS_37590 3427 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 4070 3420 gene locus_tag LOCUS_37600 4070 3420 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932940.1 protein_id gnl|my_center|LOCUS_37600 5596 4286 gene locus_tag LOCUS_37610 5596 4286 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_37610 6423 5617 gene locus_tag LOCUS_37620 6423 5617 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_37620 7003 7158 gene locus_tag LOCUS_37630 7003 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 7814 7191 gene locus_tag LOCUS_37640 7814 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 8518 7817 gene locus_tag LOCUS_37650 8518 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 8901 8596 gene locus_tag LOCUS_37660 8901 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 9797 8913 gene locus_tag LOCUS_37670 9797 8913 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_37670 10113 9799 gene locus_tag LOCUS_37680 10113 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 10368 10150 gene locus_tag LOCUS_37690 10368 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 10725 10441 gene locus_tag LOCUS_37700 10725 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 10888 10748 gene locus_tag LOCUS_37710 10888 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 11081 11422 gene locus_tag LOCUS_37720 11081 11422 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966610.1 protein_id gnl|my_center|LOCUS_37720 11702 11424 gene locus_tag LOCUS_37730 11702 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 11854 13725 gene locus_tag LOCUS_37740 gene yccS 11854 13725 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706489.1 protein_id gnl|my_center|LOCUS_37740 15590 14343 gene locus_tag LOCUS_37750 15590 14343 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067908.1 protein_id gnl|my_center|LOCUS_37750 16340 15873 gene locus_tag LOCUS_37760 16340 15873 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_37760 17736 17215 gene locus_tag LOCUS_37770 17736 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 19119 17935 gene locus_tag LOCUS_37780 19119 17935 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533426.1 protein_id gnl|my_center|LOCUS_37780 19513 19334 gene locus_tag LOCUS_37790 19513 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 20051 19590 gene locus_tag LOCUS_37800 20051 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 21370 20204 gene locus_tag LOCUS_37810 21370 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37810 22310 21360 gene locus_tag LOCUS_37820 22310 21360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37820 23859 22825 gene locus_tag LOCUS_37830 23859 22825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 26429 23970 gene locus_tag LOCUS_37840 26429 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 28779 26680 gene locus_tag LOCUS_37850 gene recG 28779 26680 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_37850 31195 28922 gene locus_tag LOCUS_37860 gene katG 31195 28922 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036402.1 protein_id gnl|my_center|LOCUS_37860 31528 32784 gene locus_tag LOCUS_37870 gene metK 31528 32784 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_37870 32922 33992 gene locus_tag LOCUS_37880 32922 33992 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_37880 35037 35210 gene locus_tag LOCUS_37890 35037 35210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 35213 36118 gene locus_tag LOCUS_37900 gene rsmH 35213 36118 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_37900 36249 36566 gene locus_tag LOCUS_37910 36249 36566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 36566 38737 gene locus_tag LOCUS_37920 36566 38737 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_37920 38744 40198 gene locus_tag LOCUS_37930 38744 40198 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_37930 40439 41698 gene locus_tag LOCUS_37940 gene mraY 40439 41698 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_37940 41711 43021 gene locus_tag LOCUS_37950 gene murD 41711 43021 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_37950 43087 44268 gene locus_tag LOCUS_37960 43087 44268 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_37960 44269 45381 gene locus_tag LOCUS_37970 gene murG 44269 45381 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_37970 45385 46755 gene locus_tag LOCUS_37980 gene murC 45385 46755 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_37980 46752 47552 gene locus_tag LOCUS_37990 46752 47552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 47607 48065 gene locus_tag LOCUS_38000 47607 48065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 48095 48889 gene locus_tag LOCUS_38010 48095 48889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 48974 50407 gene locus_tag LOCUS_38020 48974 50407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 51277 50828 gene locus_tag LOCUS_38030 51277 50828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_38030 52797 51796 gene locus_tag LOCUS_38040 52797 51796 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_38040 52845 54497 gene locus_tag LOCUS_38050 52845 54497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence13 2588 1242 gene locus_tag LOCUS_38060 2588 1242 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_38060 2883 2629 gene locus_tag LOCUS_38070 2883 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3527 3135 gene locus_tag LOCUS_38080 3527 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 3915 3508 gene locus_tag LOCUS_38090 3915 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 5365 4466 gene locus_tag LOCUS_38100 5365 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 5718 5371 gene locus_tag LOCUS_38110 5718 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 6144 5908 gene locus_tag LOCUS_38120 6144 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 7283 6126 gene locus_tag LOCUS_38130 7283 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38130 8278 7451 gene locus_tag LOCUS_38140 8278 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 8805 8476 gene locus_tag LOCUS_38150 8805 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 10461 9604 gene locus_tag LOCUS_38160 10461 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 12099 10480 gene locus_tag LOCUS_38170 12099 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 12383 12889 gene locus_tag LOCUS_38180 12383 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 12931 13494 gene locus_tag LOCUS_38190 12931 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 13526 14698 gene locus_tag LOCUS_38200 13526 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 14727 15872 gene locus_tag LOCUS_38210 14727 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 16162 16419 gene locus_tag LOCUS_38220 16162 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38220 16406 16747 gene locus_tag LOCUS_38230 16406 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 17490 17711 gene locus_tag LOCUS_38240 17490 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 17862 18086 gene locus_tag LOCUS_38250 17862 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 18279 18740 gene locus_tag LOCUS_38260 18279 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 19400 21751 gene locus_tag LOCUS_38270 19400 21751 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_38270 22698 23240 gene locus_tag LOCUS_38280 22698 23240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38280 23185 24399 gene locus_tag LOCUS_38290 23185 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38290 24368 24580 gene locus_tag LOCUS_38300 24368 24580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 27039 26761 gene locus_tag LOCUS_38310 27039 26761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 27308 27132 gene locus_tag LOCUS_38320 27308 27132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 27914 27516 gene locus_tag LOCUS_38330 27914 27516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence14 220 1731 gene locus_tag LOCUS_38340 220 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 1731 2780 gene locus_tag LOCUS_38350 1731 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 2886 3188 gene locus_tag LOCUS_38360 2886 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 3218 3931 gene locus_tag LOCUS_38370 3218 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38370 4140 4559 gene locus_tag LOCUS_38380 4140 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38380 4565 5068 gene locus_tag LOCUS_38390 4565 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38390 5017 5460 gene locus_tag LOCUS_38400 5017 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 5623 5916 gene locus_tag LOCUS_38410 5623 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 5916 7685 gene locus_tag LOCUS_38420 5916 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 7686 8411 gene locus_tag LOCUS_38430 7686 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 8432 8584 gene locus_tag LOCUS_38440 8432 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 8568 8804 gene locus_tag LOCUS_38450 8568 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 9087 10163 gene locus_tag LOCUS_38460 9087 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 10167 10601 gene locus_tag LOCUS_38470 10167 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 10605 13094 gene locus_tag LOCUS_38480 10605 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38480 13025 13375 gene locus_tag LOCUS_38490 13025 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38490 13330 13557 gene locus_tag LOCUS_38500 13330 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38500 13568 15634 gene locus_tag LOCUS_38510 13568 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 15684 16361 gene locus_tag LOCUS_38520 15684 16361 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_38520 16354 17619 gene locus_tag LOCUS_38530 16354 17619 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_38530 17692 18120 gene locus_tag LOCUS_38540 17692 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 18136 20547 gene locus_tag LOCUS_38550 18136 20547 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_38550 21426 21223 gene locus_tag LOCUS_38560 21426 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 21821 22324 gene locus_tag LOCUS_38570 21821 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 23602 22874 gene locus_tag LOCUS_38580 23602 22874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964412.1 protein_id gnl|my_center|LOCUS_38580 24068 23607 gene locus_tag LOCUS_38590 24068 23607 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233853.1 protein_id gnl|my_center|LOCUS_38590 24319 24507 gene locus_tag LOCUS_38600 24319 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161644875.1 protein_id gnl|my_center|LOCUS_38600 25746 25552 gene locus_tag LOCUS_38610 25746 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 26914 27129 gene locus_tag LOCUS_38620 26914 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 27318 27467 gene locus_tag LOCUS_38630 27318 27467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence15 1372 2409 gene locus_tag LOCUS_38640 1372 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 2519 4072 gene locus_tag LOCUS_38650 2519 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38650 4095 4652 gene locus_tag LOCUS_38660 4095 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 4783 5265 gene locus_tag LOCUS_38670 4783 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38670 5243 5617 gene locus_tag LOCUS_38680 5243 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38680 5711 5902 gene locus_tag LOCUS_38690 5711 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 5877 6260 gene locus_tag LOCUS_38700 5877 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38700 6392 6685 gene locus_tag LOCUS_38710 6392 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38710 6691 6864 gene locus_tag LOCUS_38720 6691 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence16 272 3157 gene locus_tag LOCUS_r00070 272 3157 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3379 3451 gene locus_tag LOCUS_t00350 3379 3451 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4394 4140 gene locus_tag LOCUS_38730 4394 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 4600 4412 gene locus_tag LOCUS_38740 4600 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740