>Feature sequence01 928 614 gene locus_tag LOCUS_00010 928 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1830 925 gene locus_tag LOCUS_00020 1830 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2545 3504 gene locus_tag LOCUS_00030 2545 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00030 3680 3513 gene locus_tag LOCUS_00040 3680 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4282 4947 gene locus_tag LOCUS_00050 4282 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 5027 5911 gene locus_tag LOCUS_00060 5027 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6300 6683 gene locus_tag LOCUS_00070 6300 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6879 7733 gene locus_tag LOCUS_00080 6879 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8266 9765 gene locus_tag LOCUS_00090 8266 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9762 11531 gene locus_tag LOCUS_00100 9762 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11844 11611 gene locus_tag LOCUS_00110 11844 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12424 13599 gene locus_tag LOCUS_00120 12424 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00120 13680 16280 gene locus_tag LOCUS_00130 13680 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16312 17070 gene locus_tag LOCUS_00140 16312 17070 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788700.1 protein_id gnl|my_center|LOCUS_00140 17067 17765 gene locus_tag LOCUS_00150 17067 17765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17684 18001 gene locus_tag LOCUS_00160 17684 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18006 18383 gene locus_tag LOCUS_00170 18006 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18380 18604 gene locus_tag LOCUS_00180 18380 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19616 19332 gene locus_tag LOCUS_00190 19616 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21465 20437 gene locus_tag LOCUS_00200 21465 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00200 23147 21450 gene locus_tag LOCUS_00210 23147 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23418 23068 gene locus_tag LOCUS_00220 23418 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23606 23415 gene locus_tag LOCUS_00230 23606 23415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26364 23770 gene locus_tag LOCUS_00240 26364 23770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00240 28201 26813 gene locus_tag LOCUS_00250 28201 26813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28732 28493 gene locus_tag LOCUS_00260 28732 28493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29014 28739 gene locus_tag LOCUS_00270 29014 28739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30347 29175 gene locus_tag LOCUS_00280 30347 29175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30619 30344 gene locus_tag LOCUS_00290 30619 30344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31322 30627 gene locus_tag LOCUS_00300 31322 30627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33680 32964 gene locus_tag LOCUS_00310 33680 32964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34174 33842 gene locus_tag LOCUS_00320 34174 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35168 34191 gene locus_tag LOCUS_00330 35168 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36146 35604 gene locus_tag LOCUS_00340 36146 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36769 36395 gene locus_tag LOCUS_00350 36769 36395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37311 37150 gene locus_tag LOCUS_00360 37311 37150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37310 37756 gene locus_tag LOCUS_00370 37310 37756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 40970 37764 gene locus_tag LOCUS_00380 40970 37764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42487 40973 gene locus_tag LOCUS_00390 42487 40973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44426 42480 gene locus_tag LOCUS_00400 44426 42480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45786 44419 gene locus_tag LOCUS_00410 45786 44419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47913 45793 gene locus_tag LOCUS_00420 47913 45793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 50091 47917 gene locus_tag LOCUS_00430 50091 47917 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_00430 50487 50098 gene locus_tag LOCUS_00440 50487 50098 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974730.1 protein_id gnl|my_center|LOCUS_00440 51419 50484 gene locus_tag LOCUS_00450 51419 50484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52096 51416 gene locus_tag LOCUS_00460 52096 51416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 53166 52093 gene locus_tag LOCUS_00470 53166 52093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53335 53159 gene locus_tag LOCUS_00480 53335 53159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54498 53335 gene locus_tag LOCUS_00490 54498 53335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55049 54495 gene locus_tag LOCUS_00500 55049 54495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57019 55052 gene locus_tag LOCUS_00510 57019 55052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57487 57026 gene locus_tag LOCUS_00520 57487 57026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59408 57504 gene locus_tag LOCUS_00530 59408 57504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 59308 59526 gene locus_tag LOCUS_00540 59308 59526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60278 59451 gene locus_tag LOCUS_00550 60278 59451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60856 60275 gene locus_tag LOCUS_00560 60856 60275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62070 61237 gene locus_tag LOCUS_00570 62070 61237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 62527 62114 gene locus_tag LOCUS_00580 62527 62114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67365 62500 gene locus_tag LOCUS_00590 67365 62500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 67670 68686 gene locus_tag LOCUS_00600 67670 68686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 68804 69664 gene locus_tag LOCUS_00610 68804 69664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70199 69669 gene locus_tag LOCUS_00620 70199 69669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71410 70196 gene locus_tag LOCUS_00630 71410 70196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 72261 71416 gene locus_tag LOCUS_00640 72261 71416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 73411 72239 gene locus_tag LOCUS_00650 73411 72239 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_00650 73955 73476 gene locus_tag LOCUS_00660 73955 73476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 77424 74620 gene locus_tag LOCUS_00670 77424 74620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00670 78200 77439 gene locus_tag LOCUS_00680 78200 77439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 81012 78355 gene locus_tag LOCUS_00690 81012 78355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 81789 81427 gene locus_tag LOCUS_00700 81789 81427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 82321 81827 gene locus_tag LOCUS_00710 82321 81827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00710 83313 82246 gene locus_tag LOCUS_00720 83313 82246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00720 85147 83624 gene locus_tag LOCUS_00730 85147 83624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 86908 85436 gene locus_tag LOCUS_00740 86908 85436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 87824 87018 gene locus_tag LOCUS_00750 87824 87018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 90362 88149 gene locus_tag LOCUS_00760 90362 88149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 90877 90365 gene locus_tag LOCUS_00770 90877 90365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 91604 90891 gene locus_tag LOCUS_00780 91604 90891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 92635 92144 gene locus_tag LOCUS_00790 92635 92144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 94172 94516 gene locus_tag LOCUS_00800 94172 94516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 95514 95305 gene locus_tag LOCUS_00810 95514 95305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 95839 95573 gene locus_tag LOCUS_00820 95839 95573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 96433 96358 gene locus_tag LOCUS_t00010 96433 96358 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 96468 96800 gene locus_tag LOCUS_00830 96468 96800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 98205 97924 gene locus_tag LOCUS_00840 98205 97924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 98907 98470 gene locus_tag LOCUS_00850 98907 98470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 99078 99353 gene locus_tag LOCUS_00860 99078 99353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 101638 101393 gene locus_tag LOCUS_00870 101638 101393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 102129 101635 gene locus_tag LOCUS_00880 102129 101635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 102714 103043 gene locus_tag LOCUS_00890 102714 103043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 103345 103082 gene locus_tag LOCUS_00900 103345 103082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 104149 103526 gene locus_tag LOCUS_00910 104149 103526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 104396 104214 gene locus_tag LOCUS_00920 104396 104214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 105172 104855 gene locus_tag LOCUS_00930 105172 104855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 106443 105151 gene locus_tag LOCUS_00940 106443 105151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 107390 106506 gene locus_tag LOCUS_00950 107390 106506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 107556 109286 gene locus_tag LOCUS_00960 107556 109286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 109419 110468 gene locus_tag LOCUS_00970 109419 110468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 110783 110544 gene locus_tag LOCUS_00980 110783 110544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 110674 111471 gene locus_tag LOCUS_00990 110674 111471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 111503 112300 gene locus_tag LOCUS_01000 111503 112300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 112343 113089 gene locus_tag LOCUS_01010 112343 113089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 113298 114665 gene locus_tag LOCUS_01020 113298 114665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 117452 114786 gene locus_tag LOCUS_01030 117452 114786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 117824 118555 gene locus_tag LOCUS_01040 117824 118555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 118940 118569 gene locus_tag LOCUS_01050 118940 118569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 119122 120567 gene locus_tag LOCUS_01060 119122 120567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 120564 121211 gene locus_tag LOCUS_01070 120564 121211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 121208 123199 gene locus_tag LOCUS_01080 121208 123199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 123606 126578 gene locus_tag LOCUS_01090 123606 126578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 126622 127749 gene locus_tag LOCUS_01100 126622 127749 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355766.1 protein_id gnl|my_center|LOCUS_01100 129094 127754 gene locus_tag LOCUS_01110 129094 127754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 129959 129117 gene locus_tag LOCUS_01120 129959 129117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 130061 130999 gene locus_tag LOCUS_01130 130061 130999 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 protein_id gnl|my_center|LOCUS_01130 131074 131463 gene locus_tag LOCUS_01140 131074 131463 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_01140 131478 133244 gene locus_tag LOCUS_01150 131478 133244 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_01150 134495 133257 gene locus_tag LOCUS_01160 134495 133257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 135961 134492 gene locus_tag LOCUS_01170 135961 134492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 136384 136013 gene locus_tag LOCUS_01180 136384 136013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 137832 136516 gene locus_tag LOCUS_01190 137832 136516 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_01190 139524 137857 gene locus_tag LOCUS_01200 139524 137857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 140687 139548 gene locus_tag LOCUS_01210 140687 139548 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_01210 140996 142825 gene locus_tag LOCUS_01220 140996 142825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 143732 142959 gene locus_tag LOCUS_01230 143732 142959 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_01230 145663 143750 gene locus_tag LOCUS_01240 145663 143750 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_01240 146447 145686 gene locus_tag LOCUS_01250 146447 145686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_01250 147607 146570 gene locus_tag LOCUS_01260 147607 146570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 148048 148515 gene locus_tag LOCUS_01270 148048 148515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 148512 149189 gene locus_tag LOCUS_01280 148512 149189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 149229 149780 gene locus_tag LOCUS_01290 gene atpH 149229 149780 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_01290 149825 151366 gene locus_tag LOCUS_01300 gene atpA 149825 151366 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_01300 151374 152279 gene locus_tag LOCUS_01310 gene atpG 151374 152279 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_01310 152334 153947 gene locus_tag LOCUS_01320 gene atpD 152334 153947 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_01320 153972 154388 gene locus_tag LOCUS_01330 153972 154388 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649396.1 protein_id gnl|my_center|LOCUS_01330 154561 156534 gene locus_tag LOCUS_01340 154561 156534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 158527 156599 gene locus_tag LOCUS_01350 gene sppA 158527 156599 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908566.1 protein_id gnl|my_center|LOCUS_01350 158667 159743 gene locus_tag LOCUS_01360 158667 159743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 159807 162395 gene locus_tag LOCUS_01370 159807 162395 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_01370 163041 162409 gene locus_tag LOCUS_01380 163041 162409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 163508 163038 gene locus_tag LOCUS_01390 163508 163038 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_01390 164493 163513 gene locus_tag LOCUS_01400 164493 163513 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259326.1 protein_id gnl|my_center|LOCUS_01400 164771 164499 gene locus_tag LOCUS_01410 164771 164499 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_01410 165525 164836 gene locus_tag LOCUS_01420 165525 164836 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923352.1 protein_id gnl|my_center|LOCUS_01420 166475 165522 gene locus_tag LOCUS_01430 gene cysK 166475 165522 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_01430 166897 166484 gene locus_tag LOCUS_01440 166897 166484 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_01440 167281 167841 gene locus_tag LOCUS_01450 gene efp 167281 167841 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_01450 167866 168885 gene locus_tag LOCUS_01460 gene epmA 167866 168885 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338254.1 protein_id gnl|my_center|LOCUS_01460 169191 170252 gene locus_tag LOCUS_01470 169191 170252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 170256 171053 gene locus_tag LOCUS_01480 170256 171053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 171160 171891 gene locus_tag LOCUS_01490 gene tolQ 171160 171891 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_01490 171893 172408 gene locus_tag LOCUS_01500 gene tolR 171893 172408 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_01500 172639 173088 gene locus_tag LOCUS_01510 gene tolR 172639 173088 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_01510 173155 177165 gene locus_tag LOCUS_01520 173155 177165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 177791 177273 gene locus_tag LOCUS_01530 177791 177273 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328180.1 protein_id gnl|my_center|LOCUS_01530 177878 178849 gene locus_tag LOCUS_01540 177878 178849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 180017 178953 gene locus_tag LOCUS_01550 180017 178953 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_01550 180360 181862 gene locus_tag LOCUS_01560 180360 181862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 182815 181877 gene locus_tag LOCUS_01570 182815 181877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_01570 183182 182973 gene locus_tag LOCUS_01580 183182 182973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 183239 183928 gene locus_tag LOCUS_01590 183239 183928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 183909 184091 gene locus_tag LOCUS_01600 183909 184091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 184196 184549 gene locus_tag LOCUS_01610 gene dksA 184196 184549 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881370.1 protein_id gnl|my_center|LOCUS_01610 184589 185455 gene locus_tag LOCUS_01620 gene lgt 184589 185455 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922849.1 protein_id gnl|my_center|LOCUS_01620 185467 186087 gene locus_tag LOCUS_01630 185467 186087 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_01630 186333 186257 gene locus_tag LOCUS_t00020 186333 186257 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 186595 187773 gene locus_tag LOCUS_01640 186595 187773 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339111.1 protein_id gnl|my_center|LOCUS_01640 187813 188688 gene locus_tag LOCUS_01650 187813 188688 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_01650 188685 189509 gene locus_tag LOCUS_01660 188685 189509 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_01660 189553 190701 gene locus_tag LOCUS_01670 189553 190701 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_01670 190767 191309 gene locus_tag LOCUS_01680 190767 191309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 191312 192478 gene locus_tag LOCUS_01690 191312 192478 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_01690 192505 193119 gene locus_tag LOCUS_01700 192505 193119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 193119 194525 gene locus_tag LOCUS_01710 193119 194525 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389860.1 protein_id gnl|my_center|LOCUS_01710 194522 195595 gene locus_tag LOCUS_01720 gene holA 194522 195595 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_01720 195678 196493 gene locus_tag LOCUS_01730 195678 196493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 196960 196691 gene locus_tag LOCUS_01740 gene rpsT 196960 196691 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_01740 197184 198053 gene locus_tag LOCUS_01750 197184 198053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 198584 198195 gene locus_tag LOCUS_01760 198584 198195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 198818 199168 gene locus_tag LOCUS_01770 198818 199168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 199165 200754 gene locus_tag LOCUS_01780 199165 200754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 200809 201453 gene locus_tag LOCUS_01790 200809 201453 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 protein_id gnl|my_center|LOCUS_01790 201566 202066 gene locus_tag LOCUS_01800 201566 202066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 202182 203111 gene locus_tag LOCUS_01810 gene gluQRS 202182 203111 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888322.1 protein_id gnl|my_center|LOCUS_01810 203236 205440 gene locus_tag LOCUS_01820 203236 205440 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_01820 205559 206947 gene locus_tag LOCUS_01830 205559 206947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 207550 206981 gene locus_tag LOCUS_01840 207550 206981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 209180 207705 gene locus_tag LOCUS_01850 209180 207705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 209560 209177 gene locus_tag LOCUS_01860 209560 209177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 210326 209544 gene locus_tag LOCUS_01870 210326 209544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 211544 210393 gene locus_tag LOCUS_01880 211544 210393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 211693 212286 gene locus_tag LOCUS_01890 211693 212286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 212557 213105 gene locus_tag LOCUS_01900 212557 213105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 213102 213470 gene locus_tag LOCUS_01910 213102 213470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 214429 213497 gene locus_tag LOCUS_01920 214429 213497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_01920 215397 214738 gene locus_tag LOCUS_01930 215397 214738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01930 217102 215897 gene locus_tag LOCUS_01940 217102 215897 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_01940 217401 217099 gene locus_tag LOCUS_01950 217401 217099 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064609.1 protein_id gnl|my_center|LOCUS_01950 217911 217489 gene locus_tag LOCUS_01960 217911 217489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 218108 218908 gene locus_tag LOCUS_01970 218108 218908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 219757 219008 gene locus_tag LOCUS_01980 219757 219008 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_01980 220355 219777 gene locus_tag LOCUS_01990 220355 219777 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_01990 220419 221489 gene locus_tag LOCUS_02000 220419 221489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 221527 222552 gene locus_tag LOCUS_02010 221527 222552 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144241.1 protein_id gnl|my_center|LOCUS_02010 222649 224319 gene locus_tag LOCUS_02020 222649 224319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 225339 224395 gene locus_tag LOCUS_02030 225339 224395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 225503 227743 gene locus_tag LOCUS_02040 225503 227743 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_02040 228584 227835 gene locus_tag LOCUS_02050 228584 227835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 228656 228961 gene locus_tag LOCUS_02060 228656 228961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 229024 229401 gene locus_tag LOCUS_02070 229024 229401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 229403 229909 gene locus_tag LOCUS_02080 gene ruvC 229403 229909 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814225.1 protein_id gnl|my_center|LOCUS_02080 229953 230579 gene locus_tag LOCUS_02090 gene ruvA 229953 230579 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_02090 231943 230561 gene locus_tag LOCUS_02100 231943 230561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 232851 231940 gene locus_tag LOCUS_02110 232851 231940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 233742 232867 gene locus_tag LOCUS_02120 233742 232867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 234367 233792 gene locus_tag LOCUS_02130 234367 233792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 235119 234364 gene locus_tag LOCUS_02140 235119 234364 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_02140 235196 236326 gene locus_tag LOCUS_02150 235196 236326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 236539 237573 gene locus_tag LOCUS_02160 236539 237573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 237642 238988 gene locus_tag LOCUS_02170 gene hflX 237642 238988 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261607.1 protein_id gnl|my_center|LOCUS_02170 239028 242291 gene locus_tag LOCUS_02180 239028 242291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 242559 242299 gene locus_tag LOCUS_02190 242559 242299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 242752 243000 gene locus_tag LOCUS_02200 242752 243000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 243017 243328 gene locus_tag LOCUS_02210 243017 243328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 243268 243561 gene locus_tag LOCUS_02220 243268 243561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 243580 244872 gene locus_tag LOCUS_02230 243580 244872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 248671 244841 gene locus_tag LOCUS_02240 248671 244841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 248987 248802 gene locus_tag LOCUS_02250 248987 248802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 251491 249071 gene locus_tag LOCUS_02260 251491 249071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 251730 252002 gene locus_tag LOCUS_02270 251730 252002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 252182 252910 gene locus_tag LOCUS_02280 gene rph 252182 252910 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256154.1 protein_id gnl|my_center|LOCUS_02280 253008 253688 gene locus_tag LOCUS_02290 gene rdgB 253008 253688 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_02290 253777 253853 gene locus_tag LOCUS_t00030 253777 253853 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 253855 253929 gene locus_tag LOCUS_t00040 253855 253929 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 255117 253987 gene locus_tag LOCUS_02300 gene rlmN 255117 253987 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040078.1 protein_id gnl|my_center|LOCUS_02300 255596 255177 gene locus_tag LOCUS_02310 gene ndk 255596 255177 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_02310 256194 255721 gene locus_tag LOCUS_02320 256194 255721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 256271 257491 gene locus_tag LOCUS_02330 256271 257491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 257576 261241 gene locus_tag LOCUS_02340 gene dnaE 257576 261241 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_02340 262154 261267 gene locus_tag LOCUS_02350 262154 261267 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_02350 262786 262244 gene locus_tag LOCUS_02360 262786 262244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 262969 265653 gene locus_tag LOCUS_02370 262969 265653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 265730 266443 gene locus_tag LOCUS_02380 265730 266443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 266580 277301 gene locus_tag LOCUS_02390 266580 277301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 278231 277539 gene locus_tag LOCUS_02400 278231 277539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 278324 278824 gene locus_tag LOCUS_02410 278324 278824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 278821 279972 gene locus_tag LOCUS_02420 278821 279972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 279969 281306 gene locus_tag LOCUS_02430 279969 281306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 281721 281383 gene locus_tag LOCUS_02440 281721 281383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 282067 281852 gene locus_tag LOCUS_02450 282067 281852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 281997 282554 gene locus_tag LOCUS_02460 281997 282554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 282616 283074 gene locus_tag LOCUS_02470 282616 283074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 287286 283141 gene locus_tag LOCUS_02480 287286 283141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 287557 288348 gene locus_tag LOCUS_02490 287557 288348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 288594 288779 gene locus_tag LOCUS_02500 gene rpmF 288594 288779 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_02500 288811 289878 gene locus_tag LOCUS_02510 gene plsX 288811 289878 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_02510 289956 290894 gene locus_tag LOCUS_02520 gene fabD 289956 290894 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_02520 290891 291697 gene locus_tag LOCUS_02530 gene fabG 290891 291697 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_02530 291752 291997 gene locus_tag LOCUS_02540 gene acpP 291752 291997 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_02540 292051 293268 gene locus_tag LOCUS_02550 gene fabF 292051 293268 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_02550 292567 292475 gene locus_tag LOCUS_t00050 292567 292475 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 293272 293718 gene locus_tag LOCUS_02560 gene rpiB 293272 293718 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932826.1 protein_id gnl|my_center|LOCUS_02560 293722 294330 gene locus_tag LOCUS_02570 gene nrdR 293722 294330 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_02570 294320 295507 gene locus_tag LOCUS_02580 gene ribD 294320 295507 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_02580 295568 296257 gene locus_tag LOCUS_02590 295568 296257 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532248.1 protein_id gnl|my_center|LOCUS_02590 296254 297411 gene locus_tag LOCUS_02600 296254 297411 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938495.1 protein_id gnl|my_center|LOCUS_02600 297458 298738 gene locus_tag LOCUS_02610 gene coaBC 297458 298738 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923348.1 protein_id gnl|my_center|LOCUS_02610 298735 299742 gene locus_tag LOCUS_02620 298735 299742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 299796 300431 gene locus_tag LOCUS_02630 299796 300431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 301016 300540 gene locus_tag LOCUS_02640 301016 300540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 301330 301773 gene locus_tag LOCUS_02650 301330 301773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 301721 301915 gene locus_tag LOCUS_02660 301721 301915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 303136 301919 gene locus_tag LOCUS_02670 gene amrB 303136 301919 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_02670 304805 303219 gene locus_tag LOCUS_02680 304805 303219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 306245 304869 gene locus_tag LOCUS_02690 306245 304869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 306346 307380 gene locus_tag LOCUS_02700 gene queA 306346 307380 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940607.1 protein_id gnl|my_center|LOCUS_02700 307487 308797 gene locus_tag LOCUS_02710 gene tgt 307487 308797 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938027.1 protein_id gnl|my_center|LOCUS_02710 308918 309277 gene locus_tag LOCUS_02720 308918 309277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 309284 311425 gene locus_tag LOCUS_02730 309284 311425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 311442 312875 gene locus_tag LOCUS_02740 311442 312875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 312952 314829 gene locus_tag LOCUS_02750 gene recJ 312952 314829 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_02750 314873 315622 gene locus_tag LOCUS_02760 314873 315622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 315583 315798 gene locus_tag LOCUS_02770 315583 315798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 315802 316266 gene locus_tag LOCUS_02780 315802 316266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 318223 316274 gene locus_tag LOCUS_02790 318223 316274 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_02790 317293 317388 gene locus_tag LOCUS_t00060 317293 317388 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 318264 319406 gene locus_tag LOCUS_02800 gene pfkA 318264 319406 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723299.1 protein_id gnl|my_center|LOCUS_02800 320007 319498 gene locus_tag LOCUS_02810 320007 319498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 320224 320547 gene locus_tag LOCUS_02820 320224 320547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 320567 321265 gene locus_tag LOCUS_02830 gene fliA 320567 321265 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_02830 321331 321834 gene locus_tag LOCUS_02840 321331 321834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 321876 324341 gene locus_tag LOCUS_02850 321876 324341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 324344 324712 gene locus_tag LOCUS_02860 324344 324712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 324717 326114 gene locus_tag LOCUS_02870 324717 326114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 327217 326222 gene locus_tag LOCUS_02880 327217 326222 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338116.1 protein_id gnl|my_center|LOCUS_02880 328743 327217 gene locus_tag LOCUS_02890 328743 327217 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_02890 329579 328848 gene locus_tag LOCUS_02900 329579 328848 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_02900 329703 330095 gene locus_tag LOCUS_02910 329703 330095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 331734 330184 gene locus_tag LOCUS_02920 331734 330184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 332587 331847 gene locus_tag LOCUS_02930 332587 331847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 333610 332642 gene locus_tag LOCUS_02940 333610 332642 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_02940 333693 334556 gene locus_tag LOCUS_02950 333693 334556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 334481 335905 gene locus_tag LOCUS_02960 334481 335905 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528777.1 protein_id gnl|my_center|LOCUS_02960 335985 339185 gene locus_tag LOCUS_02970 gene dnaE2 335985 339185 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_02970 339334 340851 gene locus_tag LOCUS_02980 339334 340851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 341929 340898 gene locus_tag LOCUS_02990 341929 340898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 342330 342722 gene locus_tag LOCUS_03000 342330 342722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 342745 343338 gene locus_tag LOCUS_03010 342745 343338 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_03010 344043 343351 gene locus_tag LOCUS_03020 344043 343351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 344012 345130 gene locus_tag LOCUS_03030 344012 345130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 345256 346188 gene locus_tag LOCUS_03040 345256 346188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 348156 346243 gene locus_tag LOCUS_03050 348156 346243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 350056 350502 gene locus_tag LOCUS_03060 350056 350502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 351726 350539 gene locus_tag LOCUS_03070 351726 350539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 351930 352898 gene locus_tag LOCUS_03080 351930 352898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 352957 353685 gene locus_tag LOCUS_03090 352957 353685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 353687 354484 gene locus_tag LOCUS_03100 353687 354484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 354494 354880 gene locus_tag LOCUS_03110 354494 354880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 356809 354926 gene locus_tag LOCUS_03120 356809 354926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 359026 356885 gene locus_tag LOCUS_03130 359026 356885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 359674 359030 gene locus_tag LOCUS_03140 359674 359030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 359781 359972 gene locus_tag LOCUS_03150 359781 359972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 360217 361014 gene locus_tag LOCUS_03160 360217 361014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 361281 361018 gene locus_tag LOCUS_03170 361281 361018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 363116 361503 gene locus_tag LOCUS_03180 363116 361503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 365686 363164 gene locus_tag LOCUS_03190 365686 363164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 365651 366367 gene locus_tag LOCUS_03200 365651 366367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 366367 367071 gene locus_tag LOCUS_03210 366367 367071 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_03210 367068 367712 gene locus_tag LOCUS_03220 367068 367712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 367751 368245 gene locus_tag LOCUS_03230 367751 368245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 368470 370740 gene locus_tag LOCUS_03240 368470 370740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 370737 372218 gene locus_tag LOCUS_03250 370737 372218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 372224 372979 gene locus_tag LOCUS_03260 372224 372979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 372976 375492 gene locus_tag LOCUS_03270 372976 375492 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312594.1 protein_id gnl|my_center|LOCUS_03270 375545 376168 gene locus_tag LOCUS_03280 375545 376168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 376165 376746 gene locus_tag LOCUS_03290 376165 376746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 376761 377087 gene locus_tag LOCUS_03300 376761 377087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 377092 377697 gene locus_tag LOCUS_03310 377092 377697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 378477 377737 gene locus_tag LOCUS_03320 378477 377737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 379133 378921 gene locus_tag LOCUS_03330 379133 378921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 379015 379662 gene locus_tag LOCUS_03340 379015 379662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 379670 380077 gene locus_tag LOCUS_03350 379670 380077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 380158 380685 gene locus_tag LOCUS_03360 380158 380685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 380916 382045 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgtcggccggggcgtcggt 383075 383686 gene locus_tag LOCUS_03370 383075 383686 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_03370 384135 383794 gene locus_tag LOCUS_03380 384135 383794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 386912 384186 gene locus_tag LOCUS_03390 386912 384186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 387181 393654 gene locus_tag LOCUS_03400 387181 393654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 393744 395705 gene locus_tag LOCUS_03410 393744 395705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 396131 395808 gene locus_tag LOCUS_03420 396131 395808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 396598 396299 gene locus_tag LOCUS_03430 396598 396299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 397565 396846 gene locus_tag LOCUS_03440 397565 396846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 398135 399697 gene locus_tag LOCUS_03450 398135 399697 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_03450 399803 399976 gene locus_tag LOCUS_03460 399803 399976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 400633 399980 gene locus_tag LOCUS_03470 400633 399980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 400781 401704 gene locus_tag LOCUS_03480 400781 401704 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_03480 401694 402362 gene locus_tag LOCUS_03490 gene gmk 401694 402362 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_03490 402421 404946 gene locus_tag LOCUS_03500 402421 404946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 405042 405230 gene locus_tag LOCUS_03510 405042 405230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 405625 408057 gene locus_tag LOCUS_03520 405625 408057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 410436 408166 gene locus_tag LOCUS_03530 410436 408166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 412721 410601 gene locus_tag LOCUS_03540 412721 410601 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_03540 414190 412880 gene locus_tag LOCUS_03550 414190 412880 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_03550 415496 414270 gene locus_tag LOCUS_03560 415496 414270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 415700 416458 gene locus_tag LOCUS_03570 415700 416458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_03570 416460 417323 gene locus_tag LOCUS_03580 416460 417323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03580 417326 419278 gene locus_tag LOCUS_03590 417326 419278 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_03590 419275 420639 gene locus_tag LOCUS_03600 419275 420639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 420845 422980 gene locus_tag LOCUS_03610 420845 422980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 423660 423022 gene locus_tag LOCUS_03620 423660 423022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 424757 423846 gene locus_tag LOCUS_03630 gene mazG 424757 423846 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_03630 424824 425960 gene locus_tag LOCUS_03640 424824 425960 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_03640 426476 427366 gene locus_tag LOCUS_03650 426476 427366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 427694 429352 gene locus_tag LOCUS_03660 427694 429352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 429526 431385 gene locus_tag LOCUS_03670 429526 431385 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_03670 431382 432074 gene locus_tag LOCUS_03680 431382 432074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 432217 433137 gene locus_tag LOCUS_03690 432217 433137 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 protein_id gnl|my_center|LOCUS_03690 433837 433205 gene locus_tag LOCUS_03700 433837 433205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 434472 433834 gene locus_tag LOCUS_03710 434472 433834 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_03710 435362 434469 gene locus_tag LOCUS_03720 435362 434469 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_03720 435705 436472 gene locus_tag LOCUS_03730 435705 436472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 436493 437914 gene locus_tag LOCUS_03740 gene nusA 436493 437914 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_03740 437917 438321 gene locus_tag LOCUS_03750 437917 438321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 438659 441922 gene locus_tag LOCUS_03760 438659 441922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 442065 442448 gene locus_tag LOCUS_03770 gene rbfA 442065 442448 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994317.1 protein_id gnl|my_center|LOCUS_03770 442445 443587 gene locus_tag LOCUS_03780 442445 443587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 443679 443948 gene locus_tag LOCUS_03790 gene rpsO 443679 443948 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_03790 444120 446225 gene locus_tag LOCUS_03800 gene pnp 444120 446225 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_03800 446253 446804 gene locus_tag LOCUS_03810 gene dut 446253 446804 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552523.1 protein_id gnl|my_center|LOCUS_03810 446819 448948 gene locus_tag LOCUS_03820 446819 448948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 449066 450043 gene locus_tag LOCUS_03830 449066 450043 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404262.1 protein_id gnl|my_center|LOCUS_03830 450122 450481 gene locus_tag LOCUS_03840 450122 450481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 450605 451993 gene locus_tag LOCUS_03850 gene purF 450605 451993 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_03850 452269 453162 gene locus_tag LOCUS_03860 gene prfB 452269 453162 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 453890 455188 gene locus_tag LOCUS_03870 453890 455188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 455185 456948 gene locus_tag LOCUS_03880 455185 456948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 457055 457765 gene locus_tag LOCUS_03890 457055 457765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_03890 457762 460350 gene locus_tag LOCUS_03900 gene bamA 457762 460350 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_03900 460577 461128 gene locus_tag LOCUS_03910 460577 461128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 461130 461726 gene locus_tag LOCUS_03920 461130 461726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 461810 462277 gene locus_tag LOCUS_03930 gene fabZ 461810 462277 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_03930 462274 462927 gene locus_tag LOCUS_03940 462274 462927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 463250 463444 gene locus_tag LOCUS_03950 463250 463444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 463633 465015 gene locus_tag LOCUS_03960 463633 465015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 465048 465974 gene locus_tag LOCUS_03970 gene folP 465048 465974 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_03970 465961 466923 gene locus_tag LOCUS_03980 gene cdaA 465961 466923 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_03980 466920 467903 gene locus_tag LOCUS_03990 466920 467903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 468588 467911 gene locus_tag LOCUS_04000 468588 467911 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090769.1 protein_id gnl|my_center|LOCUS_04000 468854 468585 gene locus_tag LOCUS_04010 468854 468585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 469031 469468 gene locus_tag LOCUS_04020 469031 469468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 470110 469598 gene locus_tag LOCUS_04030 470110 469598 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_04030 470251 471381 gene locus_tag LOCUS_04040 470251 471381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 471425 472438 gene locus_tag LOCUS_04050 471425 472438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 472435 473412 gene locus_tag LOCUS_04060 472435 473412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 473989 474774 gene locus_tag LOCUS_04070 473989 474774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 474824 475567 gene locus_tag LOCUS_04080 474824 475567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 475683 477323 gene locus_tag LOCUS_04090 475683 477323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 477396 478328 gene locus_tag LOCUS_04100 gene xerC 477396 478328 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_04100 479429 478332 gene locus_tag LOCUS_04110 479429 478332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 479493 480269 gene locus_tag LOCUS_04120 479493 480269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 480356 481078 gene locus_tag LOCUS_04130 480356 481078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 481244 483082 gene locus_tag LOCUS_04140 gene dnaK 481244 483082 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_04140 484292 483153 gene locus_tag LOCUS_04150 484292 483153 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_04150 485016 484369 gene locus_tag LOCUS_04160 gene coaE 485016 484369 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_04160 485088 485804 gene locus_tag LOCUS_04170 gene yihA 485088 485804 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_04170 486003 486806 gene locus_tag LOCUS_04180 486003 486806 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_04180 486803 487783 gene locus_tag LOCUS_04190 486803 487783 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_04190 488068 488901 gene locus_tag LOCUS_04200 gene asd 488068 488901 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_04200 488898 490667 gene locus_tag LOCUS_04210 488898 490667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 491458 492612 gene locus_tag LOCUS_04220 491458 492612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 492662 493081 gene locus_tag LOCUS_04230 492662 493081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 494364 493159 gene locus_tag LOCUS_04240 494364 493159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 494605 496860 gene locus_tag LOCUS_04250 494605 496860 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_04250 497198 496947 gene locus_tag LOCUS_04260 497198 496947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 499511 497220 gene locus_tag LOCUS_04270 gene recG 499511 497220 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063863.1 protein_id gnl|my_center|LOCUS_04270 500657 499764 gene locus_tag LOCUS_04280 500657 499764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 501002 502612 gene locus_tag LOCUS_04290 501002 502612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 502615 504849 gene locus_tag LOCUS_04300 502615 504849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 505996 505043 gene locus_tag LOCUS_04310 505996 505043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 507299 506028 gene locus_tag LOCUS_04320 507299 506028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_04320 507368 508741 gene locus_tag LOCUS_04330 507368 508741 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_04330 508738 509895 gene locus_tag LOCUS_04340 508738 509895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 510753 509995 gene locus_tag LOCUS_04350 510753 509995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 511468 510773 gene locus_tag LOCUS_04360 511468 510773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 513765 511738 gene locus_tag LOCUS_04370 513765 511738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 514578 513880 gene locus_tag LOCUS_04380 514578 513880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_04380 515529 514726 gene locus_tag LOCUS_04390 515529 514726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 516892 515609 gene locus_tag LOCUS_04400 516892 515609 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_04400 521542 516986 gene locus_tag LOCUS_04410 521542 516986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 522552 521764 gene locus_tag LOCUS_04420 522552 521764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 524416 522611 gene locus_tag LOCUS_04430 524416 522611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 525324 524539 gene locus_tag LOCUS_04440 525324 524539 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_04440 525432 526085 gene locus_tag LOCUS_04450 525432 526085 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977395.1 protein_id gnl|my_center|LOCUS_04450 526164 526955 gene locus_tag LOCUS_04460 526164 526955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 527942 527076 gene locus_tag LOCUS_04470 527942 527076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 528150 529094 gene locus_tag LOCUS_04480 528150 529094 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079950.1 protein_id gnl|my_center|LOCUS_04480 530327 529086 gene locus_tag LOCUS_04490 530327 529086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 531217 530324 gene locus_tag LOCUS_04500 531217 530324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 533024 531411 gene locus_tag LOCUS_04510 gene paaZ 533024 531411 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_04510 533786 533175 gene locus_tag LOCUS_04520 533786 533175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 535763 533811 gene locus_tag LOCUS_04530 535763 533811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 535970 536896 gene locus_tag LOCUS_04540 535970 536896 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_04540 538115 536970 gene locus_tag LOCUS_04550 538115 536970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 539337 538132 gene locus_tag LOCUS_04560 539337 538132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 543014 539373 gene locus_tag LOCUS_04570 543014 539373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 543013 543501 gene locus_tag LOCUS_04580 543013 543501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 543564 544355 gene locus_tag LOCUS_04590 gene folD 543564 544355 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384886.1 protein_id gnl|my_center|LOCUS_04590 545452 544454 gene locus_tag LOCUS_04600 545452 544454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 547953 545449 gene locus_tag LOCUS_04610 547953 545449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 548241 548861 gene locus_tag LOCUS_04620 548241 548861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 549158 550171 gene locus_tag LOCUS_04630 549158 550171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 550168 550953 gene locus_tag LOCUS_04640 550168 550953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 551186 551899 gene locus_tag LOCUS_04650 551186 551899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 551907 552752 gene locus_tag LOCUS_04660 551907 552752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 552924 552997 gene locus_tag LOCUS_t00070 552924 552997 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 553037 553111 gene locus_tag LOCUS_t00080 553037 553111 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 553236 554261 gene locus_tag LOCUS_04670 553236 554261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 555224 554262 gene locus_tag LOCUS_04680 555224 554262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 555238 555732 gene locus_tag LOCUS_04690 555238 555732 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_04690 555760 556953 gene locus_tag LOCUS_04700 555760 556953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 558267 557116 gene locus_tag LOCUS_04710 558267 557116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 558316 558957 gene locus_tag LOCUS_04720 gene nth 558316 558957 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_04720 560607 559000 gene locus_tag LOCUS_04730 560607 559000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 561137 560667 gene locus_tag LOCUS_04740 561137 560667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 562097 561183 gene locus_tag LOCUS_04750 562097 561183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 562441 563346 gene locus_tag LOCUS_04760 562441 563346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 563349 563984 gene locus_tag LOCUS_04770 563349 563984 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_04770 563981 564751 gene locus_tag LOCUS_04780 563981 564751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 565278 566186 gene locus_tag LOCUS_04790 565278 566186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 567053 566658 gene locus_tag LOCUS_04800 567053 566658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 567047 567463 gene locus_tag LOCUS_04810 567047 567463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 567581 568723 gene locus_tag LOCUS_04820 567581 568723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 568720 569973 gene locus_tag LOCUS_04830 568720 569973 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112315.1 protein_id gnl|my_center|LOCUS_04830 571303 569978 gene locus_tag LOCUS_04840 571303 569978 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_04840 572888 571311 gene locus_tag LOCUS_04850 gene pruA 572888 571311 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_04850 574162 572984 gene locus_tag LOCUS_04860 gene mqnE 574162 572984 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_04860 575004 574159 gene locus_tag LOCUS_04870 575004 574159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 575570 575001 gene locus_tag LOCUS_04880 575570 575001 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_04880 576325 575567 gene locus_tag LOCUS_04890 gene ubiE 576325 575567 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_04890 577528 576476 gene locus_tag LOCUS_04900 577528 576476 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383378.1 protein_id gnl|my_center|LOCUS_04900 578088 577528 gene locus_tag LOCUS_04910 578088 577528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 578311 579777 gene locus_tag LOCUS_04920 578311 579777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 581300 579819 gene locus_tag LOCUS_04930 581300 579819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 581760 581446 gene locus_tag LOCUS_04940 581760 581446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 582387 581761 gene locus_tag LOCUS_04950 gene tmk 582387 581761 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_04950 582514 583464 gene locus_tag LOCUS_04960 582514 583464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 583891 583544 gene locus_tag LOCUS_04970 583891 583544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 584155 585036 gene locus_tag LOCUS_04980 gene era 584155 585036 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_04980 585033 586478 gene locus_tag LOCUS_04990 gene der 585033 586478 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_04990 586684 588375 gene locus_tag LOCUS_05000 586684 588375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 589001 588429 gene locus_tag LOCUS_05010 589001 588429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 589023 589292 gene locus_tag LOCUS_05020 589023 589292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 589365 589754 gene locus_tag LOCUS_05030 589365 589754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 589915 590499 gene locus_tag LOCUS_05040 589915 590499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 590515 591624 gene locus_tag LOCUS_05050 590515 591624 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_05050 593184 591646 gene locus_tag LOCUS_05060 gene hutH 593184 591646 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_05060 593518 595785 gene locus_tag LOCUS_05070 593518 595785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 596044 597684 gene locus_tag LOCUS_05080 596044 597684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 598290 597901 gene locus_tag LOCUS_05090 598290 597901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 599546 598392 gene locus_tag LOCUS_05100 599546 598392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 599894 599550 gene locus_tag LOCUS_05110 599894 599550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 599836 601644 gene locus_tag LOCUS_05120 gene lepA 599836 601644 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_05120 601652 604054 gene locus_tag LOCUS_05130 601652 604054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 605911 604220 gene locus_tag LOCUS_05140 605911 604220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 606609 605908 gene locus_tag LOCUS_05150 606609 605908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 606718 606792 gene locus_tag LOCUS_t00090 606718 606792 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 607034 608170 gene locus_tag LOCUS_05160 607034 608170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 609500 608271 gene locus_tag LOCUS_05170 609500 608271 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_05170 609576 610334 gene locus_tag LOCUS_05180 609576 610334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 610583 611836 gene locus_tag LOCUS_05190 610583 611836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 611865 614360 gene locus_tag LOCUS_05200 gene mrcA 611865 614360 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 protein_id gnl|my_center|LOCUS_05200 616526 614472 gene locus_tag LOCUS_05210 gene ftsH 616526 614472 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_05210 617562 616531 gene locus_tag LOCUS_05220 617562 616531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 617592 618836 gene locus_tag LOCUS_05230 617592 618836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 618772 619440 gene locus_tag LOCUS_05240 618772 619440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 620514 619564 gene locus_tag LOCUS_05250 620514 619564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 621785 620511 gene locus_tag LOCUS_05260 621785 620511 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_05260 621865 624012 gene locus_tag LOCUS_05270 621865 624012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 624793 624107 gene locus_tag LOCUS_05280 624793 624107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 625148 626254 gene locus_tag LOCUS_05290 625148 626254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 627930 626344 gene locus_tag LOCUS_05300 627930 626344 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105241.1 protein_id gnl|my_center|LOCUS_05300 628967 627930 gene locus_tag LOCUS_05310 628967 627930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 628948 629274 gene locus_tag LOCUS_05320 628948 629274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 632928 629383 gene locus_tag LOCUS_05330 632928 629383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 636130 632930 gene locus_tag LOCUS_05340 636130 632930 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152945460.1 protein_id gnl|my_center|LOCUS_05340 637239 636127 gene locus_tag LOCUS_05350 637239 636127 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_05350 637389 638003 gene locus_tag LOCUS_05360 637389 638003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 639646 638072 gene locus_tag LOCUS_05370 639646 638072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 639540 639746 gene locus_tag LOCUS_05380 639540 639746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 640811 639774 gene locus_tag LOCUS_05390 640811 639774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 641455 640856 gene locus_tag LOCUS_05400 641455 640856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 643700 641472 gene locus_tag LOCUS_05410 643700 641472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 643802 645382 gene locus_tag LOCUS_05420 gene dacB 643802 645382 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_05420 645629 646669 gene locus_tag LOCUS_05430 645629 646669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 646942 647292 gene locus_tag LOCUS_05440 646942 647292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 647382 649247 gene locus_tag LOCUS_05450 gene typA 647382 649247 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 protein_id gnl|my_center|LOCUS_05450 650036 649314 gene locus_tag LOCUS_05460 650036 649314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 652234 650243 gene locus_tag LOCUS_05470 652234 650243 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 protein_id gnl|my_center|LOCUS_05470 652354 653109 gene locus_tag LOCUS_05480 gene fecE 652354 653109 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266549.1 protein_id gnl|my_center|LOCUS_05480 655241 653115 gene locus_tag LOCUS_05490 655241 653115 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401304.1 protein_id gnl|my_center|LOCUS_05490 655358 656533 gene locus_tag LOCUS_05500 655358 656533 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336824.1 protein_id gnl|my_center|LOCUS_05500 656542 657906 gene locus_tag LOCUS_05510 656542 657906 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_05510 657906 658952 gene locus_tag LOCUS_05520 657906 658952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 658961 660319 gene locus_tag LOCUS_05530 658961 660319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 661867 660368 gene locus_tag LOCUS_05540 661867 660368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 666597 661927 gene locus_tag LOCUS_05550 666597 661927 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_05550 668533 666725 gene locus_tag LOCUS_05560 668533 666725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 669387 668605 gene locus_tag LOCUS_05570 669387 668605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05570 669874 669527 gene locus_tag LOCUS_05580 669874 669527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 670323 669793 gene locus_tag LOCUS_05590 670323 669793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 672190 670472 gene locus_tag LOCUS_05600 672190 670472 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_05600 672189 673565 gene locus_tag LOCUS_05610 672189 673565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 673576 675516 gene locus_tag LOCUS_05620 673576 675516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 675663 676223 gene locus_tag LOCUS_05630 gene sigR 675663 676223 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_05630 676351 676881 gene locus_tag LOCUS_05640 676351 676881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 677738 676878 gene locus_tag LOCUS_05650 677738 676878 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839709.1 protein_id gnl|my_center|LOCUS_05650 677737 678246 gene locus_tag LOCUS_05660 677737 678246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 679155 678373 gene locus_tag LOCUS_05670 679155 678373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 679079 679270 gene locus_tag LOCUS_05680 679079 679270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 679989 679417 gene locus_tag LOCUS_05690 679989 679417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 683469 680137 gene locus_tag LOCUS_05700 683469 680137 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_05700 683557 684717 gene locus_tag LOCUS_05710 683557 684717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 685015 684701 gene locus_tag LOCUS_05720 685015 684701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 684975 686378 gene locus_tag LOCUS_05730 684975 686378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 686470 687744 gene locus_tag LOCUS_05740 gene rpsA 686470 687744 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_05740 691197 687880 gene locus_tag LOCUS_05750 691197 687880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 691670 691419 gene locus_tag LOCUS_05760 691670 691419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 691557 692456 gene locus_tag LOCUS_05770 691557 692456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 692564 694507 gene locus_tag LOCUS_05780 692564 694507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 696192 694693 gene locus_tag LOCUS_05790 696192 694693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 696474 696842 gene locus_tag LOCUS_05800 696474 696842 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 protein_id gnl|my_center|LOCUS_05800 696884 697447 gene locus_tag LOCUS_05810 696884 697447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 699058 697454 gene locus_tag LOCUS_05820 gene lnt 699058 697454 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_05820 700859 699060 gene locus_tag LOCUS_05830 gene aspS 700859 699060 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_05830 701011 701715 gene locus_tag LOCUS_05840 701011 701715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 701633 702595 gene locus_tag LOCUS_05850 701633 702595 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_05850 703866 702664 gene locus_tag LOCUS_05860 703866 702664 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_05860 704216 703869 gene locus_tag LOCUS_05870 704216 703869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05870 704927 706132 gene locus_tag LOCUS_05880 gene purM 704927 706132 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532445.1 protein_id gnl|my_center|LOCUS_05880 706275 708428 gene locus_tag LOCUS_05890 706275 708428 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_05890 708425 708757 gene locus_tag LOCUS_05900 708425 708757 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613859.1 protein_id gnl|my_center|LOCUS_05900 709658 708861 gene locus_tag LOCUS_05910 gene surE 709658 708861 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 protein_id gnl|my_center|LOCUS_05910 709856 709782 gene locus_tag LOCUS_t00100 709856 709782 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 710635 710018 gene locus_tag LOCUS_05920 710635 710018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 710906 710625 gene locus_tag LOCUS_05930 710906 710625 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_05930 713625 710992 gene locus_tag LOCUS_05940 gene pheT 713625 710992 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_05940 714674 713619 gene locus_tag LOCUS_05950 gene pheS 714674 713619 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_05950 715127 714774 gene locus_tag LOCUS_05960 gene rplT 715127 714774 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_05960 715334 715131 gene locus_tag LOCUS_05970 gene rpmI 715334 715131 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679992.1 protein_id gnl|my_center|LOCUS_05970 716211 715498 gene locus_tag LOCUS_05980 716211 715498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 718256 716418 gene locus_tag LOCUS_05990 gene thrS 718256 716418 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939808.1 protein_id gnl|my_center|LOCUS_05990 718423 718351 gene locus_tag LOCUS_t00110 718423 718351 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 719769 718540 gene locus_tag LOCUS_06000 719769 718540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 720359 719766 gene locus_tag LOCUS_06010 720359 719766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 722252 720438 gene locus_tag LOCUS_06020 722252 720438 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_06020 722437 724266 gene locus_tag LOCUS_06030 722437 724266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 724515 724285 gene locus_tag LOCUS_06040 724515 724285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 724397 725491 gene locus_tag LOCUS_06050 724397 725491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 725525 727360 gene locus_tag LOCUS_06060 725525 727360 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_06060 727435 728208 gene locus_tag LOCUS_06070 727435 728208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 728205 730613 gene locus_tag LOCUS_06080 728205 730613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 730792 731139 gene locus_tag LOCUS_06090 730792 731139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 731374 731291 gene locus_tag LOCUS_t00120 731374 731291 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 731500 733491 gene locus_tag LOCUS_06100 731500 733491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 734488 735693 gene locus_tag LOCUS_06110 734488 735693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 735715 736674 gene locus_tag LOCUS_06120 735715 736674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 736687 738120 gene locus_tag LOCUS_06130 736687 738120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 739342 738188 gene locus_tag LOCUS_06140 739342 738188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 740695 739499 gene locus_tag LOCUS_06150 740695 739499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 740316 740236 gene locus_tag LOCUS_t00130 740316 740236 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 741515 740784 gene locus_tag LOCUS_06160 741515 740784 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_06160 741730 741948 gene locus_tag LOCUS_06170 gene thiS 741730 741948 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_06170 742012 742785 gene locus_tag LOCUS_06180 742012 742785 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_06180 742802 743644 gene locus_tag LOCUS_06190 742802 743644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 743619 744557 gene locus_tag LOCUS_06200 743619 744557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 744748 744674 gene locus_tag LOCUS_t00140 744748 744674 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 745186 744818 gene locus_tag LOCUS_06210 745186 744818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 745279 745671 gene locus_tag LOCUS_06220 745279 745671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 745668 746606 gene locus_tag LOCUS_06230 745668 746606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 747836 746676 gene locus_tag LOCUS_06240 747836 746676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 747745 748110 gene locus_tag LOCUS_06250 747745 748110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 748856 748221 gene locus_tag LOCUS_06260 748856 748221 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275419.1 protein_id gnl|my_center|LOCUS_06260 751762 749861 gene locus_tag LOCUS_06270 751762 749861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 753387 751762 gene locus_tag LOCUS_06280 753387 751762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 754639 753455 gene locus_tag LOCUS_06290 754639 753455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 755904 754636 gene locus_tag LOCUS_06300 755904 754636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 757642 755906 gene locus_tag LOCUS_06310 757642 755906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 757957 759174 gene locus_tag LOCUS_06320 757957 759174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 759338 760762 gene locus_tag LOCUS_06330 759338 760762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 760810 761034 gene locus_tag LOCUS_06340 760810 761034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 762277 761069 gene locus_tag LOCUS_06350 762277 761069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 762442 763926 gene locus_tag LOCUS_06360 gene cls 762442 763926 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035272.1 protein_id gnl|my_center|LOCUS_06360 765731 763947 gene locus_tag LOCUS_06370 765731 763947 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_06370 766006 765623 gene locus_tag LOCUS_06380 766006 765623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 766502 766065 gene locus_tag LOCUS_06390 766502 766065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 768398 766572 gene locus_tag LOCUS_06400 768398 766572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616259.1 protein_id gnl|my_center|LOCUS_06400 769621 768395 gene locus_tag LOCUS_06410 769621 768395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 771274 769637 gene locus_tag LOCUS_06420 771274 769637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 771577 772557 gene locus_tag LOCUS_06430 771577 772557 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_06430 773983 772652 gene locus_tag LOCUS_06440 773983 772652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 775446 773986 gene locus_tag LOCUS_06450 775446 773986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 775796 777502 gene locus_tag LOCUS_06460 775796 777502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 778276 777674 gene locus_tag LOCUS_06470 778276 777674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 778399 779499 gene locus_tag LOCUS_06480 778399 779499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 779640 780818 gene locus_tag LOCUS_06490 gene speB 779640 780818 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209826.1 protein_id gnl|my_center|LOCUS_06490 781012 780746 gene locus_tag LOCUS_06500 781012 780746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 781370 784381 gene locus_tag LOCUS_06510 781370 784381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 784476 787379 gene locus_tag LOCUS_06520 784476 787379 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_06520 788663 787401 gene locus_tag LOCUS_06530 788663 787401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 789259 788651 gene locus_tag LOCUS_06540 789259 788651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 791120 789174 gene locus_tag LOCUS_06550 791120 789174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 791327 792466 gene locus_tag LOCUS_06560 791327 792466 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_06560 792596 794194 gene locus_tag LOCUS_06570 792596 794194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 794685 794191 gene locus_tag LOCUS_06580 794685 794191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 794963 794571 gene locus_tag LOCUS_06590 794963 794571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 796536 795046 gene locus_tag LOCUS_06600 gene abfD 796536 795046 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_06600 797203 796565 gene locus_tag LOCUS_06610 797203 796565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 801282 797200 gene locus_tag LOCUS_06620 801282 797200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 801441 802751 gene locus_tag LOCUS_06630 801441 802751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 804932 802860 gene locus_tag LOCUS_06640 804932 802860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 807237 805000 gene locus_tag LOCUS_06650 807237 805000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 808391 807234 gene locus_tag LOCUS_06660 808391 807234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 809560 808394 gene locus_tag LOCUS_06670 809560 808394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 810865 809783 gene locus_tag LOCUS_06680 810865 809783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 811693 811028 gene locus_tag LOCUS_06690 811693 811028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 814090 811730 gene locus_tag LOCUS_06700 814090 811730 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_06700 814965 814171 gene locus_tag LOCUS_06710 814965 814171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 815542 814955 gene locus_tag LOCUS_06720 815542 814955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 815878 815639 gene locus_tag LOCUS_06730 gene acpP 815878 815639 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_06730 817467 815932 gene locus_tag LOCUS_06740 817467 815932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 820053 817498 gene locus_tag LOCUS_06750 820053 817498 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_06750 820720 820523 gene locus_tag LOCUS_06760 820720 820523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 822259 820910 gene locus_tag LOCUS_06770 822259 820910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 824409 822415 gene locus_tag LOCUS_06780 824409 822415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 824454 826901 gene locus_tag LOCUS_06790 gene lon 824454 826901 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228447.1 protein_id gnl|my_center|LOCUS_06790 827597 826932 gene locus_tag LOCUS_06800 827597 826932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 827691 827897 gene locus_tag LOCUS_06810 827691 827897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 828579 828157 gene locus_tag LOCUS_06820 828579 828157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 830135 828627 gene locus_tag LOCUS_06830 830135 828627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 830192 831196 gene locus_tag LOCUS_06840 830192 831196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 831270 831917 gene locus_tag LOCUS_06850 831270 831917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 831914 832777 gene locus_tag LOCUS_06860 831914 832777 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_06860 832909 833328 gene locus_tag LOCUS_06870 832909 833328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 834022 834300 gene locus_tag LOCUS_06880 834022 834300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 834414 835328 gene locus_tag LOCUS_06890 gene ubiA 834414 835328 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_06890 835479 836219 gene locus_tag LOCUS_06900 835479 836219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 836326 837711 gene locus_tag LOCUS_06910 836326 837711 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_06910 836614 836523 gene locus_tag LOCUS_t00150 836614 836523 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 837718 838899 gene locus_tag LOCUS_06920 837718 838899 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_06920 840124 838967 gene locus_tag LOCUS_06930 840124 838967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 840149 842248 gene locus_tag LOCUS_06940 840149 842248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 842374 843516 gene locus_tag LOCUS_06950 842374 843516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 843408 843893 gene locus_tag LOCUS_06960 843408 843893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 845490 843880 gene locus_tag LOCUS_06970 845490 843880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 846367 845666 gene locus_tag LOCUS_06980 gene pspA 846367 845666 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428804.1 protein_id gnl|my_center|LOCUS_06980 846447 847676 gene locus_tag LOCUS_06990 846447 847676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 847694 848065 gene locus_tag LOCUS_07000 847694 848065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 848107 849117 gene locus_tag LOCUS_07010 848107 849117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 850568 849228 gene locus_tag LOCUS_07020 850568 849228 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_07020 850665 851189 gene locus_tag LOCUS_07030 850665 851189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 851186 851575 gene locus_tag LOCUS_07040 851186 851575 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_07040 851691 854687 gene locus_tag LOCUS_07050 851691 854687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 856734 854827 gene locus_tag LOCUS_07060 856734 854827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 858363 856900 gene locus_tag LOCUS_07070 858363 856900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 859723 858401 gene locus_tag LOCUS_07080 859723 858401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 860551 859853 gene locus_tag LOCUS_07090 860551 859853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 863776 860579 gene locus_tag LOCUS_07100 863776 860579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 864026 866035 gene locus_tag LOCUS_07110 864026 866035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 866911 866234 gene locus_tag LOCUS_07120 866911 866234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 866914 867222 gene locus_tag LOCUS_07130 866914 867222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 872183 867486 gene locus_tag LOCUS_07140 gene gdhB 872183 867486 CDS product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 protein_id gnl|my_center|LOCUS_07140 872374 873738 gene locus_tag LOCUS_07150 gene pepP 872374 873738 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444958.1 protein_id gnl|my_center|LOCUS_07150 875016 873745 gene locus_tag LOCUS_07160 875016 873745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 875957 875013 gene locus_tag LOCUS_07170 875957 875013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 878789 876126 gene locus_tag LOCUS_07180 878789 876126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 878966 879877 gene locus_tag LOCUS_07190 878966 879877 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_07190 879915 883802 gene locus_tag LOCUS_07200 879915 883802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 884017 884664 gene locus_tag LOCUS_07210 884017 884664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 885301 884726 gene locus_tag LOCUS_07220 885301 884726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 886319 885453 gene locus_tag LOCUS_07230 886319 885453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 886766 886368 gene locus_tag LOCUS_07240 886766 886368 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_07240 887971 886826 gene locus_tag LOCUS_07250 887971 886826 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335445.1 protein_id gnl|my_center|LOCUS_07250 888489 887968 gene locus_tag LOCUS_07260 gene purE 888489 887968 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_07260 890027 888495 gene locus_tag LOCUS_07270 890027 888495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 890026 891441 gene locus_tag LOCUS_07280 gene miaB 890026 891441 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_07280 892591 891518 gene locus_tag LOCUS_07290 892591 891518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 892930 895293 gene locus_tag LOCUS_07300 892930 895293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 895383 898547 gene locus_tag LOCUS_07310 895383 898547 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_07310 899956 898544 gene locus_tag LOCUS_07320 899956 898544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 900446 900066 gene locus_tag LOCUS_07330 900446 900066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 902569 900521 gene locus_tag LOCUS_07340 902569 900521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 902605 905043 gene locus_tag LOCUS_07350 902605 905043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 906017 905088 gene locus_tag LOCUS_07360 906017 905088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 907257 906019 gene locus_tag LOCUS_07370 907257 906019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 907924 907247 gene locus_tag LOCUS_07380 907924 907247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 908688 908086 gene locus_tag LOCUS_07390 908688 908086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 908687 910618 gene locus_tag LOCUS_07400 908687 910618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 912331 910637 gene locus_tag LOCUS_07410 912331 910637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 912440 912988 gene locus_tag LOCUS_07420 912440 912988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 912985 913221 gene locus_tag LOCUS_07430 912985 913221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 913221 914777 gene locus_tag LOCUS_07440 gene hxsB 913221 914777 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_07440 914790 915071 gene locus_tag LOCUS_07450 914790 915071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 915085 916086 gene locus_tag LOCUS_07460 915085 916086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 916165 917046 gene locus_tag LOCUS_07470 916165 917046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 917043 917429 gene locus_tag LOCUS_07480 917043 917429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 918272 917508 gene locus_tag LOCUS_07490 918272 917508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 919358 918366 gene locus_tag LOCUS_07500 919358 918366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 920313 919411 gene locus_tag LOCUS_07510 920313 919411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 920373 921746 gene locus_tag LOCUS_07520 920373 921746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 921912 926201 gene locus_tag LOCUS_07530 921912 926201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 926384 926989 gene locus_tag LOCUS_07540 926384 926989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 927063 928454 gene locus_tag LOCUS_07550 927063 928454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 928532 929059 gene locus_tag LOCUS_07560 928532 929059 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284958.1 protein_id gnl|my_center|LOCUS_07560 930654 929116 gene locus_tag LOCUS_07570 930654 929116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 931484 930831 gene locus_tag LOCUS_07580 931484 930831 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_07580 931643 931558 gene locus_tag LOCUS_t00160 931643 931558 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 932543 931731 gene locus_tag LOCUS_07590 932543 931731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 933847 932543 gene locus_tag LOCUS_07600 933847 932543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 934601 933855 gene locus_tag LOCUS_07610 gene aat 934601 933855 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_07610 935952 934621 gene locus_tag LOCUS_07620 935952 934621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 935861 936295 gene locus_tag LOCUS_07630 935861 936295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 937974 936259 gene locus_tag LOCUS_07640 gene glgP 937974 936259 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_07640 940800 938032 gene locus_tag LOCUS_07650 940800 938032 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966095.1 protein_id gnl|my_center|LOCUS_07650 940799 943222 gene locus_tag LOCUS_07660 940799 943222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 944937 943360 gene locus_tag LOCUS_07670 944937 943360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 944828 945190 gene locus_tag LOCUS_07680 944828 945190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 947027 945288 gene locus_tag LOCUS_07690 947027 945288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 947652 947170 gene locus_tag LOCUS_07700 947652 947170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 948383 947649 gene locus_tag LOCUS_07710 948383 947649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 951020 949059 gene locus_tag LOCUS_07720 951020 949059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 952159 951389 gene locus_tag LOCUS_07730 952159 951389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 952309 953202 gene locus_tag LOCUS_07740 952309 953202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 953957 953268 gene locus_tag LOCUS_07750 953957 953268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 953848 954096 gene locus_tag LOCUS_07760 953848 954096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 954265 955083 gene locus_tag LOCUS_07770 954265 955083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 955888 955121 gene locus_tag LOCUS_07780 955888 955121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 959616 956014 gene locus_tag LOCUS_07790 959616 956014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 961571 959613 gene locus_tag LOCUS_07800 961571 959613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 962529 961750 gene locus_tag LOCUS_07810 gene recO 962529 961750 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140088.1 protein_id gnl|my_center|LOCUS_07810 963898 962540 gene locus_tag LOCUS_07820 gene mgtE 963898 962540 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_07820 964529 963969 gene locus_tag LOCUS_07830 964529 963969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 965143 965967 gene locus_tag LOCUS_07840 965143 965967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 966040 967023 gene locus_tag LOCUS_07850 966040 967023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 967020 967589 gene locus_tag LOCUS_07860 967020 967589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 967773 967847 gene locus_tag LOCUS_t00170 967773 967847 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 967918 968340 gene locus_tag LOCUS_07870 967918 968340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 968344 974409 gene locus_tag LOCUS_07880 968344 974409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 974555 978370 gene locus_tag LOCUS_07890 974555 978370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 978377 978545 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccgacctgtccgccaggacatgtc 978603 979517 gene locus_tag LOCUS_07900 978603 979517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 981347 979536 gene locus_tag LOCUS_07910 gene ggt 981347 979536 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_07910 981499 981570 gene locus_tag LOCUS_t00180 981499 981570 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 981618 981690 gene locus_tag LOCUS_t00190 981618 981690 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 982328 984169 gene locus_tag LOCUS_07920 982328 984169 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_07920 984182 985183 gene locus_tag LOCUS_07930 984182 985183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 985285 985983 gene locus_tag LOCUS_07940 985285 985983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 986043 987053 gene locus_tag LOCUS_07950 986043 987053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 987058 988677 gene locus_tag LOCUS_07960 987058 988677 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480009.1 protein_id gnl|my_center|LOCUS_07960 988754 990229 gene locus_tag LOCUS_07970 988754 990229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 990309 991367 gene locus_tag LOCUS_07980 990309 991367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 992344 991412 gene locus_tag LOCUS_07990 992344 991412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 993288 992377 gene locus_tag LOCUS_08000 993288 992377 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_08000 993534 995147 gene locus_tag LOCUS_08010 993534 995147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 995399 996688 gene locus_tag LOCUS_08020 995399 996688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 996685 997734 gene locus_tag LOCUS_08030 996685 997734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 997724 998863 gene locus_tag LOCUS_08040 997724 998863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 998886 1000430 gene locus_tag LOCUS_08050 998886 1000430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1000446 1001717 gene locus_tag LOCUS_08060 1000446 1001717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1001856 1002269 gene locus_tag LOCUS_08070 1001856 1002269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1002422 1002832 gene locus_tag LOCUS_08080 1002422 1002832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1003136 1004353 gene locus_tag LOCUS_08090 1003136 1004353 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_08090 1008202 1004441 gene locus_tag LOCUS_08100 1008202 1004441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1008482 1008401 gene locus_tag LOCUS_t00200 1008482 1008401 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1008685 1011591 gene locus_tag LOCUS_08110 gene uvrA 1008685 1011591 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_08110 1011838 1013535 gene locus_tag LOCUS_08120 1011838 1013535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1014968 1013580 gene locus_tag LOCUS_08130 1014968 1013580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1015846 1015049 gene locus_tag LOCUS_08140 gene pcaD 1015846 1015049 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_08140 1015914 1017311 gene locus_tag LOCUS_08150 1015914 1017311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1017354 1017599 gene locus_tag LOCUS_08160 1017354 1017599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1017689 1019545 gene locus_tag LOCUS_08170 1017689 1019545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1019823 1021046 gene locus_tag LOCUS_08180 1019823 1021046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1021886 1021200 gene locus_tag LOCUS_08190 1021886 1021200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1024947 1021945 gene locus_tag LOCUS_08200 1024947 1021945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1025888 1024989 gene locus_tag LOCUS_08210 1025888 1024989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1028247 1026040 gene locus_tag LOCUS_08220 1028247 1026040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1028880 1028293 gene locus_tag LOCUS_08230 1028880 1028293 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_08230 1029222 1029298 gene locus_tag LOCUS_t00210 1029222 1029298 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1029416 1029607 gene locus_tag LOCUS_08240 1029416 1029607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1029656 1029952 gene locus_tag LOCUS_08250 1029656 1029952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1030024 1031766 gene locus_tag LOCUS_08260 1030024 1031766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1031878 1034874 gene locus_tag LOCUS_08270 1031878 1034874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1036025 1034982 gene locus_tag LOCUS_08280 1036025 1034982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1036145 1036360 gene locus_tag LOCUS_08290 1036145 1036360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1036712 1037518 gene locus_tag LOCUS_08300 1036712 1037518 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 protein_id gnl|my_center|LOCUS_08300 1037620 1038294 gene locus_tag LOCUS_08310 gene rplC 1037620 1038294 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892823.1 protein_id gnl|my_center|LOCUS_08310 1038353 1038994 gene locus_tag LOCUS_08320 1038353 1038994 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_08320 1042996 1039127 gene locus_tag LOCUS_08330 1042996 1039127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1043415 1042993 gene locus_tag LOCUS_08340 1043415 1042993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08340 1045055 1043352 gene locus_tag LOCUS_08350 1045055 1043352 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08350 1045338 1045892 gene locus_tag LOCUS_08360 1045338 1045892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1046044 1046700 gene locus_tag LOCUS_08370 1046044 1046700 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_08370 1049235 1046779 gene locus_tag LOCUS_08380 1049235 1046779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1049774 1049238 gene locus_tag LOCUS_08390 1049774 1049238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1052491 1049828 gene locus_tag LOCUS_08400 1052491 1049828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1052923 1052501 gene locus_tag LOCUS_08410 1052923 1052501 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_08410 1053037 1054761 gene locus_tag LOCUS_08420 1053037 1054761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1054797 1055015 gene locus_tag LOCUS_08430 1054797 1055015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1056625 1055192 gene locus_tag LOCUS_08440 1056625 1055192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1057423 1056644 gene locus_tag LOCUS_08450 1057423 1056644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1057371 1057526 gene locus_tag LOCUS_08460 1057371 1057526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1057768 1060317 gene locus_tag LOCUS_08470 1057768 1060317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1060579 1061616 gene locus_tag LOCUS_08480 1060579 1061616 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_08480 1061678 1062733 gene locus_tag LOCUS_08490 1061678 1062733 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_08490 1062715 1063188 gene locus_tag LOCUS_08500 1062715 1063188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1063473 1064522 gene locus_tag LOCUS_08510 gene fni 1063473 1064522 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_08510 1064605 1065525 gene locus_tag LOCUS_08520 gene mvk 1064605 1065525 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594553.1 protein_id gnl|my_center|LOCUS_08520 1065606 1066592 gene locus_tag LOCUS_08530 gene mvaD 1065606 1066592 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921869.1 protein_id gnl|my_center|LOCUS_08530 1066589 1068868 gene locus_tag LOCUS_08540 1066589 1068868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence02 <1 1233 gene locus_tag LOCUS_08550 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057920.1:CHAT domain-containing protein 1116 1625 gene locus_tag LOCUS_08560 1116 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3100 1793 gene locus_tag LOCUS_08570 3100 1793 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_08570 5005 3104 gene locus_tag LOCUS_08580 5005 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 11742 5002 gene locus_tag LOCUS_08590 11742 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 15005 11742 gene locus_tag LOCUS_08600 15005 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 15273 15749 gene locus_tag LOCUS_08610 15273 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 16169 15774 gene locus_tag LOCUS_08620 16169 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 16237 16941 gene locus_tag LOCUS_08630 gene pepE 16237 16941 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027213.1 protein_id gnl|my_center|LOCUS_08630 18035 16950 gene locus_tag LOCUS_08640 18035 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 18183 19064 gene locus_tag LOCUS_08650 18183 19064 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_08650 19734 19018 gene locus_tag LOCUS_08660 19734 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 20663 19749 gene locus_tag LOCUS_08670 gene metF 20663 19749 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_08670 20729 22279 gene locus_tag LOCUS_08680 20729 22279 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_08680 23295 22261 gene locus_tag LOCUS_08690 23295 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 25898 23292 gene locus_tag LOCUS_08700 25898 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 26071 27447 gene locus_tag LOCUS_08710 gene accC 26071 27447 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_08710 27461 29191 gene locus_tag LOCUS_08720 27461 29191 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_08720 29191 29847 gene locus_tag LOCUS_08730 29191 29847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 29869 30969 gene locus_tag LOCUS_08740 29869 30969 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061661.1 protein_id gnl|my_center|LOCUS_08740 32150 31476 gene locus_tag LOCUS_08750 32150 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 33587 32301 gene locus_tag LOCUS_08760 33587 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 34037 33747 gene locus_tag LOCUS_08770 34037 33747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 34434 35327 gene locus_tag LOCUS_08780 34434 35327 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_08780 35338 36069 gene locus_tag LOCUS_08790 35338 36069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 36066 37241 gene locus_tag LOCUS_08800 36066 37241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 37808 37377 gene locus_tag LOCUS_08810 37808 37377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 40273 37805 gene locus_tag LOCUS_08820 40273 37805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 41422 40289 gene locus_tag LOCUS_08830 gene rseP 41422 40289 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143011.1 protein_id gnl|my_center|LOCUS_08830 42088 41501 gene locus_tag LOCUS_08840 42088 41501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 42408 43022 gene locus_tag LOCUS_08850 42408 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 43273 44433 gene locus_tag LOCUS_08860 gene astA 43273 44433 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162182298.1 protein_id gnl|my_center|LOCUS_08860 45287 44529 gene locus_tag LOCUS_08870 45287 44529 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_08870 46160 45291 gene locus_tag LOCUS_08880 gene nadC 46160 45291 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_08880 46828 46145 gene locus_tag LOCUS_08890 46828 46145 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143203.1 protein_id gnl|my_center|LOCUS_08890 47652 46825 gene locus_tag LOCUS_08900 47652 46825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 48069 47665 gene locus_tag LOCUS_08910 48069 47665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 48228 50165 gene locus_tag LOCUS_08920 gene dnaG 48228 50165 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_08920 50179 52041 gene locus_tag LOCUS_08930 gene rpoD 50179 52041 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_08930 52169 53008 gene locus_tag LOCUS_08940 52169 53008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 53627 53049 gene locus_tag LOCUS_08950 53627 53049 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_08950 53792 54679 gene locus_tag LOCUS_08960 53792 54679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 54764 55996 gene locus_tag LOCUS_08970 54764 55996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 55888 56256 gene locus_tag LOCUS_08980 55888 56256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 56297 58126 gene locus_tag LOCUS_08990 56297 58126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_08990 58792 58136 gene locus_tag LOCUS_09000 gene eda 58792 58136 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775173.1 protein_id gnl|my_center|LOCUS_09000 59585 58860 gene locus_tag LOCUS_09010 59585 58860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 61507 59732 gene locus_tag LOCUS_09020 61507 59732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 61800 63245 gene locus_tag LOCUS_09030 61800 63245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 63374 64366 gene locus_tag LOCUS_09040 63374 64366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 66337 64499 gene locus_tag LOCUS_09050 66337 64499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 68145 66334 gene locus_tag LOCUS_09060 68145 66334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 68561 68220 gene locus_tag LOCUS_09070 gene yhbY 68561 68220 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_09070 69464 68712 gene locus_tag LOCUS_09080 69464 68712 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_09080 69534 69689 gene locus_tag LOCUS_09090 69534 69689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 69804 69877 gene locus_tag LOCUS_t00220 69804 69877 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 70088 70861 gene locus_tag LOCUS_09100 70088 70861 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_09100 70890 71474 gene locus_tag LOCUS_09110 70890 71474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 71593 75204 gene locus_tag LOCUS_09120 gene metH 71593 75204 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 protein_id gnl|my_center|LOCUS_09120 76259 75252 gene locus_tag LOCUS_09130 76259 75252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 77337 76360 gene locus_tag LOCUS_09140 77337 76360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 77605 77345 gene locus_tag LOCUS_09150 77605 77345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 77489 78193 gene locus_tag LOCUS_09160 77489 78193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 78196 78498 gene locus_tag LOCUS_09170 gene grxC 78196 78498 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315748.1 protein_id gnl|my_center|LOCUS_09170 78665 79429 gene locus_tag LOCUS_09180 78665 79429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 79842 79731 gene locus_tag LOCUS_r00010 79842 79731 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 82936 80002 gene locus_tag LOCUS_r00020 82936 80002 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 84857 83330 gene locus_tag LOCUS_r00030 84857 83330 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 85440 86363 gene locus_tag LOCUS_09190 85440 86363 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_09190 87115 86345 gene locus_tag LOCUS_09200 gene speD 87115 86345 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990692.1 protein_id gnl|my_center|LOCUS_09200 87334 87149 gene locus_tag LOCUS_09210 87334 87149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 87294 90182 gene locus_tag LOCUS_09220 87294 90182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 90227 92923 gene locus_tag LOCUS_09230 90227 92923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 93245 93000 gene locus_tag LOCUS_09240 93245 93000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 94389 93259 gene locus_tag LOCUS_09250 94389 93259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 94778 94386 gene locus_tag LOCUS_09260 94778 94386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 95309 96286 gene locus_tag LOCUS_09270 95309 96286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 96766 96416 gene locus_tag LOCUS_09280 96766 96416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 96968 96714 gene locus_tag LOCUS_09290 96968 96714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 97861 97004 gene locus_tag LOCUS_09300 97861 97004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 98039 100135 gene locus_tag LOCUS_09310 98039 100135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 100141 101454 gene locus_tag LOCUS_09320 100141 101454 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_09320 101523 102164 gene locus_tag LOCUS_09330 101523 102164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 102189 103436 gene locus_tag LOCUS_09340 102189 103436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 104063 103611 gene locus_tag LOCUS_09350 104063 103611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 105766 104375 gene locus_tag LOCUS_09360 gene asnS 105766 104375 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941817.1 protein_id gnl|my_center|LOCUS_09360 105826 106542 gene locus_tag LOCUS_09370 105826 106542 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_09370 106767 107207 gene locus_tag LOCUS_09380 gene hemJ 106767 107207 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_09380 107251 107985 gene locus_tag LOCUS_09390 107251 107985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 108161 108373 gene locus_tag LOCUS_09400 108161 108373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 108408 108728 gene locus_tag LOCUS_09410 108408 108728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 108736 109578 gene locus_tag LOCUS_09420 108736 109578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 109704 110294 gene locus_tag LOCUS_09430 gene folK 109704 110294 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_09430 110320 110392 gene locus_tag LOCUS_t00230 110320 110392 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 111812 110478 gene locus_tag LOCUS_09440 111812 110478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 112634 111966 gene locus_tag LOCUS_09450 112634 111966 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_09450 114038 112647 gene locus_tag LOCUS_09460 114038 112647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 114994 114035 gene locus_tag LOCUS_09470 114994 114035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 117190 114998 gene locus_tag LOCUS_09480 117190 114998 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206290416.1 protein_id gnl|my_center|LOCUS_09480 118033 117302 gene locus_tag LOCUS_09490 118033 117302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 118323 118781 gene locus_tag LOCUS_09500 118323 118781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 118894 122037 gene locus_tag LOCUS_09510 118894 122037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 123261 122149 gene locus_tag LOCUS_09520 123261 122149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 123516 126650 gene locus_tag LOCUS_09530 123516 126650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 126647 128170 gene locus_tag LOCUS_09540 126647 128170 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092532455.1 protein_id gnl|my_center|LOCUS_09540 128656 128072 gene locus_tag LOCUS_09550 128656 128072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 128556 129401 gene locus_tag LOCUS_09560 128556 129401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 129953 129516 gene locus_tag LOCUS_09570 129953 129516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 131208 129862 gene locus_tag LOCUS_09580 131208 129862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 132375 131296 gene locus_tag LOCUS_09590 132375 131296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 133556 132609 gene locus_tag LOCUS_09600 133556 132609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 134900 133566 gene locus_tag LOCUS_09610 134900 133566 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_09610 134781 135164 gene locus_tag LOCUS_09620 134781 135164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 136747 135062 gene locus_tag LOCUS_09630 136747 135062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 137385 136963 gene locus_tag LOCUS_09640 137385 136963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 138706 137498 gene locus_tag LOCUS_09650 138706 137498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 138675 138884 gene locus_tag LOCUS_09660 138675 138884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 139422 139943 gene locus_tag LOCUS_09670 139422 139943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 142452 139966 gene locus_tag LOCUS_09680 142452 139966 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_09680 143429 142563 gene locus_tag LOCUS_09690 143429 142563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 143517 143849 gene locus_tag LOCUS_09700 gene grxD 143517 143849 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388463.1 protein_id gnl|my_center|LOCUS_09700 144572 143895 gene locus_tag LOCUS_09710 144572 143895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 144812 145564 gene locus_tag LOCUS_09720 144812 145564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 145633 146817 gene locus_tag LOCUS_09730 145633 146817 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_09730 147336 146887 gene locus_tag LOCUS_09740 147336 146887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 147395 148273 gene locus_tag LOCUS_09750 147395 148273 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_09750 148457 149260 gene locus_tag LOCUS_09760 148457 149260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 150466 149267 gene locus_tag LOCUS_09770 150466 149267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 151143 150463 gene locus_tag LOCUS_09780 151143 150463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 152023 151148 gene locus_tag LOCUS_09790 152023 151148 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_09790 153201 152020 gene locus_tag LOCUS_09800 153201 152020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 153560 156478 gene locus_tag LOCUS_09810 153560 156478 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_09810 156475 160320 gene locus_tag LOCUS_09820 156475 160320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 161227 160325 gene locus_tag LOCUS_09830 161227 160325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 161199 161441 gene locus_tag LOCUS_09840 161199 161441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 161574 162068 gene locus_tag LOCUS_09850 161574 162068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 162186 166160 gene locus_tag LOCUS_09860 162186 166160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 166253 167338 gene locus_tag LOCUS_09870 166253 167338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 167569 169650 gene locus_tag LOCUS_09880 167569 169650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 171302 169737 gene locus_tag LOCUS_09890 171302 169737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 171944 171429 gene locus_tag LOCUS_09900 171944 171429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 172080 174674 gene locus_tag LOCUS_09910 172080 174674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 174691 175524 gene locus_tag LOCUS_09920 174691 175524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 175506 175651 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgccgaaggaggcgagtgatgc 175648 177408 gene locus_tag LOCUS_09930 175648 177408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 179066 177468 gene locus_tag LOCUS_09940 179066 177468 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_09940 181069 179063 gene locus_tag LOCUS_09950 181069 179063 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615540.1 protein_id gnl|my_center|LOCUS_09950 181432 183657 gene locus_tag LOCUS_09960 181432 183657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 183760 186243 gene locus_tag LOCUS_09970 183760 186243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 188055 186886 gene locus_tag LOCUS_09980 188055 186886 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089061.1 protein_id gnl|my_center|LOCUS_09980 188151 190721 gene locus_tag LOCUS_09990 188151 190721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 191727 190747 gene locus_tag LOCUS_10000 191727 190747 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_10000 191845 193494 gene locus_tag LOCUS_10010 191845 193494 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_10010 193581 194537 gene locus_tag LOCUS_10020 193581 194537 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_10020 194592 196298 gene locus_tag LOCUS_10030 194592 196298 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_10030 196701 196366 gene locus_tag LOCUS_10040 196701 196366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 196592 197857 gene locus_tag LOCUS_10050 196592 197857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 198577 197924 gene locus_tag LOCUS_10060 198577 197924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 198631 198855 gene locus_tag LOCUS_10070 198631 198855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 198943 199530 gene locus_tag LOCUS_10080 198943 199530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 199546 199821 gene locus_tag LOCUS_10090 199546 199821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 201479 199800 gene locus_tag LOCUS_10100 gene ettA 201479 199800 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_10100 201656 203698 gene locus_tag LOCUS_10110 gene speA 201656 203698 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_10110 204103 203723 gene locus_tag LOCUS_10120 204103 203723 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 protein_id gnl|my_center|LOCUS_10120 205452 204163 gene locus_tag LOCUS_10130 205452 204163 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_10130 207047 205491 gene locus_tag LOCUS_10140 207047 205491 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437413.1 protein_id gnl|my_center|LOCUS_10140 207415 207047 gene locus_tag LOCUS_10150 207415 207047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 207387 208352 gene locus_tag LOCUS_10160 207387 208352 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_10160 208365 209321 gene locus_tag LOCUS_10170 208365 209321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 209318 210079 gene locus_tag LOCUS_10180 209318 210079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 210773 210174 gene locus_tag LOCUS_10190 210773 210174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 210799 211830 gene locus_tag LOCUS_10200 210799 211830 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10200 212522 211851 gene locus_tag LOCUS_10210 212522 211851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 214096 212606 gene locus_tag LOCUS_10220 214096 212606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 216032 214137 gene locus_tag LOCUS_10230 216032 214137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 216368 217000 gene locus_tag LOCUS_10240 216368 217000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 217087 217749 gene locus_tag LOCUS_10250 217087 217749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 217746 218717 gene locus_tag LOCUS_10260 217746 218717 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189208.1 protein_id gnl|my_center|LOCUS_10260 221159 218784 gene locus_tag LOCUS_10270 221159 218784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 221999 221181 gene locus_tag LOCUS_10280 221999 221181 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_10280 222335 222714 gene locus_tag LOCUS_tm00010 222335 222714 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 223189 222821 gene locus_tag LOCUS_10290 223189 222821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 224842 223598 gene locus_tag LOCUS_10300 224842 223598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 225644 224898 gene locus_tag LOCUS_10310 225644 224898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 227147 225651 gene locus_tag LOCUS_10320 227147 225651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 228349 227213 gene locus_tag LOCUS_10330 228349 227213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 229302 228346 gene locus_tag LOCUS_10340 229302 228346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 229371 230591 gene locus_tag LOCUS_10350 229371 230591 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_10350 230695 231873 gene locus_tag LOCUS_10360 230695 231873 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_10360 232650 231886 gene locus_tag LOCUS_10370 232650 231886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 232717 233019 gene locus_tag LOCUS_10380 232717 233019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 protein_id gnl|my_center|LOCUS_10380 233896 233033 gene locus_tag LOCUS_10390 233896 233033 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_10390 234155 233883 gene locus_tag LOCUS_10400 gene xseB 234155 233883 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418105.1 protein_id gnl|my_center|LOCUS_10400 234293 234808 gene locus_tag LOCUS_10410 234293 234808 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_10410 234810 235121 gene locus_tag LOCUS_10420 234810 235121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 235159 235500 gene locus_tag LOCUS_10430 235159 235500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 236708 235611 gene locus_tag LOCUS_10440 236708 235611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 236882 238069 gene locus_tag LOCUS_10450 236882 238069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 238069 238770 gene locus_tag LOCUS_10460 238069 238770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 238767 239630 gene locus_tag LOCUS_10470 238767 239630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 239708 241336 gene locus_tag LOCUS_10480 gene lysS 239708 241336 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002663481.1 protein_id gnl|my_center|LOCUS_10480 242466 241333 gene locus_tag LOCUS_10490 242466 241333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 242554 243177 gene locus_tag LOCUS_10500 242554 243177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 243198 243719 gene locus_tag LOCUS_10510 gene greB 243198 243719 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941858.1 protein_id gnl|my_center|LOCUS_10510 243716 244546 gene locus_tag LOCUS_10520 243716 244546 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 protein_id gnl|my_center|LOCUS_10520 245505 244543 gene locus_tag LOCUS_10530 245505 244543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 245763 245560 gene locus_tag LOCUS_10540 245763 245560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 248237 245814 gene locus_tag LOCUS_10550 gene xdhB 248237 245814 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_10550 249712 248234 gene locus_tag LOCUS_10560 gene xdhA 249712 248234 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_10560 250741 249773 gene locus_tag LOCUS_10570 250741 249773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 251180 252082 gene locus_tag LOCUS_10580 251180 252082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 252695 252090 gene locus_tag LOCUS_10590 252695 252090 CDS product hydroxyacylglutathione hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933700.1 protein_id gnl|my_center|LOCUS_10590 252801 254894 gene locus_tag LOCUS_10600 252801 254894 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_10600 255234 254896 gene locus_tag LOCUS_10610 255234 254896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 256145 255279 gene locus_tag LOCUS_10620 256145 255279 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_10620 256340 258160 gene locus_tag LOCUS_10630 256340 258160 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_10630 258213 259442 gene locus_tag LOCUS_10640 258213 259442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 259439 261205 gene locus_tag LOCUS_10650 259439 261205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 261291 261980 gene locus_tag LOCUS_10660 261291 261980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 263288 261999 gene locus_tag LOCUS_10670 263288 261999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 263867 263424 gene locus_tag LOCUS_10680 263867 263424 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_10680 263957 264490 gene locus_tag LOCUS_10690 gene dcd 263957 264490 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_10690 266965 264506 gene locus_tag LOCUS_10700 266965 264506 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_10700 272650 266993 gene locus_tag LOCUS_10710 272650 266993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 273022 274068 gene locus_tag LOCUS_10720 273022 274068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 276002 274065 gene locus_tag LOCUS_10730 276002 274065 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085076.1 protein_id gnl|my_center|LOCUS_10730 276760 277650 gene locus_tag LOCUS_10740 276760 277650 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368403.1 protein_id gnl|my_center|LOCUS_10740 279136 277715 gene locus_tag LOCUS_10750 gene lpdA 279136 277715 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_10750 280499 279150 gene locus_tag LOCUS_10760 gene pdhC 280499 279150 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_10760 281489 280515 gene locus_tag LOCUS_10770 281489 280515 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_10770 282439 281486 gene locus_tag LOCUS_10780 gene pdhA 282439 281486 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_10780 283378 282683 gene locus_tag LOCUS_10790 283378 282683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 283522 284667 gene locus_tag LOCUS_10800 283522 284667 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_10800 284891 285451 gene locus_tag LOCUS_10810 284891 285451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 287191 285521 gene locus_tag LOCUS_10820 287191 285521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 287824 287270 gene locus_tag LOCUS_10830 287824 287270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 288864 287842 gene locus_tag LOCUS_10840 gene ansA 288864 287842 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948559.1 protein_id gnl|my_center|LOCUS_10840 290133 289021 gene locus_tag LOCUS_10850 290133 289021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 290459 291766 gene locus_tag LOCUS_10860 290459 291766 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_10860 291756 295424 gene locus_tag LOCUS_10870 291756 295424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 295483 295722 gene locus_tag LOCUS_10880 295483 295722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 295906 298317 gene locus_tag LOCUS_10890 295906 298317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 298571 298496 gene locus_tag LOCUS_t00240 298571 298496 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 298767 300641 gene locus_tag LOCUS_10900 298767 300641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 300964 301170 gene locus_tag LOCUS_10910 300964 301170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 301316 301780 gene locus_tag LOCUS_10920 gene bfr 301316 301780 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_10920 302738 301785 gene locus_tag LOCUS_10930 302738 301785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 304138 302735 gene locus_tag LOCUS_10940 304138 302735 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187164.1 protein_id gnl|my_center|LOCUS_10940 304847 304140 gene locus_tag LOCUS_10950 304847 304140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 305124 305441 gene locus_tag LOCUS_10960 305124 305441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 306673 305474 gene locus_tag LOCUS_10970 306673 305474 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_10970 306901 306719 gene locus_tag LOCUS_10980 306901 306719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 307617 307216 gene locus_tag LOCUS_10990 307617 307216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 310168 307760 gene locus_tag LOCUS_11000 310168 307760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 311594 310764 gene locus_tag LOCUS_11010 gene proC 311594 310764 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_11010 312225 311605 gene locus_tag LOCUS_11020 312225 311605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 312292 312912 gene locus_tag LOCUS_11030 312292 312912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 313057 313431 gene locus_tag LOCUS_11040 313057 313431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 313742 314725 gene locus_tag LOCUS_11050 313742 314725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 315445 314732 gene locus_tag LOCUS_11060 315445 314732 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_11060 316055 315513 gene locus_tag LOCUS_11070 316055 315513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 317456 316110 gene locus_tag LOCUS_11080 317456 316110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275264.1 protein_id gnl|my_center|LOCUS_11080 320720 317562 gene locus_tag LOCUS_11090 320720 317562 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_11090 321210 320779 gene locus_tag LOCUS_11100 gene tolR 321210 320779 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_11100 321661 321212 gene locus_tag LOCUS_11110 gene tolR 321661 321212 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310275.1 protein_id gnl|my_center|LOCUS_11110 322274 321636 gene locus_tag LOCUS_11120 322274 321636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 323141 322326 gene locus_tag LOCUS_11130 323141 322326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 323320 324093 gene locus_tag LOCUS_11140 323320 324093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068323.1 protein_id gnl|my_center|LOCUS_11140 324090 324854 gene locus_tag LOCUS_11150 324090 324854 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776752.1 protein_id gnl|my_center|LOCUS_11150 325410 324859 gene locus_tag LOCUS_11160 325410 324859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 325737 326942 gene locus_tag LOCUS_11170 325737 326942 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_11170 327240 326971 gene locus_tag LOCUS_11180 327240 326971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 327905 327237 gene locus_tag LOCUS_11190 327905 327237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 327948 328331 gene locus_tag LOCUS_11200 327948 328331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 328561 330675 gene locus_tag LOCUS_11210 gene uvrB 328561 330675 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_11210 330715 331107 gene locus_tag LOCUS_11220 330715 331107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 331909 331172 gene locus_tag LOCUS_11230 331909 331172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 332152 332604 gene locus_tag LOCUS_11240 332152 332604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 333247 332576 gene locus_tag LOCUS_11250 gene trmB 333247 332576 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_11250 333914 333261 gene locus_tag LOCUS_11260 gene fsa 333914 333261 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_11260 334262 333969 gene locus_tag LOCUS_11270 334262 333969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 334436 334798 gene locus_tag LOCUS_11280 334436 334798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 335226 334888 gene locus_tag LOCUS_11290 335226 334888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 335496 336968 gene locus_tag LOCUS_11300 335496 336968 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_11300 337605 337033 gene locus_tag LOCUS_11310 337605 337033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 337783 338274 gene locus_tag LOCUS_11320 337783 338274 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_11320 340319 338286 gene locus_tag LOCUS_11330 340319 338286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 341740 340316 gene locus_tag LOCUS_11340 341740 340316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 342385 341780 gene locus_tag LOCUS_11350 342385 341780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 343946 342459 gene locus_tag LOCUS_11360 343946 342459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 344149 344691 gene locus_tag LOCUS_11370 344149 344691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 347215 344720 gene locus_tag LOCUS_11380 gene gyrB 347215 344720 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175131.1 protein_id gnl|my_center|LOCUS_11380 348417 347344 gene locus_tag LOCUS_11390 gene recF 348417 347344 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_11390 349600 348497 gene locus_tag LOCUS_11400 gene dnaN 349600 348497 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_11400 351285 349930 gene locus_tag LOCUS_11410 gene dnaA 351285 349930 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_11410 352148 352525 gene locus_tag LOCUS_11420 gene rnpA 352148 352525 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_11420 352789 354396 gene locus_tag LOCUS_11430 gene yidC 352789 354396 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_11430 354413 354970 gene locus_tag LOCUS_11440 354413 354970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 356140 355031 gene locus_tag LOCUS_11450 gene bioF 356140 355031 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_11450 356227 356799 gene locus_tag LOCUS_11460 356227 356799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 357974 356853 gene locus_tag LOCUS_11470 357974 356853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 358258 360594 gene locus_tag LOCUS_11480 358258 360594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 360646 361677 gene locus_tag LOCUS_11490 gene tsaD 360646 361677 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_11490 361674 362531 gene locus_tag LOCUS_11500 gene rsmA 361674 362531 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004468995.1 protein_id gnl|my_center|LOCUS_11500 362515 363378 gene locus_tag LOCUS_11510 gene mutM 362515 363378 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_11510 363439 364101 gene locus_tag LOCUS_11520 363439 364101 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_11520 367839 364291 gene locus_tag LOCUS_11530 367839 364291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 369653 367836 gene locus_tag LOCUS_11540 369653 367836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 370603 369653 gene locus_tag LOCUS_11550 370603 369653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 370728 372335 gene locus_tag LOCUS_11560 370728 372335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 373374 372415 gene locus_tag LOCUS_11570 373374 372415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 373509 374594 gene locus_tag LOCUS_11580 373509 374594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 375187 374600 gene locus_tag LOCUS_11590 375187 374600 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_11590 375690 375205 gene locus_tag LOCUS_11600 375690 375205 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_11600 376537 375929 gene locus_tag LOCUS_11610 gene recR 376537 375929 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051621.1 protein_id gnl|my_center|LOCUS_11610 376860 376534 gene locus_tag LOCUS_11620 376860 376534 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926934.1 protein_id gnl|my_center|LOCUS_11620 378954 376915 gene locus_tag LOCUS_11630 378954 376915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 380632 378989 gene locus_tag LOCUS_11640 380632 378989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 380997 380770 gene locus_tag LOCUS_11650 380997 380770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 381565 383466 gene locus_tag LOCUS_11660 381565 383466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 383589 384590 gene locus_tag LOCUS_11670 383589 384590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 384630 385865 gene locus_tag LOCUS_11680 384630 385865 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_11680 385862 386596 gene locus_tag LOCUS_11690 385862 386596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 386642 388063 gene locus_tag LOCUS_11700 386642 388063 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981895.1 protein_id gnl|my_center|LOCUS_11700 388183 389313 gene locus_tag LOCUS_11710 388183 389313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 389613 389528 gene locus_tag LOCUS_t00250 389613 389528 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 389756 389669 gene locus_tag LOCUS_t00260 389756 389669 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 389920 391977 gene locus_tag LOCUS_11720 389920 391977 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_11720 391986 392267 gene locus_tag LOCUS_11730 391986 392267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 392473 392261 gene locus_tag LOCUS_11740 392473 392261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 392379 393383 gene locus_tag LOCUS_11750 392379 393383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 394305 393397 gene locus_tag LOCUS_11760 394305 393397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 394542 395471 gene locus_tag LOCUS_11770 394542 395471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 395468 396613 gene locus_tag LOCUS_11780 395468 396613 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_11780 397578 396610 gene locus_tag LOCUS_11790 397578 396610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 399064 397469 gene locus_tag LOCUS_11800 399064 397469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 399147 400070 gene locus_tag LOCUS_11810 399147 400070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 400226 402712 gene locus_tag LOCUS_11820 400226 402712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 402783 404060 gene locus_tag LOCUS_11830 402783 404060 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_11830 404097 405860 gene locus_tag LOCUS_11840 404097 405860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 405860 407077 gene locus_tag LOCUS_11850 405860 407077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 407989 407129 gene locus_tag LOCUS_11860 407989 407129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 408064 408492 gene locus_tag LOCUS_11870 408064 408492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 408549 409352 gene locus_tag LOCUS_11880 408549 409352 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140126.1 protein_id gnl|my_center|LOCUS_11880 409436 410080 gene locus_tag LOCUS_11890 409436 410080 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 protein_id gnl|my_center|LOCUS_11890 411967 410084 gene locus_tag LOCUS_11900 gene asnB 411967 410084 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_11900 412020 412850 gene locus_tag LOCUS_11910 412020 412850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 412910 413998 gene locus_tag LOCUS_11920 412910 413998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 414076 414152 gene locus_tag LOCUS_t00270 414076 414152 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 414797 414165 gene locus_tag LOCUS_11930 414797 414165 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 protein_id gnl|my_center|LOCUS_11930 416076 414808 gene locus_tag LOCUS_11940 416076 414808 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928828.1 protein_id gnl|my_center|LOCUS_11940 416326 419823 gene locus_tag LOCUS_11950 416326 419823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 419874 419961 gene locus_tag LOCUS_t00280 419874 419961 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 420461 419991 gene locus_tag LOCUS_11960 420461 419991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 421345 420491 gene locus_tag LOCUS_11970 421345 420491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 422719 421406 gene locus_tag LOCUS_11980 422719 421406 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_11980 422811 424034 gene locus_tag LOCUS_11990 422811 424034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 424031 425386 gene locus_tag LOCUS_12000 424031 425386 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259200.1 protein_id gnl|my_center|LOCUS_12000 425383 426819 gene locus_tag LOCUS_12010 425383 426819 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 protein_id gnl|my_center|LOCUS_12010 426816 427901 gene locus_tag LOCUS_12020 426816 427901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 427894 428526 gene locus_tag LOCUS_12030 427894 428526 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259201.1 protein_id gnl|my_center|LOCUS_12030 428563 429099 gene locus_tag LOCUS_12040 gene orn 428563 429099 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402903.1 protein_id gnl|my_center|LOCUS_12040 429138 430406 gene locus_tag LOCUS_12050 429138 430406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 432268 430376 gene locus_tag LOCUS_12060 gene dnaK 432268 430376 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_12060 434482 432392 gene locus_tag LOCUS_12070 gene scpA 434482 432392 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_12070 436503 434560 gene locus_tag LOCUS_12080 436503 434560 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_12080 436631 438376 gene locus_tag LOCUS_12090 436631 438376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 439176 438379 gene locus_tag LOCUS_12100 439176 438379 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704122.1 protein_id gnl|my_center|LOCUS_12100 441221 439626 gene locus_tag LOCUS_12110 441221 439626 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_12110 441453 441743 gene locus_tag LOCUS_12120 441453 441743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 442912 442079 gene locus_tag LOCUS_12130 442912 442079 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_12130 443895 443281 gene locus_tag LOCUS_12140 443895 443281 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804860.1 protein_id gnl|my_center|LOCUS_12140 444966 443935 gene locus_tag LOCUS_12150 gene fbaA 444966 443935 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907650.1 protein_id gnl|my_center|LOCUS_12150 446448 445015 gene locus_tag LOCUS_12160 446448 445015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 446526 447950 gene locus_tag LOCUS_12170 446526 447950 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_12170 448157 449620 gene locus_tag LOCUS_12180 448157 449620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 449679 452345 gene locus_tag LOCUS_12190 449679 452345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 452342 453532 gene locus_tag LOCUS_12200 452342 453532 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_12200 453629 455986 gene locus_tag LOCUS_12210 453629 455986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 456892 456137 gene locus_tag LOCUS_12220 456892 456137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 457918 457088 gene locus_tag LOCUS_12230 457918 457088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 458157 458789 gene locus_tag LOCUS_12240 458157 458789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 459215 461974 gene locus_tag LOCUS_12250 459215 461974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 462806 462060 gene locus_tag LOCUS_12260 462806 462060 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_12260 464248 462803 gene locus_tag LOCUS_12270 464248 462803 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_12270 465051 464581 gene locus_tag LOCUS_12280 465051 464581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 465176 466222 gene locus_tag LOCUS_12290 465176 466222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 467913 466252 gene locus_tag LOCUS_12300 467913 466252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 469334 468096 gene locus_tag LOCUS_12310 469334 468096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 470400 469399 gene locus_tag LOCUS_12320 470400 469399 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_12320 470644 472803 gene locus_tag LOCUS_12330 470644 472803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 473655 472870 gene locus_tag LOCUS_12340 473655 472870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 473719 474633 gene locus_tag LOCUS_12350 473719 474633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 474690 477098 gene locus_tag LOCUS_12360 474690 477098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 477101 477544 gene locus_tag LOCUS_12370 477101 477544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 478635 477481 gene locus_tag LOCUS_12380 478635 477481 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_12380 478739 479308 gene locus_tag LOCUS_12390 478739 479308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 479354 481009 gene locus_tag LOCUS_12400 479354 481009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 482147 481092 gene locus_tag LOCUS_12410 482147 481092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 482182 482361 gene locus_tag LOCUS_12420 482182 482361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 482459 485608 gene locus_tag LOCUS_12430 482459 485608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 485709 486464 gene locus_tag LOCUS_12440 485709 486464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 487365 486469 gene locus_tag LOCUS_12450 487365 486469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 488629 487409 gene locus_tag LOCUS_12460 gene queG 488629 487409 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141464.1 protein_id gnl|my_center|LOCUS_12460 489220 488633 gene locus_tag LOCUS_12470 489220 488633 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 protein_id gnl|my_center|LOCUS_12470 490753 489311 gene locus_tag LOCUS_12480 490753 489311 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_12480 492039 490780 gene locus_tag LOCUS_12490 492039 490780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 493082 492069 gene locus_tag LOCUS_12500 493082 492069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 493066 494097 gene locus_tag LOCUS_12510 493066 494097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 494880 494113 gene locus_tag LOCUS_12520 494880 494113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 496043 494892 gene locus_tag LOCUS_12530 496043 494892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 496565 496131 gene locus_tag LOCUS_12540 496565 496131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 496519 496989 gene locus_tag LOCUS_12550 496519 496989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 498509 496914 gene locus_tag LOCUS_12560 498509 496914 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_12560 498717 499835 gene locus_tag LOCUS_12570 498717 499835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 499890 500528 gene locus_tag LOCUS_12580 499890 500528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 500944 500552 gene locus_tag LOCUS_12590 500944 500552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 500865 502118 gene locus_tag LOCUS_12600 500865 502118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 502261 502881 gene locus_tag LOCUS_12610 502261 502881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 503690 502878 gene locus_tag LOCUS_12620 503690 502878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 503668 505377 gene locus_tag LOCUS_12630 503668 505377 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_12630 506711 505398 gene locus_tag LOCUS_12640 506711 505398 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_12640 507861 506824 gene locus_tag LOCUS_12650 507861 506824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 509005 508007 gene locus_tag LOCUS_12660 509005 508007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 509952 509026 gene locus_tag LOCUS_12670 509952 509026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259544.1 protein_id gnl|my_center|LOCUS_12670 510159 510572 gene locus_tag LOCUS_12680 510159 510572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_12680 510849 510526 gene locus_tag LOCUS_12690 510849 510526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 510782 511768 gene locus_tag LOCUS_12700 510782 511768 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228210.1 protein_id gnl|my_center|LOCUS_12700 511844 512929 gene locus_tag LOCUS_12710 511844 512929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 513776 512988 gene locus_tag LOCUS_12720 513776 512988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 514611 513850 gene locus_tag LOCUS_12730 514611 513850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 514793 514611 gene locus_tag LOCUS_12740 514793 514611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 514861 516369 gene locus_tag LOCUS_12750 514861 516369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 517016 516399 gene locus_tag LOCUS_12760 517016 516399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 517153 518931 gene locus_tag LOCUS_12770 517153 518931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 519388 518915 gene locus_tag LOCUS_12780 gene ybaK 519388 518915 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815307.1 protein_id gnl|my_center|LOCUS_12780 521008 519470 gene locus_tag LOCUS_12790 521008 519470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 523105 521153 gene locus_tag LOCUS_12800 523105 521153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 523337 524515 gene locus_tag LOCUS_12810 523337 524515 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946638.1 protein_id gnl|my_center|LOCUS_12810 524535 525596 gene locus_tag LOCUS_12820 gene hslO 524535 525596 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_12820 525668 526561 gene locus_tag LOCUS_12830 525668 526561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 526630 526986 gene locus_tag LOCUS_12840 526630 526986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 528000 527089 gene locus_tag LOCUS_12850 528000 527089 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_12850 528122 530443 gene locus_tag LOCUS_12860 528122 530443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 530504 530917 gene locus_tag LOCUS_12870 530504 530917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 531039 532022 gene locus_tag LOCUS_12880 531039 532022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 532022 532327 gene locus_tag LOCUS_12890 532022 532327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 532417 533808 gene locus_tag LOCUS_12900 532417 533808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 533831 534850 gene locus_tag LOCUS_12910 533831 534850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 535394 534855 gene locus_tag LOCUS_12920 gene aac(6') 535394 534855 CDS product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 protein_id gnl|my_center|LOCUS_12920 536275 535412 gene locus_tag LOCUS_12930 536275 535412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_12930 536728 536489 gene locus_tag LOCUS_12940 536728 536489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 537426 536911 gene locus_tag LOCUS_12950 537426 536911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 539265 537547 gene locus_tag LOCUS_12960 539265 537547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 539904 539278 gene locus_tag LOCUS_12970 539904 539278 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_12970 539906 540583 gene locus_tag LOCUS_12980 539906 540583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 540632 541054 gene locus_tag LOCUS_12990 540632 541054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 543356 541224 gene locus_tag LOCUS_13000 543356 541224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 543355 543906 gene locus_tag LOCUS_13010 543355 543906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 543903 544238 gene locus_tag LOCUS_13020 543903 544238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 545723 544242 gene locus_tag LOCUS_13030 gene glpK 545723 544242 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 protein_id gnl|my_center|LOCUS_13030 546520 546951 gene locus_tag LOCUS_13040 546520 546951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 546982 548019 gene locus_tag LOCUS_13050 gene pilM 546982 548019 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_13050 548016 548606 gene locus_tag LOCUS_13060 548016 548606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 548630 549184 gene locus_tag LOCUS_13070 548630 549184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 549181 549723 gene locus_tag LOCUS_13080 549181 549723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 549780 550883 gene locus_tag LOCUS_13090 gene aroB 549780 550883 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101252.1 protein_id gnl|my_center|LOCUS_13090 551037 551378 gene locus_tag LOCUS_13100 551037 551378 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_13100 551397 551900 gene locus_tag LOCUS_13110 gene aroQ 551397 551900 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 protein_id gnl|my_center|LOCUS_13110 551918 552448 gene locus_tag LOCUS_13120 gene accB 551918 552448 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_13120 552445 553824 gene locus_tag LOCUS_13130 gene accC 552445 553824 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_13130 553871 558073 gene locus_tag LOCUS_13140 553871 558073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 560007 558133 gene locus_tag LOCUS_13150 560007 558133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 560287 561645 gene locus_tag LOCUS_13160 gene tig 560287 561645 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899331.1 protein_id gnl|my_center|LOCUS_13160 561972 562592 gene locus_tag LOCUS_13170 gene clpP 561972 562592 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_13170 562589 563848 gene locus_tag LOCUS_13180 gene clpX 562589 563848 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_13180 567134 563928 gene locus_tag LOCUS_13190 567134 563928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 567363 568505 gene locus_tag LOCUS_13200 567363 568505 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_13200 568510 569376 gene locus_tag LOCUS_13210 gene rsmI 568510 569376 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391440.1 protein_id gnl|my_center|LOCUS_13210 570930 569458 gene locus_tag LOCUS_13220 570930 569458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 572863 571310 gene locus_tag LOCUS_13230 572863 571310 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_13230 574987 572894 gene locus_tag LOCUS_13240 574987 572894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 575150 575431 gene locus_tag LOCUS_13250 575150 575431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 575428 576408 gene locus_tag LOCUS_13260 575428 576408 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337469.1 protein_id gnl|my_center|LOCUS_13260 576405 577133 gene locus_tag LOCUS_13270 gene pgeF 576405 577133 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_13270 577459 577235 gene locus_tag LOCUS_13280 577459 577235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 577939 577553 gene locus_tag LOCUS_13290 577939 577553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 579462 577840 gene locus_tag LOCUS_13300 579462 577840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 580794 579604 gene locus_tag LOCUS_13310 580794 579604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 583586 580824 gene locus_tag LOCUS_13320 583586 580824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 584400 583558 gene locus_tag LOCUS_13330 584400 583558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 584877 584434 gene locus_tag LOCUS_13340 584877 584434 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_13340 585545 584889 gene locus_tag LOCUS_13350 585545 584889 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_13350 586727 585609 gene locus_tag LOCUS_13360 586727 585609 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_13360 587704 586724 gene locus_tag LOCUS_13370 587704 586724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 587828 589213 gene locus_tag LOCUS_13380 587828 589213 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_13380 589226 589534 gene locus_tag LOCUS_13390 589226 589534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 589531 590004 gene locus_tag LOCUS_13400 589531 590004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13400 592104 590053 gene locus_tag LOCUS_13410 592104 590053 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_13410 592248 593360 gene locus_tag LOCUS_13420 592248 593360 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_13420 593360 594913 gene locus_tag LOCUS_13430 593360 594913 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_13430 595123 595902 gene locus_tag LOCUS_13440 595123 595902 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_13440 597310 596516 gene locus_tag LOCUS_13450 597310 596516 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_13450 597394 597319 gene locus_tag LOCUS_t00290 597394 597319 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 598259 597795 gene locus_tag LOCUS_13460 598259 597795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 598201 599388 gene locus_tag LOCUS_13470 598201 599388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 602932 599489 gene locus_tag LOCUS_13480 602932 599489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 603721 603026 gene locus_tag LOCUS_13490 gene queC 603721 603026 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_13490 604655 603732 gene locus_tag LOCUS_13500 604655 603732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 604777 605706 gene locus_tag LOCUS_13510 604777 605706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 606185 605805 gene locus_tag LOCUS_13520 606185 605805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 606436 607035 gene locus_tag LOCUS_13530 606436 607035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 607195 608133 gene locus_tag LOCUS_13540 607195 608133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 608256 609857 gene locus_tag LOCUS_13550 608256 609857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 609883 610650 gene locus_tag LOCUS_13560 609883 610650 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226107.1 protein_id gnl|my_center|LOCUS_13560 611562 610717 gene locus_tag LOCUS_13570 611562 610717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 612599 611559 gene locus_tag LOCUS_13580 612599 611559 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_13580 615150 612616 gene locus_tag LOCUS_13590 615150 612616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 615669 615223 gene locus_tag LOCUS_13600 615669 615223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 615563 616627 gene locus_tag LOCUS_13610 615563 616627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 617157 616723 gene locus_tag LOCUS_13620 617157 616723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 617742 620279 gene locus_tag LOCUS_13630 gene gyrA 617742 620279 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210821.1 protein_id gnl|my_center|LOCUS_13630 620266 621615 gene locus_tag LOCUS_13640 gene hemL 620266 621615 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_13640 621627 621959 gene locus_tag LOCUS_13650 621627 621959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 622027 622503 gene locus_tag LOCUS_13660 622027 622503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 622519 623307 gene locus_tag LOCUS_13670 622519 623307 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_13670 623335 623676 gene locus_tag LOCUS_13680 623335 623676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 623796 623975 gene locus_tag LOCUS_13690 623796 623975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 624832 623894 gene locus_tag LOCUS_13700 gene trxB 624832 623894 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_13700 626385 624937 gene locus_tag LOCUS_13710 626385 624937 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_13710 626401 627798 gene locus_tag LOCUS_13720 626401 627798 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_13720 627807 629348 gene locus_tag LOCUS_13730 627807 629348 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_13730 631952 629364 gene locus_tag LOCUS_13740 631952 629364 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_13740 633757 631991 gene locus_tag LOCUS_13750 633757 631991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 634911 633868 gene locus_tag LOCUS_13760 634911 633868 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_13760 634968 635561 gene locus_tag LOCUS_13770 gene hpt 634968 635561 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_13770 635558 636625 gene locus_tag LOCUS_13780 gene add 635558 636625 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_13780 637302 636787 gene locus_tag LOCUS_13790 637302 636787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 638358 637483 gene locus_tag LOCUS_13800 638358 637483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 638363 638737 gene locus_tag LOCUS_13810 638363 638737 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_13810 638734 639588 gene locus_tag LOCUS_13820 638734 639588 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_13820 639612 640790 gene locus_tag LOCUS_13830 639612 640790 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_13830 641335 640955 gene locus_tag LOCUS_13840 641335 640955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 641784 642365 gene locus_tag LOCUS_13850 641784 642365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13850 642452 643246 gene locus_tag LOCUS_13860 642452 643246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_13860 643243 643959 gene locus_tag LOCUS_13870 643243 643959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 644033 644815 gene locus_tag LOCUS_13880 644033 644815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 648389 644913 gene locus_tag LOCUS_13890 648389 644913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 649627 648527 gene locus_tag LOCUS_13900 649627 648527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 650593 649691 gene locus_tag LOCUS_13910 650593 649691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 651899 650679 gene locus_tag LOCUS_13920 651899 650679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 653041 651896 gene locus_tag LOCUS_13930 653041 651896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 653703 653038 gene locus_tag LOCUS_13940 gene sigY 653703 653038 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_13940 654930 653890 gene locus_tag LOCUS_13950 654930 653890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 655826 654927 gene locus_tag LOCUS_13960 655826 654927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 656546 656082 gene locus_tag LOCUS_13970 656546 656082 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092129.1 protein_id gnl|my_center|LOCUS_13970 658509 656806 gene locus_tag LOCUS_13980 658509 656806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_13980 660525 658630 gene locus_tag LOCUS_13990 660525 658630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618939.1 protein_id gnl|my_center|LOCUS_13990 660886 660677 gene locus_tag LOCUS_14000 660886 660677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 661698 661093 gene locus_tag LOCUS_14010 661698 661093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 661784 662749 gene locus_tag LOCUS_14020 661784 662749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 662817 664718 gene locus_tag LOCUS_14030 662817 664718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 664870 665445 gene locus_tag LOCUS_14040 664870 665445 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_14040 665468 666319 gene locus_tag LOCUS_14050 665468 666319 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_14050 666621 670163 gene locus_tag LOCUS_14060 666621 670163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 670201 672210 gene locus_tag LOCUS_14070 670201 672210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 672270 673436 gene locus_tag LOCUS_14080 672270 673436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 673527 674684 gene locus_tag LOCUS_14090 673527 674684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 675246 674704 gene locus_tag LOCUS_14100 675246 674704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 675303 676637 gene locus_tag LOCUS_14110 gene rsmB 675303 676637 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_14110 677576 676770 gene locus_tag LOCUS_14120 677576 676770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 677762 678673 gene locus_tag LOCUS_14130 677762 678673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 678837 679508 gene locus_tag LOCUS_14140 678837 679508 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_14140 679676 680686 gene locus_tag LOCUS_14150 679676 680686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 680696 681265 gene locus_tag LOCUS_14160 680696 681265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 681412 682272 gene locus_tag LOCUS_14170 681412 682272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 684240 682360 gene locus_tag LOCUS_14180 684240 682360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 684571 684242 gene locus_tag LOCUS_14190 684571 684242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 685282 685464 gene locus_tag LOCUS_14200 685282 685464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 685489 686622 gene locus_tag LOCUS_14210 685489 686622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 686603 687187 gene locus_tag LOCUS_14220 686603 687187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 687903 689021 gene locus_tag LOCUS_14230 687903 689021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 689243 689884 gene locus_tag LOCUS_14240 689243 689884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 692757 689911 gene locus_tag LOCUS_14250 692757 689911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 694791 693073 gene locus_tag LOCUS_14260 694791 693073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 696664 695057 gene locus_tag LOCUS_14270 696664 695057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 696826 697665 gene locus_tag LOCUS_14280 696826 697665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 698198 697713 gene locus_tag LOCUS_14290 698198 697713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 698755 698228 gene locus_tag LOCUS_14300 698755 698228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 699531 698761 gene locus_tag LOCUS_14310 699531 698761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 699859 700338 gene locus_tag LOCUS_14320 699859 700338 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_14320 700363 702522 gene locus_tag LOCUS_14330 gene ppk1 700363 702522 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_14330 703235 702573 gene locus_tag LOCUS_14340 703235 702573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 704861 703323 gene locus_tag LOCUS_14350 gene ppx 704861 703323 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_14350 705421 704873 gene locus_tag LOCUS_14360 705421 704873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 705494 707413 gene locus_tag LOCUS_14370 705494 707413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 708638 707460 gene locus_tag LOCUS_14380 708638 707460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 709212 710225 gene locus_tag LOCUS_14390 709212 710225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 710222 711220 gene locus_tag LOCUS_14400 710222 711220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 711708 711307 gene locus_tag LOCUS_14410 711708 711307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 711908 712756 gene locus_tag LOCUS_14420 711908 712756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 713991 712963 gene locus_tag LOCUS_14430 713991 712963 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223430.1 protein_id gnl|my_center|LOCUS_14430 714266 715630 gene locus_tag LOCUS_14440 714266 715630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 716755 715652 gene locus_tag LOCUS_14450 716755 715652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 716907 717269 gene locus_tag LOCUS_14460 716907 717269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 717303 717476 gene locus_tag LOCUS_14470 717303 717476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 719172 717496 gene locus_tag LOCUS_14480 719172 717496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 720846 719314 gene locus_tag LOCUS_14490 720846 719314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 721118 722965 gene locus_tag LOCUS_14500 721118 722965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 723130 723005 gene locus_tag LOCUS_14510 723130 723005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 724835 723270 gene locus_tag LOCUS_14520 724835 723270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 726009 724807 gene locus_tag LOCUS_14530 726009 724807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 726190 728592 gene locus_tag LOCUS_14540 726190 728592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 729451 728690 gene locus_tag LOCUS_14550 729451 728690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 729519 729872 gene locus_tag LOCUS_14560 729519 729872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 731789 729957 gene locus_tag LOCUS_14570 731789 729957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 732405 731866 gene locus_tag LOCUS_14580 732405 731866 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_14580 732453 733553 gene locus_tag LOCUS_14590 732453 733553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 733640 735127 gene locus_tag LOCUS_14600 733640 735127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 735268 735669 gene locus_tag LOCUS_14610 735268 735669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 736806 735703 gene locus_tag LOCUS_14620 736806 735703 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_14620 737109 738029 gene locus_tag LOCUS_14630 737109 738029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 740459 738216 gene locus_tag LOCUS_14640 740459 738216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 744254 740712 gene locus_tag LOCUS_14650 744254 740712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 744865 744296 gene locus_tag LOCUS_14660 744865 744296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 744996 747779 gene locus_tag LOCUS_14670 744996 747779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143140759.1 protein_id gnl|my_center|LOCUS_14670 747828 748436 gene locus_tag LOCUS_14680 747828 748436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397934.1 protein_id gnl|my_center|LOCUS_14680 749562 748498 gene locus_tag LOCUS_14690 749562 748498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 749846 749559 gene locus_tag LOCUS_14700 749846 749559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 750083 749889 gene locus_tag LOCUS_14710 750083 749889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 750777 750073 gene locus_tag LOCUS_14720 750777 750073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 751062 752396 gene locus_tag LOCUS_14730 751062 752396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 752853 752350 gene locus_tag LOCUS_14740 752853 752350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 753502 752855 gene locus_tag LOCUS_14750 753502 752855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 754383 754973 gene locus_tag LOCUS_14760 754383 754973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 755230 756579 gene locus_tag LOCUS_14770 755230 756579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 756576 759323 gene locus_tag LOCUS_14780 756576 759323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 759925 759536 gene locus_tag LOCUS_14790 759925 759536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 760438 760103 gene locus_tag LOCUS_14800 760438 760103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 760567 760803 gene locus_tag LOCUS_14810 760567 760803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 761769 760966 gene locus_tag LOCUS_14820 761769 760966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 761859 762194 gene locus_tag LOCUS_14830 761859 762194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 762557 763516 gene locus_tag LOCUS_14840 762557 763516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 763513 765228 gene locus_tag LOCUS_14850 763513 765228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 765659 768469 gene locus_tag LOCUS_14860 765659 768469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 768493 768714 gene locus_tag LOCUS_14870 768493 768714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 768711 770219 gene locus_tag LOCUS_14880 768711 770219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 770971 770216 gene locus_tag LOCUS_14890 770971 770216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 771533 772120 gene locus_tag LOCUS_14900 771533 772120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 772008 773165 gene locus_tag LOCUS_14910 772008 773165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14910 773189 774067 gene locus_tag LOCUS_14920 773189 774067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 774070 774969 gene locus_tag LOCUS_14930 774070 774969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 775039 776109 gene locus_tag LOCUS_14940 775039 776109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 776340 776951 gene locus_tag LOCUS_14950 776340 776951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 776948 777742 gene locus_tag LOCUS_14960 776948 777742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 777757 778389 gene locus_tag LOCUS_14970 777757 778389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 778386 780299 gene locus_tag LOCUS_14980 778386 780299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 780193 782052 gene locus_tag LOCUS_14990 780193 782052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 782049 783347 gene locus_tag LOCUS_15000 782049 783347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15000 783263 784090 gene locus_tag LOCUS_15010 783263 784090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15010 784768 786330 gene locus_tag LOCUS_15020 784768 786330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 786327 789290 gene locus_tag LOCUS_15030 786327 789290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 789287 790612 gene locus_tag LOCUS_15040 789287 790612 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_15040 790609 791550 gene locus_tag LOCUS_15050 790609 791550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 791547 791732 gene locus_tag LOCUS_15060 791547 791732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 791726 792328 gene locus_tag LOCUS_15070 791726 792328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 792337 793551 gene locus_tag LOCUS_15080 792337 793551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 793548 794861 gene locus_tag LOCUS_15090 793548 794861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 794858 797620 gene locus_tag LOCUS_15100 794858 797620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 797645 799294 gene locus_tag LOCUS_15110 797645 799294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 799449 799742 gene locus_tag LOCUS_15120 799449 799742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 799742 801187 gene locus_tag LOCUS_15130 799742 801187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 801160 802053 gene locus_tag LOCUS_15140 801160 802053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 802008 802487 gene locus_tag LOCUS_15150 802008 802487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 802990 802595 gene locus_tag LOCUS_15160 802990 802595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 803539 803117 gene locus_tag LOCUS_15170 803539 803117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 804202 803627 gene locus_tag LOCUS_15180 804202 803627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 805360 804383 gene locus_tag LOCUS_15190 805360 804383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 805401 805784 gene locus_tag LOCUS_15200 805401 805784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15200 805768 806637 gene locus_tag LOCUS_15210 805768 806637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 806704 807210 gene locus_tag LOCUS_15220 806704 807210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 807231 808934 gene locus_tag LOCUS_15230 807231 808934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 809644 809877 gene locus_tag LOCUS_15240 809644 809877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 809874 811418 gene locus_tag LOCUS_15250 809874 811418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 811330 811731 gene locus_tag LOCUS_15260 811330 811731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 812429 812761 gene locus_tag LOCUS_15270 812429 812761 CDS product killer suppression protein HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387766.1 protein_id gnl|my_center|LOCUS_15270 812754 813851 gene locus_tag LOCUS_15280 812754 813851 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_15280 813841 814221 gene locus_tag LOCUS_15290 813841 814221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 814868 815164 gene locus_tag LOCUS_15300 814868 815164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 815531 815331 gene locus_tag LOCUS_15310 815531 815331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 815794 815492 gene locus_tag LOCUS_15320 815794 815492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 816279 815878 gene locus_tag LOCUS_15330 816279 815878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 817623 817417 gene locus_tag LOCUS_15340 817623 817417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 817760 817578 gene locus_tag LOCUS_15350 817760 817578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 818449 819555 gene locus_tag LOCUS_15360 818449 819555 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_15360 819754 821076 gene locus_tag LOCUS_15370 819754 821076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 821371 822513 gene locus_tag LOCUS_15380 821371 822513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 822494 824086 gene locus_tag LOCUS_15390 822494 824086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 824411 824238 gene locus_tag LOCUS_15400 824411 824238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 825535 824645 gene locus_tag LOCUS_15410 825535 824645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15410 826000 825608 gene locus_tag LOCUS_15420 826000 825608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15420 826795 826112 gene locus_tag LOCUS_15430 826795 826112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15430 826930 827454 gene locus_tag LOCUS_15440 826930 827454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 827725 827504 gene locus_tag LOCUS_15450 827725 827504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 828377 828889 gene locus_tag LOCUS_15460 828377 828889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 829151 829585 gene locus_tag LOCUS_15470 829151 829585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 829832 829560 gene locus_tag LOCUS_15480 829832 829560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 830099 830242 gene locus_tag LOCUS_15490 830099 830242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence03 2188 1631 gene locus_tag LOCUS_15500 2188 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2413 3462 gene locus_tag LOCUS_15510 2413 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 6743 3474 gene locus_tag LOCUS_15520 6743 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 6998 8464 gene locus_tag LOCUS_15530 6998 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 8668 10218 gene locus_tag LOCUS_15540 8668 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 11225 10359 gene locus_tag LOCUS_15550 11225 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 11720 11346 gene locus_tag LOCUS_15560 11720 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 14070 11896 gene locus_tag LOCUS_15570 14070 11896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088156.1 protein_id gnl|my_center|LOCUS_15570 14977 14219 gene locus_tag LOCUS_15580 14977 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 15942 14974 gene locus_tag LOCUS_15590 15942 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 16102 16794 gene locus_tag LOCUS_15600 16102 16794 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_15600 16799 18847 gene locus_tag LOCUS_15610 16799 18847 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_15610 18865 19983 gene locus_tag LOCUS_15620 18865 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 protein_id gnl|my_center|LOCUS_15620 20067 20828 gene locus_tag LOCUS_15630 20067 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 21711 20851 gene locus_tag LOCUS_15640 21711 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 23179 21779 gene locus_tag LOCUS_15650 23179 21779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 24350 23187 gene locus_tag LOCUS_15660 24350 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 25339 24371 gene locus_tag LOCUS_15670 25339 24371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 27023 25398 gene locus_tag LOCUS_15680 27023 25398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 28534 27251 gene locus_tag LOCUS_15690 28534 27251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_15690 29121 28531 gene locus_tag LOCUS_15700 29121 28531 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_15700 29148 30647 gene locus_tag LOCUS_15710 29148 30647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 30758 31075 gene locus_tag LOCUS_15720 30758 31075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 31156 32055 gene locus_tag LOCUS_15730 31156 32055 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114074.1 protein_id gnl|my_center|LOCUS_15730 32052 32864 gene locus_tag LOCUS_15740 32052 32864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 32930 33280 gene locus_tag LOCUS_15750 32930 33280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 33370 34617 gene locus_tag LOCUS_15760 33370 34617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 36054 34633 gene locus_tag LOCUS_15770 36054 34633 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_15770 36282 37481 gene locus_tag LOCUS_15780 36282 37481 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_15780 38634 37417 gene locus_tag LOCUS_15790 38634 37417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 39110 40615 gene locus_tag LOCUS_15800 39110 40615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 41589 40666 gene locus_tag LOCUS_15810 41589 40666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 42470 41694 gene locus_tag LOCUS_15820 42470 41694 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_15820 43464 42520 gene locus_tag LOCUS_15830 43464 42520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 44355 43468 gene locus_tag LOCUS_15840 44355 43468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 44393 44998 gene locus_tag LOCUS_15850 44393 44998 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_15850 44995 45471 gene locus_tag LOCUS_15860 44995 45471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_15860 48439 45518 gene locus_tag LOCUS_15870 48439 45518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 49172 48768 gene locus_tag LOCUS_15880 49172 48768 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_15880 50180 49353 gene locus_tag LOCUS_15890 50180 49353 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971164.1 protein_id gnl|my_center|LOCUS_15890 50218 50952 gene locus_tag LOCUS_15900 50218 50952 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324308.1 protein_id gnl|my_center|LOCUS_15900 51080 51823 gene locus_tag LOCUS_15910 51080 51823 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877731.1 protein_id gnl|my_center|LOCUS_15910 51807 52478 gene locus_tag LOCUS_15920 51807 52478 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090254.1 protein_id gnl|my_center|LOCUS_15920 52530 53216 gene locus_tag LOCUS_15930 52530 53216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 53370 53981 gene locus_tag LOCUS_15940 53370 53981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 53984 54244 gene locus_tag LOCUS_15950 53984 54244 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_15950 54241 54654 gene locus_tag LOCUS_15960 54241 54654 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_15960 54656 55486 gene locus_tag LOCUS_15970 gene ttcA 54656 55486 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706151.1 protein_id gnl|my_center|LOCUS_15970 56535 55483 gene locus_tag LOCUS_15980 56535 55483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 56666 57799 gene locus_tag LOCUS_15990 56666 57799 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943210.1 protein_id gnl|my_center|LOCUS_15990 58266 57859 gene locus_tag LOCUS_16000 58266 57859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 58323 59894 gene locus_tag LOCUS_16010 58323 59894 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_16010 59938 60090 gene locus_tag LOCUS_16020 59938 60090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 60199 62448 gene locus_tag LOCUS_16030 60199 62448 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728218.1 protein_id gnl|my_center|LOCUS_16030 62822 63529 gene locus_tag LOCUS_16040 62822 63529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 63943 63563 gene locus_tag LOCUS_16050 63943 63563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 64535 66913 gene locus_tag LOCUS_16060 64535 66913 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003909410.1 protein_id gnl|my_center|LOCUS_16060 67746 67030 gene locus_tag LOCUS_16070 67746 67030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 68239 67727 gene locus_tag LOCUS_16080 68239 67727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 68787 68236 gene locus_tag LOCUS_16090 68787 68236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 69326 68784 gene locus_tag LOCUS_16100 69326 68784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 69983 69402 gene locus_tag LOCUS_16110 69983 69402 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 protein_id gnl|my_center|LOCUS_16110 70246 71025 gene locus_tag LOCUS_16120 70246 71025 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564131.1 protein_id gnl|my_center|LOCUS_16120 71025 71621 gene locus_tag LOCUS_16130 71025 71621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 71766 73562 gene locus_tag LOCUS_16140 71766 73562 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_16140 75087 73606 gene locus_tag LOCUS_16150 75087 73606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 76211 75171 gene locus_tag LOCUS_16160 76211 75171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 79069 76430 gene locus_tag LOCUS_16170 gene clpB 79069 76430 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_16170 79365 80408 gene locus_tag LOCUS_16180 79365 80408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 80405 80887 gene locus_tag LOCUS_16190 80405 80887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 81547 81179 gene locus_tag LOCUS_16200 81547 81179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 81438 82544 gene locus_tag LOCUS_16210 81438 82544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 82784 82578 gene locus_tag LOCUS_16220 82784 82578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 82668 83759 gene locus_tag LOCUS_16230 gene add 82668 83759 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_16230 83898 86960 gene locus_tag LOCUS_16240 83898 86960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 88842 87025 gene locus_tag LOCUS_16250 88842 87025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 89288 88839 gene locus_tag LOCUS_16260 89288 88839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 90076 89291 gene locus_tag LOCUS_16270 90076 89291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 91043 90171 gene locus_tag LOCUS_16280 91043 90171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_16280 91626 91084 gene locus_tag LOCUS_16290 91626 91084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 91800 93713 gene locus_tag LOCUS_16300 91800 93713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 93803 94291 gene locus_tag LOCUS_16310 93803 94291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 94270 94449 gene locus_tag LOCUS_16320 94270 94449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 94578 96419 gene locus_tag LOCUS_16330 94578 96419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 97770 96457 gene locus_tag LOCUS_16340 97770 96457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 98338 97757 gene locus_tag LOCUS_16350 98338 97757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 99795 98335 gene locus_tag LOCUS_16360 gene tssC 99795 98335 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480731.1 protein_id gnl|my_center|LOCUS_16360 100333 99809 gene locus_tag LOCUS_16370 gene tssB 100333 99809 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943792.1 protein_id gnl|my_center|LOCUS_16370 100517 101014 gene locus_tag LOCUS_16380 100517 101014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 105282 101128 gene locus_tag LOCUS_16390 105282 101128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 106274 105276 gene locus_tag LOCUS_16400 106274 105276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 108634 106361 gene locus_tag LOCUS_16410 108634 106361 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203275.1 protein_id gnl|my_center|LOCUS_16410 110038 108785 gene locus_tag LOCUS_16420 gene tssC 110038 108785 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943793.1 protein_id gnl|my_center|LOCUS_16420 113474 110142 gene locus_tag LOCUS_16430 113474 110142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 114332 113628 gene locus_tag LOCUS_16440 114332 113628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 115658 114339 gene locus_tag LOCUS_16450 gene tssK 115658 114339 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686687.1 protein_id gnl|my_center|LOCUS_16450 116362 115655 gene locus_tag LOCUS_16460 116362 115655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 117458 116574 gene locus_tag LOCUS_16470 117458 116574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 118856 117510 gene locus_tag LOCUS_16480 118856 117510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 119863 118805 gene locus_tag LOCUS_16490 119863 118805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 120397 119873 gene locus_tag LOCUS_16500 120397 119873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 120347 120796 gene locus_tag LOCUS_16510 120347 120796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 120723 122105 gene locus_tag LOCUS_16520 120723 122105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 123311 122199 gene locus_tag LOCUS_16530 123311 122199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 124286 123390 gene locus_tag LOCUS_16540 gene prmC 124286 123390 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_16540 125535 124309 gene locus_tag LOCUS_16550 125535 124309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 126191 125607 gene locus_tag LOCUS_16560 126191 125607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 127210 126188 gene locus_tag LOCUS_16570 gene hemE 127210 126188 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_16570 127449 127970 gene locus_tag LOCUS_16580 127449 127970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 128037 129497 gene locus_tag LOCUS_16590 128037 129497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 129513 129809 gene locus_tag LOCUS_16600 129513 129809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 129793 130986 gene locus_tag LOCUS_16610 129793 130986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 130995 132353 gene locus_tag LOCUS_16620 130995 132353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 133601 132420 gene locus_tag LOCUS_16630 133601 132420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 133852 137178 gene locus_tag LOCUS_16640 gene ileS 133852 137178 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_16640 137175 138617 gene locus_tag LOCUS_16650 gene hisS 137175 138617 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_16650 138654 139625 gene locus_tag LOCUS_16660 138654 139625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_16660 139672 141117 gene locus_tag LOCUS_16670 139672 141117 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_16670 141453 141214 gene locus_tag LOCUS_16680 141453 141214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 142073 141450 gene locus_tag LOCUS_16690 gene plsY 142073 141450 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_16690 142719 142114 gene locus_tag LOCUS_16700 gene hisIE 142719 142114 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257923.1 protein_id gnl|my_center|LOCUS_16700 143476 142841 gene locus_tag LOCUS_16710 143476 142841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 143468 143665 gene locus_tag LOCUS_16720 143468 143665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 144453 143662 gene locus_tag LOCUS_16730 gene hisA 144453 143662 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_16730 145175 144450 gene locus_tag LOCUS_16740 gene hisH 145175 144450 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_16740 145315 146421 gene locus_tag LOCUS_16750 145315 146421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 146418 148631 gene locus_tag LOCUS_16760 146418 148631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 148876 150405 gene locus_tag LOCUS_16770 148876 150405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 150852 150433 gene locus_tag LOCUS_16780 150852 150433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 151637 150900 gene locus_tag LOCUS_16790 gene rpoE 151637 150900 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_16790 152811 151729 gene locus_tag LOCUS_16800 152811 151729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 153338 152859 gene locus_tag LOCUS_16810 153338 152859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 153510 154478 gene locus_tag LOCUS_16820 153510 154478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 154502 155503 gene locus_tag LOCUS_16830 154502 155503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 157133 155529 gene locus_tag LOCUS_16840 157133 155529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 157185 157973 gene locus_tag LOCUS_16850 157185 157973 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_16850 159050 157977 gene locus_tag LOCUS_16860 159050 157977 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037180.1 protein_id gnl|my_center|LOCUS_16860 159124 159438 gene locus_tag LOCUS_16870 159124 159438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 160022 159540 gene locus_tag LOCUS_16880 160022 159540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 160218 161750 gene locus_tag LOCUS_16890 gene rng 160218 161750 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_16890 161785 162447 gene locus_tag LOCUS_16900 161785 162447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 162488 162949 gene locus_tag LOCUS_16910 162488 162949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 163006 163836 gene locus_tag LOCUS_16920 163006 163836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 163843 164742 gene locus_tag LOCUS_16930 163843 164742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 166161 164803 gene locus_tag LOCUS_16940 gene rimO 166161 164803 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_16940 168025 166304 gene locus_tag LOCUS_16950 168025 166304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 168281 168538 gene locus_tag LOCUS_16960 168281 168538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 168694 168951 gene locus_tag LOCUS_16970 168694 168951 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_16970 168958 169569 gene locus_tag LOCUS_16980 gene rimM 168958 169569 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056908.1 protein_id gnl|my_center|LOCUS_16980 169566 170828 gene locus_tag LOCUS_16990 169566 170828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 170866 171282 gene locus_tag LOCUS_17000 gene rplS 170866 171282 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897519.1 protein_id gnl|my_center|LOCUS_17000 171289 171687 gene locus_tag LOCUS_17010 171289 171687 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174223.1 protein_id gnl|my_center|LOCUS_17010 172298 171699 gene locus_tag LOCUS_17020 172298 171699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 172404 172709 gene locus_tag LOCUS_17030 172404 172709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 173154 174755 gene locus_tag LOCUS_17040 173154 174755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 174855 178739 gene locus_tag LOCUS_17050 174855 178739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 178749 180863 gene locus_tag LOCUS_17060 178749 180863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 180938 182332 gene locus_tag LOCUS_17070 180938 182332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 182287 183030 gene locus_tag LOCUS_17080 182287 183030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 183280 184188 gene locus_tag LOCUS_17090 183280 184188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 184471 196560 gene locus_tag LOCUS_17100 184471 196560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 198133 196685 gene locus_tag LOCUS_17110 198133 196685 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_17110 198300 198112 gene locus_tag LOCUS_17120 198300 198112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 198603 201704 gene locus_tag LOCUS_17130 198603 201704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 201806 201890 gene locus_tag LOCUS_t00300 201806 201890 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 202248 202096 gene locus_tag LOCUS_17140 202248 202096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 202287 203093 gene locus_tag LOCUS_17150 gene thiD 202287 203093 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_17150 204699 203113 gene locus_tag LOCUS_17160 204699 203113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 205529 204720 gene locus_tag LOCUS_17170 205529 204720 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_17170 205675 206007 gene locus_tag LOCUS_17180 205675 206007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 206038 207474 gene locus_tag LOCUS_17190 206038 207474 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036996.1 protein_id gnl|my_center|LOCUS_17190 208192 207488 gene locus_tag LOCUS_17200 208192 207488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 208218 208300 gene locus_tag LOCUS_t00310 208218 208300 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 208948 209523 gene locus_tag LOCUS_17210 208948 209523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 209907 211550 gene locus_tag LOCUS_17220 209907 211550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_17220 211628 215413 gene locus_tag LOCUS_17230 211628 215413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 215648 215427 gene locus_tag LOCUS_17240 215648 215427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 215680 216084 gene locus_tag LOCUS_17250 215680 216084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 216280 216642 gene locus_tag LOCUS_17260 216280 216642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 217409 216570 gene locus_tag LOCUS_17270 gene pssA 217409 216570 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_17270 218052 217414 gene locus_tag LOCUS_17280 218052 217414 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_17280 218979 218257 gene locus_tag LOCUS_17290 218979 218257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 219484 220380 gene locus_tag LOCUS_17300 219484 220380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 220390 223092 gene locus_tag LOCUS_17310 220390 223092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 221943 222193 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcaggcggaggcggcgctggtcg 224870 223188 gene locus_tag LOCUS_17320 224870 223188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 224899 226224 gene locus_tag LOCUS_17330 224899 226224 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_17330 226750 226247 gene locus_tag LOCUS_17340 226750 226247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 227784 226801 gene locus_tag LOCUS_17350 227784 226801 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_17350 228062 228619 gene locus_tag LOCUS_17360 228062 228619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 229461 228622 gene locus_tag LOCUS_17370 229461 228622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 230231 229458 gene locus_tag LOCUS_17380 230231 229458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 231232 230201 gene locus_tag LOCUS_17390 231232 230201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 232398 231229 gene locus_tag LOCUS_17400 232398 231229 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226447.1 protein_id gnl|my_center|LOCUS_17400 234149 232395 gene locus_tag LOCUS_17410 gene asnB 234149 232395 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115546.1 protein_id gnl|my_center|LOCUS_17410 235099 234128 gene locus_tag LOCUS_17420 235099 234128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 236328 235096 gene locus_tag LOCUS_17430 236328 235096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 237244 236363 gene locus_tag LOCUS_17440 237244 236363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 237364 238044 gene locus_tag LOCUS_17450 237364 238044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 238038 238523 gene locus_tag LOCUS_17460 gene rplL 238038 238523 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_17460 240246 238564 gene locus_tag LOCUS_17470 240246 238564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 241118 240291 gene locus_tag LOCUS_17480 241118 240291 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_17480 241188 241487 gene locus_tag LOCUS_17490 241188 241487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 244036 241607 gene locus_tag LOCUS_17500 gene clpA 244036 241607 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337384.1 protein_id gnl|my_center|LOCUS_17500 244367 244023 gene locus_tag LOCUS_17510 gene clpS 244367 244023 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535011.1 protein_id gnl|my_center|LOCUS_17510 244433 245662 gene locus_tag LOCUS_17520 244433 245662 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087892.1 protein_id gnl|my_center|LOCUS_17520 245778 247370 gene locus_tag LOCUS_17530 245778 247370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 248337 247375 gene locus_tag LOCUS_17540 248337 247375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 249556 248459 gene locus_tag LOCUS_17550 249556 248459 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_17550 250714 249683 gene locus_tag LOCUS_17560 250714 249683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 253016 250857 gene locus_tag LOCUS_17570 253016 250857 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036305.1 protein_id gnl|my_center|LOCUS_17570 254063 253116 gene locus_tag LOCUS_17580 254063 253116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 254204 255844 gene locus_tag LOCUS_17590 254204 255844 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898728.1 protein_id gnl|my_center|LOCUS_17590 255853 257616 gene locus_tag LOCUS_17600 255853 257616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 259185 257668 gene locus_tag LOCUS_17610 259185 257668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 259254 259811 gene locus_tag LOCUS_17620 259254 259811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 260840 259797 gene locus_tag LOCUS_17630 260840 259797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 261717 260980 gene locus_tag LOCUS_17640 261717 260980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 261838 262728 gene locus_tag LOCUS_17650 261838 262728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 263811 262705 gene locus_tag LOCUS_17660 263811 262705 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_17660 264711 263959 gene locus_tag LOCUS_17670 264711 263959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 266690 264858 gene locus_tag LOCUS_17680 266690 264858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 267288 266680 gene locus_tag LOCUS_17690 267288 266680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 268150 267440 gene locus_tag LOCUS_17700 268150 267440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 272182 268205 gene locus_tag LOCUS_17710 272182 268205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 274395 272179 gene locus_tag LOCUS_17720 274395 272179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 274709 277444 gene locus_tag LOCUS_17730 274709 277444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_17730 277652 278092 gene locus_tag LOCUS_17740 277652 278092 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943047.1 protein_id gnl|my_center|LOCUS_17740 278140 278526 gene locus_tag LOCUS_17750 278140 278526 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_17750 278781 280214 gene locus_tag LOCUS_17760 278781 280214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 280207 281052 gene locus_tag LOCUS_17770 280207 281052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 281056 282693 gene locus_tag LOCUS_17780 gene muiA 281056 282693 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_17780 282766 283665 gene locus_tag LOCUS_17790 282766 283665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 285283 283649 gene locus_tag LOCUS_17800 285283 283649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 287687 285411 gene locus_tag LOCUS_17810 287687 285411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 287809 287715 gene locus_tag LOCUS_t00320 287809 287715 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 288503 287877 gene locus_tag LOCUS_17820 288503 287877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 288566 289720 gene locus_tag LOCUS_17830 gene dnaJ 288566 289720 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_17830 289983 289717 gene locus_tag LOCUS_17840 289983 289717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 290484 289993 gene locus_tag LOCUS_17850 290484 289993 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_17850 290893 290594 gene locus_tag LOCUS_17860 290893 290594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 292763 291126 gene locus_tag LOCUS_17870 gene pruA 292763 291126 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_17870 293380 292853 gene locus_tag LOCUS_17880 293380 292853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 293620 295224 gene locus_tag LOCUS_17890 293620 295224 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626143.1 protein_id gnl|my_center|LOCUS_17890 295980 295243 gene locus_tag LOCUS_17900 295980 295243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 296591 296136 gene locus_tag LOCUS_17910 296591 296136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 297081 297401 gene locus_tag LOCUS_17920 gene rplU 297081 297401 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_17920 297456 297755 gene locus_tag LOCUS_17930 gene rpmA 297456 297755 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_17930 297776 298987 gene locus_tag LOCUS_17940 gene obgE 297776 298987 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_17940 300334 299087 gene locus_tag LOCUS_17950 300334 299087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17950 301047 300268 gene locus_tag LOCUS_17960 301047 300268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17960 301996 301073 gene locus_tag LOCUS_17970 301996 301073 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187293929.1 protein_id gnl|my_center|LOCUS_17970 302431 302159 gene locus_tag LOCUS_17980 302431 302159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 302481 302828 gene locus_tag LOCUS_17990 302481 302828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 302838 303176 gene locus_tag LOCUS_18000 302838 303176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 303436 304257 gene locus_tag LOCUS_18010 303436 304257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 305014 304235 gene locus_tag LOCUS_18020 305014 304235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 305104 305847 gene locus_tag LOCUS_18030 305104 305847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 306012 308336 gene locus_tag LOCUS_18040 306012 308336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 308392 309429 gene locus_tag LOCUS_18050 308392 309429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 309809 310783 gene locus_tag LOCUS_18060 309809 310783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 311218 312687 gene locus_tag LOCUS_18070 311218 312687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 314282 312831 gene locus_tag LOCUS_18080 314282 312831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 316789 314351 gene locus_tag LOCUS_18090 316789 314351 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_18090 316957 318384 gene locus_tag LOCUS_18100 316957 318384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 318400 320046 gene locus_tag LOCUS_18110 318400 320046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 320575 320054 gene locus_tag LOCUS_18120 320575 320054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 321661 320672 gene locus_tag LOCUS_18130 321661 320672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 321576 321893 gene locus_tag LOCUS_18140 321576 321893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 322606 322226 gene locus_tag LOCUS_18150 322606 322226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 322488 324194 gene locus_tag LOCUS_18160 322488 324194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 326003 324195 gene locus_tag LOCUS_18170 326003 324195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 326538 326038 gene locus_tag LOCUS_18180 326538 326038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 328053 326620 gene locus_tag LOCUS_18190 328053 326620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 328688 328110 gene locus_tag LOCUS_18200 328688 328110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 329925 328654 gene locus_tag LOCUS_18210 329925 328654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 331821 329938 gene locus_tag LOCUS_18220 331821 329938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 332674 331859 gene locus_tag LOCUS_18230 332674 331859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 333277 332819 gene locus_tag LOCUS_18240 333277 332819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 334614 333274 gene locus_tag LOCUS_18250 334614 333274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 334495 336024 gene locus_tag LOCUS_18260 334495 336024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 336110 337480 gene locus_tag LOCUS_18270 336110 337480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 337658 338104 gene locus_tag LOCUS_18280 337658 338104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 338101 339036 gene locus_tag LOCUS_18290 338101 339036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 339188 339646 gene locus_tag LOCUS_18300 339188 339646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 339685 342177 gene locus_tag LOCUS_18310 339685 342177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 342832 342392 gene locus_tag LOCUS_18320 342832 342392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 342831 343538 gene locus_tag LOCUS_18330 342831 343538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 344687 343587 gene locus_tag LOCUS_18340 344687 343587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 345570 344698 gene locus_tag LOCUS_18350 345570 344698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 345782 346870 gene locus_tag LOCUS_18360 345782 346870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 347719 347000 gene locus_tag LOCUS_18370 347719 347000 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_18370 348833 347784 gene locus_tag LOCUS_18380 348833 347784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 349473 348886 gene locus_tag LOCUS_18390 349473 348886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 349739 349470 gene locus_tag LOCUS_18400 349739 349470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 351440 349806 gene locus_tag LOCUS_18410 351440 349806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 355137 351481 gene locus_tag LOCUS_18420 355137 351481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 355604 355134 gene locus_tag LOCUS_18430 355604 355134 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265987.1 protein_id gnl|my_center|LOCUS_18430 356020 355604 gene locus_tag LOCUS_18440 356020 355604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 356164 356976 gene locus_tag LOCUS_18450 356164 356976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 357048 358655 gene locus_tag LOCUS_18460 357048 358655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 358779 358706 gene locus_tag LOCUS_t00330 358779 358706 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 359650 358940 gene locus_tag LOCUS_18470 359650 358940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 360201 359647 gene locus_tag LOCUS_18480 360201 359647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 361406 360093 gene locus_tag LOCUS_18490 361406 360093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 361941 361717 gene locus_tag LOCUS_18500 361941 361717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 362216 361890 gene locus_tag LOCUS_18510 362216 361890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 363028 362789 gene locus_tag LOCUS_18520 363028 362789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 363122 364030 gene locus_tag LOCUS_18530 363122 364030 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_18530 364958 364104 gene locus_tag LOCUS_18540 364958 364104 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_18540 366069 365059 gene locus_tag LOCUS_18550 366069 365059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 367725 366319 gene locus_tag LOCUS_18560 367725 366319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 368892 367822 gene locus_tag LOCUS_18570 368892 367822 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_18570 369730 368897 gene locus_tag LOCUS_18580 369730 368897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 369812 370747 gene locus_tag LOCUS_18590 369812 370747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 373296 370891 gene locus_tag LOCUS_18600 373296 370891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 375397 373427 gene locus_tag LOCUS_18610 375397 373427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 375657 375995 gene locus_tag LOCUS_18620 375657 375995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 375913 376275 gene locus_tag LOCUS_18630 375913 376275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 379134 377560 gene locus_tag LOCUS_18640 379134 377560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 379228 380322 gene locus_tag LOCUS_18650 gene pyrC 379228 380322 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_18650 380365 381411 gene locus_tag LOCUS_18660 gene asd 380365 381411 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_18660 381477 382559 gene locus_tag LOCUS_18670 381477 382559 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_18670 382636 383007 gene locus_tag LOCUS_18680 382636 383007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 383560 383093 gene locus_tag LOCUS_18690 383560 383093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 384570 383761 gene locus_tag LOCUS_18700 384570 383761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 384781 385791 gene locus_tag LOCUS_18710 384781 385791 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205925.1 protein_id gnl|my_center|LOCUS_18710 386971 385724 gene locus_tag LOCUS_18720 386971 385724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 388019 387069 gene locus_tag LOCUS_18730 388019 387069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 388140 388793 gene locus_tag LOCUS_18740 388140 388793 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_18740 388877 389488 gene locus_tag LOCUS_18750 388877 389488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 390835 389534 gene locus_tag LOCUS_18760 390835 389534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 390830 391195 gene locus_tag LOCUS_18770 390830 391195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 391170 391670 gene locus_tag LOCUS_18780 391170 391670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 391704 392381 gene locus_tag LOCUS_18790 391704 392381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 392521 393039 gene locus_tag LOCUS_18800 392521 393039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 393485 393661 gene locus_tag LOCUS_18810 393485 393661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 393801 394826 gene locus_tag LOCUS_18820 393801 394826 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_18820 395819 394827 gene locus_tag LOCUS_18830 395819 394827 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 protein_id gnl|my_center|LOCUS_18830 395833 399096 gene locus_tag LOCUS_18840 395833 399096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 400483 399119 gene locus_tag LOCUS_18850 400483 399119 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_18850 401991 400567 gene locus_tag LOCUS_18860 401991 400567 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 protein_id gnl|my_center|LOCUS_18860 402142 402615 gene locus_tag LOCUS_18870 gene ruvX 402142 402615 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531790.1 protein_id gnl|my_center|LOCUS_18870 402612 403844 gene locus_tag LOCUS_18880 gene mltG 402612 403844 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_18880 404455 403778 gene locus_tag LOCUS_18890 404455 403778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 404803 405834 gene locus_tag LOCUS_18900 404803 405834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 406425 405892 gene locus_tag LOCUS_18910 406425 405892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 407237 406329 gene locus_tag LOCUS_18920 407237 406329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 407791 407234 gene locus_tag LOCUS_18930 407791 407234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 408444 408013 gene locus_tag LOCUS_18940 408444 408013 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_18940 408595 409437 gene locus_tag LOCUS_18950 408595 409437 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 protein_id gnl|my_center|LOCUS_18950 409796 409509 gene locus_tag LOCUS_18960 409796 409509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 409912 410937 gene locus_tag LOCUS_18970 409912 410937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 412245 411331 gene locus_tag LOCUS_18980 412245 411331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 412718 412539 gene locus_tag LOCUS_18990 412718 412539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 412816 413118 gene locus_tag LOCUS_19000 412816 413118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 414519 413326 gene locus_tag LOCUS_19010 414519 413326 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_19010 416008 414743 gene locus_tag LOCUS_19020 416008 414743 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_19020 417284 416073 gene locus_tag LOCUS_19030 417284 416073 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_19030 417746 417288 gene locus_tag LOCUS_19040 417746 417288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 419225 417798 gene locus_tag LOCUS_19050 gene boxB 419225 417798 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_19050 420974 419289 gene locus_tag LOCUS_19060 gene boxC 420974 419289 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 protein_id gnl|my_center|LOCUS_19060 421568 422233 gene locus_tag LOCUS_19070 421568 422233 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087905.1 protein_id gnl|my_center|LOCUS_19070 423629 422331 gene locus_tag LOCUS_19080 gene rlmD 423629 422331 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_19080 425091 423790 gene locus_tag LOCUS_19090 gene aroA 425091 423790 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 protein_id gnl|my_center|LOCUS_19090 426107 425175 gene locus_tag LOCUS_19100 426107 425175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 427339 426515 gene locus_tag LOCUS_19110 427339 426515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 427556 428398 gene locus_tag LOCUS_19120 427556 428398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 428412 428939 gene locus_tag LOCUS_19130 gene moaB 428412 428939 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532836.1 protein_id gnl|my_center|LOCUS_19130 429872 429015 gene locus_tag LOCUS_19140 429872 429015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 431543 429936 gene locus_tag LOCUS_19150 gene cysS 431543 429936 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_19150 432637 431564 gene locus_tag LOCUS_19160 432637 431564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 435881 432735 gene locus_tag LOCUS_19170 435881 432735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 436083 436610 gene locus_tag LOCUS_19180 436083 436610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 436725 437108 gene locus_tag LOCUS_19190 436725 437108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 437155 438258 gene locus_tag LOCUS_19200 437155 438258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 438409 439116 gene locus_tag LOCUS_19210 gene bioD 438409 439116 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_19210 439571 439167 gene locus_tag LOCUS_19220 439571 439167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 439627 440673 gene locus_tag LOCUS_19230 439627 440673 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_19230 443920 440924 gene locus_tag LOCUS_19240 443920 440924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 444936 444031 gene locus_tag LOCUS_19250 444936 444031 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640467.1 protein_id gnl|my_center|LOCUS_19250 445033 445638 gene locus_tag LOCUS_19260 445033 445638 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369194.1 protein_id gnl|my_center|LOCUS_19260 447306 445720 gene locus_tag LOCUS_19270 447306 445720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 447663 448250 gene locus_tag LOCUS_19280 447663 448250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 449983 448262 gene locus_tag LOCUS_19290 449983 448262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 449960 450502 gene locus_tag LOCUS_19300 449960 450502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 450465 450872 gene locus_tag LOCUS_19310 450465 450872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 451099 451242 gene locus_tag LOCUS_19320 451099 451242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 451435 452895 gene locus_tag LOCUS_19330 451435 452895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 456346 453086 gene locus_tag LOCUS_19340 456346 453086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 457390 456503 gene locus_tag LOCUS_19350 457390 456503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 458490 457486 gene locus_tag LOCUS_19360 458490 457486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 458793 459086 gene locus_tag LOCUS_19370 458793 459086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 459092 460072 gene locus_tag LOCUS_19380 459092 460072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 460079 461344 gene locus_tag LOCUS_19390 gene murA 460079 461344 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_19390 461328 462014 gene locus_tag LOCUS_19400 gene hisG 461328 462014 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_19400 462011 462718 gene locus_tag LOCUS_19410 462011 462718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 462803 463891 gene locus_tag LOCUS_19420 462803 463891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 465144 463888 gene locus_tag LOCUS_19430 gene hutI 465144 463888 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_19430 466814 465141 gene locus_tag LOCUS_19440 gene hutU 466814 465141 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_19440 468371 466845 gene locus_tag LOCUS_19450 468371 466845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 469099 468455 gene locus_tag LOCUS_19460 469099 468455 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_19460 469210 469584 gene locus_tag LOCUS_19470 469210 469584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 469674 471539 gene locus_tag LOCUS_19480 469674 471539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 471556 472785 gene locus_tag LOCUS_19490 471556 472785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 472769 473392 gene locus_tag LOCUS_19500 472769 473392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 476430 473446 gene locus_tag LOCUS_19510 gene uvrA 476430 473446 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_19510 477431 476427 gene locus_tag LOCUS_19520 gene pdxA 477431 476427 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399975.1 protein_id gnl|my_center|LOCUS_19520 477809 478807 gene locus_tag LOCUS_19530 477809 478807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 478886 480448 gene locus_tag LOCUS_19540 478886 480448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 480448 480960 gene locus_tag LOCUS_19550 480448 480960 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_19550 481900 481022 gene locus_tag LOCUS_19560 481900 481022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 481782 482060 gene locus_tag LOCUS_19570 481782 482060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 482130 483269 gene locus_tag LOCUS_19580 482130 483269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_19580 483280 483552 gene locus_tag LOCUS_19590 483280 483552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 483549 485351 gene locus_tag LOCUS_19600 483549 485351 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051300116.1 protein_id gnl|my_center|LOCUS_19600 487240 485423 gene locus_tag LOCUS_19610 487240 485423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 487335 490937 gene locus_tag LOCUS_19620 487335 490937 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_19620 491034 491906 gene locus_tag LOCUS_19630 491034 491906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 491953 493461 gene locus_tag LOCUS_19640 491953 493461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 494620 493400 gene locus_tag LOCUS_19650 494620 493400 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122217.1 protein_id gnl|my_center|LOCUS_19650 494688 495116 gene locus_tag LOCUS_19660 494688 495116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 495116 496249 gene locus_tag LOCUS_19670 495116 496249 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178915.1 protein_id gnl|my_center|LOCUS_19670 496429 498411 gene locus_tag LOCUS_19680 gene bamA 496429 498411 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_19680 498411 503363 gene locus_tag LOCUS_19690 498411 503363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 503817 503365 gene locus_tag LOCUS_19700 503817 503365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 504894 503860 gene locus_tag LOCUS_19710 504894 503860 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_19710 504918 506270 gene locus_tag LOCUS_19720 504918 506270 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_19720 506318 506554 gene locus_tag LOCUS_19730 506318 506554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 506986 506564 gene locus_tag LOCUS_19740 506986 506564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 507209 507673 gene locus_tag LOCUS_19750 507209 507673 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_19750 507686 508657 gene locus_tag LOCUS_19760 gene glpX 507686 508657 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919260.1 protein_id gnl|my_center|LOCUS_19760 508665 509609 gene locus_tag LOCUS_19770 508665 509609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 509644 512001 gene locus_tag LOCUS_19780 509644 512001 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_19780 512001 512429 gene locus_tag LOCUS_19790 512001 512429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 512580 513425 gene locus_tag LOCUS_19800 gene ligD 512580 513425 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_19800 514129 513488 gene locus_tag LOCUS_19810 514129 513488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 515189 514137 gene locus_tag LOCUS_19820 515189 514137 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_19820 515333 516616 gene locus_tag LOCUS_19830 gene eno 515333 516616 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_19830 516679 518142 gene locus_tag LOCUS_19840 516679 518142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 518205 519770 gene locus_tag LOCUS_19850 518205 519770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 519792 520727 gene locus_tag LOCUS_19860 gene coaA 519792 520727 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528342.1 protein_id gnl|my_center|LOCUS_19860 522118 520733 gene locus_tag LOCUS_19870 522118 520733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 522556 522260 gene locus_tag LOCUS_19880 522556 522260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 523420 523064 gene locus_tag LOCUS_19890 523420 523064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 524596 525054 gene locus_tag LOCUS_19900 524596 525054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 526621 525149 gene locus_tag LOCUS_19910 526621 525149 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_19910 527868 526618 gene locus_tag LOCUS_19920 527868 526618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 530586 528595 gene locus_tag LOCUS_19930 530586 528595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 532157 530691 gene locus_tag LOCUS_19940 532157 530691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 532606 532268 gene locus_tag LOCUS_19950 532606 532268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 532599 533828 gene locus_tag LOCUS_19960 532599 533828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19960 534785 534564 gene locus_tag LOCUS_19970 534785 534564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 535789 534791 gene locus_tag LOCUS_19980 535789 534791 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_19980 538207 535862 gene locus_tag LOCUS_19990 538207 535862 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_19990 538830 538207 gene locus_tag LOCUS_20000 538830 538207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 539690 538962 gene locus_tag LOCUS_20010 539690 538962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 539851 540417 gene locus_tag LOCUS_20020 539851 540417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 540579 542321 gene locus_tag LOCUS_20030 540579 542321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 542328 543392 gene locus_tag LOCUS_20040 542328 543392 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_20040 546388 543500 gene locus_tag LOCUS_20050 546388 543500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 546482 547105 gene locus_tag LOCUS_20060 546482 547105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 547062 547847 gene locus_tag LOCUS_20070 547062 547847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 548713 547844 gene locus_tag LOCUS_20080 548713 547844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 548790 549263 gene locus_tag LOCUS_20090 gene coaD 548790 549263 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_20090 549260 549868 gene locus_tag LOCUS_20100 549260 549868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 550082 551287 gene locus_tag LOCUS_20110 550082 551287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 551385 552029 gene locus_tag LOCUS_20120 551385 552029 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616977.1 protein_id gnl|my_center|LOCUS_20120 552046 552480 gene locus_tag LOCUS_20130 552046 552480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 552534 553859 gene locus_tag LOCUS_20140 gene ahcY 552534 553859 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_20140 554214 554771 gene locus_tag LOCUS_20150 554214 554771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 554866 556887 gene locus_tag LOCUS_20160 gene tkt 554866 556887 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_20160 557031 559130 gene locus_tag LOCUS_20170 gene fusA 557031 559130 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102023.1 protein_id gnl|my_center|LOCUS_20170 561851 559335 gene locus_tag LOCUS_20180 561851 559335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 564131 561894 gene locus_tag LOCUS_20190 564131 561894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 565607 564219 gene locus_tag LOCUS_20200 565607 564219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 567040 566246 gene locus_tag LOCUS_20210 567040 566246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 568867 567068 gene locus_tag LOCUS_20220 568867 567068 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_20220 569886 569092 gene locus_tag LOCUS_20230 569886 569092 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_20230 571436 569895 gene locus_tag LOCUS_20240 571436 569895 CDS product HAD-IG family 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_20240 571654 572364 gene locus_tag LOCUS_20250 571654 572364 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_20250 573190 572369 gene locus_tag LOCUS_20260 573190 572369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_20260 574954 573311 gene locus_tag LOCUS_20270 gene groL 574954 573311 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_20270 575296 575003 gene locus_tag LOCUS_20280 gene groES 575296 575003 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_20280 575724 575485 gene locus_tag LOCUS_20290 575724 575485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 575605 576177 gene locus_tag LOCUS_20300 575605 576177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 576174 576788 gene locus_tag LOCUS_20310 576174 576788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 577685 576840 gene locus_tag LOCUS_20320 gene panC 577685 576840 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_20320 578684 577755 gene locus_tag LOCUS_20330 gene panB 578684 577755 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939717.1 protein_id gnl|my_center|LOCUS_20330 578940 579905 gene locus_tag LOCUS_20340 578940 579905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 579933 581441 gene locus_tag LOCUS_20350 579933 581441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 581455 583608 gene locus_tag LOCUS_20360 581455 583608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 584526 583609 gene locus_tag LOCUS_20370 584526 583609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 584682 585677 gene locus_tag LOCUS_20380 584682 585677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 586773 585787 gene locus_tag LOCUS_20390 586773 585787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_20390 586854 588452 gene locus_tag LOCUS_20400 586854 588452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 588626 589684 gene locus_tag LOCUS_20410 588626 589684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 590628 589780 gene locus_tag LOCUS_20420 590628 589780 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_20420 591789 590653 gene locus_tag LOCUS_20430 591789 590653 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_20430 594086 591993 gene locus_tag LOCUS_20440 594086 591993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 595205 594408 gene locus_tag LOCUS_20450 595205 594408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 595310 596032 gene locus_tag LOCUS_20460 595310 596032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 596113 597348 gene locus_tag LOCUS_20470 596113 597348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 597512 597682 gene locus_tag LOCUS_20480 597512 597682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 597688 598596 gene locus_tag LOCUS_20490 597688 598596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 598640 599791 gene locus_tag LOCUS_20500 598640 599791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 599805 600671 gene locus_tag LOCUS_20510 599805 600671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 600965 600612 gene locus_tag LOCUS_20520 600965 600612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 600982 601554 gene locus_tag LOCUS_20530 600982 601554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 601541 602410 gene locus_tag LOCUS_20540 601541 602410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 602544 603692 gene locus_tag LOCUS_20550 602544 603692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 604027 604581 gene locus_tag LOCUS_20560 604027 604581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 605518 604691 gene locus_tag LOCUS_20570 605518 604691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 607640 605964 gene locus_tag LOCUS_20580 gene ubiB 607640 605964 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_20580 607834 608649 gene locus_tag LOCUS_20590 607834 608649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 608739 609581 gene locus_tag LOCUS_20600 gene ttcA 608739 609581 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_20600 609801 610208 gene locus_tag LOCUS_20610 609801 610208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 610325 612571 gene locus_tag LOCUS_20620 610325 612571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 613399 612635 gene locus_tag LOCUS_20630 613399 612635 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_20630 614678 613506 gene locus_tag LOCUS_20640 614678 613506 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_20640 614709 616043 gene locus_tag LOCUS_20650 614709 616043 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776397.1 protein_id gnl|my_center|LOCUS_20650 616139 616846 gene locus_tag LOCUS_20660 616139 616846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 620102 616938 gene locus_tag LOCUS_20670 620102 616938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 620793 620164 gene locus_tag LOCUS_20680 620793 620164 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_20680 620949 622382 gene locus_tag LOCUS_20690 620949 622382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 623314 622448 gene locus_tag LOCUS_20700 623314 622448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 623837 625417 gene locus_tag LOCUS_20710 623837 625417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 626313 625468 gene locus_tag LOCUS_20720 626313 625468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 627107 626310 gene locus_tag LOCUS_20730 627107 626310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 629915 627207 gene locus_tag LOCUS_20740 gene hrpB 629915 627207 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440436.1 protein_id gnl|my_center|LOCUS_20740 630177 630368 gene locus_tag LOCUS_20750 630177 630368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 630430 632526 gene locus_tag LOCUS_20760 gene feoB 630430 632526 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_20760 633027 632632 gene locus_tag LOCUS_20770 gene mscL 633027 632632 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_20770 633579 633196 gene locus_tag LOCUS_20780 633579 633196 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693740.1 protein_id gnl|my_center|LOCUS_20780 633730 634764 gene locus_tag LOCUS_20790 633730 634764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 636365 635169 gene locus_tag LOCUS_20800 636365 635169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 636664 637911 gene locus_tag LOCUS_20810 gene serA 636664 637911 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626385.1 protein_id gnl|my_center|LOCUS_20810 638157 638810 gene locus_tag LOCUS_20820 638157 638810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 639154 638957 gene locus_tag LOCUS_20830 639154 638957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 639348 639148 gene locus_tag LOCUS_20840 639348 639148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 639772 639359 gene locus_tag LOCUS_20850 639772 639359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 640718 639759 gene locus_tag LOCUS_20860 640718 639759 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_20860 641292 640795 gene locus_tag LOCUS_20870 641292 640795 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980181.1 protein_id gnl|my_center|LOCUS_20870 641429 642910 gene locus_tag LOCUS_20880 641429 642910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 642960 645542 gene locus_tag LOCUS_20890 642960 645542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 645547 646617 gene locus_tag LOCUS_20900 645547 646617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339377.1 protein_id gnl|my_center|LOCUS_20900 648561 646621 gene locus_tag LOCUS_20910 648561 646621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 650872 648884 gene locus_tag LOCUS_20920 650872 648884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 651274 650972 gene locus_tag LOCUS_20930 651274 650972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 652414 651350 gene locus_tag LOCUS_20940 gene gshB 652414 651350 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_20940 652518 653588 gene locus_tag LOCUS_20950 652518 653588 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052886479.1 protein_id gnl|my_center|LOCUS_20950 653593 654639 gene locus_tag LOCUS_20960 653593 654639 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_20960 654653 655249 gene locus_tag LOCUS_20970 654653 655249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 655515 656918 gene locus_tag LOCUS_20980 655515 656918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 657023 657835 gene locus_tag LOCUS_20990 657023 657835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 658993 657866 gene locus_tag LOCUS_21000 658993 657866 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105511.1 protein_id gnl|my_center|LOCUS_21000 659010 659978 gene locus_tag LOCUS_21010 gene cysK 659010 659978 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_21010 660084 660752 gene locus_tag LOCUS_21020 660084 660752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 660774 661793 gene locus_tag LOCUS_21030 660774 661793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 661858 662220 gene locus_tag LOCUS_21040 gene queD 661858 662220 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_21040 663447 662221 gene locus_tag LOCUS_21050 663447 662221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 663559 665295 gene locus_tag LOCUS_21060 663559 665295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 665477 666316 gene locus_tag LOCUS_21070 665477 666316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 666907 666449 gene locus_tag LOCUS_21080 666907 666449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 667078 667608 gene locus_tag LOCUS_21090 667078 667608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 670173 667615 gene locus_tag LOCUS_21100 670173 667615 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_21100 671570 670164 gene locus_tag LOCUS_21110 671570 670164 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_21110 672940 671579 gene locus_tag LOCUS_21120 672940 671579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 673832 673041 gene locus_tag LOCUS_21130 673832 673041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 676226 674034 gene locus_tag LOCUS_21140 676226 674034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 676324 677091 gene locus_tag LOCUS_21150 676324 677091 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 protein_id gnl|my_center|LOCUS_21150 677100 677543 gene locus_tag LOCUS_21160 677100 677543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 678484 677594 gene locus_tag LOCUS_21170 678484 677594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 679855 678539 gene locus_tag LOCUS_21180 679855 678539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 680190 679927 gene locus_tag LOCUS_21190 680190 679927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 680471 680187 gene locus_tag LOCUS_21200 680471 680187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 682054 680513 gene locus_tag LOCUS_21210 682054 680513 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_21210 682105 683967 gene locus_tag LOCUS_21220 682105 683967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 684953 683973 gene locus_tag LOCUS_21230 684953 683973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 685163 686098 gene locus_tag LOCUS_21240 685163 686098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 686080 686508 gene locus_tag LOCUS_21250 686080 686508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 687696 686728 gene locus_tag LOCUS_21260 687696 686728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 689375 688134 gene locus_tag LOCUS_21270 gene aspB 689375 688134 CDS product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 protein_id gnl|my_center|LOCUS_21270 690856 689423 gene locus_tag LOCUS_21280 gene asnB 690856 689423 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_21280 690851 691336 gene locus_tag LOCUS_21290 690851 691336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 691555 692955 gene locus_tag LOCUS_21300 691555 692955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 692952 694673 gene locus_tag LOCUS_21310 gene gatA 692952 694673 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_21310 694958 695227 gene locus_tag LOCUS_21320 694958 695227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 695436 697319 gene locus_tag LOCUS_21330 695436 697319 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_21330 698265 697324 gene locus_tag LOCUS_21340 698265 697324 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_21340 698661 698503 gene locus_tag LOCUS_21350 698661 698503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 699087 698881 gene locus_tag LOCUS_21360 699087 698881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 699389 699084 gene locus_tag LOCUS_21370 699389 699084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 699507 700784 gene locus_tag LOCUS_21380 699507 700784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 702555 700786 gene locus_tag LOCUS_21390 702555 700786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 703255 702608 gene locus_tag LOCUS_21400 703255 702608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 703779 703252 gene locus_tag LOCUS_21410 703779 703252 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_21410 705590 703875 gene locus_tag LOCUS_21420 705590 703875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 705901 706890 gene locus_tag LOCUS_21430 705901 706890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 706915 707256 gene locus_tag LOCUS_21440 706915 707256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 708158 707232 gene locus_tag LOCUS_21450 708158 707232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 708766 708197 gene locus_tag LOCUS_21460 708766 708197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 709986 708769 gene locus_tag LOCUS_21470 709986 708769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 712880 710001 gene locus_tag LOCUS_21480 gene cphA 712880 710001 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_21480 712970 713962 gene locus_tag LOCUS_21490 712970 713962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 713996 714565 gene locus_tag LOCUS_21500 713996 714565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 715535 714618 gene locus_tag LOCUS_21510 715535 714618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 717406 715604 gene locus_tag LOCUS_21520 717406 715604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 718431 717466 gene locus_tag LOCUS_21530 718431 717466 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_21530 720006 718441 gene locus_tag LOCUS_21540 720006 718441 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_21540 720149 720556 gene locus_tag LOCUS_21550 720149 720556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 721466 720621 gene locus_tag LOCUS_21560 721466 720621 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_21560 722638 721463 gene locus_tag LOCUS_21570 gene iadA 722638 721463 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868956.1 protein_id gnl|my_center|LOCUS_21570 723431 722646 gene locus_tag LOCUS_21580 723431 722646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 725161 723395 gene locus_tag LOCUS_21590 725161 723395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 725312 726355 gene locus_tag LOCUS_21600 725312 726355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 727777 726407 gene locus_tag LOCUS_21610 727777 726407 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_21610 729216 727774 gene locus_tag LOCUS_21620 729216 727774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 729604 730647 gene locus_tag LOCUS_21630 729604 730647 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814200.1 protein_id gnl|my_center|LOCUS_21630 730658 733948 gene locus_tag LOCUS_21640 730658 733948 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_21640 733941 735383 gene locus_tag LOCUS_21650 733941 735383 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_21650 735869 735411 gene locus_tag LOCUS_21660 735869 735411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 736095 736358 gene locus_tag LOCUS_21670 736095 736358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 737309 736407 gene locus_tag LOCUS_21680 737309 736407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 738202 737342 gene locus_tag LOCUS_21690 738202 737342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 738319 738714 gene locus_tag LOCUS_21700 738319 738714 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_21700 739665 738763 gene locus_tag LOCUS_21710 739665 738763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 739875 741740 gene locus_tag LOCUS_21720 739875 741740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 742596 741724 gene locus_tag LOCUS_21730 742596 741724 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533619.1 protein_id gnl|my_center|LOCUS_21730 743540 742605 gene locus_tag LOCUS_21740 743540 742605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 744951 743638 gene locus_tag LOCUS_21750 744951 743638 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_21750 745947 744982 gene locus_tag LOCUS_21760 745947 744982 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731130.1 protein_id gnl|my_center|LOCUS_21760 747968 745944 gene locus_tag LOCUS_21770 747968 745944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 748753 747965 gene locus_tag LOCUS_21780 748753 747965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 749781 748750 gene locus_tag LOCUS_21790 749781 748750 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 protein_id gnl|my_center|LOCUS_21790 750577 749786 gene locus_tag LOCUS_21800 750577 749786 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_21800 751128 750574 gene locus_tag LOCUS_21810 751128 750574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 751358 752884 gene locus_tag LOCUS_21820 751358 752884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 752929 753972 gene locus_tag LOCUS_21830 752929 753972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 753969 754805 gene locus_tag LOCUS_21840 753969 754805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 755665 754811 gene locus_tag LOCUS_21850 755665 754811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 755848 756279 gene locus_tag LOCUS_21860 755848 756279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 756406 756897 gene locus_tag LOCUS_21870 756406 756897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 757079 758788 gene locus_tag LOCUS_21880 757079 758788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 759043 758864 gene locus_tag LOCUS_21890 759043 758864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 759840 759064 gene locus_tag LOCUS_21900 759840 759064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 759746 761101 gene locus_tag LOCUS_21910 759746 761101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 761111 762400 gene locus_tag LOCUS_21920 761111 762400 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_21920 762515 763951 gene locus_tag LOCUS_21930 762515 763951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 763951 766470 gene locus_tag LOCUS_21940 763951 766470 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 protein_id gnl|my_center|LOCUS_21940 767411 766467 gene locus_tag LOCUS_21950 767411 766467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 768356 767562 gene locus_tag LOCUS_21960 768356 767562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 769125 768358 gene locus_tag LOCUS_21970 769125 768358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 769934 769122 gene locus_tag LOCUS_21980 769934 769122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 770064 770279 gene locus_tag LOCUS_21990 770064 770279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 772268 770343 gene locus_tag LOCUS_22000 772268 770343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 773687 772479 gene locus_tag LOCUS_22010 773687 772479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 775505 773733 gene locus_tag LOCUS_22020 775505 773733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 777010 775496 gene locus_tag LOCUS_22030 777010 775496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 778236 777007 gene locus_tag LOCUS_22040 778236 777007 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_22040 778726 778226 gene locus_tag LOCUS_22050 778726 778226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 779205 778723 gene locus_tag LOCUS_22060 779205 778723 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_22060 780057 779251 gene locus_tag LOCUS_22070 780057 779251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 780103 781383 gene locus_tag LOCUS_22080 780103 781383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 781706 781380 gene locus_tag LOCUS_22090 781706 781380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 782894 781785 gene locus_tag LOCUS_22100 782894 781785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 782776 783099 gene locus_tag LOCUS_22110 782776 783099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 784846 783173 gene locus_tag LOCUS_22120 784846 783173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 785526 784924 gene locus_tag LOCUS_22130 785526 784924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 787752 785530 gene locus_tag LOCUS_22140 787752 785530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 788033 788875 gene locus_tag LOCUS_22150 788033 788875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 789314 789556 gene locus_tag LOCUS_22160 789314 789556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 789611 790477 gene locus_tag LOCUS_22170 789611 790477 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_22170 791135 791476 gene locus_tag LOCUS_22180 791135 791476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 791451 791627 gene locus_tag LOCUS_22190 791451 791627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 792177 792452 gene locus_tag LOCUS_22200 792177 792452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 792741 793685 gene locus_tag LOCUS_22210 792741 793685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 793682 794515 gene locus_tag LOCUS_22220 793682 794515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 794536 796026 gene locus_tag LOCUS_22230 794536 796026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442181.1 protein_id gnl|my_center|LOCUS_22230 796200 795985 gene locus_tag LOCUS_22240 796200 795985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 796121 796747 gene locus_tag LOCUS_22250 796121 796747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence04 1560 1006 gene locus_tag LOCUS_22260 1560 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22260 3051 1756 gene locus_tag LOCUS_22270 3051 1756 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_22270 4137 3136 gene locus_tag LOCUS_22280 4137 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4196 4819 gene locus_tag LOCUS_22290 4196 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 6328 4805 gene locus_tag LOCUS_22300 6328 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7227 6328 gene locus_tag LOCUS_22310 7227 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 8358 7702 gene locus_tag LOCUS_22320 8358 7702 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_22320 9537 8473 gene locus_tag LOCUS_22330 9537 8473 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_22330 10640 9609 gene locus_tag LOCUS_22340 10640 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 10697 11575 gene locus_tag LOCUS_22350 gene thyX 10697 11575 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_22350 11633 11953 gene locus_tag LOCUS_22360 11633 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 12102 11935 gene locus_tag LOCUS_22370 12102 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 12718 12104 gene locus_tag LOCUS_22380 12718 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22380 12789 13757 gene locus_tag LOCUS_22390 12789 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 13902 14873 gene locus_tag LOCUS_22400 gene mdh 13902 14873 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_22400 14870 16084 gene locus_tag LOCUS_22410 gene sucC 14870 16084 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_22410 16081 16965 gene locus_tag LOCUS_22420 gene sucD 16081 16965 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_22420 17224 18294 gene locus_tag LOCUS_22430 17224 18294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 18341 19189 gene locus_tag LOCUS_22440 18341 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 19186 20097 gene locus_tag LOCUS_22450 19186 20097 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_22450 20739 20098 gene locus_tag LOCUS_22460 20739 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 20937 21680 gene locus_tag LOCUS_22470 20937 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 21778 22638 gene locus_tag LOCUS_22480 21778 22638 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 protein_id gnl|my_center|LOCUS_22480 22799 23716 gene locus_tag LOCUS_22490 22799 23716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 23753 24307 gene locus_tag LOCUS_22500 gene lspA 23753 24307 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217934.1 protein_id gnl|my_center|LOCUS_22500 24368 24961 gene locus_tag LOCUS_22510 24368 24961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22510 26317 25025 gene locus_tag LOCUS_22520 26317 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 26919 26317 gene locus_tag LOCUS_22530 gene pgsA 26919 26317 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_22530 27806 27078 gene locus_tag LOCUS_22540 27806 27078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 27857 29491 gene locus_tag LOCUS_22550 gene nadB 27857 29491 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_22550 29532 30167 gene locus_tag LOCUS_22560 29532 30167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 30685 31176 gene locus_tag LOCUS_22570 30685 31176 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_22570 31178 31705 gene locus_tag LOCUS_22580 31178 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 31722 32015 gene locus_tag LOCUS_22590 31722 32015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 32047 33213 gene locus_tag LOCUS_22600 32047 33213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 33559 34476 gene locus_tag LOCUS_22610 33559 34476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 34602 35216 gene locus_tag LOCUS_22620 34602 35216 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_22620 35213 35431 gene locus_tag LOCUS_22630 35213 35431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 36330 35488 gene locus_tag LOCUS_22640 36330 35488 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228771.1 protein_id gnl|my_center|LOCUS_22640 36995 36327 gene locus_tag LOCUS_22650 36995 36327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 37265 37942 gene locus_tag LOCUS_22660 37265 37942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 38080 39723 gene locus_tag LOCUS_22670 38080 39723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22670 39727 40869 gene locus_tag LOCUS_22680 39727 40869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 40872 42386 gene locus_tag LOCUS_22690 40872 42386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 42383 44014 gene locus_tag LOCUS_22700 42383 44014 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_22700 44105 44800 gene locus_tag LOCUS_22710 44105 44800 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815612.1 protein_id gnl|my_center|LOCUS_22710 44831 45067 gene locus_tag LOCUS_22720 44831 45067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 45068 46786 gene locus_tag LOCUS_22730 45068 46786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 46795 47712 gene locus_tag LOCUS_22740 46795 47712 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_22740 47716 48510 gene locus_tag LOCUS_22750 47716 48510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 50468 48552 gene locus_tag LOCUS_22760 50468 48552 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_22760 53048 50478 gene locus_tag LOCUS_22770 53048 50478 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404233.1 protein_id gnl|my_center|LOCUS_22770 53229 53843 gene locus_tag LOCUS_22780 gene cysC 53229 53843 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083931.1 protein_id gnl|my_center|LOCUS_22780 54109 54327 gene locus_tag LOCUS_22790 gene infA 54109 54327 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_22790 54513 55910 gene locus_tag LOCUS_22800 54513 55910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 56034 56768 gene locus_tag LOCUS_22810 56034 56768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 56926 57255 gene locus_tag LOCUS_22820 56926 57255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 58324 57314 gene locus_tag LOCUS_22830 58324 57314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_22830 59013 59384 gene locus_tag LOCUS_22840 59013 59384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 59510 59947 gene locus_tag LOCUS_22850 59510 59947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 61423 60005 gene locus_tag LOCUS_22860 61423 60005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 62420 61428 gene locus_tag LOCUS_22870 62420 61428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 65722 62408 gene locus_tag LOCUS_22880 65722 62408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 66006 65737 gene locus_tag LOCUS_22890 66006 65737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 68128 65999 gene locus_tag LOCUS_22900 68128 65999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 68777 68238 gene locus_tag LOCUS_22910 68777 68238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 69896 68799 gene locus_tag LOCUS_22920 69896 68799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 70487 69900 gene locus_tag LOCUS_22930 70487 69900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 70644 72863 gene locus_tag LOCUS_22940 70644 72863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 74166 72853 gene locus_tag LOCUS_22950 gene tuf 74166 72853 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210669.1 protein_id gnl|my_center|LOCUS_22950 74165 76405 gene locus_tag LOCUS_22960 74165 76405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 76575 77021 gene locus_tag LOCUS_22970 76575 77021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 77567 77031 gene locus_tag LOCUS_22980 77567 77031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 77794 77564 gene locus_tag LOCUS_22990 77794 77564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 77684 78130 gene locus_tag LOCUS_23000 77684 78130 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378068.1 protein_id gnl|my_center|LOCUS_23000 79198 78197 gene locus_tag LOCUS_23010 79198 78197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 83304 79354 gene locus_tag LOCUS_23020 83304 79354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 84817 83471 gene locus_tag LOCUS_23030 84817 83471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 85594 84833 gene locus_tag LOCUS_23040 85594 84833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_23040 86378 85599 gene locus_tag LOCUS_23050 86378 85599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_23050 86924 86385 gene locus_tag LOCUS_23060 86924 86385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 87879 87016 gene locus_tag LOCUS_23070 87879 87016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 87976 88884 gene locus_tag LOCUS_23080 87976 88884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 88881 89495 gene locus_tag LOCUS_23090 88881 89495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 89591 89917 gene locus_tag LOCUS_23100 89591 89917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 90091 90339 gene locus_tag LOCUS_23110 90091 90339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 90402 90854 gene locus_tag LOCUS_23120 90402 90854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23120 90851 91672 gene locus_tag LOCUS_23130 90851 91672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23130 91675 92460 gene locus_tag LOCUS_23140 gene tpiA 91675 92460 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_23140 92464 93195 gene locus_tag LOCUS_23150 92464 93195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 93192 94085 gene locus_tag LOCUS_23160 gene dapF 93192 94085 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_23160 94888 94097 gene locus_tag LOCUS_23170 94888 94097 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_23170 94991 95185 gene locus_tag LOCUS_23180 94991 95185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 97220 95175 gene locus_tag LOCUS_23190 97220 95175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 99361 97253 gene locus_tag LOCUS_23200 99361 97253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 99463 101208 gene locus_tag LOCUS_23210 99463 101208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 101222 103150 gene locus_tag LOCUS_23220 101222 103150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 103156 104226 gene locus_tag LOCUS_23230 gene ugpC 103156 104226 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531923.1 protein_id gnl|my_center|LOCUS_23230 104271 105869 gene locus_tag LOCUS_23240 104271 105869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 105919 106563 gene locus_tag LOCUS_23250 105919 106563 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_23250 106690 108921 gene locus_tag LOCUS_23260 106690 108921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 108974 109873 gene locus_tag LOCUS_23270 108974 109873 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240247.1 protein_id gnl|my_center|LOCUS_23270 109915 110649 gene locus_tag LOCUS_23280 109915 110649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 111459 110656 gene locus_tag LOCUS_23290 111459 110656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 111574 113334 gene locus_tag LOCUS_23300 111574 113334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 113485 117279 gene locus_tag LOCUS_23310 113485 117279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 117338 118495 gene locus_tag LOCUS_23320 117338 118495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 120370 118547 gene locus_tag LOCUS_23330 120370 118547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 120634 121380 gene locus_tag LOCUS_23340 120634 121380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23340 121380 124292 gene locus_tag LOCUS_23350 121380 124292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 124431 125087 gene locus_tag LOCUS_23360 124431 125087 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675552.1 protein_id gnl|my_center|LOCUS_23360 125084 126922 gene locus_tag LOCUS_23370 125084 126922 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_23370 126935 127525 gene locus_tag LOCUS_23380 126935 127525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 128200 127595 gene locus_tag LOCUS_23390 128200 127595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 128861 128586 gene locus_tag LOCUS_23400 128861 128586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 131689 128918 gene locus_tag LOCUS_23410 131689 128918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 131864 133318 gene locus_tag LOCUS_23420 131864 133318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 133315 134451 gene locus_tag LOCUS_23430 133315 134451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 135632 134535 gene locus_tag LOCUS_23440 135632 134535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 135619 136275 gene locus_tag LOCUS_23450 135619 136275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 137552 136227 gene locus_tag LOCUS_23460 137552 136227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 137455 137811 gene locus_tag LOCUS_23470 137455 137811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 138032 138922 gene locus_tag LOCUS_23480 138032 138922 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_23480 138919 140307 gene locus_tag LOCUS_23490 138919 140307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 140321 141151 gene locus_tag LOCUS_23500 140321 141151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 141148 142008 gene locus_tag LOCUS_23510 141148 142008 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143543.1 protein_id gnl|my_center|LOCUS_23510 142624 142013 gene locus_tag LOCUS_23520 142624 142013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 143329 142649 gene locus_tag LOCUS_23530 143329 142649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 146523 143362 gene locus_tag LOCUS_23540 146523 143362 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_23540 150227 146538 gene locus_tag LOCUS_23550 150227 146538 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_23550 151447 150227 gene locus_tag LOCUS_23560 151447 150227 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_23560 152314 151598 gene locus_tag LOCUS_23570 152314 151598 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_23570 152462 153670 gene locus_tag LOCUS_23580 152462 153670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 153756 154652 gene locus_tag LOCUS_23590 153756 154652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_23590 154649 158215 gene locus_tag LOCUS_23600 154649 158215 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_23600 158347 159174 gene locus_tag LOCUS_23610 158347 159174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 159626 159300 gene locus_tag LOCUS_23620 159626 159300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 159957 160757 gene locus_tag LOCUS_23630 159957 160757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 161664 160822 gene locus_tag LOCUS_23640 161664 160822 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928847.1 protein_id gnl|my_center|LOCUS_23640 162920 161829 gene locus_tag LOCUS_23650 162920 161829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 163570 162935 gene locus_tag LOCUS_23660 gene pncA 163570 162935 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_23660 164271 163582 gene locus_tag LOCUS_23670 164271 163582 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_23670 165713 164268 gene locus_tag LOCUS_23680 165713 164268 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_23680 166523 165771 gene locus_tag LOCUS_23690 166523 165771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 166897 166586 gene locus_tag LOCUS_23700 166897 166586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 166779 167813 gene locus_tag LOCUS_23710 166779 167813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 167914 168744 gene locus_tag LOCUS_23720 167914 168744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 168744 169958 gene locus_tag LOCUS_23730 168744 169958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 170336 172639 gene locus_tag LOCUS_23740 170336 172639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 172651 173961 gene locus_tag LOCUS_23750 172651 173961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 174123 176018 gene locus_tag LOCUS_23760 174123 176018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 176614 176060 gene locus_tag LOCUS_23770 176614 176060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 176807 176734 gene locus_tag LOCUS_t00340 176807 176734 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 177455 176901 gene locus_tag LOCUS_23780 177455 176901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 177548 178303 gene locus_tag LOCUS_23790 177548 178303 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564059.1 protein_id gnl|my_center|LOCUS_23790 178303 179367 gene locus_tag LOCUS_23800 178303 179367 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_23800 179737 179537 gene locus_tag LOCUS_23810 179737 179537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 180814 180074 gene locus_tag LOCUS_23820 180814 180074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 181056 183125 gene locus_tag LOCUS_23830 181056 183125 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123042767.1 protein_id gnl|my_center|LOCUS_23830 183122 183871 gene locus_tag LOCUS_23840 183122 183871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 185152 183968 gene locus_tag LOCUS_23850 gene ruvB 185152 183968 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_23850 186699 185155 gene locus_tag LOCUS_23860 gene guaA 186699 185155 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_23860 187292 186822 gene locus_tag LOCUS_23870 187292 186822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23870 188278 187214 gene locus_tag LOCUS_23880 188278 187214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 188492 188752 gene locus_tag LOCUS_23890 188492 188752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 188749 189588 gene locus_tag LOCUS_23900 188749 189588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 190398 189685 gene locus_tag LOCUS_23910 190398 189685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 191783 190395 gene locus_tag LOCUS_23920 191783 190395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 193263 191776 gene locus_tag LOCUS_23930 193263 191776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 193918 193274 gene locus_tag LOCUS_23940 193918 193274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 194403 193915 gene locus_tag LOCUS_23950 194403 193915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 195097 194423 gene locus_tag LOCUS_23960 195097 194423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 195911 195369 gene locus_tag LOCUS_23970 195911 195369 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058135.1 protein_id gnl|my_center|LOCUS_23970 195906 196640 gene locus_tag LOCUS_23980 195906 196640 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799489.1 protein_id gnl|my_center|LOCUS_23980 196637 197419 gene locus_tag LOCUS_23990 196637 197419 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028236.1 protein_id gnl|my_center|LOCUS_23990 199941 197452 gene locus_tag LOCUS_24000 199941 197452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 201180 200296 gene locus_tag LOCUS_24010 201180 200296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24010 201345 202844 gene locus_tag LOCUS_24020 201345 202844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 202951 204885 gene locus_tag LOCUS_24030 202951 204885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 205023 206813 gene locus_tag LOCUS_24040 205023 206813 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_24040 208133 206949 gene locus_tag LOCUS_24050 208133 206949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 208312 208761 gene locus_tag LOCUS_24060 208312 208761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 209660 208788 gene locus_tag LOCUS_24070 209660 208788 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_24070 209834 210862 gene locus_tag LOCUS_24080 209834 210862 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_24080 210871 211881 gene locus_tag LOCUS_24090 210871 211881 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_24090 211934 214120 gene locus_tag LOCUS_24100 211934 214120 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259038.1 protein_id gnl|my_center|LOCUS_24100 214859 214074 gene locus_tag LOCUS_24110 214859 214074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 215109 214834 gene locus_tag LOCUS_24120 215109 214834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 215089 217131 gene locus_tag LOCUS_24130 215089 217131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 216251 216154 gene locus_tag LOCUS_t00350 216251 216154 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 217651 217430 gene locus_tag LOCUS_24140 217651 217430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 218392 218090 gene locus_tag LOCUS_24150 gene hupN 218392 218090 CDS product HU-related DNA-binding protein HupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399274.1 protein_id gnl|my_center|LOCUS_24150 218659 218949 gene locus_tag LOCUS_24160 218659 218949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 218963 219766 gene locus_tag LOCUS_24170 218963 219766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 219831 220430 gene locus_tag LOCUS_24180 219831 220430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 220912 220487 gene locus_tag LOCUS_24190 220912 220487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 221103 222119 gene locus_tag LOCUS_24200 221103 222119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 222196 223617 gene locus_tag LOCUS_24210 gene sthA 222196 223617 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176056.1 protein_id gnl|my_center|LOCUS_24210 223883 224695 gene locus_tag LOCUS_24220 223883 224695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 225633 226655 gene locus_tag LOCUS_24230 gene czcD 225633 226655 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_24230 226579 227466 gene locus_tag LOCUS_24240 226579 227466 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_24240 227676 227542 gene locus_tag LOCUS_24250 227676 227542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 229331 227643 gene locus_tag LOCUS_24260 229331 227643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 230478 230053 gene locus_tag LOCUS_24270 230478 230053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 231119 230481 gene locus_tag LOCUS_24280 231119 230481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 231200 231490 gene locus_tag LOCUS_24290 231200 231490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 232086 231382 gene locus_tag LOCUS_24300 232086 231382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 235336 232154 gene locus_tag LOCUS_24310 235336 232154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 235730 235329 gene locus_tag LOCUS_24320 235730 235329 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_24320 235948 235736 gene locus_tag LOCUS_24330 235948 235736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 236346 235945 gene locus_tag LOCUS_24340 236346 235945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 237386 236343 gene locus_tag LOCUS_24350 237386 236343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 238123 237383 gene locus_tag LOCUS_24360 238123 237383 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_24360 239505 238120 gene locus_tag LOCUS_24370 239505 238120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 240037 239498 gene locus_tag LOCUS_24380 240037 239498 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_24380 240245 240063 gene locus_tag LOCUS_24390 240245 240063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24390 240580 240242 gene locus_tag LOCUS_24400 240580 240242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_24400 241044 240604 gene locus_tag LOCUS_24410 241044 240604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 242207 241059 gene locus_tag LOCUS_24420 242207 241059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 243417 242218 gene locus_tag LOCUS_24430 243417 242218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 244015 243428 gene locus_tag LOCUS_24440 244015 243428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 246386 244269 gene locus_tag LOCUS_24450 246386 244269 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_24450 247617 246427 gene locus_tag LOCUS_24460 247617 246427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 248421 247627 gene locus_tag LOCUS_24470 248421 247627 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_24470 248664 249443 gene locus_tag LOCUS_24480 248664 249443 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_24480 249454 250584 gene locus_tag LOCUS_24490 249454 250584 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_24490 251420 250611 gene locus_tag LOCUS_24500 251420 250611 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_24500 252382 251444 gene locus_tag LOCUS_24510 252382 251444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 253347 252490 gene locus_tag LOCUS_24520 253347 252490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 253961 253347 gene locus_tag LOCUS_24530 253961 253347 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976292.1 protein_id gnl|my_center|LOCUS_24530 254038 255456 gene locus_tag LOCUS_24540 254038 255456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 255587 258298 gene locus_tag LOCUS_24550 255587 258298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 259172 258315 gene locus_tag LOCUS_24560 259172 258315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 261290 259239 gene locus_tag LOCUS_24570 261290 259239 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_24570 261464 263860 gene locus_tag LOCUS_24580 261464 263860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 264015 265490 gene locus_tag LOCUS_24590 264015 265490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 265616 265957 gene locus_tag LOCUS_24600 265616 265957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 266026 267765 gene locus_tag LOCUS_24610 266026 267765 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_24610 268030 269019 gene locus_tag LOCUS_24620 268030 269019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 269093 269869 gene locus_tag LOCUS_24630 269093 269869 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_24630 270702 269947 gene locus_tag LOCUS_24640 270702 269947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 270841 271839 gene locus_tag LOCUS_24650 270841 271839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 272401 271913 gene locus_tag LOCUS_24660 272401 271913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 272944 276183 gene locus_tag LOCUS_24670 272944 276183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 276180 279002 gene locus_tag LOCUS_24680 276180 279002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 279690 279076 gene locus_tag LOCUS_24690 279690 279076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 280840 279701 gene locus_tag LOCUS_24700 280840 279701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 281736 280894 gene locus_tag LOCUS_24710 281736 280894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 282608 281670 gene locus_tag LOCUS_24720 282608 281670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 283843 282632 gene locus_tag LOCUS_24730 283843 282632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 284044 284595 gene locus_tag LOCUS_24740 284044 284595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 284592 285503 gene locus_tag LOCUS_24750 284592 285503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 286354 285458 gene locus_tag LOCUS_24760 286354 285458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 287138 286497 gene locus_tag LOCUS_24770 287138 286497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 288816 287128 gene locus_tag LOCUS_24780 288816 287128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 288855 289631 gene locus_tag LOCUS_24790 288855 289631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 289976 290347 gene locus_tag LOCUS_24800 289976 290347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 290500 291900 gene locus_tag LOCUS_24810 290500 291900 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_24810 292611 291961 gene locus_tag LOCUS_24820 292611 291961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 292888 293286 gene locus_tag LOCUS_24830 292888 293286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 293687 293406 gene locus_tag LOCUS_24840 293687 293406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 293692 294396 gene locus_tag LOCUS_24850 293692 294396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 294347 295054 gene locus_tag LOCUS_24860 294347 295054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 295307 294957 gene locus_tag LOCUS_24870 295307 294957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 295627 296445 gene locus_tag LOCUS_24880 295627 296445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 296442 297518 gene locus_tag LOCUS_24890 296442 297518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 297545 297931 gene locus_tag LOCUS_24900 297545 297931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 297903 299300 gene locus_tag LOCUS_24910 297903 299300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 299409 300878 gene locus_tag LOCUS_24920 299409 300878 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082638.1 protein_id gnl|my_center|LOCUS_24920 301137 302891 gene locus_tag LOCUS_24930 301137 302891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 303007 304809 gene locus_tag LOCUS_24940 303007 304809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 305751 304822 gene locus_tag LOCUS_24950 305751 304822 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215352211.1 protein_id gnl|my_center|LOCUS_24950 307322 305748 gene locus_tag LOCUS_24960 307322 305748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 307333 307572 gene locus_tag LOCUS_24970 307333 307572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 307832 307530 gene locus_tag LOCUS_24980 307832 307530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 308184 309146 gene locus_tag LOCUS_24990 308184 309146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 309244 309636 gene locus_tag LOCUS_25000 309244 309636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 309719 310546 gene locus_tag LOCUS_25010 309719 310546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 312046 310631 gene locus_tag LOCUS_25020 312046 310631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 312261 313217 gene locus_tag LOCUS_25030 312261 313217 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_25030 313163 314125 gene locus_tag LOCUS_25040 gene cysD 313163 314125 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_25040 314523 316079 gene locus_tag LOCUS_25050 gene cysN 314523 316079 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_25050 316131 317144 gene locus_tag LOCUS_25060 316131 317144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 318503 317148 gene locus_tag LOCUS_25070 318503 317148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 319029 318682 gene locus_tag LOCUS_25080 319029 318682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387861.1 protein_id gnl|my_center|LOCUS_25080 319608 319033 gene locus_tag LOCUS_25090 319608 319033 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109025.1 protein_id gnl|my_center|LOCUS_25090 321209 319617 gene locus_tag LOCUS_25100 321209 319617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 322742 321219 gene locus_tag LOCUS_25110 322742 321219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 325179 323071 gene locus_tag LOCUS_25120 325179 323071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 325741 325205 gene locus_tag LOCUS_25130 325741 325205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 325923 327671 gene locus_tag LOCUS_25140 325923 327671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 327691 329061 gene locus_tag LOCUS_25150 327691 329061 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921825.1 protein_id gnl|my_center|LOCUS_25150 329119 330921 gene locus_tag LOCUS_25160 329119 330921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 330951 332183 gene locus_tag LOCUS_25170 330951 332183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 332293 333345 gene locus_tag LOCUS_25180 332293 333345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 333432 334553 gene locus_tag LOCUS_25190 333432 334553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 334725 335762 gene locus_tag LOCUS_25200 334725 335762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 336987 336640 gene locus_tag LOCUS_25210 336987 336640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 337191 336994 gene locus_tag LOCUS_25220 337191 336994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 337097 342694 gene locus_tag LOCUS_25230 337097 342694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 343008 342577 gene locus_tag LOCUS_25240 343008 342577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 342999 344183 gene locus_tag LOCUS_25250 342999 344183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 344239 344622 gene locus_tag LOCUS_25260 344239 344622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 345047 344769 gene locus_tag LOCUS_25270 345047 344769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 345197 345481 gene locus_tag LOCUS_25280 345197 345481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 346427 345534 gene locus_tag LOCUS_25290 346427 345534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 346693 347373 gene locus_tag LOCUS_25300 346693 347373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 347596 348504 gene locus_tag LOCUS_25310 347596 348504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 349228 348506 gene locus_tag LOCUS_25320 349228 348506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 349179 349715 gene locus_tag LOCUS_25330 349179 349715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 349779 351440 gene locus_tag LOCUS_25340 349779 351440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 351640 352017 gene locus_tag LOCUS_25350 351640 352017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 352042 352935 gene locus_tag LOCUS_25360 352042 352935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 353299 352874 gene locus_tag LOCUS_25370 353299 352874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 353767 354546 gene locus_tag LOCUS_25380 353767 354546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 356071 354647 gene locus_tag LOCUS_25390 356071 354647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 359045 356076 gene locus_tag LOCUS_25400 359045 356076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 359962 359042 gene locus_tag LOCUS_25410 359962 359042 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_25410 361593 359959 gene locus_tag LOCUS_25420 361593 359959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 362326 361862 gene locus_tag LOCUS_25430 362326 361862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 364964 362403 gene locus_tag LOCUS_25440 364964 362403 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_25440 365117 365656 gene locus_tag LOCUS_25450 365117 365656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 365977 365753 gene locus_tag LOCUS_25460 365977 365753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 365937 366353 gene locus_tag LOCUS_25470 365937 366353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 366350 367279 gene locus_tag LOCUS_25480 366350 367279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 367276 367974 gene locus_tag LOCUS_25490 367276 367974 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_25490 368058 368639 gene locus_tag LOCUS_25500 368058 368639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 368636 371965 gene locus_tag LOCUS_25510 368636 371965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 369674 369899 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acacctgtccctccggacagccgca 372024 372938 gene locus_tag LOCUS_25520 372024 372938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 373445 372951 gene locus_tag LOCUS_25530 373445 372951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 373494 375113 gene locus_tag LOCUS_25540 373494 375113 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067369.1 protein_id gnl|my_center|LOCUS_25540 375204 376784 gene locus_tag LOCUS_25550 375204 376784 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_25550 377302 376787 gene locus_tag LOCUS_25560 377302 376787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 377931 377410 gene locus_tag LOCUS_25570 377931 377410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 379042 377945 gene locus_tag LOCUS_25580 379042 377945 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_25580 379990 379055 gene locus_tag LOCUS_25590 379990 379055 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938559.1 protein_id gnl|my_center|LOCUS_25590 380045 381106 gene locus_tag LOCUS_25600 380045 381106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 381153 381827 gene locus_tag LOCUS_25610 381153 381827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 381824 382264 gene locus_tag LOCUS_25620 381824 382264 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_25620 382278 383156 gene locus_tag LOCUS_25630 382278 383156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 383292 384731 gene locus_tag LOCUS_25640 383292 384731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 385120 384728 gene locus_tag LOCUS_25650 385120 384728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25650 385776 385054 gene locus_tag LOCUS_25660 385776 385054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 386197 385790 gene locus_tag LOCUS_25670 386197 385790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 386706 386194 gene locus_tag LOCUS_25680 386706 386194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 387632 386703 gene locus_tag LOCUS_25690 387632 386703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 388195 387662 gene locus_tag LOCUS_25700 388195 387662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 389313 388195 gene locus_tag LOCUS_25710 389313 388195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 389516 390301 gene locus_tag LOCUS_25720 389516 390301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 390298 391503 gene locus_tag LOCUS_25730 390298 391503 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969317.1 protein_id gnl|my_center|LOCUS_25730 391646 392209 gene locus_tag LOCUS_25740 391646 392209 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393195.1 protein_id gnl|my_center|LOCUS_25740 392206 392556 gene locus_tag LOCUS_25750 392206 392556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311963.1 protein_id gnl|my_center|LOCUS_25750 392579 393880 gene locus_tag LOCUS_25760 392579 393880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 394616 393972 gene locus_tag LOCUS_25770 394616 393972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 395878 394610 gene locus_tag LOCUS_25780 395878 394610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 396505 396014 gene locus_tag LOCUS_25790 396505 396014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 396790 397404 gene locus_tag LOCUS_25800 396790 397404 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_25800 397420 397896 gene locus_tag LOCUS_25810 gene smpB 397420 397896 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963988.1 protein_id gnl|my_center|LOCUS_25810 397893 398795 gene locus_tag LOCUS_25820 397893 398795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 398792 400417 gene locus_tag LOCUS_25830 398792 400417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25830 400547 400747 gene locus_tag LOCUS_25840 400547 400747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 400744 401148 gene locus_tag LOCUS_25850 400744 401148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 401250 401963 gene locus_tag LOCUS_25860 401250 401963 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228739.1 protein_id gnl|my_center|LOCUS_25860 402006 402563 gene locus_tag LOCUS_25870 402006 402563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 403404 402613 gene locus_tag LOCUS_25880 403404 402613 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730405.1 protein_id gnl|my_center|LOCUS_25880 403472 403840 gene locus_tag LOCUS_25890 403472 403840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_25890 403846 405564 gene locus_tag LOCUS_25900 403846 405564 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_25900 405762 407552 gene locus_tag LOCUS_25910 405762 407552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 407742 409082 gene locus_tag LOCUS_25920 407742 409082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 409179 409877 gene locus_tag LOCUS_25930 409179 409877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 410227 409925 gene locus_tag LOCUS_25940 410227 409925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 412080 410371 gene locus_tag LOCUS_25950 412080 410371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 412832 412080 gene locus_tag LOCUS_25960 412832 412080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 412719 413615 gene locus_tag LOCUS_25970 412719 413615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 413818 414657 gene locus_tag LOCUS_25980 413818 414657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 414734 415597 gene locus_tag LOCUS_25990 414734 415597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 415618 416544 gene locus_tag LOCUS_26000 415618 416544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 416554 417150 gene locus_tag LOCUS_26010 416554 417150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 418417 417386 gene locus_tag LOCUS_26020 418417 417386 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_26020 418477 419889 gene locus_tag LOCUS_26030 gene fumC 418477 419889 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_26030 419939 421108 gene locus_tag LOCUS_26040 419939 421108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 421138 422019 gene locus_tag LOCUS_26050 421138 422019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 422076 422657 gene locus_tag LOCUS_26060 422076 422657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 425178 422764 gene locus_tag LOCUS_26070 425178 422764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 425271 427316 gene locus_tag LOCUS_26080 425271 427316 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_26080 427406 428182 gene locus_tag LOCUS_26090 427406 428182 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_26090 428263 428817 gene locus_tag LOCUS_26100 428263 428817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 428888 430096 gene locus_tag LOCUS_26110 428888 430096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 430624 430196 gene locus_tag LOCUS_26120 430624 430196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 431927 430638 gene locus_tag LOCUS_26130 431927 430638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 432018 434885 gene locus_tag LOCUS_26140 432018 434885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 435145 436212 gene locus_tag LOCUS_26150 435145 436212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 436296 437990 gene locus_tag LOCUS_26160 436296 437990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 438298 440025 gene locus_tag LOCUS_26170 438298 440025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 440383 441954 gene locus_tag LOCUS_26180 440383 441954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 442100 443641 gene locus_tag LOCUS_26190 442100 443641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 443967 445487 gene locus_tag LOCUS_26200 443967 445487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 445661 447283 gene locus_tag LOCUS_26210 445661 447283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 447797 447294 gene locus_tag LOCUS_26220 447797 447294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 448606 447899 gene locus_tag LOCUS_26230 448606 447899 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_26230 448772 449575 gene locus_tag LOCUS_26240 448772 449575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 450643 449636 gene locus_tag LOCUS_26250 450643 449636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 453036 450772 gene locus_tag LOCUS_26260 453036 450772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 456539 453258 gene locus_tag LOCUS_26270 456539 453258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 457284 456553 gene locus_tag LOCUS_26280 457284 456553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 458298 457465 gene locus_tag LOCUS_26290 458298 457465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 459648 458509 gene locus_tag LOCUS_26300 gene ablA 459648 458509 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_26300 460175 459645 gene locus_tag LOCUS_26310 460175 459645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 460818 460168 gene locus_tag LOCUS_26320 460818 460168 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_26320 461393 460815 gene locus_tag LOCUS_26330 461393 460815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 462111 461503 gene locus_tag LOCUS_26340 462111 461503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 463304 462114 gene locus_tag LOCUS_26350 463304 462114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 464006 463377 gene locus_tag LOCUS_26360 464006 463377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 464076 465293 gene locus_tag LOCUS_26370 464076 465293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 465347 466756 gene locus_tag LOCUS_26380 465347 466756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 466743 467156 gene locus_tag LOCUS_26390 466743 467156 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_26390 467163 470867 gene locus_tag LOCUS_26400 467163 470867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 473643 470884 gene locus_tag LOCUS_26410 473643 470884 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_26410 474659 473790 gene locus_tag LOCUS_26420 474659 473790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 474749 475528 gene locus_tag LOCUS_26430 474749 475528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 475616 476242 gene locus_tag LOCUS_26440 475616 476242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 478197 476488 gene locus_tag LOCUS_26450 478197 476488 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_26450 479208 478342 gene locus_tag LOCUS_26460 gene cmk 479208 478342 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_26460 479329 479517 gene locus_tag LOCUS_26470 479329 479517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 479502 480656 gene locus_tag LOCUS_26480 479502 480656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 480739 481185 gene locus_tag LOCUS_26490 480739 481185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 481325 481639 gene locus_tag LOCUS_26500 481325 481639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 481674 482744 gene locus_tag LOCUS_26510 481674 482744 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_26510 482755 483288 gene locus_tag LOCUS_26520 482755 483288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 483285 484082 gene locus_tag LOCUS_26530 483285 484082 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064400.1 protein_id gnl|my_center|LOCUS_26530 484125 484583 gene locus_tag LOCUS_26540 484125 484583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 486837 484615 gene locus_tag LOCUS_26550 486837 484615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 486906 488705 gene locus_tag LOCUS_26560 486906 488705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 489746 488715 gene locus_tag LOCUS_26570 489746 488715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 490667 489759 gene locus_tag LOCUS_26580 gene speE 490667 489759 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546275.1 protein_id gnl|my_center|LOCUS_26580 491184 490696 gene locus_tag LOCUS_26590 491184 490696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 493825 491297 gene locus_tag LOCUS_26600 493825 491297 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207071.1 protein_id gnl|my_center|LOCUS_26600 495030 493879 gene locus_tag LOCUS_26610 495030 493879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 495344 496057 gene locus_tag LOCUS_26620 495344 496057 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267698.1 protein_id gnl|my_center|LOCUS_26620 496132 497337 gene locus_tag LOCUS_26630 496132 497337 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_26630 497334 498395 gene locus_tag LOCUS_26640 497334 498395 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_26640 498471 499172 gene locus_tag LOCUS_26650 498471 499172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 500931 499438 gene locus_tag LOCUS_26660 gene gltX 500931 499438 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_26660 500980 501885 gene locus_tag LOCUS_26670 500980 501885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 502314 503774 gene locus_tag LOCUS_26680 502314 503774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 504285 503902 gene locus_tag LOCUS_26690 504285 503902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 504363 505127 gene locus_tag LOCUS_26700 504363 505127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 505497 505222 gene locus_tag LOCUS_26710 505497 505222 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213017.1 protein_id gnl|my_center|LOCUS_26710 506348 505494 gene locus_tag LOCUS_26720 506348 505494 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213024.1 protein_id gnl|my_center|LOCUS_26720 507160 506351 gene locus_tag LOCUS_26730 507160 506351 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213024.1 protein_id gnl|my_center|LOCUS_26730 507950 507177 gene locus_tag LOCUS_26740 507950 507177 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213025.1 protein_id gnl|my_center|LOCUS_26740 508870 507947 gene locus_tag LOCUS_26750 508870 507947 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_26750 510114 508888 gene locus_tag LOCUS_26760 510114 508888 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213028.1 protein_id gnl|my_center|LOCUS_26760 510860 510114 gene locus_tag LOCUS_26770 510860 510114 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213030.1 protein_id gnl|my_center|LOCUS_26770 512195 510900 gene locus_tag LOCUS_26780 512195 510900 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213032.1 protein_id gnl|my_center|LOCUS_26780 512945 512340 gene locus_tag LOCUS_26790 512945 512340 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213034.1 protein_id gnl|my_center|LOCUS_26790 514009 512930 gene locus_tag LOCUS_26800 gene fabD 514009 512930 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515899.1 protein_id gnl|my_center|LOCUS_26800 515276 514017 gene locus_tag LOCUS_26810 515276 514017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 515390 516577 gene locus_tag LOCUS_26820 515390 516577 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403928.1 protein_id gnl|my_center|LOCUS_26820 516587 517720 gene locus_tag LOCUS_26830 516587 517720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 519046 517742 gene locus_tag LOCUS_26840 gene mtaB 519046 517742 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_26840 521570 519051 gene locus_tag LOCUS_26850 521570 519051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 521533 521919 gene locus_tag LOCUS_26860 521533 521919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 523167 522628 gene locus_tag LOCUS_26870 523167 522628 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_26870 523733 523545 gene locus_tag LOCUS_26880 523733 523545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 523752 525107 gene locus_tag LOCUS_26890 523752 525107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 526776 525232 gene locus_tag LOCUS_26900 526776 525232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 527713 526778 gene locus_tag LOCUS_26910 527713 526778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 529364 527787 gene locus_tag LOCUS_26920 529364 527787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 530219 531709 gene locus_tag LOCUS_26930 530219 531709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 531724 532410 gene locus_tag LOCUS_26940 gene ung 531724 532410 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_26940 533221 532850 gene locus_tag LOCUS_26950 533221 532850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 533348 533689 gene locus_tag LOCUS_26960 533348 533689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 533798 535387 gene locus_tag LOCUS_26970 533798 535387 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_26970 535997 535488 gene locus_tag LOCUS_26980 535997 535488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 539868 536053 gene locus_tag LOCUS_26990 539868 536053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 540725 539877 gene locus_tag LOCUS_27000 540725 539877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 546565 540722 gene locus_tag LOCUS_27010 546565 540722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 547563 546562 gene locus_tag LOCUS_27020 547563 546562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 550690 547751 gene locus_tag LOCUS_27030 550690 547751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 553778 550725 gene locus_tag LOCUS_27040 553778 550725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 554470 553775 gene locus_tag LOCUS_27050 554470 553775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 554892 554467 gene locus_tag LOCUS_27060 554892 554467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 555381 554953 gene locus_tag LOCUS_27070 555381 554953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27070 556874 555378 gene locus_tag LOCUS_27080 556874 555378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 557238 559016 gene locus_tag LOCUS_27090 557238 559016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 559685 559074 gene locus_tag LOCUS_27100 559685 559074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 560249 561490 gene locus_tag LOCUS_27110 560249 561490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 561577 562389 gene locus_tag LOCUS_27120 561577 562389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 562958 562446 gene locus_tag LOCUS_27130 562958 562446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 563757 563218 gene locus_tag LOCUS_27140 563757 563218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 563711 564217 gene locus_tag LOCUS_27150 563711 564217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 565588 564227 gene locus_tag LOCUS_27160 565588 564227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 566253 565585 gene locus_tag LOCUS_27170 566253 565585 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_27170 566944 566321 gene locus_tag LOCUS_27180 566944 566321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 569391 566905 gene locus_tag LOCUS_27190 569391 566905 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27190 570455 569388 gene locus_tag LOCUS_27200 570455 569388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 571668 570424 gene locus_tag LOCUS_27210 571668 570424 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093996.1 protein_id gnl|my_center|LOCUS_27210 575459 571770 gene locus_tag LOCUS_27220 gene smc 575459 571770 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_27220 575668 576900 gene locus_tag LOCUS_27230 gene ftsY 575668 576900 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_27230 577486 578490 gene locus_tag LOCUS_27240 577486 578490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 578502 579485 gene locus_tag LOCUS_27250 578502 579485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 580039 579590 gene locus_tag LOCUS_27260 580039 579590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 <582455 580225 gene locus_tag LOCUS_27270 <582455 580225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081361214.1:sigma 54-interacting transcriptional regulator >Feature sequence05 <1 654 gene locus_tag LOCUS_27280 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384872.1:FAD-dependent urate hydroxylase HpxO 651 4097 gene locus_tag LOCUS_27290 651 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 4544 4053 gene locus_tag LOCUS_27300 4544 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 5331 4576 gene locus_tag LOCUS_27310 5331 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27310 7685 5337 gene locus_tag LOCUS_27320 7685 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 8095 7682 gene locus_tag LOCUS_27330 8095 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 9144 8098 gene locus_tag LOCUS_27340 9144 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 9440 9141 gene locus_tag LOCUS_27350 9440 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 9811 9437 gene locus_tag LOCUS_27360 9811 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 10692 9808 gene locus_tag LOCUS_27370 10692 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 11768 10701 gene locus_tag LOCUS_27380 11768 10701 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227641.1 protein_id gnl|my_center|LOCUS_27380 12145 12879 gene locus_tag LOCUS_27390 12145 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 13135 13647 gene locus_tag LOCUS_27400 13135 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 13670 14215 gene locus_tag LOCUS_27410 13670 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 14266 15504 gene locus_tag LOCUS_27420 14266 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 15568 16491 gene locus_tag LOCUS_27430 15568 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 16488 16913 gene locus_tag LOCUS_27440 16488 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 17311 17829 gene locus_tag LOCUS_27450 17311 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 17822 21358 gene locus_tag LOCUS_27460 17822 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 22361 21459 gene locus_tag LOCUS_27470 22361 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 23250 22576 gene locus_tag LOCUS_27480 23250 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 23663 23433 gene locus_tag LOCUS_27490 23663 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 23893 23690 gene locus_tag LOCUS_27500 23893 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 24073 23897 gene locus_tag LOCUS_27510 24073 23897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 24333 24019 gene locus_tag LOCUS_27520 24333 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 24583 24398 gene locus_tag LOCUS_27530 24583 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 25381 24617 gene locus_tag LOCUS_27540 25381 24617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 25920 25378 gene locus_tag LOCUS_27550 25920 25378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 26221 26060 gene locus_tag LOCUS_27560 26221 26060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 26837 32128 gene locus_tag LOCUS_27570 26837 32128 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_27570 32125 33477 gene locus_tag LOCUS_27580 32125 33477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 33715 34101 gene locus_tag LOCUS_27590 33715 34101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_27590 34098 34460 gene locus_tag LOCUS_27600 34098 34460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 34504 37515 gene locus_tag LOCUS_27610 34504 37515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 37907 38578 gene locus_tag LOCUS_27620 37907 38578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 39874 38645 gene locus_tag LOCUS_27630 39874 38645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 40345 39992 gene locus_tag LOCUS_27640 40345 39992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 41745 41449 gene locus_tag LOCUS_27650 41745 41449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 41903 42100 gene locus_tag LOCUS_27660 41903 42100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 43231 42527 gene locus_tag LOCUS_27670 43231 42527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 43397 44812 gene locus_tag LOCUS_27680 43397 44812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 44817 45185 gene locus_tag LOCUS_27690 44817 45185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 46459 45395 gene locus_tag LOCUS_27700 gene rhuM 46459 45395 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_27700 46644 46456 gene locus_tag LOCUS_27710 46644 46456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 46894 46691 gene locus_tag LOCUS_27720 46894 46691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 47286 47026 gene locus_tag LOCUS_27730 47286 47026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 47591 49015 gene locus_tag LOCUS_27740 47591 49015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 49260 50363 gene locus_tag LOCUS_27750 49260 50363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 50356 51396 gene locus_tag LOCUS_27760 50356 51396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 52583 51510 gene locus_tag LOCUS_27770 52583 51510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 53594 52635 gene locus_tag LOCUS_27780 53594 52635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 54803 53757 gene locus_tag LOCUS_27790 54803 53757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 56323 55016 gene locus_tag LOCUS_27800 56323 55016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 57285 56413 gene locus_tag LOCUS_27810 57285 56413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_27810 57432 57908 gene locus_tag LOCUS_27820 gene rnhA 57432 57908 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_27820 58865 57942 gene locus_tag LOCUS_27830 58865 57942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 59122 59212 gene locus_tag LOCUS_t00360 59122 59212 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 60918 59476 gene locus_tag LOCUS_27840 60918 59476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 61719 61021 gene locus_tag LOCUS_27850 61719 61021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 61882 62265 gene locus_tag LOCUS_27860 61882 62265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 63436 62429 gene locus_tag LOCUS_27870 63436 62429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 64462 63560 gene locus_tag LOCUS_27880 64462 63560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27880 65025 64459 gene locus_tag LOCUS_27890 65025 64459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 67142 65139 gene locus_tag LOCUS_27900 67142 65139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 68303 67260 gene locus_tag LOCUS_27910 68303 67260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 68815 68300 gene locus_tag LOCUS_27920 gene tadA 68815 68300 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_27920 70033 68909 gene locus_tag LOCUS_27930 70033 68909 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730401.1 protein_id gnl|my_center|LOCUS_27930 70878 70126 gene locus_tag LOCUS_27940 70878 70126 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_27940 71075 72937 gene locus_tag LOCUS_27950 gene muiA 71075 72937 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_27950 73693 72968 gene locus_tag LOCUS_27960 73693 72968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 75418 73826 gene locus_tag LOCUS_27970 75418 73826 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_27970 75578 76033 gene locus_tag LOCUS_27980 75578 76033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 76026 78659 gene locus_tag LOCUS_27990 76026 78659 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461688.1 protein_id gnl|my_center|LOCUS_27990 78773 79660 gene locus_tag LOCUS_28000 78773 79660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 80326 79679 gene locus_tag LOCUS_28010 80326 79679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 80473 81921 gene locus_tag LOCUS_28020 80473 81921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 81918 83447 gene locus_tag LOCUS_28030 81918 83447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 83580 84455 gene locus_tag LOCUS_28040 83580 84455 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_28040 84579 86768 gene locus_tag LOCUS_28050 84579 86768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 86782 87645 gene locus_tag LOCUS_28060 86782 87645 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798219.1 protein_id gnl|my_center|LOCUS_28060 88304 87687 gene locus_tag LOCUS_28070 88304 87687 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640263.1 protein_id gnl|my_center|LOCUS_28070 88836 88408 gene locus_tag LOCUS_28080 88836 88408 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_28080 89501 88833 gene locus_tag LOCUS_28090 89501 88833 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_28090 89686 89759 gene locus_tag LOCUS_t00370 89686 89759 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 89886 90923 gene locus_tag LOCUS_28100 89886 90923 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_28100 91044 92306 gene locus_tag LOCUS_28110 91044 92306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 92303 93691 gene locus_tag LOCUS_28120 92303 93691 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_28120 94625 93696 gene locus_tag LOCUS_28130 94625 93696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 94826 96289 gene locus_tag LOCUS_28140 94826 96289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 97506 96316 gene locus_tag LOCUS_28150 97506 96316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 97668 97988 gene locus_tag LOCUS_28160 97668 97988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 100498 98039 gene locus_tag LOCUS_28170 100498 98039 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136932681.1 protein_id gnl|my_center|LOCUS_28170 101184 100642 gene locus_tag LOCUS_28180 101184 100642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 101927 101193 gene locus_tag LOCUS_28190 101927 101193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28190 104895 101986 gene locus_tag LOCUS_28200 104895 101986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 104840 106198 gene locus_tag LOCUS_28210 104840 106198 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_28210 106720 106313 gene locus_tag LOCUS_28220 106720 106313 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 protein_id gnl|my_center|LOCUS_28220 106927 107889 gene locus_tag LOCUS_28230 106927 107889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 107895 109130 gene locus_tag LOCUS_28240 107895 109130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 109244 110542 gene locus_tag LOCUS_28250 109244 110542 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_28250 111096 110596 gene locus_tag LOCUS_28260 111096 110596 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_28260 111269 112216 gene locus_tag LOCUS_28270 111269 112216 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_28270 112217 112996 gene locus_tag LOCUS_28280 112217 112996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 113126 114271 gene locus_tag LOCUS_28290 113126 114271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 114643 117021 gene locus_tag LOCUS_28300 114643 117021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 117093 117494 gene locus_tag LOCUS_28310 gene msrB 117093 117494 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903021.1 protein_id gnl|my_center|LOCUS_28310 120401 117495 gene locus_tag LOCUS_28320 120401 117495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 121288 120398 gene locus_tag LOCUS_28330 121288 120398 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 protein_id gnl|my_center|LOCUS_28330 121584 121291 gene locus_tag LOCUS_28340 121584 121291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 122345 121665 gene locus_tag LOCUS_28350 122345 121665 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 protein_id gnl|my_center|LOCUS_28350 122401 123219 gene locus_tag LOCUS_28360 122401 123219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 123536 124327 gene locus_tag LOCUS_28370 123536 124327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_28370 124320 125327 gene locus_tag LOCUS_28380 124320 125327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_28380 125388 126317 gene locus_tag LOCUS_28390 125388 126317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 126340 126666 gene locus_tag LOCUS_28400 126340 126666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 126681 127523 gene locus_tag LOCUS_28410 126681 127523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 127520 128701 gene locus_tag LOCUS_28420 127520 128701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 129617 128763 gene locus_tag LOCUS_28430 129617 128763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 131551 129629 gene locus_tag LOCUS_28440 131551 129629 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_28440 133847 131592 gene locus_tag LOCUS_28450 133847 131592 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 protein_id gnl|my_center|LOCUS_28450 136104 133861 gene locus_tag LOCUS_28460 136104 133861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 137236 136241 gene locus_tag LOCUS_28470 gene egtD 137236 136241 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_28470 138699 137239 gene locus_tag LOCUS_28480 gene egtB 138699 137239 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_28480 139876 138635 gene locus_tag LOCUS_28490 139876 138635 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_28490 140467 139967 gene locus_tag LOCUS_28500 140467 139967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 140591 141220 gene locus_tag LOCUS_28510 140591 141220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 142705 141239 gene locus_tag LOCUS_28520 142705 141239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 143687 142917 gene locus_tag LOCUS_28530 143687 142917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 144386 143802 gene locus_tag LOCUS_28540 144386 143802 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067426.1 protein_id gnl|my_center|LOCUS_28540 146063 144426 gene locus_tag LOCUS_28550 146063 144426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 147361 146102 gene locus_tag LOCUS_28560 gene wecC 147361 146102 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006609.1 protein_id gnl|my_center|LOCUS_28560 147583 148542 gene locus_tag LOCUS_28570 gene wecB 147583 148542 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703970.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28570 148559 150010 gene locus_tag LOCUS_28580 148559 150010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 150069 150560 gene locus_tag LOCUS_28590 150069 150560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 152300 150561 gene locus_tag LOCUS_28600 152300 150561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 152602 152297 gene locus_tag LOCUS_28610 152602 152297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 152823 153422 gene locus_tag LOCUS_28620 152823 153422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 153572 153769 gene locus_tag LOCUS_28630 153572 153769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 155390 153825 gene locus_tag LOCUS_28640 155390 153825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 155541 156581 gene locus_tag LOCUS_28650 gene gap 155541 156581 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_28650 157991 156609 gene locus_tag LOCUS_28660 157991 156609 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_28660 158320 157988 gene locus_tag LOCUS_28670 gene erpA 158320 157988 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016875.1 protein_id gnl|my_center|LOCUS_28670 158334 158516 gene locus_tag LOCUS_28680 158334 158516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 158683 160230 gene locus_tag LOCUS_28690 158683 160230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 161226 160273 gene locus_tag LOCUS_28700 161226 160273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 161323 163368 gene locus_tag LOCUS_28710 gene ligA 161323 163368 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_28710 163932 163369 gene locus_tag LOCUS_28720 163932 163369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 165980 163995 gene locus_tag LOCUS_28730 165980 163995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 166290 167270 gene locus_tag LOCUS_28740 166290 167270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 167399 168793 gene locus_tag LOCUS_28750 167399 168793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 168906 169796 gene locus_tag LOCUS_28760 168906 169796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 169816 172101 gene locus_tag LOCUS_28770 169816 172101 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_28770 172238 172615 gene locus_tag LOCUS_28780 172238 172615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 172736 173695 gene locus_tag LOCUS_28790 172736 173695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 173692 175386 gene locus_tag LOCUS_28800 173692 175386 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_28800 175542 176915 gene locus_tag LOCUS_28810 175542 176915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28810 176942 178342 gene locus_tag LOCUS_28820 176942 178342 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_28820 179473 178439 gene locus_tag LOCUS_28830 179473 178439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 179834 179502 gene locus_tag LOCUS_28840 179834 179502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 180129 181136 gene locus_tag LOCUS_28850 180129 181136 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_28850 181147 182124 gene locus_tag LOCUS_28860 181147 182124 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_28860 182121 183365 gene locus_tag LOCUS_28870 182121 183365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 183362 184390 gene locus_tag LOCUS_28880 183362 184390 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_28880 184458 185624 gene locus_tag LOCUS_28890 184458 185624 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_28890 186001 185546 gene locus_tag LOCUS_28900 186001 185546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 186013 186396 gene locus_tag LOCUS_28910 186013 186396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 186398 188191 gene locus_tag LOCUS_28920 186398 188191 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_28920 188188 188985 gene locus_tag LOCUS_28930 188188 188985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 189171 189452 gene locus_tag LOCUS_28940 189171 189452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 190360 189461 gene locus_tag LOCUS_28950 190360 189461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_28950 191617 190439 gene locus_tag LOCUS_28960 191617 190439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 191601 192356 gene locus_tag LOCUS_28970 191601 192356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 192367 193995 gene locus_tag LOCUS_28980 gene gpmI 192367 193995 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_28980 194101 194802 gene locus_tag LOCUS_28990 194101 194802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 195465 194872 gene locus_tag LOCUS_29000 195465 194872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 196267 195482 gene locus_tag LOCUS_29010 gene map 196267 195482 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020076.1 protein_id gnl|my_center|LOCUS_29010 196363 197406 gene locus_tag LOCUS_29020 196363 197406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 197987 197436 gene locus_tag LOCUS_29030 197987 197436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 197968 199128 gene locus_tag LOCUS_29040 197968 199128 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_29040 199821 199189 gene locus_tag LOCUS_29050 199821 199189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 200588 199866 gene locus_tag LOCUS_29060 200588 199866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 200642 202255 gene locus_tag LOCUS_29070 200642 202255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 202380 202306 gene locus_tag LOCUS_t00380 202380 202306 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 202477 203085 gene locus_tag LOCUS_29080 202477 203085 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_29080 203956 203150 gene locus_tag LOCUS_29090 203956 203150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 204825 204067 gene locus_tag LOCUS_29100 204825 204067 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_29100 206435 204822 gene locus_tag LOCUS_29110 206435 204822 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_29110 206623 207114 gene locus_tag LOCUS_29120 206623 207114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 208068 207250 gene locus_tag LOCUS_29130 208068 207250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 208182 211079 gene locus_tag LOCUS_29140 208182 211079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 211285 211986 gene locus_tag LOCUS_29150 211285 211986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 212533 213081 gene locus_tag LOCUS_29160 212533 213081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 215353 213146 gene locus_tag LOCUS_29170 215353 213146 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_29170 215561 216703 gene locus_tag LOCUS_29180 215561 216703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 216714 217817 gene locus_tag LOCUS_29190 216714 217817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 219119 217854 gene locus_tag LOCUS_29200 219119 217854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 219273 219881 gene locus_tag LOCUS_29210 219273 219881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 219871 222246 gene locus_tag LOCUS_29220 219871 222246 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_29220 222246 223250 gene locus_tag LOCUS_29230 222246 223250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 223258 224028 gene locus_tag LOCUS_29240 223258 224028 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_29240 224091 224753 gene locus_tag LOCUS_29250 224091 224753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 225141 226544 gene locus_tag LOCUS_29260 225141 226544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 227995 226559 gene locus_tag LOCUS_29270 227995 226559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 229245 228205 gene locus_tag LOCUS_29280 229245 228205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 229315 230652 gene locus_tag LOCUS_29290 229315 230652 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_29290 230649 231386 gene locus_tag LOCUS_29300 230649 231386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 231383 232273 gene locus_tag LOCUS_29310 231383 232273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 233003 232293 gene locus_tag LOCUS_29320 233003 232293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 233197 234255 gene locus_tag LOCUS_29330 233197 234255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 234373 234795 gene locus_tag LOCUS_29340 234373 234795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 235690 234941 gene locus_tag LOCUS_29350 235690 234941 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_29350 235896 235699 gene locus_tag LOCUS_29360 235896 235699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 236912 235932 gene locus_tag LOCUS_29370 236912 235932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29370 237601 237242 gene locus_tag LOCUS_29380 237601 237242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 238648 238271 gene locus_tag LOCUS_29390 238648 238271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 239418 238759 gene locus_tag LOCUS_29400 239418 238759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 239342 239626 gene locus_tag LOCUS_29410 239342 239626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 239973 239623 gene locus_tag LOCUS_29420 239973 239623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29420 240350 239937 gene locus_tag LOCUS_29430 240350 239937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 240973 240347 gene locus_tag LOCUS_29440 240973 240347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29440 240994 241260 gene locus_tag LOCUS_29450 240994 241260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 241823 241197 gene locus_tag LOCUS_29460 241823 241197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29460 242131 241820 gene locus_tag LOCUS_29470 242131 241820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 242978 242601 gene locus_tag LOCUS_29480 242978 242601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 243170 246232 gene locus_tag LOCUS_29490 243170 246232 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122713.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 246156 246356 gene locus_tag LOCUS_29500 246156 246356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 246346 247713 gene locus_tag LOCUS_29510 246346 247713 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122712.1 protein_id gnl|my_center|LOCUS_29510 247710 249197 gene locus_tag LOCUS_29520 247710 249197 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841217.1 protein_id gnl|my_center|LOCUS_29520 249237 249602 gene locus_tag LOCUS_29530 249237 249602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 249811 250239 gene locus_tag LOCUS_29540 249811 250239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 250994 251221 gene locus_tag LOCUS_29550 250994 251221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 252221 251316 gene locus_tag LOCUS_29560 252221 251316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 252642 252890 gene locus_tag LOCUS_29570 252642 252890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 252863 253357 gene locus_tag LOCUS_29580 252863 253357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29580 253357 253860 gene locus_tag LOCUS_29590 253357 253860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29590 254014 254412 gene locus_tag LOCUS_29600 254014 254412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 254925 254419 gene locus_tag LOCUS_29610 254925 254419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 255305 254880 gene locus_tag LOCUS_29620 255305 254880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29620 256693 255761 gene locus_tag LOCUS_29630 256693 255761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 256891 256697 gene locus_tag LOCUS_29640 256891 256697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 257532 257080 gene locus_tag LOCUS_29650 257532 257080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 258371 257529 gene locus_tag LOCUS_29660 258371 257529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 261074 258450 gene locus_tag LOCUS_29670 261074 258450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 261886 261275 gene locus_tag LOCUS_29680 261886 261275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 262950 261883 gene locus_tag LOCUS_29690 262950 261883 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_29690 263107 264753 gene locus_tag LOCUS_29700 263107 264753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 264753 266378 gene locus_tag LOCUS_29710 264753 266378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 266375 267937 gene locus_tag LOCUS_29720 266375 267937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 268510 268064 gene locus_tag LOCUS_29730 268510 268064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 268869 269783 gene locus_tag LOCUS_29740 268869 269783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 270072 271496 gene locus_tag LOCUS_29750 270072 271496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 271676 272803 gene locus_tag LOCUS_29760 gene serC 271676 272803 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_29760 272800 273480 gene locus_tag LOCUS_29770 272800 273480 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263126.1 protein_id gnl|my_center|LOCUS_29770 275134 273602 gene locus_tag LOCUS_29780 275134 273602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 275755 275180 gene locus_tag LOCUS_29790 gene def 275755 275180 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_29790 277523 275832 gene locus_tag LOCUS_29800 277523 275832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 277656 279530 gene locus_tag LOCUS_29810 277656 279530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 279579 280055 gene locus_tag LOCUS_29820 279579 280055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 280043 281554 gene locus_tag LOCUS_29830 gene selA 280043 281554 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_29830 283734 281593 gene locus_tag LOCUS_29840 gene selB 283734 281593 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_29840 283876 284871 gene locus_tag LOCUS_29850 gene selD 283876 284871 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941269.1 protein_id gnl|my_center|LOCUS_29850 285329 284931 gene locus_tag LOCUS_29860 285329 284931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 286110 285349 gene locus_tag LOCUS_29870 286110 285349 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_29870 286230 287546 gene locus_tag LOCUS_29880 286230 287546 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_29880 287686 288870 gene locus_tag LOCUS_29890 gene recA 287686 288870 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_29890 290454 288982 gene locus_tag LOCUS_29900 290454 288982 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143678.1 protein_id gnl|my_center|LOCUS_29900 290626 291600 gene locus_tag LOCUS_29910 290626 291600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 293035 291617 gene locus_tag LOCUS_29920 gene radA 293035 291617 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930258.1 protein_id gnl|my_center|LOCUS_29920 295204 293066 gene locus_tag LOCUS_29930 295204 293066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 295315 296451 gene locus_tag LOCUS_29940 295315 296451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 297897 296803 gene locus_tag LOCUS_29950 297897 296803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 298457 297948 gene locus_tag LOCUS_29960 298457 297948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 298813 298478 gene locus_tag LOCUS_29970 298813 298478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 298956 300641 gene locus_tag LOCUS_29980 298956 300641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 300664 301707 gene locus_tag LOCUS_29990 300664 301707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 302180 301674 gene locus_tag LOCUS_30000 302180 301674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 302280 304427 gene locus_tag LOCUS_30010 302280 304427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 304429 305181 gene locus_tag LOCUS_30020 304429 305181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 305482 305195 gene locus_tag LOCUS_30030 305482 305195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 307113 305494 gene locus_tag LOCUS_30040 307113 305494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 307164 308417 gene locus_tag LOCUS_30050 307164 308417 CDS product DUF4056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705469.1 protein_id gnl|my_center|LOCUS_30050 310109 308460 gene locus_tag LOCUS_30060 310109 308460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 310453 312639 gene locus_tag LOCUS_30070 310453 312639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 313937 312693 gene locus_tag LOCUS_30080 313937 312693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 315594 313945 gene locus_tag LOCUS_30090 315594 313945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 315749 316738 gene locus_tag LOCUS_30100 315749 316738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 316799 320305 gene locus_tag LOCUS_30110 316799 320305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 320414 321547 gene locus_tag LOCUS_30120 320414 321547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 321593 323221 gene locus_tag LOCUS_30130 321593 323221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 324736 323756 gene locus_tag LOCUS_30140 324736 323756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 324844 325857 gene locus_tag LOCUS_30150 324844 325857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 327089 325929 gene locus_tag LOCUS_30160 327089 325929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 327418 327086 gene locus_tag LOCUS_30170 327418 327086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 329178 327448 gene locus_tag LOCUS_30180 329178 327448 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_30180 330971 329271 gene locus_tag LOCUS_30190 330971 329271 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_30190 331162 331587 gene locus_tag LOCUS_30200 331162 331587 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_30200 331694 332122 gene locus_tag LOCUS_30210 331694 332122 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 protein_id gnl|my_center|LOCUS_30210 332119 332529 gene locus_tag LOCUS_30220 332119 332529 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_30220 332526 333413 gene locus_tag LOCUS_30230 332526 333413 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_30230 334414 333428 gene locus_tag LOCUS_30240 334414 333428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 334482 335285 gene locus_tag LOCUS_30250 334482 335285 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_30250 336137 335337 gene locus_tag LOCUS_30260 336137 335337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 336208 336603 gene locus_tag LOCUS_30270 336208 336603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 336703 337554 gene locus_tag LOCUS_30280 336703 337554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 338275 337577 gene locus_tag LOCUS_30290 338275 337577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 338600 339991 gene locus_tag LOCUS_30300 338600 339991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 340088 341449 gene locus_tag LOCUS_30310 340088 341449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 341468 341821 gene locus_tag LOCUS_30320 341468 341821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 341868 342605 gene locus_tag LOCUS_30330 341868 342605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 343926 342616 gene locus_tag LOCUS_30340 343926 342616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 344023 345354 gene locus_tag LOCUS_30350 344023 345354 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_30350 345395 346891 gene locus_tag LOCUS_30360 345395 346891 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_30360 347952 346864 gene locus_tag LOCUS_30370 347952 346864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 348524 348078 gene locus_tag LOCUS_30380 348524 348078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 349500 348565 gene locus_tag LOCUS_30390 349500 348565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 349388 350182 gene locus_tag LOCUS_30400 349388 350182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30400 351736 350201 gene locus_tag LOCUS_30410 gene proS 351736 350201 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_30410 351991 352533 gene locus_tag LOCUS_30420 351991 352533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 353373 352690 gene locus_tag LOCUS_30430 353373 352690 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119806.1 protein_id gnl|my_center|LOCUS_30430 354089 353436 gene locus_tag LOCUS_30440 354089 353436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 355439 354270 gene locus_tag LOCUS_30450 355439 354270 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195471.1 protein_id gnl|my_center|LOCUS_30450 356787 355621 gene locus_tag LOCUS_30460 356787 355621 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_30460 356995 359946 gene locus_tag LOCUS_30470 356995 359946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 359943 360155 gene locus_tag LOCUS_30480 359943 360155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 360155 361072 gene locus_tag LOCUS_30490 360155 361072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 361566 361078 gene locus_tag LOCUS_30500 361566 361078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 362336 361836 gene locus_tag LOCUS_30510 362336 361836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 363539 362550 gene locus_tag LOCUS_30520 363539 362550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 364670 363891 gene locus_tag LOCUS_30530 364670 363891 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 protein_id gnl|my_center|LOCUS_30530 364728 369815 gene locus_tag LOCUS_30540 364728 369815 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_30540 371382 369850 gene locus_tag LOCUS_30550 371382 369850 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_30550 373405 371462 gene locus_tag LOCUS_30560 373405 371462 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 protein_id gnl|my_center|LOCUS_30560 373623 375317 gene locus_tag LOCUS_30570 373623 375317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 375317 377617 gene locus_tag LOCUS_30580 375317 377617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 378504 377665 gene locus_tag LOCUS_30590 378504 377665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 379818 379126 gene locus_tag LOCUS_30600 379818 379126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 379906 380910 gene locus_tag LOCUS_30610 379906 380910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 381367 380981 gene locus_tag LOCUS_30620 381367 380981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 382919 381429 gene locus_tag LOCUS_30630 382919 381429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 383331 382948 gene locus_tag LOCUS_30640 383331 382948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 385178 383328 gene locus_tag LOCUS_30650 385178 383328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 385293 386771 gene locus_tag LOCUS_30660 385293 386771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 387123 387911 gene locus_tag LOCUS_30670 387123 387911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 388037 388822 gene locus_tag LOCUS_30680 388037 388822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 388819 389370 gene locus_tag LOCUS_30690 388819 389370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 389732 389517 gene locus_tag LOCUS_30700 389732 389517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 392732 389871 gene locus_tag LOCUS_30710 392732 389871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 393274 392777 gene locus_tag LOCUS_30720 393274 392777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 393464 394453 gene locus_tag LOCUS_30730 393464 394453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 395902 394571 gene locus_tag LOCUS_30740 395902 394571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 397943 395961 gene locus_tag LOCUS_30750 397943 395961 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_30750 398185 398700 gene locus_tag LOCUS_30760 398185 398700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 399334 398936 gene locus_tag LOCUS_30770 gene rpsI 399334 398936 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_30770 399785 399351 gene locus_tag LOCUS_30780 gene rplM 399785 399351 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258261.1 protein_id gnl|my_center|LOCUS_30780 400043 400963 gene locus_tag LOCUS_30790 400043 400963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 400963 401844 gene locus_tag LOCUS_30800 400963 401844 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_30800 402213 401917 gene locus_tag LOCUS_30810 402213 401917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 402416 404158 gene locus_tag LOCUS_30820 gene recN 402416 404158 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_30820 404665 404159 gene locus_tag LOCUS_30830 404665 404159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 404962 405348 gene locus_tag LOCUS_30840 404962 405348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 406068 405517 gene locus_tag LOCUS_30850 406068 405517 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521511.1 protein_id gnl|my_center|LOCUS_30850 406226 407590 gene locus_tag LOCUS_30860 406226 407590 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812163.1 protein_id gnl|my_center|LOCUS_30860 407608 409212 gene locus_tag LOCUS_30870 407608 409212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 409764 409216 gene locus_tag LOCUS_30880 409764 409216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 410615 409761 gene locus_tag LOCUS_30890 410615 409761 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002690262.1 protein_id gnl|my_center|LOCUS_30890 412125 410725 gene locus_tag LOCUS_30900 412125 410725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 412022 412246 gene locus_tag LOCUS_30910 412022 412246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 415346 412422 gene locus_tag LOCUS_30920 415346 412422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 417015 415519 gene locus_tag LOCUS_30930 417015 415519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 416085 416181 gene locus_tag LOCUS_t00390 416085 416181 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 417416 417045 gene locus_tag LOCUS_30940 417416 417045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 418605 417862 gene locus_tag LOCUS_30950 418605 417862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 418604 419017 gene locus_tag LOCUS_30960 418604 419017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 419682 418963 gene locus_tag LOCUS_30970 419682 418963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 419881 420822 gene locus_tag LOCUS_30980 419881 420822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 421168 422121 gene locus_tag LOCUS_30990 421168 422121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 422792 422070 gene locus_tag LOCUS_31000 422792 422070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 424309 422900 gene locus_tag LOCUS_31010 424309 422900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 424763 425839 gene locus_tag LOCUS_31020 424763 425839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 425858 427171 gene locus_tag LOCUS_31030 425858 427171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 427481 427092 gene locus_tag LOCUS_31040 427481 427092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 427864 428283 gene locus_tag LOCUS_31050 427864 428283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 428961 428347 gene locus_tag LOCUS_31060 428961 428347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 429366 429010 gene locus_tag LOCUS_31070 429366 429010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 430209 429451 gene locus_tag LOCUS_31080 430209 429451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 430476 430270 gene locus_tag LOCUS_31090 430476 430270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31090 430939 431913 gene locus_tag LOCUS_31100 430939 431913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 432121 433230 gene locus_tag LOCUS_31110 432121 433230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 433452 433246 gene locus_tag LOCUS_31120 433452 433246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 433658 434302 gene locus_tag LOCUS_31130 433658 434302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 434327 435376 gene locus_tag LOCUS_31140 434327 435376 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_31140 435394 435732 gene locus_tag LOCUS_31150 435394 435732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 435729 436436 gene locus_tag LOCUS_31160 gene rpe 435729 436436 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143537.1 protein_id gnl|my_center|LOCUS_31160 436683 437621 gene locus_tag LOCUS_31170 436683 437621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 438750 437635 gene locus_tag LOCUS_31180 438750 437635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 439975 438761 gene locus_tag LOCUS_31190 439975 438761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 440457 440008 gene locus_tag LOCUS_31200 440457 440008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 440884 443145 gene locus_tag LOCUS_31210 440884 443145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 447112 443258 gene locus_tag LOCUS_31220 447112 443258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 448389 447328 gene locus_tag LOCUS_31230 448389 447328 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_31230 448467 449003 gene locus_tag LOCUS_31240 448467 449003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 449877 449011 gene locus_tag LOCUS_31250 449877 449011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 450072 450440 gene locus_tag LOCUS_31260 450072 450440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 450437 450961 gene locus_tag LOCUS_31270 450437 450961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 451953 451042 gene locus_tag LOCUS_31280 451953 451042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 452123 452740 gene locus_tag LOCUS_31290 452123 452740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 452737 453633 gene locus_tag LOCUS_31300 452737 453633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 453630 454385 gene locus_tag LOCUS_31310 453630 454385 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705192.1 protein_id gnl|my_center|LOCUS_31310 454494 455282 gene locus_tag LOCUS_31320 454494 455282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 455305 455958 gene locus_tag LOCUS_31330 455305 455958 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_31330 457403 456135 gene locus_tag LOCUS_31340 457403 456135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 458329 457616 gene locus_tag LOCUS_31350 458329 457616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 458378 459538 gene locus_tag LOCUS_31360 458378 459538 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_31360 459920 459612 gene locus_tag LOCUS_31370 459920 459612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 460009 460818 gene locus_tag LOCUS_31380 460009 460818 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_31380 462027 460957 gene locus_tag LOCUS_31390 gene recA 462027 460957 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537720.1 protein_id gnl|my_center|LOCUS_31390 463726 462206 gene locus_tag LOCUS_31400 463726 462206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 464978 463881 gene locus_tag LOCUS_31410 464978 463881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 465048 466049 gene locus_tag LOCUS_31420 465048 466049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 466774 466172 gene locus_tag LOCUS_31430 466774 466172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 466905 467378 gene locus_tag LOCUS_31440 466905 467378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 467297 468199 gene locus_tag LOCUS_31450 467297 468199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 468174 469490 gene locus_tag LOCUS_31460 468174 469490 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_31460 469487 470020 gene locus_tag LOCUS_31470 469487 470020 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705527.1 protein_id gnl|my_center|LOCUS_31470 470175 471617 gene locus_tag LOCUS_31480 470175 471617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 471778 472260 gene locus_tag LOCUS_31490 471778 472260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 473273 472671 gene locus_tag LOCUS_31500 473273 472671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 473375 473788 gene locus_tag LOCUS_31510 473375 473788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 473788 474237 gene locus_tag LOCUS_31520 473788 474237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 474646 474239 gene locus_tag LOCUS_31530 474646 474239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 474734 475543 gene locus_tag LOCUS_31540 474734 475543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 475970 475692 gene locus_tag LOCUS_31550 475970 475692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence06 1058 492 gene locus_tag LOCUS_31560 1058 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 1321 1082 gene locus_tag LOCUS_31570 1321 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 1621 1349 gene locus_tag LOCUS_31580 1621 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 2820 1594 gene locus_tag LOCUS_31590 2820 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3095 3433 gene locus_tag LOCUS_31600 3095 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 6032 3762 gene locus_tag LOCUS_31610 6032 3762 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_31610 6613 6539 gene locus_tag LOCUS_t00400 6613 6539 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6710 8710 gene locus_tag LOCUS_31620 6710 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 8808 9725 gene locus_tag LOCUS_31630 8808 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 9751 10071 gene locus_tag LOCUS_31640 9751 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 10617 10159 gene locus_tag LOCUS_31650 10617 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 10864 10658 gene locus_tag LOCUS_31660 10864 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 10982 10911 gene locus_tag LOCUS_t00410 10982 10911 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11367 11185 gene locus_tag LOCUS_31670 11367 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 13867 11522 gene locus_tag LOCUS_31680 13867 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 14036 14569 gene locus_tag LOCUS_31690 14036 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 16991 14520 gene locus_tag LOCUS_31700 16991 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 15492 15588 gene locus_tag LOCUS_t00420 15492 15588 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17213 17887 gene locus_tag LOCUS_31710 17213 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 18618 17905 gene locus_tag LOCUS_31720 18618 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 20283 18697 gene locus_tag LOCUS_31730 20283 18697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 21377 20430 gene locus_tag LOCUS_31740 21377 20430 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 protein_id gnl|my_center|LOCUS_31740 23105 21612 gene locus_tag LOCUS_31750 23105 21612 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_31750 23842 23102 gene locus_tag LOCUS_31760 23842 23102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 24356 23901 gene locus_tag LOCUS_31770 24356 23901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 26811 25606 gene locus_tag LOCUS_31780 26811 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 26954 29026 gene locus_tag LOCUS_31790 26954 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 29772 29125 gene locus_tag LOCUS_31800 29772 29125 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_31800 29844 30521 gene locus_tag LOCUS_31810 29844 30521 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_31810 30641 31507 gene locus_tag LOCUS_31820 30641 31507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 31504 32547 gene locus_tag LOCUS_31830 31504 32547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 32749 33330 gene locus_tag LOCUS_31840 gene rsmD 32749 33330 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_31840 33365 34582 gene locus_tag LOCUS_31850 33365 34582 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_31850 36436 34679 gene locus_tag LOCUS_31860 36436 34679 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884040.1 protein_id gnl|my_center|LOCUS_31860 37622 36519 gene locus_tag LOCUS_31870 gene bioB 37622 36519 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_31870 37879 38925 gene locus_tag LOCUS_31880 gene pdhA 37879 38925 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_31880 38929 39909 gene locus_tag LOCUS_31890 38929 39909 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_31890 39964 41181 gene locus_tag LOCUS_31900 39964 41181 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31900 41115 41381 gene locus_tag LOCUS_31910 41115 41381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31910 42048 41374 gene locus_tag LOCUS_31920 42048 41374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 42150 42623 gene locus_tag LOCUS_31930 42150 42623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 44239 42710 gene locus_tag LOCUS_31940 44239 42710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 45209 44283 gene locus_tag LOCUS_31950 45209 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 45273 45620 gene locus_tag LOCUS_31960 45273 45620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 45630 47255 gene locus_tag LOCUS_31970 45630 47255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 47306 49165 gene locus_tag LOCUS_31980 47306 49165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 49740 49198 gene locus_tag LOCUS_31990 49740 49198 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970751.1 protein_id gnl|my_center|LOCUS_31990 50796 49753 gene locus_tag LOCUS_32000 50796 49753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 52709 50793 gene locus_tag LOCUS_32010 gene hflX 52709 50793 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_32010 54664 52706 gene locus_tag LOCUS_32020 54664 52706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 55135 56460 gene locus_tag LOCUS_32030 55135 56460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 57401 56526 gene locus_tag LOCUS_32040 57401 56526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 58048 57398 gene locus_tag LOCUS_32050 58048 57398 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_32050 58167 59621 gene locus_tag LOCUS_32060 gene purB 58167 59621 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_32060 59686 59973 gene locus_tag LOCUS_32070 59686 59973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 60938 60036 gene locus_tag LOCUS_32080 60938 60036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 62366 60984 gene locus_tag LOCUS_32090 62366 60984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 63857 62517 gene locus_tag LOCUS_32100 63857 62517 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_32100 64128 65333 gene locus_tag LOCUS_32110 64128 65333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 65495 67282 gene locus_tag LOCUS_32120 65495 67282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 67345 69795 gene locus_tag LOCUS_32130 67345 69795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 70559 69942 gene locus_tag LOCUS_32140 70559 69942 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_32140 71406 70579 gene locus_tag LOCUS_32150 71406 70579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 72667 71543 gene locus_tag LOCUS_32160 72667 71543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 74328 72760 gene locus_tag LOCUS_32170 gene cobA 74328 72760 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_32170 74403 76199 gene locus_tag LOCUS_32180 gene mnmG 74403 76199 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_32180 76230 77090 gene locus_tag LOCUS_32190 76230 77090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 77743 77396 gene locus_tag LOCUS_32200 77743 77396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 77911 78762 gene locus_tag LOCUS_32210 77911 78762 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928645.1 protein_id gnl|my_center|LOCUS_32210 80649 78892 gene locus_tag LOCUS_32220 80649 78892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 81670 80816 gene locus_tag LOCUS_32230 81670 80816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 83098 81683 gene locus_tag LOCUS_32240 83098 81683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 83499 83137 gene locus_tag LOCUS_32250 83499 83137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 83477 84544 gene locus_tag LOCUS_32260 83477 84544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 84650 86086 gene locus_tag LOCUS_32270 84650 86086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 87276 86458 gene locus_tag LOCUS_32280 87276 86458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 88518 87289 gene locus_tag LOCUS_32290 88518 87289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 89981 88530 gene locus_tag LOCUS_32300 89981 88530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 90881 90051 gene locus_tag LOCUS_32310 gene speE 90881 90051 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_32310 93243 91006 gene locus_tag LOCUS_32320 93243 91006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 93488 94168 gene locus_tag LOCUS_32330 93488 94168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32330 94194 95306 gene locus_tag LOCUS_32340 94194 95306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32340 95320 96630 gene locus_tag LOCUS_32350 95320 96630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 96633 99824 gene locus_tag LOCUS_32360 96633 99824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 100178 99963 gene locus_tag LOCUS_32370 100178 99963 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_32370 101988 100195 gene locus_tag LOCUS_32380 101988 100195 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389322.1 protein_id gnl|my_center|LOCUS_32380 102214 101981 gene locus_tag LOCUS_32390 102214 101981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 103794 102211 gene locus_tag LOCUS_32400 103794 102211 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389324.1 protein_id gnl|my_center|LOCUS_32400 105382 103871 gene locus_tag LOCUS_32410 105382 103871 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_32410 105854 105375 gene locus_tag LOCUS_32420 105854 105375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 107056 105851 gene locus_tag LOCUS_32430 107056 105851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 107373 107053 gene locus_tag LOCUS_32440 gene mnhG 107373 107053 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_32440 107640 107377 gene locus_tag LOCUS_32450 107640 107377 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_32450 108118 107645 gene locus_tag LOCUS_32460 108118 107645 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_32460 108255 110834 gene locus_tag LOCUS_32470 108255 110834 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_32470 110874 113552 gene locus_tag LOCUS_32480 110874 113552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 113604 114338 gene locus_tag LOCUS_32490 113604 114338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 115683 114403 gene locus_tag LOCUS_32500 115683 114403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 118414 115751 gene locus_tag LOCUS_32510 118414 115751 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_32510 119193 118879 gene locus_tag LOCUS_32520 119193 118879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 120464 119187 gene locus_tag LOCUS_32530 120464 119187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 123110 120468 gene locus_tag LOCUS_32540 123110 120468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 123559 123107 gene locus_tag LOCUS_32550 123559 123107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 126130 123722 gene locus_tag LOCUS_32560 126130 123722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 protein_id gnl|my_center|LOCUS_32560 126913 126305 gene locus_tag LOCUS_32570 126913 126305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 127235 127726 gene locus_tag LOCUS_32580 127235 127726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 128647 128048 gene locus_tag LOCUS_32590 128647 128048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 129180 129755 gene locus_tag LOCUS_32600 129180 129755 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_32600 130227 129739 gene locus_tag LOCUS_32610 130227 129739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 131335 130304 gene locus_tag LOCUS_32620 131335 130304 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_32620 133024 131456 gene locus_tag LOCUS_32630 133024 131456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 134207 133152 gene locus_tag LOCUS_32640 134207 133152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 135777 134779 gene locus_tag LOCUS_32650 135777 134779 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140582.1 protein_id gnl|my_center|LOCUS_32650 136755 135850 gene locus_tag LOCUS_32660 136755 135850 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095100.1 protein_id gnl|my_center|LOCUS_32660 137972 136752 gene locus_tag LOCUS_32670 137972 136752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 139258 137975 gene locus_tag LOCUS_32680 139258 137975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 141481 139262 gene locus_tag LOCUS_32690 141481 139262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_32690 142067 143680 gene locus_tag LOCUS_32700 142067 143680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 143822 144253 gene locus_tag LOCUS_32710 143822 144253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 144419 144979 gene locus_tag LOCUS_32720 144419 144979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 144979 145293 gene locus_tag LOCUS_32730 144979 145293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 145347 146867 gene locus_tag LOCUS_32740 145347 146867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 146937 148571 gene locus_tag LOCUS_32750 146937 148571 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_32750 148731 150194 gene locus_tag LOCUS_32760 gene rpoN 148731 150194 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_32760 150222 150884 gene locus_tag LOCUS_32770 gene raiA 150222 150884 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_32770 151020 152078 gene locus_tag LOCUS_32780 gene hprK 151020 152078 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_32780 152080 153018 gene locus_tag LOCUS_32790 gene rapZ 152080 153018 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_32790 152993 153469 gene locus_tag LOCUS_32800 152993 153469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 153466 153744 gene locus_tag LOCUS_32810 153466 153744 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_32810 153741 155576 gene locus_tag LOCUS_32820 gene ptsP 153741 155576 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_32820 155719 156627 gene locus_tag LOCUS_32830 155719 156627 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_32830 156642 159755 gene locus_tag LOCUS_32840 156642 159755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 159865 162897 gene locus_tag LOCUS_32850 159865 162897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 162987 163454 gene locus_tag LOCUS_32860 162987 163454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 164870 163560 gene locus_tag LOCUS_32870 164870 163560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 165474 165019 gene locus_tag LOCUS_32880 165474 165019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 165597 168281 gene locus_tag LOCUS_32890 165597 168281 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529541.1 protein_id gnl|my_center|LOCUS_32890 168792 168289 gene locus_tag LOCUS_32900 168792 168289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 168871 171009 gene locus_tag LOCUS_32910 168871 171009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 171643 171014 gene locus_tag LOCUS_32920 171643 171014 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_32920 171972 171658 gene locus_tag LOCUS_32930 171972 171658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 172185 174992 gene locus_tag LOCUS_32940 gene polA 172185 174992 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 protein_id gnl|my_center|LOCUS_32940 175399 175001 gene locus_tag LOCUS_32950 175399 175001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 175368 175541 gene locus_tag LOCUS_32960 175368 175541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 176926 175622 gene locus_tag LOCUS_32970 176926 175622 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111848.1 protein_id gnl|my_center|LOCUS_32970 177046 177588 gene locus_tag LOCUS_32980 177046 177588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 177722 178267 gene locus_tag LOCUS_32990 177722 178267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 178335 179597 gene locus_tag LOCUS_33000 178335 179597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 181524 179761 gene locus_tag LOCUS_33010 181524 179761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 182349 181537 gene locus_tag LOCUS_33020 182349 181537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 182927 182349 gene locus_tag LOCUS_33030 182927 182349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 182926 183423 gene locus_tag LOCUS_33040 182926 183423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 184082 183543 gene locus_tag LOCUS_33050 184082 183543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 185110 184133 gene locus_tag LOCUS_33060 185110 184133 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_33060 186316 185231 gene locus_tag LOCUS_33070 gene hemH 186316 185231 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957341.1 protein_id gnl|my_center|LOCUS_33070 186394 187131 gene locus_tag LOCUS_33080 186394 187131 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_33080 189731 187278 gene locus_tag LOCUS_33090 gene glgB 189731 187278 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_33090 191964 189874 gene locus_tag LOCUS_33100 gene glgX 191964 189874 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_33100 192087 193715 gene locus_tag LOCUS_33110 192087 193715 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882974.1 protein_id gnl|my_center|LOCUS_33110 194598 193753 gene locus_tag LOCUS_33120 194598 193753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 194480 194824 gene locus_tag LOCUS_33130 194480 194824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 195112 196407 gene locus_tag LOCUS_33140 195112 196407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 197848 196487 gene locus_tag LOCUS_33150 197848 196487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 198333 197950 gene locus_tag LOCUS_33160 198333 197950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 199014 198547 gene locus_tag LOCUS_33170 199014 198547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 200374 199145 gene locus_tag LOCUS_33180 200374 199145 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_33180 202575 200560 gene locus_tag LOCUS_33190 202575 200560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 204368 203001 gene locus_tag LOCUS_33200 204368 203001 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_33200 206470 204689 gene locus_tag LOCUS_33210 206470 204689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 207613 206570 gene locus_tag LOCUS_33220 207613 206570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 208781 207723 gene locus_tag LOCUS_33230 208781 207723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 209571 209116 gene locus_tag LOCUS_33240 209571 209116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 211674 209818 gene locus_tag LOCUS_33250 211674 209818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 212297 211680 gene locus_tag LOCUS_33260 212297 211680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 212574 213299 gene locus_tag LOCUS_33270 212574 213299 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_33270 213316 214209 gene locus_tag LOCUS_33280 gene ilvE 213316 214209 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_33280 215904 214270 gene locus_tag LOCUS_33290 215904 214270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 216535 215918 gene locus_tag LOCUS_33300 216535 215918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 217519 218193 gene locus_tag LOCUS_33310 217519 218193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 218413 219462 gene locus_tag LOCUS_33320 218413 219462 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_33320 220467 219514 gene locus_tag LOCUS_33330 220467 219514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 220572 221390 gene locus_tag LOCUS_33340 220572 221390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 221481 222206 gene locus_tag LOCUS_33350 221481 222206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 225429 222226 gene locus_tag LOCUS_33360 225429 222226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 225558 226139 gene locus_tag LOCUS_33370 225558 226139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 226157 226465 gene locus_tag LOCUS_33380 226157 226465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 226462 227361 gene locus_tag LOCUS_33390 226462 227361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 227457 229868 gene locus_tag LOCUS_33400 227457 229868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 230924 230202 gene locus_tag LOCUS_33410 230924 230202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 231034 234540 gene locus_tag LOCUS_33420 231034 234540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 234467 234706 gene locus_tag LOCUS_33430 234467 234706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 234757 236418 gene locus_tag LOCUS_33440 234757 236418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 237468 236512 gene locus_tag LOCUS_33450 237468 236512 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062236.1 protein_id gnl|my_center|LOCUS_33450 237592 238398 gene locus_tag LOCUS_33460 237592 238398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 238737 238456 gene locus_tag LOCUS_33470 238737 238456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 241852 238865 gene locus_tag LOCUS_33480 241852 238865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 241946 242959 gene locus_tag LOCUS_33490 241946 242959 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_33490 243023 243979 gene locus_tag LOCUS_33500 gene lipA 243023 243979 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_33500 244007 244840 gene locus_tag LOCUS_33510 244007 244840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 245415 244792 gene locus_tag LOCUS_33520 245415 244792 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_33520 245765 245412 gene locus_tag LOCUS_33530 245765 245412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 247857 245824 gene locus_tag LOCUS_33540 gene recQ 247857 245824 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_33540 249993 247942 gene locus_tag LOCUS_33550 249993 247942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 250149 251633 gene locus_tag LOCUS_33560 250149 251633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 251660 254224 gene locus_tag LOCUS_33570 251660 254224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 254268 255455 gene locus_tag LOCUS_33580 254268 255455 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_33580 255452 256363 gene locus_tag LOCUS_33590 255452 256363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 256360 256965 gene locus_tag LOCUS_33600 256360 256965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 256962 257684 gene locus_tag LOCUS_33610 256962 257684 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_33610 257681 258910 gene locus_tag LOCUS_33620 257681 258910 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 protein_id gnl|my_center|LOCUS_33620 259011 260216 gene locus_tag LOCUS_33630 259011 260216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 261549 260287 gene locus_tag LOCUS_33640 261549 260287 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_33640 261779 264931 gene locus_tag LOCUS_33650 261779 264931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 265089 265826 gene locus_tag LOCUS_33660 265089 265826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 265940 266611 gene locus_tag LOCUS_33670 gene pabA 265940 266611 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601879.1 protein_id gnl|my_center|LOCUS_33670 266636 267442 gene locus_tag LOCUS_33680 gene trpC 266636 267442 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028830.1 protein_id gnl|my_center|LOCUS_33680 268376 267495 gene locus_tag LOCUS_33690 268376 267495 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478729.1 protein_id gnl|my_center|LOCUS_33690 268460 269497 gene locus_tag LOCUS_33700 268460 269497 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546621.1 protein_id gnl|my_center|LOCUS_33700 271047 269545 gene locus_tag LOCUS_33710 271047 269545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 272717 271182 gene locus_tag LOCUS_33720 272717 271182 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_33720 272837 273916 gene locus_tag LOCUS_33730 272837 273916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 273981 275135 gene locus_tag LOCUS_33740 273981 275135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_33740 276409 275066 gene locus_tag LOCUS_33750 276409 275066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 277169 276582 gene locus_tag LOCUS_33760 277169 276582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 277307 278158 gene locus_tag LOCUS_33770 277307 278158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_33770 279154 278234 gene locus_tag LOCUS_33780 279154 278234 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_33780 279924 279151 gene locus_tag LOCUS_33790 279924 279151 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_33790 280098 280271 gene locus_tag LOCUS_33800 280098 280271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 281675 280275 gene locus_tag LOCUS_33810 281675 280275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 283704 281797 gene locus_tag LOCUS_33820 283704 281797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 283751 286201 gene locus_tag LOCUS_33830 gene lon 283751 286201 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_33830 286395 288329 gene locus_tag LOCUS_33840 gene dnaK 286395 288329 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_33840 288471 289334 gene locus_tag LOCUS_33850 288471 289334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 289966 290511 gene locus_tag LOCUS_33860 289966 290511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 290618 291178 gene locus_tag LOCUS_33870 290618 291178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 291267 292856 gene locus_tag LOCUS_33880 gene purH 291267 292856 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_33880 292932 294200 gene locus_tag LOCUS_33890 gene purD 292932 294200 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_33890 294236 295543 gene locus_tag LOCUS_33900 294236 295543 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_33900 295540 296766 gene locus_tag LOCUS_33910 295540 296766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 296763 298052 gene locus_tag LOCUS_33920 296763 298052 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_33920 298332 300089 gene locus_tag LOCUS_33930 298332 300089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 300354 301142 gene locus_tag LOCUS_33940 300354 301142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 301269 301341 gene locus_tag LOCUS_t00430 301269 301341 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 301659 303512 gene locus_tag LOCUS_33950 301659 303512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 303766 304392 gene locus_tag LOCUS_33960 303766 304392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 304425 306236 gene locus_tag LOCUS_33970 304425 306236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 306385 308295 gene locus_tag LOCUS_33980 306385 308295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 309538 308306 gene locus_tag LOCUS_33990 309538 308306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 311482 309701 gene locus_tag LOCUS_34000 311482 309701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 312171 311566 gene locus_tag LOCUS_34010 312171 311566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 312493 313284 gene locus_tag LOCUS_34020 312493 313284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 313289 313828 gene locus_tag LOCUS_34030 313289 313828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 313933 315606 gene locus_tag LOCUS_34040 313933 315606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 315606 316328 gene locus_tag LOCUS_34050 315606 316328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 316441 317886 gene locus_tag LOCUS_34060 316441 317886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 319749 317911 gene locus_tag LOCUS_34070 319749 317911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 319947 320180 gene locus_tag LOCUS_34080 319947 320180 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139648.1 protein_id gnl|my_center|LOCUS_34080 320211 320870 gene locus_tag LOCUS_34090 320211 320870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 320920 322245 gene locus_tag LOCUS_34100 320920 322245 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_34100 323438 322560 gene locus_tag LOCUS_34110 323438 322560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 323344 323553 gene locus_tag LOCUS_34120 323344 323553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 324984 323965 gene locus_tag LOCUS_34130 324984 323965 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707165.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34130 325377 325183 gene locus_tag LOCUS_34140 325377 325183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 325887 326084 gene locus_tag LOCUS_34150 325887 326084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 327745 325985 gene locus_tag LOCUS_34160 327745 325985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 329868 327742 gene locus_tag LOCUS_34170 329868 327742 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 protein_id gnl|my_center|LOCUS_34170 330066 330845 gene locus_tag LOCUS_34180 330066 330845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 331446 330796 gene locus_tag LOCUS_34190 331446 330796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 331762 332292 gene locus_tag LOCUS_34200 331762 332292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 332335 333291 gene locus_tag LOCUS_34210 332335 333291 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 protein_id gnl|my_center|LOCUS_34210 333369 334013 gene locus_tag LOCUS_34220 gene prfH 333369 334013 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114116.1 protein_id gnl|my_center|LOCUS_34220 334432 334139 gene locus_tag LOCUS_34230 334432 334139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 335343 334429 gene locus_tag LOCUS_34240 335343 334429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 336250 335471 gene locus_tag LOCUS_34250 336250 335471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 337163 336456 gene locus_tag LOCUS_34260 337163 336456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 337399 337806 gene locus_tag LOCUS_34270 337399 337806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 337819 340458 gene locus_tag LOCUS_34280 337819 340458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 342883 340517 gene locus_tag LOCUS_34290 342883 340517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 343110 344387 gene locus_tag LOCUS_34300 343110 344387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 348908 344403 gene locus_tag LOCUS_34310 348908 344403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 350986 348905 gene locus_tag LOCUS_34320 350986 348905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 351568 351131 gene locus_tag LOCUS_34330 351568 351131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 352168 351674 gene locus_tag LOCUS_34340 352168 351674 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 protein_id gnl|my_center|LOCUS_34340 352155 352328 gene locus_tag LOCUS_34350 352155 352328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 352641 353240 gene locus_tag LOCUS_34360 352641 353240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 353277 355319 gene locus_tag LOCUS_34370 353277 355319 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_34370 355316 359143 gene locus_tag LOCUS_34380 355316 359143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 359121 359378 gene locus_tag LOCUS_34390 359121 359378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 359635 359438 gene locus_tag LOCUS_34400 359635 359438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 359564 361234 gene locus_tag LOCUS_34410 359564 361234 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_34410 361433 362668 gene locus_tag LOCUS_34420 361433 362668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 362718 364610 gene locus_tag LOCUS_34430 362718 364610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 364618 365505 gene locus_tag LOCUS_34440 364618 365505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 365502 366872 gene locus_tag LOCUS_34450 365502 366872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34450 366954 371270 gene locus_tag LOCUS_34460 366954 371270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 371393 376204 gene locus_tag LOCUS_34470 371393 376204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 377327 376302 gene locus_tag LOCUS_34480 377327 376302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 379738 377459 gene locus_tag LOCUS_34490 379738 377459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 380724 379840 gene locus_tag LOCUS_34500 380724 379840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 382667 380721 gene locus_tag LOCUS_34510 382667 380721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 383921 382680 gene locus_tag LOCUS_34520 383921 382680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 385921 383918 gene locus_tag LOCUS_34530 385921 383918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 387557 385950 gene locus_tag LOCUS_34540 387557 385950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 387804 388301 gene locus_tag LOCUS_34550 387804 388301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 389980 388406 gene locus_tag LOCUS_34560 389980 388406 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_34560 393009 390427 gene locus_tag LOCUS_34570 393009 390427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 393312 394208 gene locus_tag LOCUS_34580 393312 394208 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660680.1 protein_id gnl|my_center|LOCUS_34580 394222 394416 gene locus_tag LOCUS_34590 394222 394416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 394543 396525 gene locus_tag LOCUS_34600 394543 396525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 396596 398527 gene locus_tag LOCUS_34610 396596 398527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 398535 402386 gene locus_tag LOCUS_34620 398535 402386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 402426 403700 gene locus_tag LOCUS_34630 402426 403700 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_34630 404360 403728 gene locus_tag LOCUS_34640 404360 403728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 405793 404468 gene locus_tag LOCUS_34650 405793 404468 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_34650 408039 405874 gene locus_tag LOCUS_34660 408039 405874 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_34660 408228 409313 gene locus_tag LOCUS_34670 408228 409313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 409597 409292 gene locus_tag LOCUS_34680 409597 409292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 409494 410468 gene locus_tag LOCUS_34690 409494 410468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 411771 410470 gene locus_tag LOCUS_34700 411771 410470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 413616 411889 gene locus_tag LOCUS_34710 413616 411889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 415659 413680 gene locus_tag LOCUS_34720 415659 413680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 416296 415673 gene locus_tag LOCUS_34730 416296 415673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 <418025 416344 gene locus_tag LOCUS_34740 <418025 416344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941480.1:TolC family protein >Feature sequence07 154 495 gene locus_tag LOCUS_34750 154 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 5429 2967 gene locus_tag LOCUS_34760 5429 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 7312 5432 gene locus_tag LOCUS_34770 7312 5432 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_34770 7982 7290 gene locus_tag LOCUS_34780 7982 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 8062 11226 gene locus_tag LOCUS_34790 8062 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 11357 12139 gene locus_tag LOCUS_34800 gene radC 11357 12139 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_34800 12849 12154 gene locus_tag LOCUS_34810 12849 12154 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_34810 12874 13548 gene locus_tag LOCUS_34820 12874 13548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_34820 13560 16076 gene locus_tag LOCUS_34830 13560 16076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252344.1 protein_id gnl|my_center|LOCUS_34830 16717 16169 gene locus_tag LOCUS_34840 16717 16169 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_34840 17741 16830 gene locus_tag LOCUS_34850 17741 16830 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294680.1 protein_id gnl|my_center|LOCUS_34850 17809 18246 gene locus_tag LOCUS_34860 17809 18246 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815644.1 protein_id gnl|my_center|LOCUS_34860 19340 18360 gene locus_tag LOCUS_34870 19340 18360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_34870 19568 20941 gene locus_tag LOCUS_34880 19568 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 21268 22473 gene locus_tag LOCUS_34890 21268 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 24461 22530 gene locus_tag LOCUS_34900 24461 22530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 26025 24511 gene locus_tag LOCUS_34910 26025 24511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 27758 26022 gene locus_tag LOCUS_34920 27758 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 28453 27755 gene locus_tag LOCUS_34930 28453 27755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 30013 28691 gene locus_tag LOCUS_34940 30013 28691 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_34940 32337 30028 gene locus_tag LOCUS_34950 32337 30028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 32540 32998 gene locus_tag LOCUS_34960 32540 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 36018 33016 gene locus_tag LOCUS_34970 36018 33016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 36931 36035 gene locus_tag LOCUS_34980 36931 36035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 37433 36963 gene locus_tag LOCUS_34990 37433 36963 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899923.1 protein_id gnl|my_center|LOCUS_34990 37901 38755 gene locus_tag LOCUS_35000 37901 38755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 38861 41200 gene locus_tag LOCUS_35010 38861 41200 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_35010 41906 41256 gene locus_tag LOCUS_35020 gene def 41906 41256 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595989.1 protein_id gnl|my_center|LOCUS_35020 41907 43019 gene locus_tag LOCUS_35030 41907 43019 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228099.1 protein_id gnl|my_center|LOCUS_35030 43300 43686 gene locus_tag LOCUS_35040 43300 43686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 44429 43863 gene locus_tag LOCUS_35050 gene folE 44429 43863 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075743291.1 protein_id gnl|my_center|LOCUS_35050 44998 44462 gene locus_tag LOCUS_35060 gene zntR 44998 44462 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 protein_id gnl|my_center|LOCUS_35060 45066 45824 gene locus_tag LOCUS_35070 45066 45824 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443912.1 protein_id gnl|my_center|LOCUS_35070 45914 46225 gene locus_tag LOCUS_35080 45914 46225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 46326 46877 gene locus_tag LOCUS_35090 46326 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 46888 47886 gene locus_tag LOCUS_35100 46888 47886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 48293 49621 gene locus_tag LOCUS_35110 48293 49621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 49979 49752 gene locus_tag LOCUS_35120 49979 49752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 49891 51099 gene locus_tag LOCUS_35130 49891 51099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257517.1 protein_id gnl|my_center|LOCUS_35130 51233 54997 gene locus_tag LOCUS_35140 51233 54997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 55032 58676 gene locus_tag LOCUS_35150 55032 58676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 60603 58768 gene locus_tag LOCUS_35160 60603 58768 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_35160 63133 60893 gene locus_tag LOCUS_35170 63133 60893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 63960 63268 gene locus_tag LOCUS_35180 gene lexA 63960 63268 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_35180 64119 64541 gene locus_tag LOCUS_35190 64119 64541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 64635 65582 gene locus_tag LOCUS_35200 64635 65582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 65637 65789 gene locus_tag LOCUS_35210 65637 65789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 65786 66118 gene locus_tag LOCUS_35220 65786 66118 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_35220 67096 66143 gene locus_tag LOCUS_35230 67096 66143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 67263 69356 gene locus_tag LOCUS_35240 67263 69356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 69486 69812 gene locus_tag LOCUS_35250 69486 69812 CDS product O-6-alkylguanine-DNA--cysteine-protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174014.1 protein_id gnl|my_center|LOCUS_35250 69939 70439 gene locus_tag LOCUS_35260 69939 70439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 71269 70511 gene locus_tag LOCUS_35270 gene murI 71269 70511 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228827.1 protein_id gnl|my_center|LOCUS_35270 72579 71266 gene locus_tag LOCUS_35280 72579 71266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 72542 73588 gene locus_tag LOCUS_35290 72542 73588 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406126.1 protein_id gnl|my_center|LOCUS_35290 73696 75621 gene locus_tag LOCUS_35300 73696 75621 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_35300 75605 76822 gene locus_tag LOCUS_35310 75605 76822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 76825 77829 gene locus_tag LOCUS_35320 gene dusA 76825 77829 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_35320 79135 77891 gene locus_tag LOCUS_35330 79135 77891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 79385 80296 gene locus_tag LOCUS_35340 79385 80296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 81559 80315 gene locus_tag LOCUS_35350 81559 80315 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080704.1 protein_id gnl|my_center|LOCUS_35350 82395 81565 gene locus_tag LOCUS_35360 82395 81565 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_35360 82624 85305 gene locus_tag LOCUS_35370 gene polA 82624 85305 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_35370 87331 85340 gene locus_tag LOCUS_35380 87331 85340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 87840 87914 gene locus_tag LOCUS_t00440 87840 87914 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 87920 87993 gene locus_tag LOCUS_t00450 87920 87993 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 87999 88073 gene locus_tag LOCUS_t00460 87999 88073 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 88096 88172 gene locus_tag LOCUS_t00470 88096 88172 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 88212 88296 gene locus_tag LOCUS_t00480 88212 88296 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88323 88406 gene locus_tag LOCUS_t00490 88323 88406 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88425 89147 gene locus_tag LOCUS_35390 88425 89147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 90620 89172 gene locus_tag LOCUS_35400 90620 89172 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_35400 91966 90800 gene locus_tag LOCUS_35410 91966 90800 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230888.1 protein_id gnl|my_center|LOCUS_35410 92911 92036 gene locus_tag LOCUS_35420 92911 92036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 93893 92931 gene locus_tag LOCUS_35430 gene gshB 93893 92931 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_35430 94061 94567 gene locus_tag LOCUS_35440 94061 94567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 94681 95553 gene locus_tag LOCUS_35450 94681 95553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 95587 97308 gene locus_tag LOCUS_35460 95587 97308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 97331 98404 gene locus_tag LOCUS_35470 97331 98404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 99329 98526 gene locus_tag LOCUS_35480 99329 98526 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_35480 99739 99332 gene locus_tag LOCUS_35490 99739 99332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 100003 100854 gene locus_tag LOCUS_35500 100003 100854 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839293.1 protein_id gnl|my_center|LOCUS_35500 100859 101704 gene locus_tag LOCUS_35510 100859 101704 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_35510 101974 101732 gene locus_tag LOCUS_35520 101974 101732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 102135 102389 gene locus_tag LOCUS_35530 102135 102389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 102410 104047 gene locus_tag LOCUS_35540 102410 104047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 104422 105084 gene locus_tag LOCUS_35550 104422 105084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 105346 106479 gene locus_tag LOCUS_35560 105346 106479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 107554 106613 gene locus_tag LOCUS_35570 107554 106613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 108315 109850 gene locus_tag LOCUS_35580 108315 109850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 109885 110730 gene locus_tag LOCUS_35590 109885 110730 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101741.1 protein_id gnl|my_center|LOCUS_35590 112443 110827 gene locus_tag LOCUS_35600 gene rtcR 112443 110827 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_35600 112648 113835 gene locus_tag LOCUS_35610 112648 113835 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_35610 113843 114883 gene locus_tag LOCUS_35620 gene rtcA 113843 114883 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 protein_id gnl|my_center|LOCUS_35620 115015 115167 gene locus_tag LOCUS_35630 115015 115167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 117186 115177 gene locus_tag LOCUS_35640 117186 115177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 117143 118033 gene locus_tag LOCUS_35650 117143 118033 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257018.1 protein_id gnl|my_center|LOCUS_35650 119282 118137 gene locus_tag LOCUS_35660 119282 118137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 119977 119279 gene locus_tag LOCUS_35670 119977 119279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 119964 120371 gene locus_tag LOCUS_35680 119964 120371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 121235 120444 gene locus_tag LOCUS_35690 121235 120444 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_35690 122617 121334 gene locus_tag LOCUS_35700 122617 121334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 122698 124230 gene locus_tag LOCUS_35710 122698 124230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 125769 124966 gene locus_tag LOCUS_35720 125769 124966 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_35720 130601 126303 gene locus_tag LOCUS_35730 130601 126303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 132249 130672 gene locus_tag LOCUS_35740 132249 130672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 132396 133679 gene locus_tag LOCUS_35750 132396 133679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 134646 133738 gene locus_tag LOCUS_35760 134646 133738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35760 136694 135045 gene locus_tag LOCUS_35770 136694 135045 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_35770 136843 137520 gene locus_tag LOCUS_35780 136843 137520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35780 137493 137717 gene locus_tag LOCUS_35790 137493 137717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 137698 138633 gene locus_tag LOCUS_35800 137698 138633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 139122 138670 gene locus_tag LOCUS_35810 139122 138670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 140664 139234 gene locus_tag LOCUS_35820 140664 139234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 142629 140767 gene locus_tag LOCUS_35830 142629 140767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 143193 142663 gene locus_tag LOCUS_35840 143193 142663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35840 143606 143139 gene locus_tag LOCUS_35850 143606 143139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35850 144971 143646 gene locus_tag LOCUS_35860 144971 143646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 148974 144988 gene locus_tag LOCUS_35870 148974 144988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 149124 151343 gene locus_tag LOCUS_35880 149124 151343 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_35880 151352 151837 gene locus_tag LOCUS_35890 151352 151837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 151921 153393 gene locus_tag LOCUS_35900 151921 153393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 153479 154345 gene locus_tag LOCUS_35910 153479 154345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 157317 154456 gene locus_tag LOCUS_35920 157317 154456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 157584 157919 gene locus_tag LOCUS_35930 157584 157919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 158125 159240 gene locus_tag LOCUS_35940 158125 159240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 160865 159633 gene locus_tag LOCUS_35950 160865 159633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_35950 160939 161397 gene locus_tag LOCUS_35960 160939 161397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35960 161404 162081 gene locus_tag LOCUS_35970 161404 162081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35970 162291 163766 gene locus_tag LOCUS_35980 162291 163766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 163772 165223 gene locus_tag LOCUS_35990 163772 165223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 165726 165235 gene locus_tag LOCUS_36000 165726 165235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 166066 166536 gene locus_tag LOCUS_36010 166066 166536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 167525 166551 gene locus_tag LOCUS_36020 167525 166551 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083359.1 protein_id gnl|my_center|LOCUS_36020 168034 169314 gene locus_tag LOCUS_36030 168034 169314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 169367 170035 gene locus_tag LOCUS_36040 169367 170035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 170312 171310 gene locus_tag LOCUS_36050 170312 171310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 172327 171314 gene locus_tag LOCUS_36060 172327 171314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 172387 173568 gene locus_tag LOCUS_36070 172387 173568 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651731.1 protein_id gnl|my_center|LOCUS_36070 174406 173603 gene locus_tag LOCUS_36080 174406 173603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 175482 174472 gene locus_tag LOCUS_36090 175482 174472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 176389 175517 gene locus_tag LOCUS_36100 176389 175517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 178408 176600 gene locus_tag LOCUS_36110 178408 176600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 178826 179713 gene locus_tag LOCUS_36120 178826 179713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 179662 180129 gene locus_tag LOCUS_36130 179662 180129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 180608 180192 gene locus_tag LOCUS_36140 180608 180192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 181366 180941 gene locus_tag LOCUS_36150 181366 180941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 183122 181557 gene locus_tag LOCUS_36160 183122 181557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 183230 184987 gene locus_tag LOCUS_36170 183230 184987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 186327 185032 gene locus_tag LOCUS_36180 186327 185032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 186422 188413 gene locus_tag LOCUS_36190 186422 188413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 188573 189586 gene locus_tag LOCUS_36200 188573 189586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 190331 189576 gene locus_tag LOCUS_36210 190331 189576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 191930 190353 gene locus_tag LOCUS_36220 191930 190353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 192766 193887 gene locus_tag LOCUS_36230 192766 193887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 193884 194426 gene locus_tag LOCUS_36240 193884 194426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 194521 195114 gene locus_tag LOCUS_36250 194521 195114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 195188 195433 gene locus_tag LOCUS_36260 195188 195433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 195970 197952 gene locus_tag LOCUS_36270 195970 197952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 197963 198574 gene locus_tag LOCUS_36280 197963 198574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36280 198571 199821 gene locus_tag LOCUS_36290 198571 199821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 200193 199822 gene locus_tag LOCUS_36300 200193 199822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 200396 201388 gene locus_tag LOCUS_36310 200396 201388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 201918 201514 gene locus_tag LOCUS_36320 201918 201514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 202629 201958 gene locus_tag LOCUS_36330 202629 201958 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504113.1 protein_id gnl|my_center|LOCUS_36330 202753 203772 gene locus_tag LOCUS_36340 202753 203772 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929150.1 protein_id gnl|my_center|LOCUS_36340 203895 205091 gene locus_tag LOCUS_36350 203895 205091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 205149 206336 gene locus_tag LOCUS_36360 205149 206336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 206993 206349 gene locus_tag LOCUS_36370 206993 206349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 208132 207338 gene locus_tag LOCUS_36380 208132 207338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 208260 209348 gene locus_tag LOCUS_36390 208260 209348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 210801 209371 gene locus_tag LOCUS_36400 210801 209371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 210801 211946 gene locus_tag LOCUS_36410 210801 211946 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_36410 212088 212363 gene locus_tag LOCUS_36420 212088 212363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 215124 212350 gene locus_tag LOCUS_36430 215124 212350 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_36430 215242 218049 gene locus_tag LOCUS_36440 215242 218049 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263450.1 protein_id gnl|my_center|LOCUS_36440 218520 219068 gene locus_tag LOCUS_36450 218520 219068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 219947 220123 gene locus_tag LOCUS_36460 219947 220123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 222253 221024 gene locus_tag LOCUS_36470 222253 221024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730816.1 protein_id gnl|my_center|LOCUS_36470 222279 224057 gene locus_tag LOCUS_36480 222279 224057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 224974 224432 gene locus_tag LOCUS_36490 224974 224432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 225330 225010 gene locus_tag LOCUS_36500 225330 225010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 226359 225394 gene locus_tag LOCUS_36510 226359 225394 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_36510 226502 227137 gene locus_tag LOCUS_36520 226502 227137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 228095 227160 gene locus_tag LOCUS_36530 228095 227160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 228979 228101 gene locus_tag LOCUS_36540 228979 228101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 229154 230503 gene locus_tag LOCUS_36550 229154 230503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 protein_id gnl|my_center|LOCUS_36550 230731 230507 gene locus_tag LOCUS_36560 230731 230507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 230825 231883 gene locus_tag LOCUS_36570 230825 231883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 232023 233231 gene locus_tag LOCUS_36580 232023 233231 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_36580 237347 233238 gene locus_tag LOCUS_36590 237347 233238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36590 246157 237344 gene locus_tag LOCUS_36600 246157 237344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 246624 247835 gene locus_tag LOCUS_36610 246624 247835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 247832 249247 gene locus_tag LOCUS_36620 247832 249247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_36620 250630 249257 gene locus_tag LOCUS_36630 250630 249257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172671.1 protein_id gnl|my_center|LOCUS_36630 250768 251730 gene locus_tag LOCUS_36640 250768 251730 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057094.1 protein_id gnl|my_center|LOCUS_36640 251727 253412 gene locus_tag LOCUS_36650 251727 253412 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_36650 253469 255088 gene locus_tag LOCUS_36660 253469 255088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 255527 255216 gene locus_tag LOCUS_36670 255527 255216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 255412 257757 gene locus_tag LOCUS_36680 255412 257757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 257918 258337 gene locus_tag LOCUS_36690 257918 258337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 261240 258334 gene locus_tag LOCUS_36700 261240 258334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 262275 261475 gene locus_tag LOCUS_36710 262275 261475 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816315.1 protein_id gnl|my_center|LOCUS_36710 262975 262376 gene locus_tag LOCUS_36720 262975 262376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36720 263463 262972 gene locus_tag LOCUS_36730 263463 262972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36730 263357 263713 gene locus_tag LOCUS_36740 263357 263713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 263740 264129 gene locus_tag LOCUS_36750 263740 264129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 265638 264196 gene locus_tag LOCUS_36760 265638 264196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 267931 265781 gene locus_tag LOCUS_36770 267931 265781 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_36770 268108 268434 gene locus_tag LOCUS_36780 268108 268434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 268365 269042 gene locus_tag LOCUS_36790 268365 269042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 269189 270085 gene locus_tag LOCUS_36800 269189 270085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 270756 270097 gene locus_tag LOCUS_36810 270756 270097 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_36810 270861 271307 gene locus_tag LOCUS_36820 270861 271307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 273094 271331 gene locus_tag LOCUS_36830 273094 271331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 273549 273298 gene locus_tag LOCUS_36840 273549 273298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 273814 274113 gene locus_tag LOCUS_36850 273814 274113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 274481 275578 gene locus_tag LOCUS_36860 274481 275578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 276382 275630 gene locus_tag LOCUS_36870 276382 275630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 277076 276459 gene locus_tag LOCUS_36880 277076 276459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 277228 278094 gene locus_tag LOCUS_36890 277228 278094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 279282 279106 gene locus_tag LOCUS_36900 279282 279106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 280582 279323 gene locus_tag LOCUS_36910 280582 279323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 281837 281364 gene locus_tag LOCUS_36920 281837 281364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 281727 281936 gene locus_tag LOCUS_36930 281727 281936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 282067 282642 gene locus_tag LOCUS_36940 282067 282642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 283011 283799 gene locus_tag LOCUS_36950 283011 283799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 284708 284469 gene locus_tag LOCUS_36960 284708 284469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 284641 284964 gene locus_tag LOCUS_36970 284641 284964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 284964 286001 gene locus_tag LOCUS_36980 284964 286001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 286003 286887 gene locus_tag LOCUS_36990 286003 286887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 286884 287444 gene locus_tag LOCUS_37000 286884 287444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 287441 287992 gene locus_tag LOCUS_37010 287441 287992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 288036 289115 gene locus_tag LOCUS_37020 288036 289115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 289141 289560 gene locus_tag LOCUS_37030 289141 289560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 289587 290072 gene locus_tag LOCUS_37040 289587 290072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 290087 291616 gene locus_tag LOCUS_37050 290087 291616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 291613 293028 gene locus_tag LOCUS_37060 291613 293028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 293025 293600 gene locus_tag LOCUS_37070 293025 293600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 293867 295231 gene locus_tag LOCUS_37080 293867 295231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 295868 295353 gene locus_tag LOCUS_37090 295868 295353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 296338 296553 gene locus_tag LOCUS_37100 296338 296553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 297838 298128 gene locus_tag LOCUS_37110 297838 298128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 298125 298502 gene locus_tag LOCUS_37120 gene tnpB 298125 298502 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_37120 298518 300101 gene locus_tag LOCUS_37130 298518 300101 CDS product IS66-like element ISSfl3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004967149.1 protein_id gnl|my_center|LOCUS_37130 300352 300059 gene locus_tag LOCUS_37140 300352 300059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 303085 300605 gene locus_tag LOCUS_37150 303085 300605 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136932681.1 protein_id gnl|my_center|LOCUS_37150 303783 303184 gene locus_tag LOCUS_37160 303783 303184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 305504 303876 gene locus_tag LOCUS_37170 305504 303876 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 protein_id gnl|my_center|LOCUS_37170 305534 307201 gene locus_tag LOCUS_37180 305534 307201 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407380.1 protein_id gnl|my_center|LOCUS_37180 307414 307244 gene locus_tag LOCUS_37190 307414 307244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 309281 308004 gene locus_tag LOCUS_37200 309281 308004 CDS product pectin acetylesterase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878319.1 protein_id gnl|my_center|LOCUS_37200 310751 309360 gene locus_tag LOCUS_37210 310751 309360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 311086 312549 gene locus_tag LOCUS_37220 311086 312549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 312528 312986 gene locus_tag LOCUS_37230 312528 312986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 313398 313012 gene locus_tag LOCUS_37240 313398 313012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 314758 313421 gene locus_tag LOCUS_37250 314758 313421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 315051 314737 gene locus_tag LOCUS_37260 315051 314737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 315043 316518 gene locus_tag LOCUS_37270 315043 316518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 316515 317348 gene locus_tag LOCUS_37280 316515 317348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 317611 318729 gene locus_tag LOCUS_37290 317611 318729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 318618 320804 gene locus_tag LOCUS_37300 318618 320804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 321977 320916 gene locus_tag LOCUS_37310 321977 320916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 322022 322411 gene locus_tag LOCUS_37320 322022 322411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 322528 323676 gene locus_tag LOCUS_37330 322528 323676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 324898 325776 gene locus_tag LOCUS_37340 324898 325776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 325719 326306 gene locus_tag LOCUS_37350 325719 326306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 326353 327444 gene locus_tag LOCUS_37360 326353 327444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 327381 328469 gene locus_tag LOCUS_37370 327381 328469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 328905 329963 gene locus_tag LOCUS_37380 328905 329963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 330211 332343 gene locus_tag LOCUS_37390 330211 332343 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_37390 332327 336763 gene locus_tag LOCUS_37400 332327 336763 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258729.1 protein_id gnl|my_center|LOCUS_37400 336843 338507 gene locus_tag LOCUS_37410 336843 338507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 338754 339371 gene locus_tag LOCUS_37420 338754 339371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 339272 340120 gene locus_tag LOCUS_37430 339272 340120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 340174 343653 gene locus_tag LOCUS_37440 340174 343653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 344424 343663 gene locus_tag LOCUS_37450 344424 343663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 344980 344444 gene locus_tag LOCUS_37460 344980 344444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 347186 347935 gene locus_tag LOCUS_37470 347186 347935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 348406 348804 gene locus_tag LOCUS_37480 348406 348804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 348998 350095 gene locus_tag LOCUS_37490 348998 350095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 350121 351026 gene locus_tag LOCUS_37500 350121 351026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 352751 351135 gene locus_tag LOCUS_37510 352751 351135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 357402 352918 gene locus_tag LOCUS_37520 357402 352918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 358287 357490 gene locus_tag LOCUS_37530 358287 357490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 358452 359102 gene locus_tag LOCUS_37540 358452 359102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 362456 359679 gene locus_tag LOCUS_37550 362456 359679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 363033 364106 gene locus_tag LOCUS_37560 363033 364106 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 protein_id gnl|my_center|LOCUS_37560 364492 364145 gene locus_tag LOCUS_37570 364492 364145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 364723 365784 gene locus_tag LOCUS_37580 364723 365784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 365865 366539 gene locus_tag LOCUS_37590 365865 366539 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_37590 366697 368013 gene locus_tag LOCUS_37600 366697 368013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 369392 368133 gene locus_tag LOCUS_37610 369392 368133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 370442 369426 gene locus_tag LOCUS_37620 370442 369426 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521899.1 protein_id gnl|my_center|LOCUS_37620 371492 370500 gene locus_tag LOCUS_37630 371492 370500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 371607 373484 gene locus_tag LOCUS_37640 371607 373484 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615668.1 protein_id gnl|my_center|LOCUS_37640 373488 373925 gene locus_tag LOCUS_37650 373488 373925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 374795 373953 gene locus_tag LOCUS_37660 374795 373953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 375561 374806 gene locus_tag LOCUS_37670 375561 374806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 378888 375772 gene locus_tag LOCUS_37680 378888 375772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 380951 379107 gene locus_tag LOCUS_37690 380951 379107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 381087 381890 gene locus_tag LOCUS_37700 381087 381890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 384014 382080 gene locus_tag LOCUS_37710 384014 382080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37710 386991 384220 gene locus_tag LOCUS_37720 386991 384220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37720 <387791 387134 gene locus_tag LOCUS_37730 <387791 387134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:YDG domain-containing protein >Feature sequence08 324 524 gene locus_tag LOCUS_37740 324 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 1138 506 gene locus_tag LOCUS_37750 1138 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 1300 1920 gene locus_tag LOCUS_37760 1300 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37760 2257 2616 gene locus_tag LOCUS_37770 2257 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 2849 3289 gene locus_tag LOCUS_37780 2849 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 4223 3456 gene locus_tag LOCUS_37790 4223 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 6006 4954 gene locus_tag LOCUS_37800 6006 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 6068 6676 gene locus_tag LOCUS_37810 6068 6676 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_37810 7201 7320 gene locus_tag LOCUS_37820 7201 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 7396 8256 gene locus_tag LOCUS_37830 gene lgt 7396 8256 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_37830 8683 10821 gene locus_tag LOCUS_37840 8683 10821 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_37840 10848 12626 gene locus_tag LOCUS_37850 10848 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 12599 14731 gene locus_tag LOCUS_37860 12599 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37860 16679 14958 gene locus_tag LOCUS_37870 16679 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 18666 16798 gene locus_tag LOCUS_37880 18666 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 19148 18732 gene locus_tag LOCUS_37890 19148 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 19800 25424 gene locus_tag LOCUS_37900 19800 25424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 26936 25824 gene locus_tag LOCUS_37910 26936 25824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 28539 27208 gene locus_tag LOCUS_37920 28539 27208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 28884 30083 gene locus_tag LOCUS_37930 28884 30083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 30049 30444 gene locus_tag LOCUS_37940 30049 30444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 31145 30501 gene locus_tag LOCUS_37950 31145 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 32156 32644 gene locus_tag LOCUS_37960 32156 32644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 32739 33359 gene locus_tag LOCUS_37970 32739 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 33619 33356 gene locus_tag LOCUS_37980 33619 33356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 35038 34442 gene locus_tag LOCUS_37990 35038 34442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 37154 35022 gene locus_tag LOCUS_38000 37154 35022 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258728.1 protein_id gnl|my_center|LOCUS_38000 38228 37167 gene locus_tag LOCUS_38010 38228 37167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 39237 38671 gene locus_tag LOCUS_38020 39237 38671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 43329 39259 gene locus_tag LOCUS_38030 43329 39259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 43969 43430 gene locus_tag LOCUS_38040 43969 43430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 44450 43977 gene locus_tag LOCUS_38050 44450 43977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 44848 44465 gene locus_tag LOCUS_38060 44848 44465 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_38060 46448 44877 gene locus_tag LOCUS_38070 46448 44877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 46892 50194 gene locus_tag LOCUS_38080 46892 50194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 50191 51705 gene locus_tag LOCUS_38090 50191 51705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 51702 52280 gene locus_tag LOCUS_38100 51702 52280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 53611 52346 gene locus_tag LOCUS_38110 53611 52346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 53826 55331 gene locus_tag LOCUS_38120 53826 55331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 57951 55351 gene locus_tag LOCUS_38130 57951 55351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 58554 58108 gene locus_tag LOCUS_38140 58554 58108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 59789 58626 gene locus_tag LOCUS_38150 59789 58626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 59842 60177 gene locus_tag LOCUS_38160 59842 60177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 60237 61358 gene locus_tag LOCUS_38170 60237 61358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 61355 62572 gene locus_tag LOCUS_38180 61355 62572 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684174.1 protein_id gnl|my_center|LOCUS_38180 64118 62574 gene locus_tag LOCUS_38190 64118 62574 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 protein_id gnl|my_center|LOCUS_38190 64732 64142 gene locus_tag LOCUS_38200 64732 64142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 65466 64795 gene locus_tag LOCUS_38210 65466 64795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 65504 65965 gene locus_tag LOCUS_38220 65504 65965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 66019 67209 gene locus_tag LOCUS_38230 66019 67209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 67367 70174 gene locus_tag LOCUS_38240 67367 70174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 70179 71243 gene locus_tag LOCUS_38250 70179 71243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 71325 72302 gene locus_tag LOCUS_38260 71325 72302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 72390 73838 gene locus_tag LOCUS_38270 72390 73838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 74847 73891 gene locus_tag LOCUS_38280 74847 73891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 75024 75542 gene locus_tag LOCUS_38290 75024 75542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 76272 75553 gene locus_tag LOCUS_38300 76272 75553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 76438 77475 gene locus_tag LOCUS_38310 76438 77475 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_38310 78208 77501 gene locus_tag LOCUS_38320 78208 77501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 78099 79682 gene locus_tag LOCUS_38330 78099 79682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 80826 79690 gene locus_tag LOCUS_38340 80826 79690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 80963 81919 gene locus_tag LOCUS_38350 80963 81919 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_38350 81959 82462 gene locus_tag LOCUS_38360 81959 82462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 82899 82474 gene locus_tag LOCUS_38370 82899 82474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 82862 83275 gene locus_tag LOCUS_38380 82862 83275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 84233 83241 gene locus_tag LOCUS_38390 84233 83241 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_38390 85918 84413 gene locus_tag LOCUS_38400 85918 84413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 85982 86626 gene locus_tag LOCUS_38410 85982 86626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 88234 86669 gene locus_tag LOCUS_38420 88234 86669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 90360 88306 gene locus_tag LOCUS_38430 90360 88306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 90588 91367 gene locus_tag LOCUS_38440 90588 91367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 93040 92183 gene locus_tag LOCUS_38450 93040 92183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 94602 93052 gene locus_tag LOCUS_38460 94602 93052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 96410 94605 gene locus_tag LOCUS_38470 96410 94605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 96634 97236 gene locus_tag LOCUS_38480 96634 97236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 98042 97269 gene locus_tag LOCUS_38490 98042 97269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 98190 98522 gene locus_tag LOCUS_38500 98190 98522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 98561 99622 gene locus_tag LOCUS_38510 98561 99622 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226829.1 protein_id gnl|my_center|LOCUS_38510 99612 101408 gene locus_tag LOCUS_38520 99612 101408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226828.1 protein_id gnl|my_center|LOCUS_38520 101469 102461 gene locus_tag LOCUS_38530 101469 102461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 103325 102471 gene locus_tag LOCUS_38540 103325 102471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 104375 103335 gene locus_tag LOCUS_38550 104375 103335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 105594 104407 gene locus_tag LOCUS_38560 105594 104407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 105650 106153 gene locus_tag LOCUS_38570 105650 106153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 106297 107796 gene locus_tag LOCUS_38580 106297 107796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 107861 108961 gene locus_tag LOCUS_38590 107861 108961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 109538 109185 gene locus_tag LOCUS_38600 109538 109185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 110094 109660 gene locus_tag LOCUS_38610 gene arfB 110094 109660 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_38610 114003 110140 gene locus_tag LOCUS_38620 114003 110140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 114063 114680 gene locus_tag LOCUS_38630 114063 114680 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_38630 114829 115422 gene locus_tag LOCUS_38640 114829 115422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 117709 115532 gene locus_tag LOCUS_38650 117709 115532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 118674 117706 gene locus_tag LOCUS_38660 118674 117706 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_38660 119699 118671 gene locus_tag LOCUS_38670 gene miaA 119699 118671 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 protein_id gnl|my_center|LOCUS_38670 122307 119737 gene locus_tag LOCUS_38680 122307 119737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 122329 122619 gene locus_tag LOCUS_38690 122329 122619 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_38690 123552 122665 gene locus_tag LOCUS_38700 123552 122665 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_38700 123965 125587 gene locus_tag LOCUS_38710 123965 125587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 125709 126941 gene locus_tag LOCUS_38720 125709 126941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 127029 128492 gene locus_tag LOCUS_38730 127029 128492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 129094 128720 gene locus_tag LOCUS_38740 129094 128720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 128985 130013 gene locus_tag LOCUS_38750 128985 130013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 130644 130177 gene locus_tag LOCUS_38760 130644 130177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 131083 130772 gene locus_tag LOCUS_38770 131083 130772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 132116 131112 gene locus_tag LOCUS_38780 132116 131112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 132322 133422 gene locus_tag LOCUS_38790 132322 133422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 133480 135429 gene locus_tag LOCUS_38800 133480 135429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 135426 136913 gene locus_tag LOCUS_38810 135426 136913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 136910 138934 gene locus_tag LOCUS_38820 136910 138934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 141398 139026 gene locus_tag LOCUS_38830 141398 139026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 141483 142613 gene locus_tag LOCUS_38840 141483 142613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 143164 142694 gene locus_tag LOCUS_38850 143164 142694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 143328 144182 gene locus_tag LOCUS_38860 143328 144182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 144257 145450 gene locus_tag LOCUS_38870 144257 145450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 145455 148730 gene locus_tag LOCUS_38880 gene carB 145455 148730 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_38880 148754 149245 gene locus_tag LOCUS_38890 gene greA 148754 149245 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225115.1 protein_id gnl|my_center|LOCUS_38890 149242 149868 gene locus_tag LOCUS_38900 149242 149868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 149881 150339 gene locus_tag LOCUS_38910 149881 150339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 152368 150404 gene locus_tag LOCUS_38920 152368 150404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 153376 152402 gene locus_tag LOCUS_38930 153376 152402 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383456.1 protein_id gnl|my_center|LOCUS_38930 154204 153440 gene locus_tag LOCUS_38940 154204 153440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 155176 154208 gene locus_tag LOCUS_38950 155176 154208 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818344.1 protein_id gnl|my_center|LOCUS_38950 155339 156223 gene locus_tag LOCUS_38960 155339 156223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 158200 156296 gene locus_tag LOCUS_38970 158200 156296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 159247 158420 gene locus_tag LOCUS_38980 159247 158420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 159382 160167 gene locus_tag LOCUS_38990 159382 160167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 161208 160168 gene locus_tag LOCUS_39000 161208 160168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 protein_id gnl|my_center|LOCUS_39000 161285 162145 gene locus_tag LOCUS_39010 161285 162145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 162223 162786 gene locus_tag LOCUS_39020 gene rpoE 162223 162786 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_39020 162783 163472 gene locus_tag LOCUS_39030 162783 163472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 166064 163479 gene locus_tag LOCUS_39040 166064 163479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 167015 166212 gene locus_tag LOCUS_39050 167015 166212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 167162 168895 gene locus_tag LOCUS_39060 167162 168895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 168892 169611 gene locus_tag LOCUS_39070 168892 169611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 169751 170809 gene locus_tag LOCUS_39080 169751 170809 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957836.1 protein_id gnl|my_center|LOCUS_39080 170816 172453 gene locus_tag LOCUS_39090 gene asnB 170816 172453 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_39090 172602 172961 gene locus_tag LOCUS_39100 172602 172961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 173103 173858 gene locus_tag LOCUS_39110 173103 173858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 173958 174752 gene locus_tag LOCUS_39120 173958 174752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 174869 176335 gene locus_tag LOCUS_39130 174869 176335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 177754 176357 gene locus_tag LOCUS_39140 177754 176357 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_39140 178425 177751 gene locus_tag LOCUS_39150 178425 177751 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_39150 179027 178446 gene locus_tag LOCUS_39160 179027 178446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 179158 179469 gene locus_tag LOCUS_39170 179158 179469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 179605 180306 gene locus_tag LOCUS_39180 179605 180306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 180780 180322 gene locus_tag LOCUS_39190 180780 180322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 181524 180805 gene locus_tag LOCUS_39200 181524 180805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 181656 183323 gene locus_tag LOCUS_39210 181656 183323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 183333 184646 gene locus_tag LOCUS_39220 183333 184646 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080704.1 protein_id gnl|my_center|LOCUS_39220 184919 185902 gene locus_tag LOCUS_39230 184919 185902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 185950 186774 gene locus_tag LOCUS_39240 185950 186774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 188050 186782 gene locus_tag LOCUS_39250 188050 186782 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_39250 189515 188103 gene locus_tag LOCUS_39260 189515 188103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 190669 189434 gene locus_tag LOCUS_39270 190669 189434 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_39270 191318 192340 gene locus_tag LOCUS_39280 191318 192340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 192957 192325 gene locus_tag LOCUS_39290 192957 192325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 193603 193058 gene locus_tag LOCUS_39300 193603 193058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 195217 193907 gene locus_tag LOCUS_39310 195217 193907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 195475 196263 gene locus_tag LOCUS_39320 195475 196263 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_39320 197706 196279 gene locus_tag LOCUS_39330 197706 196279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 199340 197829 gene locus_tag LOCUS_39340 199340 197829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 200104 199370 gene locus_tag LOCUS_39350 200104 199370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 201317 200220 gene locus_tag LOCUS_39360 201317 200220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 204526 201314 gene locus_tag LOCUS_39370 204526 201314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 205072 204572 gene locus_tag LOCUS_39380 205072 204572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 206221 205130 gene locus_tag LOCUS_39390 206221 205130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 206390 207013 gene locus_tag LOCUS_39400 206390 207013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 207076 207822 gene locus_tag LOCUS_39410 207076 207822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 207848 208714 gene locus_tag LOCUS_39420 207848 208714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 208884 210575 gene locus_tag LOCUS_39430 208884 210575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 210764 213637 gene locus_tag LOCUS_39440 210764 213637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 213875 214492 gene locus_tag LOCUS_39450 213875 214492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 214653 214489 gene locus_tag LOCUS_39460 214653 214489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 217073 214689 gene locus_tag LOCUS_39470 217073 214689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 218188 217070 gene locus_tag LOCUS_39480 218188 217070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 218262 219326 gene locus_tag LOCUS_39490 218262 219326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 219963 219355 gene locus_tag LOCUS_39500 219963 219355 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391497.1 protein_id gnl|my_center|LOCUS_39500 221159 219957 gene locus_tag LOCUS_39510 221159 219957 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942570.1 protein_id gnl|my_center|LOCUS_39510 222822 221308 gene locus_tag LOCUS_39520 222822 221308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 223192 224712 gene locus_tag LOCUS_39530 223192 224712 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_39530 224712 225098 gene locus_tag LOCUS_39540 224712 225098 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_39540 226132 225095 gene locus_tag LOCUS_39550 226132 225095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 226329 226129 gene locus_tag LOCUS_39560 226329 226129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39560 227549 226263 gene locus_tag LOCUS_39570 227549 226263 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39570 228913 227615 gene locus_tag LOCUS_39580 gene guaD 228913 227615 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142418.1 protein_id gnl|my_center|LOCUS_39580 230864 228930 gene locus_tag LOCUS_39590 230864 228930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 230863 231834 gene locus_tag LOCUS_39600 230863 231834 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922054.1 protein_id gnl|my_center|LOCUS_39600 231979 232572 gene locus_tag LOCUS_39610 231979 232572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 235237 232589 gene locus_tag LOCUS_39620 235237 232589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 236024 235458 gene locus_tag LOCUS_39630 236024 235458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 237308 236076 gene locus_tag LOCUS_39640 237308 236076 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_39640 237458 238678 gene locus_tag LOCUS_39650 237458 238678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 240038 238701 gene locus_tag LOCUS_39660 240038 238701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 241649 240474 gene locus_tag LOCUS_39670 241649 240474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 241750 242301 gene locus_tag LOCUS_39680 241750 242301 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942734.1 protein_id gnl|my_center|LOCUS_39680 243933 242452 gene locus_tag LOCUS_39690 243933 242452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 244044 244685 gene locus_tag LOCUS_39700 244044 244685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 244847 245725 gene locus_tag LOCUS_39710 244847 245725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 245963 245730 gene locus_tag LOCUS_39720 245963 245730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 246691 246035 gene locus_tag LOCUS_39730 246691 246035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 246892 248082 gene locus_tag LOCUS_39740 246892 248082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 248387 249901 gene locus_tag LOCUS_39750 248387 249901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 249915 250124 gene locus_tag LOCUS_39760 249915 250124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 251119 250142 gene locus_tag LOCUS_39770 251119 250142 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_39770 252374 251157 gene locus_tag LOCUS_39780 252374 251157 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_39780 252944 252480 gene locus_tag LOCUS_39790 252944 252480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 254524 253022 gene locus_tag LOCUS_39800 254524 253022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 256599 258017 gene locus_tag LOCUS_39810 256599 258017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 258522 258821 gene locus_tag LOCUS_39820 258522 258821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 259515 258862 gene locus_tag LOCUS_39830 259515 258862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 261191 259623 gene locus_tag LOCUS_39840 261191 259623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 261342 261620 gene locus_tag LOCUS_39850 261342 261620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 261799 262989 gene locus_tag LOCUS_39860 261799 262989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 263001 264869 gene locus_tag LOCUS_39870 263001 264869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 264876 265694 gene locus_tag LOCUS_39880 264876 265694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 266557 265754 gene locus_tag LOCUS_39890 266557 265754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 267269 266583 gene locus_tag LOCUS_39900 267269 266583 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_39900 267374 272005 gene locus_tag LOCUS_39910 267374 272005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 267464 267386 gene locus_tag LOCUS_t00500 267464 267386 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 272075 272884 gene locus_tag LOCUS_39920 272075 272884 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_39920 273781 272888 gene locus_tag LOCUS_39930 273781 272888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 275296 273875 gene locus_tag LOCUS_39940 275296 273875 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_39940 275418 275651 gene locus_tag LOCUS_39950 275418 275651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 275725 277185 gene locus_tag LOCUS_39960 275725 277185 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028356.1 protein_id gnl|my_center|LOCUS_39960 278065 277202 gene locus_tag LOCUS_39970 278065 277202 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_39970 278223 278141 gene locus_tag LOCUS_t00510 278223 278141 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 279742 278276 gene locus_tag LOCUS_39980 gene pyk 279742 278276 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_39980 279813 280775 gene locus_tag LOCUS_39990 279813 280775 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_39990 280791 281111 gene locus_tag LOCUS_40000 gene sugE 280791 281111 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_40000 281208 281924 gene locus_tag LOCUS_40010 281208 281924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 281968 283248 gene locus_tag LOCUS_40020 281968 283248 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_40020 283299 283805 gene locus_tag LOCUS_40030 283299 283805 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074119.1 protein_id gnl|my_center|LOCUS_40030 283830 284810 gene locus_tag LOCUS_40040 gene corA 283830 284810 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_40040 285734 284850 gene locus_tag LOCUS_40050 285734 284850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 286276 287538 gene locus_tag LOCUS_40060 gene glgC 286276 287538 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313778.1 protein_id gnl|my_center|LOCUS_40060 287615 288538 gene locus_tag LOCUS_40070 287615 288538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40070 288535 289068 gene locus_tag LOCUS_40080 288535 289068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40080 289533 289087 gene locus_tag LOCUS_40090 289533 289087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 290853 289603 gene locus_tag LOCUS_40100 290853 289603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 291419 290850 gene locus_tag LOCUS_40110 291419 290850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 292199 291612 gene locus_tag LOCUS_40120 292199 291612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 293888 292251 gene locus_tag LOCUS_40130 293888 292251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 294385 293885 gene locus_tag LOCUS_40140 294385 293885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 294669 295583 gene locus_tag LOCUS_40150 294669 295583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 297636 295561 gene locus_tag LOCUS_40160 297636 295561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 298522 297653 gene locus_tag LOCUS_40170 298522 297653 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_40170 298721 301033 gene locus_tag LOCUS_40180 298721 301033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 301018 301797 gene locus_tag LOCUS_40190 301018 301797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 301801 303510 gene locus_tag LOCUS_40200 301801 303510 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_40200 303507 303782 gene locus_tag LOCUS_40210 303507 303782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 304203 303859 gene locus_tag LOCUS_40220 304203 303859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 304088 305755 gene locus_tag LOCUS_40230 304088 305755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 305939 308350 gene locus_tag LOCUS_40240 305939 308350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 309544 308423 gene locus_tag LOCUS_40250 309544 308423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 311151 310183 gene locus_tag LOCUS_40260 311151 310183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 311419 313509 gene locus_tag LOCUS_40270 311419 313509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 313500 314222 gene locus_tag LOCUS_40280 313500 314222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 314246 316198 gene locus_tag LOCUS_40290 314246 316198 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408749.1 protein_id gnl|my_center|LOCUS_40290 317947 316256 gene locus_tag LOCUS_40300 317947 316256 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_40300 318797 318009 gene locus_tag LOCUS_40310 318797 318009 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_40310 320033 318933 gene locus_tag LOCUS_40320 320033 318933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 320323 321264 gene locus_tag LOCUS_40330 320323 321264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 321321 322043 gene locus_tag LOCUS_40340 321321 322043 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_40340 322123 323127 gene locus_tag LOCUS_40350 322123 323127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 323197 325368 gene locus_tag LOCUS_40360 323197 325368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 327005 325419 gene locus_tag LOCUS_40370 327005 325419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 326902 327255 gene locus_tag LOCUS_40380 326902 327255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 327388 328122 gene locus_tag LOCUS_40390 327388 328122 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522249.1 protein_id gnl|my_center|LOCUS_40390 328719 328591 gene locus_tag LOCUS_40400 328719 328591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 329082 328882 gene locus_tag LOCUS_40410 329082 328882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 329325 329101 gene locus_tag LOCUS_40420 329325 329101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 >Feature sequence09 1036 101 gene locus_tag LOCUS_40430 1036 101 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190190.1 protein_id gnl|my_center|LOCUS_40430 2623 1136 gene locus_tag LOCUS_40440 2623 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 3301 2756 gene locus_tag LOCUS_40450 3301 2756 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_40450 3368 6292 gene locus_tag LOCUS_40460 3368 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 7531 6308 gene locus_tag LOCUS_40470 7531 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 8404 7541 gene locus_tag LOCUS_40480 8404 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 8508 10520 gene locus_tag LOCUS_40490 8508 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 10672 11970 gene locus_tag LOCUS_40500 10672 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 11970 13361 gene locus_tag LOCUS_40510 11970 13361 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_40510 13480 15108 gene locus_tag LOCUS_40520 13480 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 15108 15905 gene locus_tag LOCUS_40530 15108 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 15943 16374 gene locus_tag LOCUS_40540 15943 16374 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_40540 16393 19284 gene locus_tag LOCUS_40550 16393 19284 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_40550 20164 19316 gene locus_tag LOCUS_40560 20164 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 20745 20912 gene locus_tag LOCUS_40570 20745 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 20925 21992 gene locus_tag LOCUS_40580 20925 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 22554 22021 gene locus_tag LOCUS_40590 22554 22021 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 protein_id gnl|my_center|LOCUS_40590 24647 22626 gene locus_tag LOCUS_40600 24647 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 25585 24653 gene locus_tag LOCUS_40610 25585 24653 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_40610 25688 26167 gene locus_tag LOCUS_40620 25688 26167 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_40620 26248 26523 gene locus_tag LOCUS_40630 26248 26523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 27681 26545 gene locus_tag LOCUS_40640 27681 26545 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_40640 27828 28805 gene locus_tag LOCUS_40650 27828 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 29308 29054 gene locus_tag LOCUS_40660 29308 29054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 29196 30077 gene locus_tag LOCUS_40670 29196 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 33198 30118 gene locus_tag LOCUS_40680 33198 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 37130 33210 gene locus_tag LOCUS_40690 37130 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40690 37382 37987 gene locus_tag LOCUS_40700 37382 37987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 39218 37974 gene locus_tag LOCUS_40710 39218 37974 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_40710 40270 39242 gene locus_tag LOCUS_40720 40270 39242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 42673 40406 gene locus_tag LOCUS_40730 42673 40406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 43648 42770 gene locus_tag LOCUS_40740 43648 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 44688 43645 gene locus_tag LOCUS_40750 44688 43645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 44839 45978 gene locus_tag LOCUS_40760 44839 45978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 45975 46949 gene locus_tag LOCUS_40770 45975 46949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 47718 46921 gene locus_tag LOCUS_40780 47718 46921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 48378 47854 gene locus_tag LOCUS_40790 48378 47854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 48775 48380 gene locus_tag LOCUS_40800 48775 48380 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_40800 48917 50269 gene locus_tag LOCUS_40810 48917 50269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 50409 50777 gene locus_tag LOCUS_40820 50409 50777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171331.1 protein_id gnl|my_center|LOCUS_40820 51340 50828 gene locus_tag LOCUS_40830 51340 50828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 51988 51350 gene locus_tag LOCUS_40840 51988 51350 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897510.1 protein_id gnl|my_center|LOCUS_40840 53193 52033 gene locus_tag LOCUS_40850 53193 52033 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_40850 55219 53213 gene locus_tag LOCUS_40860 55219 53213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 55774 55229 gene locus_tag LOCUS_40870 55774 55229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 56010 56606 gene locus_tag LOCUS_40880 56010 56606 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_40880 56621 57385 gene locus_tag LOCUS_40890 56621 57385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 57294 57932 gene locus_tag LOCUS_40900 57294 57932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 57929 58192 gene locus_tag LOCUS_40910 57929 58192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 58304 58237 gene locus_tag LOCUS_t00520 58304 58237 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 58417 58327 gene locus_tag LOCUS_t00530 58417 58327 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58532 58442 gene locus_tag LOCUS_t00540 58532 58442 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58676 58584 gene locus_tag LOCUS_t00550 58676 58584 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 59692 58988 gene locus_tag LOCUS_40920 59692 58988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 60192 59689 gene locus_tag LOCUS_40930 60192 59689 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948551.1 protein_id gnl|my_center|LOCUS_40930 60616 60209 gene locus_tag LOCUS_40940 gene queD 60616 60209 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_40940 61242 60616 gene locus_tag LOCUS_40950 gene folE 61242 60616 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141579.1 protein_id gnl|my_center|LOCUS_40950 61743 65072 gene locus_tag LOCUS_40960 61743 65072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 66370 65285 gene locus_tag LOCUS_40970 66370 65285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 67443 66505 gene locus_tag LOCUS_40980 67443 66505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 67339 67587 gene locus_tag LOCUS_40990 67339 67587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 67795 68559 gene locus_tag LOCUS_41000 67795 68559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 70038 69211 gene locus_tag LOCUS_41010 70038 69211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 71052 70357 gene locus_tag LOCUS_41020 71052 70357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 71209 71622 gene locus_tag LOCUS_41030 71209 71622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 71882 72142 gene locus_tag LOCUS_41040 71882 72142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 72999 72184 gene locus_tag LOCUS_41050 72999 72184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 72880 73323 gene locus_tag LOCUS_41060 72880 73323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 73668 73354 gene locus_tag LOCUS_41070 73668 73354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 73995 74312 gene locus_tag LOCUS_41080 73995 74312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 74316 76037 gene locus_tag LOCUS_41090 gene tssF 74316 76037 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941100.1 protein_id gnl|my_center|LOCUS_41090 76013 77026 gene locus_tag LOCUS_41100 76013 77026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 77694 77143 gene locus_tag LOCUS_41110 77694 77143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 80071 78146 gene locus_tag LOCUS_41120 80071 78146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 81539 80115 gene locus_tag LOCUS_41130 81539 80115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 82477 81566 gene locus_tag LOCUS_41140 82477 81566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 83636 82458 gene locus_tag LOCUS_41150 83636 82458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 84647 83655 gene locus_tag LOCUS_41160 84647 83655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41160 85935 84595 gene locus_tag LOCUS_41170 85935 84595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41170 86272 86063 gene locus_tag LOCUS_41180 86272 86063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 86943 86326 gene locus_tag LOCUS_41190 86943 86326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41190 88184 86832 gene locus_tag LOCUS_41200 88184 86832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41200 88821 88453 gene locus_tag LOCUS_41210 88821 88453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 89303 89590 gene locus_tag LOCUS_41220 89303 89590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 89667 90500 gene locus_tag LOCUS_41230 89667 90500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 91865 91638 gene locus_tag LOCUS_41240 91865 91638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 92526 92756 gene locus_tag LOCUS_41250 92526 92756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 92764 93540 gene locus_tag LOCUS_41260 92764 93540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 93545 94918 gene locus_tag LOCUS_41270 gene tssK 93545 94918 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 protein_id gnl|my_center|LOCUS_41270 94920 95633 gene locus_tag LOCUS_41280 94920 95633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 95640 97691 gene locus_tag LOCUS_41290 95640 97691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 97573 98355 gene locus_tag LOCUS_41300 97573 98355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 98394 99182 gene locus_tag LOCUS_41310 98394 99182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41310 99170 100105 gene locus_tag LOCUS_41320 99170 100105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41320 99997 100611 gene locus_tag LOCUS_41330 99997 100611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41330 102185 102937 gene locus_tag LOCUS_41340 102185 102937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41340 103134 103502 gene locus_tag LOCUS_41350 103134 103502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 103523 103966 gene locus_tag LOCUS_41360 103523 103966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 103908 105056 gene locus_tag LOCUS_41370 103908 105056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 105071 106159 gene locus_tag LOCUS_41380 105071 106159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 107705 106188 gene locus_tag LOCUS_41390 107705 106188 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255965.1 protein_id gnl|my_center|LOCUS_41390 109381 107741 gene locus_tag LOCUS_41400 109381 107741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 110403 109384 gene locus_tag LOCUS_41410 110403 109384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 110984 110400 gene locus_tag LOCUS_41420 110984 110400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 112072 110981 gene locus_tag LOCUS_41430 112072 110981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 113720 112086 gene locus_tag LOCUS_41440 113720 112086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 115008 113935 gene locus_tag LOCUS_41450 115008 113935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 116312 115014 gene locus_tag LOCUS_41460 116312 115014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 116872 116309 gene locus_tag LOCUS_41470 116872 116309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 118716 117385 gene locus_tag LOCUS_41480 118716 117385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 120223 118721 gene locus_tag LOCUS_41490 120223 118721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 120917 121264 gene locus_tag LOCUS_41500 120917 121264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 121261 121734 gene locus_tag LOCUS_41510 121261 121734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 121655 122293 gene locus_tag LOCUS_41520 121655 122293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 122290 124887 gene locus_tag LOCUS_41530 122290 124887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 124800 125411 gene locus_tag LOCUS_41540 124800 125411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 126336 125422 gene locus_tag LOCUS_41550 126336 125422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 126585 127067 gene locus_tag LOCUS_41560 126585 127067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 128477 127164 gene locus_tag LOCUS_41570 128477 127164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 129976 128483 gene locus_tag LOCUS_41580 gene tssC 129976 128483 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943793.1 protein_id gnl|my_center|LOCUS_41580 130508 130002 gene locus_tag LOCUS_41590 gene tssB 130508 130002 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943792.1 protein_id gnl|my_center|LOCUS_41590 130720 131214 gene locus_tag LOCUS_41600 130720 131214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 131276 132421 gene locus_tag LOCUS_41610 131276 132421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41610 132418 133341 gene locus_tag LOCUS_41620 132418 133341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41620 133247 133882 gene locus_tag LOCUS_41630 133247 133882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41630 133934 134275 gene locus_tag LOCUS_41640 133934 134275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 134633 134262 gene locus_tag LOCUS_41650 134633 134262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 135915 134737 gene locus_tag LOCUS_41660 135915 134737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 136435 135905 gene locus_tag LOCUS_41670 136435 135905 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977294.1 protein_id gnl|my_center|LOCUS_41670 137431 138843 gene locus_tag LOCUS_41680 137431 138843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 138869 139540 gene locus_tag LOCUS_41690 138869 139540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 139537 140142 gene locus_tag LOCUS_41700 139537 140142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 140120 140290 gene locus_tag LOCUS_41710 140120 140290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 140405 141073 gene locus_tag LOCUS_41720 140405 141073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 141007 141699 gene locus_tag LOCUS_41730 141007 141699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 141696 142370 gene locus_tag LOCUS_41740 141696 142370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 142367 146770 gene locus_tag LOCUS_41750 gene mukB 142367 146770 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572729.1 protein_id gnl|my_center|LOCUS_41750 147450 146866 gene locus_tag LOCUS_41760 147450 146866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 147756 149444 gene locus_tag LOCUS_41770 147756 149444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 149810 149460 gene locus_tag LOCUS_41780 149810 149460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 149851 150186 gene locus_tag LOCUS_41790 149851 150186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 150275 151597 gene locus_tag LOCUS_41800 150275 151597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 151495 151833 gene locus_tag LOCUS_41810 151495 151833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 151833 152726 gene locus_tag LOCUS_41820 151833 152726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 153154 153912 gene locus_tag LOCUS_41830 153154 153912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 153924 154787 gene locus_tag LOCUS_41840 153924 154787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 155304 154807 gene locus_tag LOCUS_41850 155304 154807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 155231 156004 gene locus_tag LOCUS_41860 155231 156004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41860 155938 157614 gene locus_tag LOCUS_41870 155938 157614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41870 157608 158081 gene locus_tag LOCUS_41880 157608 158081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 158376 158131 gene locus_tag LOCUS_41890 158376 158131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 158535 159035 gene locus_tag LOCUS_41900 158535 159035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 159037 159936 gene locus_tag LOCUS_41910 159037 159936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 159946 160542 gene locus_tag LOCUS_41920 159946 160542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 160886 162853 gene locus_tag LOCUS_41930 160886 162853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 164421 162922 gene locus_tag LOCUS_41940 164421 162922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 166387 164531 gene locus_tag LOCUS_41950 166387 164531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 172059 166645 gene locus_tag LOCUS_41960 172059 166645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 172693 172049 gene locus_tag LOCUS_41970 172693 172049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 172861 175713 gene locus_tag LOCUS_41980 172861 175713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 176655 175849 gene locus_tag LOCUS_41990 176655 175849 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_41990 179053 176792 gene locus_tag LOCUS_42000 179053 176792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 179165 179983 gene locus_tag LOCUS_42010 179165 179983 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_42010 180172 181224 gene locus_tag LOCUS_42020 180172 181224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42020 181221 181574 gene locus_tag LOCUS_42030 181221 181574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42030 183232 181736 gene locus_tag LOCUS_42040 183232 181736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 183463 183389 gene locus_tag LOCUS_t00560 183463 183389 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 184396 183632 gene locus_tag LOCUS_42050 184396 183632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 184688 184777 gene locus_tag LOCUS_t00570 184688 184777 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 184998 187376 gene locus_tag LOCUS_42060 184998 187376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 187560 188258 gene locus_tag LOCUS_42070 187560 188258 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208082.1 protein_id gnl|my_center|LOCUS_42070 191624 188301 gene locus_tag LOCUS_42080 191624 188301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 193034 191631 gene locus_tag LOCUS_42090 193034 191631 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_42090 193640 193047 gene locus_tag LOCUS_42100 193640 193047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 194799 193672 gene locus_tag LOCUS_42110 194799 193672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 194799 195296 gene locus_tag LOCUS_42120 194799 195296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 195581 195844 gene locus_tag LOCUS_42130 195581 195844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 196256 197404 gene locus_tag LOCUS_42140 196256 197404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 198992 197631 gene locus_tag LOCUS_42150 198992 197631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 199095 199469 gene locus_tag LOCUS_42160 199095 199469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 199511 201904 gene locus_tag LOCUS_42170 199511 201904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 201901 204255 gene locus_tag LOCUS_42180 201901 204255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 204616 212370 gene locus_tag LOCUS_42190 204616 212370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 213033 212482 gene locus_tag LOCUS_42200 213033 212482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 213182 213955 gene locus_tag LOCUS_42210 213182 213955 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 protein_id gnl|my_center|LOCUS_42210 213965 214990 gene locus_tag LOCUS_42220 213965 214990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 217303 215069 gene locus_tag LOCUS_42230 217303 215069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42230 217707 217219 gene locus_tag LOCUS_42240 217707 217219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42240 218149 218280 gene locus_tag LOCUS_42250 218149 218280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 218338 218610 gene locus_tag LOCUS_42260 218338 218610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 218645 219199 gene locus_tag LOCUS_42270 218645 219199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 219202 219462 gene locus_tag LOCUS_42280 219202 219462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 219494 221350 gene locus_tag LOCUS_42290 219494 221350 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_42290 221364 221780 gene locus_tag LOCUS_42300 gene apaG 221364 221780 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_42300 221890 222456 gene locus_tag LOCUS_42310 221890 222456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 222637 223242 gene locus_tag LOCUS_42320 222637 223242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 223303 223812 gene locus_tag LOCUS_42330 223303 223812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 224491 223883 gene locus_tag LOCUS_42340 224491 223883 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_42340 224775 225011 gene locus_tag LOCUS_42350 gene rpmB 224775 225011 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208991.1 protein_id gnl|my_center|LOCUS_42350 225054 226274 gene locus_tag LOCUS_42360 225054 226274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 226351 228921 gene locus_tag LOCUS_42370 226351 228921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 230638 228938 gene locus_tag LOCUS_42380 230638 228938 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_42380 231896 230784 gene locus_tag LOCUS_42390 231896 230784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 233274 232174 gene locus_tag LOCUS_42400 233274 232174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 237232 233279 gene locus_tag LOCUS_42410 237232 233279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 237456 238298 gene locus_tag LOCUS_42420 237456 238298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 239688 238300 gene locus_tag LOCUS_42430 239688 238300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 239888 240892 gene locus_tag LOCUS_42440 239888 240892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 241915 241013 gene locus_tag LOCUS_42450 241915 241013 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_42450 242282 241986 gene locus_tag LOCUS_42460 242282 241986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 242867 242310 gene locus_tag LOCUS_42470 242867 242310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 243045 243212 gene locus_tag LOCUS_42480 243045 243212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 244417 243233 gene locus_tag LOCUS_42490 244417 243233 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_42490 244956 244471 gene locus_tag LOCUS_42500 244956 244471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 245150 244953 gene locus_tag LOCUS_42510 245150 244953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 245352 246143 gene locus_tag LOCUS_42520 245352 246143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 246220 247320 gene locus_tag LOCUS_42530 gene ychF 246220 247320 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_42530 248499 247372 gene locus_tag LOCUS_42540 248499 247372 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_42540 248574 249821 gene locus_tag LOCUS_42550 248574 249821 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_42550 249859 250683 gene locus_tag LOCUS_42560 249859 250683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 250690 250953 gene locus_tag LOCUS_42570 250690 250953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 253105 251027 gene locus_tag LOCUS_42580 253105 251027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 254984 253107 gene locus_tag LOCUS_42590 254984 253107 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_42590 255714 255118 gene locus_tag LOCUS_42600 255714 255118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 256213 255725 gene locus_tag LOCUS_42610 256213 255725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 256307 257338 gene locus_tag LOCUS_42620 256307 257338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 257350 258597 gene locus_tag LOCUS_42630 257350 258597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 260190 258610 gene locus_tag LOCUS_42640 260190 258610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 261638 260217 gene locus_tag LOCUS_42650 gene lpdA 261638 260217 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227834.1 protein_id gnl|my_center|LOCUS_42650 263141 261645 gene locus_tag LOCUS_42660 263141 261645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 265961 263166 gene locus_tag LOCUS_42670 265961 263166 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366703.1 protein_id gnl|my_center|LOCUS_42670 266174 267250 gene locus_tag LOCUS_42680 266174 267250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 267264 268355 gene locus_tag LOCUS_42690 267264 268355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 268434 269366 gene locus_tag LOCUS_42700 268434 269366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 270567 269413 gene locus_tag LOCUS_42710 270567 269413 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_42710 271982 270669 gene locus_tag LOCUS_42720 271982 270669 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_42720 272042 272590 gene locus_tag LOCUS_42730 272042 272590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 273800 272529 gene locus_tag LOCUS_42740 273800 272529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 274882 273893 gene locus_tag LOCUS_42750 274882 273893 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_42750 274134 274227 gene locus_tag LOCUS_t00580 274134 274227 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 276697 274970 gene locus_tag LOCUS_42760 276697 274970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 277924 276854 gene locus_tag LOCUS_42770 277924 276854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 278722 277964 gene locus_tag LOCUS_42780 278722 277964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 280192 278957 gene locus_tag LOCUS_42790 280192 278957 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_42790 280638 280189 gene locus_tag LOCUS_42800 280638 280189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 280926 280660 gene locus_tag LOCUS_42810 280926 280660 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139648.1 protein_id gnl|my_center|LOCUS_42810 282600 280984 gene locus_tag LOCUS_42820 282600 280984 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039072.1 protein_id gnl|my_center|LOCUS_42820 283062 282700 gene locus_tag LOCUS_42830 283062 282700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 283883 283062 gene locus_tag LOCUS_42840 gene dapB 283883 283062 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_42840 284767 283880 gene locus_tag LOCUS_42850 gene dapA 284767 283880 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_42850 285234 284782 gene locus_tag LOCUS_42860 285234 284782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 286217 285231 gene locus_tag LOCUS_42870 286217 285231 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337390.1 protein_id gnl|my_center|LOCUS_42870 286134 286691 gene locus_tag LOCUS_42880 286134 286691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 287633 286734 gene locus_tag LOCUS_42890 287633 286734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 288066 288503 gene locus_tag LOCUS_42900 288066 288503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 288500 289750 gene locus_tag LOCUS_42910 288500 289750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 289882 291735 gene locus_tag LOCUS_42920 289882 291735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 292896 291736 gene locus_tag LOCUS_42930 292896 291736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 294626 292893 gene locus_tag LOCUS_42940 gene pilB 294626 292893 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_42940 294786 296288 gene locus_tag LOCUS_42950 294786 296288 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_42950 296399 299116 gene locus_tag LOCUS_42960 gene alaS 296399 299116 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810664.1 protein_id gnl|my_center|LOCUS_42960 299271 300893 gene locus_tag LOCUS_42970 299271 300893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 302445 301015 gene locus_tag LOCUS_42980 302445 301015 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_42980 302660 303052 gene locus_tag LOCUS_42990 302660 303052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 303070 303384 gene locus_tag LOCUS_43000 303070 303384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 303389 304189 gene locus_tag LOCUS_43010 303389 304189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 304526 304233 gene locus_tag LOCUS_43020 304526 304233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 304572 306302 gene locus_tag LOCUS_43030 304572 306302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 306412 307638 gene locus_tag LOCUS_43040 306412 307638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 307827 307899 gene locus_tag LOCUS_t00590 307827 307899 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 307948 308032 gene locus_tag LOCUS_t00600 307948 308032 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 308038 308111 gene locus_tag LOCUS_t00610 308038 308111 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 308133 308207 gene locus_tag LOCUS_t00620 308133 308207 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 308270 309475 gene locus_tag LOCUS_43050 gene tuf 308270 309475 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_43050 309589 309750 gene locus_tag LOCUS_43060 gene rpmG 309589 309750 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630505.1 protein_id gnl|my_center|LOCUS_43060 309788 309861 gene locus_tag LOCUS_t00630 309788 309861 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 310008 310343 gene locus_tag LOCUS_43070 310008 310343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 310518 311057 gene locus_tag LOCUS_43080 gene nusG 310518 311057 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 protein_id gnl|my_center|LOCUS_43080 311176 311601 gene locus_tag LOCUS_43090 gene rplK 311176 311601 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_43090 311711 312412 gene locus_tag LOCUS_43100 gene rplA 311711 312412 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_43100 312655 313170 gene locus_tag LOCUS_43110 gene rplJ 312655 313170 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_43110 313729 313190 gene locus_tag LOCUS_43120 313729 313190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 313866 318050 gene locus_tag LOCUS_43130 gene rpoB 313866 318050 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_43130 318080 322282 gene locus_tag LOCUS_43140 gene rpoC 318080 322282 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_43140 322588 322959 gene locus_tag LOCUS_43150 gene rpsL 322588 322959 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_43150 322983 323471 gene locus_tag LOCUS_43160 gene rpsG 322983 323471 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_43160 323648 325783 gene locus_tag LOCUS_43170 gene fusA 323648 325783 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_43170 325926 327131 gene locus_tag LOCUS_43180 gene tuf 325926 327131 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_43180 327158 327466 gene locus_tag LOCUS_43190 gene rpsJ 327158 327466 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_43190 327477 328133 gene locus_tag LOCUS_43200 gene rplD 327477 328133 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531423.1 protein_id gnl|my_center|LOCUS_43200 328130 328459 gene locus_tag LOCUS_43210 gene rplW 328130 328459 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_43210 328489 329313 gene locus_tag LOCUS_43220 gene rplB 328489 329313 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_43220 329316 329594 gene locus_tag LOCUS_43230 gene rpsS 329316 329594 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_43230 329612 329947 gene locus_tag LOCUS_43240 gene rplV 329612 329947 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence10 280 2256 gene locus_tag LOCUS_43250 gene hscA 280 2256 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103546.1 protein_id gnl|my_center|LOCUS_43250 2259 2597 gene locus_tag LOCUS_43260 gene fdx 2259 2597 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615771.1 protein_id gnl|my_center|LOCUS_43260 2681 3877 gene locus_tag LOCUS_43270 2681 3877 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037551.1 protein_id gnl|my_center|LOCUS_43270 4661 3882 gene locus_tag LOCUS_43280 4661 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 5521 4715 gene locus_tag LOCUS_43290 5521 4715 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_43290 5536 5994 gene locus_tag LOCUS_43300 5536 5994 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_43300 6356 6048 gene locus_tag LOCUS_43310 6356 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 6726 10661 gene locus_tag LOCUS_43320 6726 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 10699 11928 gene locus_tag LOCUS_43330 10699 11928 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_43330 12688 12026 gene locus_tag LOCUS_43340 12688 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 14300 12789 gene locus_tag LOCUS_43350 14300 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 14571 15974 gene locus_tag LOCUS_43360 14571 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 16149 17669 gene locus_tag LOCUS_43370 16149 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 17666 19057 gene locus_tag LOCUS_43380 17666 19057 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527932.1 protein_id gnl|my_center|LOCUS_43380 19163 20641 gene locus_tag LOCUS_43390 19163 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 20722 21525 gene locus_tag LOCUS_43400 20722 21525 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_43400 22905 21532 gene locus_tag LOCUS_43410 22905 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 22976 24565 gene locus_tag LOCUS_43420 22976 24565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 24591 25313 gene locus_tag LOCUS_43430 24591 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 25395 26033 gene locus_tag LOCUS_43440 25395 26033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 26214 27104 gene locus_tag LOCUS_43450 26214 27104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 29452 27188 gene locus_tag LOCUS_43460 29452 27188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 29956 31146 gene locus_tag LOCUS_43470 29956 31146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 31179 31982 gene locus_tag LOCUS_43480 31179 31982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 32077 33843 gene locus_tag LOCUS_43490 32077 33843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 34090 36210 gene locus_tag LOCUS_43500 34090 36210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 34306 34216 gene locus_tag LOCUS_t00640 34306 34216 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 36398 37462 gene locus_tag LOCUS_43510 36398 37462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 37480 38130 gene locus_tag LOCUS_43520 37480 38130 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_43520 38324 40060 gene locus_tag LOCUS_43530 38324 40060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 40057 41430 gene locus_tag LOCUS_43540 40057 41430 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224193226.1 protein_id gnl|my_center|LOCUS_43540 41440 42357 gene locus_tag LOCUS_43550 41440 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 42666 42385 gene locus_tag LOCUS_43560 42666 42385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 43313 42672 gene locus_tag LOCUS_43570 43313 42672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 44416 43310 gene locus_tag LOCUS_43580 44416 43310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 45340 44462 gene locus_tag LOCUS_43590 45340 44462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 45795 45337 gene locus_tag LOCUS_43600 45795 45337 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_43600 46483 45788 gene locus_tag LOCUS_43610 46483 45788 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_43610 47463 46561 gene locus_tag LOCUS_43620 47463 46561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 48254 47478 gene locus_tag LOCUS_43630 48254 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 51007 48266 gene locus_tag LOCUS_43640 51007 48266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 52809 51256 gene locus_tag LOCUS_43650 52809 51256 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_43650 52936 53892 gene locus_tag LOCUS_43660 gene mtnP 52936 53892 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_43660 53920 54864 gene locus_tag LOCUS_43670 53920 54864 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_43670 55821 54880 gene locus_tag LOCUS_43680 55821 54880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 55871 57736 gene locus_tag LOCUS_43690 55871 57736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 58586 57741 gene locus_tag LOCUS_43700 gene asd 58586 57741 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_43700 58661 59533 gene locus_tag LOCUS_43710 58661 59533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 60811 59549 gene locus_tag LOCUS_43720 60811 59549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 61714 60815 gene locus_tag LOCUS_43730 61714 60815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 61880 63229 gene locus_tag LOCUS_43740 61880 63229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 63519 63313 gene locus_tag LOCUS_43750 63519 63313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 63931 64197 gene locus_tag LOCUS_43760 63931 64197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 66021 64279 gene locus_tag LOCUS_43770 66021 64279 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886457.1 protein_id gnl|my_center|LOCUS_43770 69363 66220 gene locus_tag LOCUS_43780 69363 66220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 69474 70898 gene locus_tag LOCUS_43790 69474 70898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 70816 71295 gene locus_tag LOCUS_43800 70816 71295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 71306 72487 gene locus_tag LOCUS_43810 71306 72487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 72641 75355 gene locus_tag LOCUS_43820 72641 75355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 75479 76249 gene locus_tag LOCUS_43830 75479 76249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 76458 77744 gene locus_tag LOCUS_43840 76458 77744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 79778 77766 gene locus_tag LOCUS_43850 79778 77766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 80172 79945 gene locus_tag LOCUS_43860 80172 79945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 80345 81874 gene locus_tag LOCUS_43870 80345 81874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 82994 82035 gene locus_tag LOCUS_43880 82994 82035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 83562 83005 gene locus_tag LOCUS_43890 83562 83005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 83885 84250 gene locus_tag LOCUS_43900 83885 84250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 85091 84276 gene locus_tag LOCUS_43910 85091 84276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 85393 85611 gene locus_tag LOCUS_43920 85393 85611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 86096 85791 gene locus_tag LOCUS_43930 86096 85791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 87016 86093 gene locus_tag LOCUS_43940 87016 86093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 89674 87125 gene locus_tag LOCUS_43950 gene thrA 89674 87125 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_43950 90994 89807 gene locus_tag LOCUS_43960 90994 89807 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_43960 91081 95277 gene locus_tag LOCUS_43970 91081 95277 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_43970 95775 95287 gene locus_tag LOCUS_43980 95775 95287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 97429 95768 gene locus_tag LOCUS_43990 97429 95768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 97316 97672 gene locus_tag LOCUS_44000 97316 97672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 97685 98317 gene locus_tag LOCUS_44010 97685 98317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 98326 98628 gene locus_tag LOCUS_44020 98326 98628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 98825 99172 gene locus_tag LOCUS_44030 98825 99172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 99093 99347 gene locus_tag LOCUS_44040 99093 99347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 99506 100468 gene locus_tag LOCUS_44050 99506 100468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 102995 100470 gene locus_tag LOCUS_44060 102995 100470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 103175 103498 gene locus_tag LOCUS_44070 103175 103498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 103689 104858 gene locus_tag LOCUS_44080 103689 104858 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_44080 105647 104931 gene locus_tag LOCUS_44090 105647 104931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 106519 105623 gene locus_tag LOCUS_44100 106519 105623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 107813 107304 gene locus_tag LOCUS_44110 107813 107304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 109159 108191 gene locus_tag LOCUS_44120 109159 108191 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_44120 109641 109261 gene locus_tag LOCUS_44130 109641 109261 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_44130 109686 110159 gene locus_tag LOCUS_44140 109686 110159 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193832.1 protein_id gnl|my_center|LOCUS_44140 110243 111469 gene locus_tag LOCUS_44150 gene murG 110243 111469 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_44150 111601 114525 gene locus_tag LOCUS_44160 gene gcvP 111601 114525 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_44160 114656 116506 gene locus_tag LOCUS_44170 114656 116506 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_44170 117451 116627 gene locus_tag LOCUS_44180 117451 116627 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_44180 117851 118240 gene locus_tag LOCUS_44190 117851 118240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 118984 118310 gene locus_tag LOCUS_44200 118984 118310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44200 118928 119353 gene locus_tag LOCUS_44210 118928 119353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 119724 119236 gene locus_tag LOCUS_44220 119724 119236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 120952 119729 gene locus_tag LOCUS_44230 120952 119729 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_44230 123104 121029 gene locus_tag LOCUS_44240 123104 121029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 123151 123387 gene locus_tag LOCUS_44250 123151 123387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 124519 123434 gene locus_tag LOCUS_44260 124519 123434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 125413 124520 gene locus_tag LOCUS_44270 125413 124520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 125931 127751 gene locus_tag LOCUS_44280 125931 127751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 127756 129225 gene locus_tag LOCUS_44290 127756 129225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 129153 129839 gene locus_tag LOCUS_44300 129153 129839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 132336 129862 gene locus_tag LOCUS_44310 132336 129862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 132360 133718 gene locus_tag LOCUS_44320 gene thrC 132360 133718 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_44320 134692 133730 gene locus_tag LOCUS_44330 134692 133730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 136080 134800 gene locus_tag LOCUS_44340 gene tyrS 136080 134800 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337526.1 protein_id gnl|my_center|LOCUS_44340 136567 136229 gene locus_tag LOCUS_44350 136567 136229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 137803 136610 gene locus_tag LOCUS_44360 137803 136610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 137796 138086 gene locus_tag LOCUS_44370 137796 138086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 138793 138065 gene locus_tag LOCUS_44380 138793 138065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 139443 138811 gene locus_tag LOCUS_44390 139443 138811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 139704 140465 gene locus_tag LOCUS_44400 139704 140465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 141614 140538 gene locus_tag LOCUS_44410 gene prfA 141614 140538 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_44410 141887 143128 gene locus_tag LOCUS_44420 141887 143128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 143404 144048 gene locus_tag LOCUS_44430 143404 144048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 144053 145045 gene locus_tag LOCUS_44440 144053 145045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 145243 146322 gene locus_tag LOCUS_44450 145243 146322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 147057 146371 gene locus_tag LOCUS_44460 147057 146371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 147154 147504 gene locus_tag LOCUS_44470 gene queF 147154 147504 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_44470 147594 149024 gene locus_tag LOCUS_44480 147594 149024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 149330 151798 gene locus_tag LOCUS_44490 149330 151798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 152557 151805 gene locus_tag LOCUS_44500 152557 151805 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_44500 153603 152554 gene locus_tag LOCUS_44510 153603 152554 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_44510 154624 153608 gene locus_tag LOCUS_44520 154624 153608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 155684 154629 gene locus_tag LOCUS_44530 155684 154629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 155902 158169 gene locus_tag LOCUS_44540 155902 158169 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_44540 158186 158374 gene locus_tag LOCUS_44550 158186 158374 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920199.1 protein_id gnl|my_center|LOCUS_44550 160318 158471 gene locus_tag LOCUS_44560 gene ffh 160318 158471 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_44560 160390 162360 gene locus_tag LOCUS_44570 160390 162360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 162399 164738 gene locus_tag LOCUS_44580 162399 164738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 164772 166409 gene locus_tag LOCUS_44590 164772 166409 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_44590 167226 166507 gene locus_tag LOCUS_44600 gene tsaB 167226 166507 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_44600 168857 167226 gene locus_tag LOCUS_44610 168857 167226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 169200 170030 gene locus_tag LOCUS_44620 169200 170030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 171350 170097 gene locus_tag LOCUS_44630 171350 170097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 172775 171357 gene locus_tag LOCUS_44640 gene bioA 172775 171357 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038009.1 protein_id gnl|my_center|LOCUS_44640 172847 173560 gene locus_tag LOCUS_44650 172847 173560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 173708 174220 gene locus_tag LOCUS_44660 173708 174220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 174351 174779 gene locus_tag LOCUS_44670 174351 174779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 174789 176459 gene locus_tag LOCUS_44680 174789 176459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 176466 179015 gene locus_tag LOCUS_44690 176466 179015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 178985 179494 gene locus_tag LOCUS_44700 178985 179494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 179491 179997 gene locus_tag LOCUS_44710 179491 179997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 180041 180433 gene locus_tag LOCUS_44720 180041 180433 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_44720 180471 180719 gene locus_tag LOCUS_44730 180471 180719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 180719 181648 gene locus_tag LOCUS_44740 180719 181648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 181715 183544 gene locus_tag LOCUS_44750 181715 183544 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_44750 184211 183585 gene locus_tag LOCUS_44760 184211 183585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 185287 184256 gene locus_tag LOCUS_44770 185287 184256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 185398 185994 gene locus_tag LOCUS_44780 185398 185994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 186067 187089 gene locus_tag LOCUS_44790 186067 187089 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_44790 187364 188944 gene locus_tag LOCUS_44800 187364 188944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 188945 189703 gene locus_tag LOCUS_44810 188945 189703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 189726 190886 gene locus_tag LOCUS_44820 189726 190886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 190974 192077 gene locus_tag LOCUS_44830 gene hrcA 190974 192077 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068110.1 protein_id gnl|my_center|LOCUS_44830 192128 192679 gene locus_tag LOCUS_44840 192128 192679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 192700 194565 gene locus_tag LOCUS_44850 gene dnaK 192700 194565 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721635.1 protein_id gnl|my_center|LOCUS_44850 194704 195810 gene locus_tag LOCUS_44860 gene dnaJ 194704 195810 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_44860 195891 196283 gene locus_tag LOCUS_44870 195891 196283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 196698 196327 gene locus_tag LOCUS_44880 196698 196327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 197055 199964 gene locus_tag LOCUS_44890 197055 199964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 200050 200568 gene locus_tag LOCUS_44900 gene ribE 200050 200568 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_44900 200555 201058 gene locus_tag LOCUS_44910 200555 201058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 201228 201584 gene locus_tag LOCUS_44920 201228 201584 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_44920 201581 204004 gene locus_tag LOCUS_44930 201581 204004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 204015 204635 gene locus_tag LOCUS_44940 204015 204635 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081017.1 protein_id gnl|my_center|LOCUS_44940 204632 205147 gene locus_tag LOCUS_44950 204632 205147 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942858.1 protein_id gnl|my_center|LOCUS_44950 205157 205942 gene locus_tag LOCUS_44960 205157 205942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 205933 207969 gene locus_tag LOCUS_44970 205933 207969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 207966 208829 gene locus_tag LOCUS_44980 207966 208829 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_44980 208859 210073 gene locus_tag LOCUS_44990 208859 210073 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_44990 210150 211016 gene locus_tag LOCUS_45000 210150 211016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 211013 211426 gene locus_tag LOCUS_45010 211013 211426 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942852.1 protein_id gnl|my_center|LOCUS_45010 211455 212423 gene locus_tag LOCUS_45020 gene xerD 211455 212423 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 protein_id gnl|my_center|LOCUS_45020 213298 212459 gene locus_tag LOCUS_45030 213298 212459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 213498 213367 gene locus_tag LOCUS_45040 213498 213367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 213860 213561 gene locus_tag LOCUS_45050 213860 213561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 213766 214608 gene locus_tag LOCUS_45060 213766 214608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 214781 215770 gene locus_tag LOCUS_45070 214781 215770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 215793 217712 gene locus_tag LOCUS_45080 215793 217712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_45080 217795 219384 gene locus_tag LOCUS_45090 217795 219384 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_45090 219419 219706 gene locus_tag LOCUS_45100 219419 219706 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305420.1 protein_id gnl|my_center|LOCUS_45100 219922 220494 gene locus_tag LOCUS_45110 219922 220494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 220413 221678 gene locus_tag LOCUS_45120 220413 221678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 221887 223308 gene locus_tag LOCUS_45130 221887 223308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 224052 223339 gene locus_tag LOCUS_45140 224052 223339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 225250 224090 gene locus_tag LOCUS_45150 225250 224090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 225520 225308 gene locus_tag LOCUS_45160 225520 225308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 225483 225872 gene locus_tag LOCUS_45170 225483 225872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 227275 225962 gene locus_tag LOCUS_45180 227275 225962 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931620.1 protein_id gnl|my_center|LOCUS_45180 228207 229322 gene locus_tag LOCUS_45190 228207 229322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 229396 230358 gene locus_tag LOCUS_45200 229396 230358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 232554 230524 gene locus_tag LOCUS_45210 232554 230524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 232840 232544 gene locus_tag LOCUS_45220 232840 232544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 232725 234251 gene locus_tag LOCUS_45230 232725 234251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 235674 234265 gene locus_tag LOCUS_45240 235674 234265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 236937 235768 gene locus_tag LOCUS_45250 236937 235768 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_45250 238079 236934 gene locus_tag LOCUS_45260 238079 236934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 238487 238089 gene locus_tag LOCUS_45270 gene gcvH 238487 238089 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695621.1 protein_id gnl|my_center|LOCUS_45270 239732 238626 gene locus_tag LOCUS_45280 gene gcvT 239732 238626 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_45280 240000 239782 gene locus_tag LOCUS_45290 240000 239782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 239912 240988 gene locus_tag LOCUS_45300 239912 240988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 242050 241073 gene locus_tag LOCUS_45310 242050 241073 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_45310 242658 241990 gene locus_tag LOCUS_45320 242658 241990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 243588 242794 gene locus_tag LOCUS_45330 243588 242794 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_45330 243702 244775 gene locus_tag LOCUS_45340 243702 244775 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920301.1 protein_id gnl|my_center|LOCUS_45340 244854 246014 gene locus_tag LOCUS_45350 gene carA 244854 246014 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_45350 246011 246727 gene locus_tag LOCUS_45360 246011 246727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 248269 246728 gene locus_tag LOCUS_45370 248269 246728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 248394 248322 gene locus_tag LOCUS_t00650 248394 248322 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 248609 248534 gene locus_tag LOCUS_t00660 248609 248534 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 251398 248681 gene locus_tag LOCUS_45380 251398 248681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 253486 251594 gene locus_tag LOCUS_45390 253486 251594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 254646 253483 gene locus_tag LOCUS_45400 254646 253483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 255928 254879 gene locus_tag LOCUS_45410 255928 254879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 255927 256256 gene locus_tag LOCUS_45420 255927 256256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 257083 256436 gene locus_tag LOCUS_45430 257083 256436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 257142 257699 gene locus_tag LOCUS_45440 257142 257699 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_45440 258319 257765 gene locus_tag LOCUS_45450 258319 257765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 260352 258376 gene locus_tag LOCUS_45460 260352 258376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 262397 260484 gene locus_tag LOCUS_45470 262397 260484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 264322 262496 gene locus_tag LOCUS_45480 264322 262496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 266144 264969 gene locus_tag LOCUS_45490 266144 264969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 266860 266363 gene locus_tag LOCUS_45500 266860 266363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 268549 267434 gene locus_tag LOCUS_45510 gene plsX 268549 267434 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_45510 269521 268682 gene locus_tag LOCUS_45520 269521 268682 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_45520 270447 269518 gene locus_tag LOCUS_45530 270447 269518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 270784 270464 gene locus_tag LOCUS_45540 270784 270464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 270665 271075 gene locus_tag LOCUS_45550 270665 271075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 272321 271311 gene locus_tag LOCUS_45560 272321 271311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 272531 274555 gene locus_tag LOCUS_45570 272531 274555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 274576 275232 gene locus_tag LOCUS_45580 274576 275232 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582678.1 protein_id gnl|my_center|LOCUS_45580 275245 276783 gene locus_tag LOCUS_45590 275245 276783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 276892 278031 gene locus_tag LOCUS_45600 276892 278031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 278028 279242 gene locus_tag LOCUS_45610 278028 279242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 279335 280288 gene locus_tag LOCUS_45620 279335 280288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 280285 280929 gene locus_tag LOCUS_45630 280285 280929 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722809.1 protein_id gnl|my_center|LOCUS_45630 280930 281550 gene locus_tag LOCUS_45640 280930 281550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 281653 283698 gene locus_tag LOCUS_45650 281653 283698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 285037 283619 gene locus_tag LOCUS_45660 285037 283619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45660 285244 285600 gene locus_tag LOCUS_45670 285244 285600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 286470 285739 gene locus_tag LOCUS_45680 286470 285739 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_45680 286357 286584 gene locus_tag LOCUS_45690 286357 286584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 286584 287084 gene locus_tag LOCUS_45700 286584 287084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 287105 288079 gene locus_tag LOCUS_45710 287105 288079 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257671.1 protein_id gnl|my_center|LOCUS_45710 288076 288921 gene locus_tag LOCUS_45720 288076 288921 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256865.1 protein_id gnl|my_center|LOCUS_45720 289084 289713 gene locus_tag LOCUS_45730 289084 289713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 protein_id gnl|my_center|LOCUS_45730 >Feature sequence11 274 1716 gene locus_tag LOCUS_45740 274 1716 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_45740 1740 2528 gene locus_tag LOCUS_45750 1740 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 2701 2480 gene locus_tag LOCUS_45760 2701 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 2723 3379 gene locus_tag LOCUS_45770 2723 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 3470 5347 gene locus_tag LOCUS_45780 gene glmS 3470 5347 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_45780 6298 5372 gene locus_tag LOCUS_45790 6298 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 8162 6540 gene locus_tag LOCUS_45800 8162 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 8907 8422 gene locus_tag LOCUS_45810 gene moaC 8907 8422 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_45810 9046 10641 gene locus_tag LOCUS_45820 9046 10641 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612355.1 protein_id gnl|my_center|LOCUS_45820 10654 12078 gene locus_tag LOCUS_45830 gene pntB 10654 12078 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705257.1 protein_id gnl|my_center|LOCUS_45830 13407 12103 gene locus_tag LOCUS_45840 13407 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 13289 13546 gene locus_tag LOCUS_45850 13289 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 15339 13639 gene locus_tag LOCUS_45860 15339 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 16930 15329 gene locus_tag LOCUS_45870 16930 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 17792 16947 gene locus_tag LOCUS_45880 17792 16947 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_45880 18726 17845 gene locus_tag LOCUS_45890 18726 17845 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_45890 20146 18875 gene locus_tag LOCUS_45900 gene tolB 20146 18875 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_45900 21431 20568 gene locus_tag LOCUS_45910 21431 20568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 21934 21488 gene locus_tag LOCUS_45920 21934 21488 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 protein_id gnl|my_center|LOCUS_45920 22643 21936 gene locus_tag LOCUS_45930 gene tolQ 22643 21936 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_45930 22830 23429 gene locus_tag LOCUS_45940 22830 23429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 23399 24208 gene locus_tag LOCUS_45950 23399 24208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 24219 25538 gene locus_tag LOCUS_45960 24219 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 25555 26346 gene locus_tag LOCUS_45970 25555 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 28196 26388 gene locus_tag LOCUS_45980 28196 26388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 29688 28357 gene locus_tag LOCUS_45990 29688 28357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 29959 30144 gene locus_tag LOCUS_46000 29959 30144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 31689 30337 gene locus_tag LOCUS_46010 31689 30337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 33351 32134 gene locus_tag LOCUS_46020 33351 32134 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530099.1 protein_id gnl|my_center|LOCUS_46020 33387 33929 gene locus_tag LOCUS_46030 33387 33929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 33997 34716 gene locus_tag LOCUS_46040 33997 34716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 34785 35168 gene locus_tag LOCUS_46050 34785 35168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 35708 35920 gene locus_tag LOCUS_46060 35708 35920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 37397 36018 gene locus_tag LOCUS_46070 gene ablA 37397 36018 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_46070 37632 39341 gene locus_tag LOCUS_46080 37632 39341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 39423 40979 gene locus_tag LOCUS_46090 39423 40979 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_46090 40972 42285 gene locus_tag LOCUS_46100 40972 42285 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_46100 42884 42372 gene locus_tag LOCUS_46110 42884 42372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 43563 45014 gene locus_tag LOCUS_46120 43563 45014 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_46120 48110 45150 gene locus_tag LOCUS_46130 48110 45150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 51064 48194 gene locus_tag LOCUS_46140 51064 48194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 51705 51424 gene locus_tag LOCUS_46150 51705 51424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 51903 52058 gene locus_tag LOCUS_46160 51903 52058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 53862 52186 gene locus_tag LOCUS_46170 53862 52186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 55739 54048 gene locus_tag LOCUS_46180 55739 54048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 55890 56417 gene locus_tag LOCUS_46190 55890 56417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 56550 58712 gene locus_tag LOCUS_46200 56550 58712 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_46200 58931 59007 gene locus_tag LOCUS_t00670 58931 59007 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 59694 59380 gene locus_tag LOCUS_46210 59694 59380 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879095.1 protein_id gnl|my_center|LOCUS_46210 61113 59749 gene locus_tag LOCUS_46220 61113 59749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 61010 61519 gene locus_tag LOCUS_46230 61010 61519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 61516 63135 gene locus_tag LOCUS_46240 61516 63135 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_46240 63237 65171 gene locus_tag LOCUS_46250 63237 65171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 65943 65185 gene locus_tag LOCUS_46260 65943 65185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46260 66575 65940 gene locus_tag LOCUS_46270 66575 65940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46270 66840 67682 gene locus_tag LOCUS_46280 66840 67682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 67679 68047 gene locus_tag LOCUS_46290 67679 68047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 69781 68108 gene locus_tag LOCUS_46300 69781 68108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 69983 70708 gene locus_tag LOCUS_46310 69983 70708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 70705 72309 gene locus_tag LOCUS_46320 70705 72309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 72489 73154 gene locus_tag LOCUS_46330 72489 73154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 73430 73155 gene locus_tag LOCUS_46340 73430 73155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 78308 73524 gene locus_tag LOCUS_46350 78308 73524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 78371 78796 gene locus_tag LOCUS_46360 78371 78796 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887201.1 protein_id gnl|my_center|LOCUS_46360 78885 80159 gene locus_tag LOCUS_46370 78885 80159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 80534 80163 gene locus_tag LOCUS_46380 80534 80163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 80534 81778 gene locus_tag LOCUS_46390 80534 81778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 82300 81779 gene locus_tag LOCUS_46400 82300 81779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 83345 82413 gene locus_tag LOCUS_46410 83345 82413 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_46410 84937 83606 gene locus_tag LOCUS_46420 84937 83606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 85187 86470 gene locus_tag LOCUS_46430 85187 86470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 86620 87267 gene locus_tag LOCUS_46440 86620 87267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 90427 87365 gene locus_tag LOCUS_46450 90427 87365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 90785 91531 gene locus_tag LOCUS_46460 90785 91531 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963188.1 protein_id gnl|my_center|LOCUS_46460 91537 92928 gene locus_tag LOCUS_46470 91537 92928 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963189.1 protein_id gnl|my_center|LOCUS_46470 92925 93239 gene locus_tag LOCUS_46480 92925 93239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 93390 93776 gene locus_tag LOCUS_46490 93390 93776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 93850 94581 gene locus_tag LOCUS_46500 93850 94581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 94839 94603 gene locus_tag LOCUS_46510 94839 94603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 94933 95862 gene locus_tag LOCUS_46520 94933 95862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 96023 97177 gene locus_tag LOCUS_46530 96023 97177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 97398 98312 gene locus_tag LOCUS_46540 97398 98312 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_46540 99787 98333 gene locus_tag LOCUS_46550 gene boxB 99787 98333 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_46550 99998 100948 gene locus_tag LOCUS_46560 99998 100948 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338360.1 protein_id gnl|my_center|LOCUS_46560 101274 100957 gene locus_tag LOCUS_46570 101274 100957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 101822 101265 gene locus_tag LOCUS_46580 101822 101265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 102238 101819 gene locus_tag LOCUS_46590 102238 101819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 102482 103996 gene locus_tag LOCUS_46600 102482 103996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 106342 104018 gene locus_tag LOCUS_46610 106342 104018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 106235 107734 gene locus_tag LOCUS_46620 106235 107734 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_46620 110133 107737 gene locus_tag LOCUS_46630 110133 107737 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_46630 110295 110765 gene locus_tag LOCUS_46640 110295 110765 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334532.1 protein_id gnl|my_center|LOCUS_46640 110762 111676 gene locus_tag LOCUS_46650 gene rimK 110762 111676 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_46650 111874 112953 gene locus_tag LOCUS_46660 111874 112953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 112972 113997 gene locus_tag LOCUS_46670 112972 113997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 114008 116050 gene locus_tag LOCUS_46680 114008 116050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 116081 116875 gene locus_tag LOCUS_46690 116081 116875 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836734.1 protein_id gnl|my_center|LOCUS_46690 116872 117555 gene locus_tag LOCUS_46700 116872 117555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 118260 117529 gene locus_tag LOCUS_46710 118260 117529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 118196 118831 gene locus_tag LOCUS_46720 118196 118831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 118828 119643 gene locus_tag LOCUS_46730 118828 119643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 119628 121049 gene locus_tag LOCUS_46740 119628 121049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 121075 122367 gene locus_tag LOCUS_46750 121075 122367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 123243 126494 gene locus_tag LOCUS_46760 123243 126494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 127037 127768 gene locus_tag LOCUS_46770 127037 127768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 127808 128230 gene locus_tag LOCUS_46780 127808 128230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 128285 129241 gene locus_tag LOCUS_46790 128285 129241 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259483.1 protein_id gnl|my_center|LOCUS_46790 130055 129300 gene locus_tag LOCUS_46800 130055 129300 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_46800 131127 130036 gene locus_tag LOCUS_46810 131127 130036 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_46810 132187 131150 gene locus_tag LOCUS_46820 132187 131150 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_46820 132863 132213 gene locus_tag LOCUS_46830 132863 132213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 133091 134533 gene locus_tag LOCUS_46840 133091 134533 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_46840 134530 135084 gene locus_tag LOCUS_46850 134530 135084 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086236.1 protein_id gnl|my_center|LOCUS_46850 135100 136362 gene locus_tag LOCUS_46860 135100 136362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 136491 137276 gene locus_tag LOCUS_46870 136491 137276 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_46870 137273 137932 gene locus_tag LOCUS_46880 137273 137932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 138282 138049 gene locus_tag LOCUS_46890 138282 138049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 138164 139378 gene locus_tag LOCUS_46900 138164 139378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 139504 140799 gene locus_tag LOCUS_46910 139504 140799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 141252 140800 gene locus_tag LOCUS_46920 141252 140800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 141374 142432 gene locus_tag LOCUS_46930 141374 142432 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056930.1 protein_id gnl|my_center|LOCUS_46930 145717 142580 gene locus_tag LOCUS_46940 145717 142580 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_46940 146135 145671 gene locus_tag LOCUS_46950 146135 145671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 147066 146149 gene locus_tag LOCUS_46960 147066 146149 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_46960 147351 147986 gene locus_tag LOCUS_46970 147351 147986 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350382.1 protein_id gnl|my_center|LOCUS_46970 147983 149377 gene locus_tag LOCUS_46980 147983 149377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 149512 150606 gene locus_tag LOCUS_46990 149512 150606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_46990 150603 151304 gene locus_tag LOCUS_47000 150603 151304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176600.1 protein_id gnl|my_center|LOCUS_47000 151567 152406 gene locus_tag LOCUS_47010 151567 152406 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176599.1 protein_id gnl|my_center|LOCUS_47010 152436 153092 gene locus_tag LOCUS_47020 152436 153092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 153142 153564 gene locus_tag LOCUS_47030 153142 153564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 153822 154715 gene locus_tag LOCUS_47040 153822 154715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 156038 154878 gene locus_tag LOCUS_47050 156038 154878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 155929 156495 gene locus_tag LOCUS_47060 155929 156495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 157261 156602 gene locus_tag LOCUS_47070 157261 156602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 157697 157527 gene locus_tag LOCUS_47080 157697 157527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 157621 158745 gene locus_tag LOCUS_47090 157621 158745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 158866 159930 gene locus_tag LOCUS_47100 158866 159930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 159927 160721 gene locus_tag LOCUS_47110 159927 160721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 160845 161516 gene locus_tag LOCUS_47120 160845 161516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 161542 162402 gene locus_tag LOCUS_47130 161542 162402 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_47130 162494 163483 gene locus_tag LOCUS_47140 162494 163483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 165021 163519 gene locus_tag LOCUS_47150 165021 163519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 165718 165131 gene locus_tag LOCUS_47160 165718 165131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 165765 166931 gene locus_tag LOCUS_47170 165765 166931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 166988 167605 gene locus_tag LOCUS_47180 166988 167605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016106.1 protein_id gnl|my_center|LOCUS_47180 167602 169176 gene locus_tag LOCUS_47190 167602 169176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 169550 169164 gene locus_tag LOCUS_47200 169550 169164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 169432 170190 gene locus_tag LOCUS_47210 169432 170190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 170226 172328 gene locus_tag LOCUS_47220 170226 172328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 172355 172942 gene locus_tag LOCUS_47230 172355 172942 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_47230 173029 173832 gene locus_tag LOCUS_47240 173029 173832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 175702 173807 gene locus_tag LOCUS_47250 175702 173807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 177038 175608 gene locus_tag LOCUS_47260 177038 175608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 177441 178163 gene locus_tag LOCUS_47270 177441 178163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 178377 179870 gene locus_tag LOCUS_47280 178377 179870 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172762.1 protein_id gnl|my_center|LOCUS_47280 179931 180302 gene locus_tag LOCUS_47290 179931 180302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 181472 180609 gene locus_tag LOCUS_47300 181472 180609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 181906 181544 gene locus_tag LOCUS_47310 181906 181544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 182262 181819 gene locus_tag LOCUS_47320 182262 181819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 182554 183753 gene locus_tag LOCUS_47330 182554 183753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 184569 183802 gene locus_tag LOCUS_47340 184569 183802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 185101 184667 gene locus_tag LOCUS_47350 185101 184667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 185619 185416 gene locus_tag LOCUS_47360 185619 185416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 185745 187100 gene locus_tag LOCUS_47370 185745 187100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 187178 187597 gene locus_tag LOCUS_47380 187178 187597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 187594 188358 gene locus_tag LOCUS_47390 187594 188358 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_47390 188471 189148 gene locus_tag LOCUS_47400 188471 189148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 192755 189174 gene locus_tag LOCUS_47410 192755 189174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 194407 192737 gene locus_tag LOCUS_47420 194407 192737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 194436 195617 gene locus_tag LOCUS_47430 194436 195617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 196234 195659 gene locus_tag LOCUS_47440 196234 195659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47440 196463 196242 gene locus_tag LOCUS_47450 196463 196242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 199075 196703 gene locus_tag LOCUS_47460 199075 196703 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_47460 200028 199072 gene locus_tag LOCUS_47470 200028 199072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 200239 200760 gene locus_tag LOCUS_47480 200239 200760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 203589 200887 gene locus_tag LOCUS_47490 gene acnA 203589 200887 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_47490 203764 204306 gene locus_tag LOCUS_47500 203764 204306 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376387.1 protein_id gnl|my_center|LOCUS_47500 204309 204794 gene locus_tag LOCUS_47510 204309 204794 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_47510 204823 205713 gene locus_tag LOCUS_47520 204823 205713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 205848 206294 gene locus_tag LOCUS_47530 205848 206294 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256363.1 protein_id gnl|my_center|LOCUS_47530 207147 206263 gene locus_tag LOCUS_47540 207147 206263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 208296 207190 gene locus_tag LOCUS_47550 208296 207190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 208720 208298 gene locus_tag LOCUS_47560 208720 208298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 209294 208725 gene locus_tag LOCUS_47570 209294 208725 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256364.1 protein_id gnl|my_center|LOCUS_47570 209920 209294 gene locus_tag LOCUS_47580 209920 209294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 211545 209917 gene locus_tag LOCUS_47590 211545 209917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 211767 212384 gene locus_tag LOCUS_47600 211767 212384 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_47600 212381 213586 gene locus_tag LOCUS_47610 212381 213586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 213635 214903 gene locus_tag LOCUS_47620 213635 214903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 214913 215575 gene locus_tag LOCUS_47630 214913 215575 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702308.1 protein_id gnl|my_center|LOCUS_47630 215621 217279 gene locus_tag LOCUS_47640 215621 217279 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865397.1 protein_id gnl|my_center|LOCUS_47640 218956 217301 gene locus_tag LOCUS_47650 218956 217301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 219117 220331 gene locus_tag LOCUS_47660 219117 220331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 220610 220422 gene locus_tag LOCUS_47670 220610 220422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 222097 220676 gene locus_tag LOCUS_47680 222097 220676 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_47680 222244 222477 gene locus_tag LOCUS_47690 222244 222477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 223387 222575 gene locus_tag LOCUS_47700 223387 222575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 223606 225312 gene locus_tag LOCUS_47710 223606 225312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 225409 226335 gene locus_tag LOCUS_47720 225409 226335 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47720 226352 227539 gene locus_tag LOCUS_47730 gene kbl 226352 227539 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703795.1 protein_id gnl|my_center|LOCUS_47730 228678 227632 gene locus_tag LOCUS_47740 228678 227632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 229175 228768 gene locus_tag LOCUS_47750 229175 228768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 229438 230235 gene locus_tag LOCUS_47760 229438 230235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 230404 231570 gene locus_tag LOCUS_47770 230404 231570 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 protein_id gnl|my_center|LOCUS_47770 232555 231698 gene locus_tag LOCUS_47780 232555 231698 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_47780 233121 232588 gene locus_tag LOCUS_47790 233121 232588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 236029 233132 gene locus_tag LOCUS_47800 gene fdhF 236029 233132 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_47800 236062 236307 gene locus_tag LOCUS_47810 236062 236307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 237098 236325 gene locus_tag LOCUS_47820 237098 236325 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_47820 237262 239046 gene locus_tag LOCUS_47830 237262 239046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 239043 240191 gene locus_tag LOCUS_47840 239043 240191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 240369 240707 gene locus_tag LOCUS_47850 240369 240707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 240704 241405 gene locus_tag LOCUS_47860 240704 241405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47860 241421 242110 gene locus_tag LOCUS_47870 241421 242110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 242406 242783 gene locus_tag LOCUS_47880 242406 242783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 244887 243676 gene locus_tag LOCUS_47890 gene metK 244887 243676 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_47890 246102 244972 gene locus_tag LOCUS_47900 246102 244972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 246462 246202 gene locus_tag LOCUS_47910 246462 246202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 246376 247524 gene locus_tag LOCUS_47920 gene hisD 246376 247524 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537892.1 protein_id gnl|my_center|LOCUS_47920 247642 248757 gene locus_tag LOCUS_47930 gene hisC 247642 248757 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_47930 248754 250076 gene locus_tag LOCUS_47940 248754 250076 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_47940 250717 250112 gene locus_tag LOCUS_47950 250717 250112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 251977 250724 gene locus_tag LOCUS_47960 251977 250724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 253195 251978 gene locus_tag LOCUS_47970 253195 251978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 257474 253203 gene locus_tag LOCUS_47980 257474 253203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 257701 258207 gene locus_tag LOCUS_47990 257701 258207 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_47990 259107 258226 gene locus_tag LOCUS_48000 259107 258226 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393019.1 protein_id gnl|my_center|LOCUS_48000 259814 259137 gene locus_tag LOCUS_48010 259814 259137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 259891 260394 gene locus_tag LOCUS_48020 259891 260394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 260485 263085 gene locus_tag LOCUS_48030 260485 263085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 263082 264875 gene locus_tag LOCUS_48040 263082 264875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 265787 264993 gene locus_tag LOCUS_48050 265787 264993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 265980 268916 gene locus_tag LOCUS_48060 265980 268916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 269140 268955 gene locus_tag LOCUS_48070 269140 268955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 270041 269175 gene locus_tag LOCUS_48080 270041 269175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 270362 272107 gene locus_tag LOCUS_48090 270362 272107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 272160 272732 gene locus_tag LOCUS_48100 272160 272732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 275403 272734 gene locus_tag LOCUS_48110 275403 272734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 276303 275500 gene locus_tag LOCUS_48120 276303 275500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 276928 276533 gene locus_tag LOCUS_48130 276928 276533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 277115 277768 gene locus_tag LOCUS_48140 277115 277768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 277836 279062 gene locus_tag LOCUS_48150 277836 279062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 279462 279067 gene locus_tag LOCUS_48160 279462 279067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 282567 279499 gene locus_tag LOCUS_48170 282567 279499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 284302 282554 gene locus_tag LOCUS_48180 284302 282554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 >Feature sequence12 1862 717 gene locus_tag LOCUS_48190 1862 717 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_48190 2091 1876 gene locus_tag LOCUS_48200 2091 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 2391 2113 gene locus_tag LOCUS_48210 2391 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 3085 2417 gene locus_tag LOCUS_48220 3085 2417 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_48220 3863 3096 gene locus_tag LOCUS_48230 3863 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 4642 3857 gene locus_tag LOCUS_48240 4642 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 6690 4639 gene locus_tag LOCUS_48250 6690 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 7379 6690 gene locus_tag LOCUS_48260 7379 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 9453 7369 gene locus_tag LOCUS_48270 9453 7369 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_48270 9897 9472 gene locus_tag LOCUS_48280 9897 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 10985 9900 gene locus_tag LOCUS_48290 gene moaA 10985 9900 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_48290 11178 12131 gene locus_tag LOCUS_48300 11178 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 12140 12916 gene locus_tag LOCUS_48310 12140 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 12941 14200 gene locus_tag LOCUS_48320 12941 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 14205 14642 gene locus_tag LOCUS_48330 14205 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 15318 14788 gene locus_tag LOCUS_48340 15318 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 16014 15337 gene locus_tag LOCUS_48350 16014 15337 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_48350 17720 16065 gene locus_tag LOCUS_48360 17720 16065 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_48360 18738 17737 gene locus_tag LOCUS_48370 gene coxB 18738 17737 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_48370 19607 18735 gene locus_tag LOCUS_48380 19607 18735 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922554.1 protein_id gnl|my_center|LOCUS_48380 20358 19621 gene locus_tag LOCUS_48390 20358 19621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 21625 20372 gene locus_tag LOCUS_48400 21625 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_48400 22266 21628 gene locus_tag LOCUS_48410 22266 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 22813 22268 gene locus_tag LOCUS_48420 22813 22268 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_48420 24232 22817 gene locus_tag LOCUS_48430 gene nrfD 24232 22817 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_48430 27373 24239 gene locus_tag LOCUS_48440 27373 24239 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_48440 28045 27392 gene locus_tag LOCUS_48450 28045 27392 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_48450 28969 28427 gene locus_tag LOCUS_48460 28969 28427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 29753 28974 gene locus_tag LOCUS_48470 29753 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 30694 29753 gene locus_tag LOCUS_48480 gene cyoE 30694 29753 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_48480 31172 30708 gene locus_tag LOCUS_48490 31172 30708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 31304 32257 gene locus_tag LOCUS_48500 31304 32257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 32282 33475 gene locus_tag LOCUS_48510 32282 33475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 33513 35000 gene locus_tag LOCUS_48520 33513 35000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 35651 35019 gene locus_tag LOCUS_48530 35651 35019 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388157.1 protein_id gnl|my_center|LOCUS_48530 37008 35653 gene locus_tag LOCUS_48540 37008 35653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 36989 37192 gene locus_tag LOCUS_48550 36989 37192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 39329 37197 gene locus_tag LOCUS_48560 39329 37197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 40777 39344 gene locus_tag LOCUS_48570 40777 39344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 41470 40913 gene locus_tag LOCUS_48580 41470 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 41746 41673 gene locus_tag LOCUS_t00680 41746 41673 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41916 41991 gene locus_tag LOCUS_t00690 41916 41991 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 42052 42975 gene locus_tag LOCUS_48590 42052 42975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 43845 43063 gene locus_tag LOCUS_48600 43845 43063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 44332 43847 gene locus_tag LOCUS_48610 44332 43847 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730198.1 protein_id gnl|my_center|LOCUS_48610 45008 44244 gene locus_tag LOCUS_48620 45008 44244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 45127 45741 gene locus_tag LOCUS_48630 gene wrbA 45127 45741 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889473.1 protein_id gnl|my_center|LOCUS_48630 46575 46360 gene locus_tag LOCUS_48640 46575 46360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 48348 46810 gene locus_tag LOCUS_48650 48348 46810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 49763 48456 gene locus_tag LOCUS_48660 49763 48456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 50442 50020 gene locus_tag LOCUS_48670 50442 50020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 51170 50439 gene locus_tag LOCUS_48680 51170 50439 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382286.1 protein_id gnl|my_center|LOCUS_48680 51258 52514 gene locus_tag LOCUS_48690 51258 52514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 52528 52836 gene locus_tag LOCUS_48700 52528 52836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 52915 53532 gene locus_tag LOCUS_48710 gene lpoB 52915 53532 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 protein_id gnl|my_center|LOCUS_48710 53561 54997 gene locus_tag LOCUS_48720 53561 54997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 55015 55632 gene locus_tag LOCUS_48730 55015 55632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 55955 55683 gene locus_tag LOCUS_48740 55955 55683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 59427 56053 gene locus_tag LOCUS_48750 59427 56053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 61358 59424 gene locus_tag LOCUS_48760 61358 59424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 63282 61459 gene locus_tag LOCUS_48770 63282 61459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 63433 64512 gene locus_tag LOCUS_48780 63433 64512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 66454 64604 gene locus_tag LOCUS_48790 66454 64604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 68100 66787 gene locus_tag LOCUS_48800 68100 66787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 68411 68163 gene locus_tag LOCUS_48810 68411 68163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 68292 69176 gene locus_tag LOCUS_48820 68292 69176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 69224 69829 gene locus_tag LOCUS_48830 69224 69829 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_48830 69967 70404 gene locus_tag LOCUS_48840 69967 70404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 71065 70409 gene locus_tag LOCUS_48850 71065 70409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 72128 71151 gene locus_tag LOCUS_48860 72128 71151 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_48860 74276 72219 gene locus_tag LOCUS_48870 74276 72219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 74686 75768 gene locus_tag LOCUS_48880 74686 75768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 77208 75784 gene locus_tag LOCUS_48890 77208 75784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 78497 77271 gene locus_tag LOCUS_48900 78497 77271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 80396 78585 gene locus_tag LOCUS_48910 80396 78585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 80335 80700 gene locus_tag LOCUS_48920 80335 80700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 82343 80901 gene locus_tag LOCUS_48930 82343 80901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 82993 82496 gene locus_tag LOCUS_48940 82993 82496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 83221 85422 gene locus_tag LOCUS_48950 83221 85422 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_48950 85427 87457 gene locus_tag LOCUS_48960 85427 87457 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_48960 88508 87462 gene locus_tag LOCUS_48970 88508 87462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 88667 90130 gene locus_tag LOCUS_48980 88667 90130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 91855 90245 gene locus_tag LOCUS_48990 91855 90245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 93582 91909 gene locus_tag LOCUS_49000 93582 91909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 94728 93907 gene locus_tag LOCUS_49010 94728 93907 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216809.1 protein_id gnl|my_center|LOCUS_49010 94787 95827 gene locus_tag LOCUS_49020 94787 95827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 95959 96963 gene locus_tag LOCUS_49030 95959 96963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 96966 97178 gene locus_tag LOCUS_49040 96966 97178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 97790 97197 gene locus_tag LOCUS_49050 97790 97197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49050 98860 97682 gene locus_tag LOCUS_49060 98860 97682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49060 98902 100398 gene locus_tag LOCUS_49070 98902 100398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 100646 102925 gene locus_tag LOCUS_49080 100646 102925 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202503.1 protein_id gnl|my_center|LOCUS_49080 102925 103767 gene locus_tag LOCUS_49090 102925 103767 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_49090 103764 104951 gene locus_tag LOCUS_49100 103764 104951 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_49100 105154 106350 gene locus_tag LOCUS_49110 105154 106350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 106852 106415 gene locus_tag LOCUS_49120 106852 106415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_49120 107263 106880 gene locus_tag LOCUS_49130 107263 106880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 107425 108615 gene locus_tag LOCUS_49140 107425 108615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 109656 108700 gene locus_tag LOCUS_49150 109656 108700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 109697 111052 gene locus_tag LOCUS_49160 109697 111052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 112804 111506 gene locus_tag LOCUS_49170 112804 111506 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_49170 114993 112801 gene locus_tag LOCUS_49180 gene fadJ 114993 112801 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214156.1 protein_id gnl|my_center|LOCUS_49180 116861 115152 gene locus_tag LOCUS_49190 116861 115152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 116999 116880 gene locus_tag LOCUS_49200 116999 116880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 118165 117077 gene locus_tag LOCUS_49210 118165 117077 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528474.1 protein_id gnl|my_center|LOCUS_49210 118337 119572 gene locus_tag LOCUS_49220 118337 119572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 121658 119589 gene locus_tag LOCUS_49230 121658 119589 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925311.1 protein_id gnl|my_center|LOCUS_49230 121701 122183 gene locus_tag LOCUS_49240 121701 122183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 123452 122187 gene locus_tag LOCUS_49250 123452 122187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 123630 124484 gene locus_tag LOCUS_49260 123630 124484 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_49260 124657 126690 gene locus_tag LOCUS_49270 124657 126690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_49270 126929 127726 gene locus_tag LOCUS_49280 126929 127726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 128025 127849 gene locus_tag LOCUS_49290 128025 127849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 127955 129172 gene locus_tag LOCUS_49300 127955 129172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 130602 129223 gene locus_tag LOCUS_49310 130602 129223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 131291 130599 gene locus_tag LOCUS_49320 131291 130599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 132247 131444 gene locus_tag LOCUS_49330 132247 131444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 132316 133383 gene locus_tag LOCUS_49340 132316 133383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 133377 134267 gene locus_tag LOCUS_49350 133377 134267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 134313 135620 gene locus_tag LOCUS_49360 134313 135620 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_49360 135826 139053 gene locus_tag LOCUS_49370 135826 139053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 139969 139058 gene locus_tag LOCUS_49380 139969 139058 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_49380 141492 139903 gene locus_tag LOCUS_49390 gene crtI 141492 139903 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_49390 141689 142483 gene locus_tag LOCUS_49400 141689 142483 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_49400 142611 143333 gene locus_tag LOCUS_49410 142611 143333 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 protein_id gnl|my_center|LOCUS_49410 143336 144856 gene locus_tag LOCUS_49420 143336 144856 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877361.1 protein_id gnl|my_center|LOCUS_49420 145956 145603 gene locus_tag LOCUS_49430 145956 145603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 146276 146007 gene locus_tag LOCUS_49440 146276 146007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49440 147311 150787 gene locus_tag LOCUS_49450 147311 150787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 151965 150784 gene locus_tag LOCUS_49460 151965 150784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 153098 152136 gene locus_tag LOCUS_49470 153098 152136 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065335.1 protein_id gnl|my_center|LOCUS_49470 153951 153100 gene locus_tag LOCUS_49480 153951 153100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 155625 153955 gene locus_tag LOCUS_49490 155625 153955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 155702 156454 gene locus_tag LOCUS_49500 155702 156454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 156479 156994 gene locus_tag LOCUS_49510 156479 156994 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528818.1 protein_id gnl|my_center|LOCUS_49510 159827 157029 gene locus_tag LOCUS_49520 159827 157029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 159724 160056 gene locus_tag LOCUS_49530 159724 160056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 160988 160248 gene locus_tag LOCUS_49540 160988 160248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 161319 163457 gene locus_tag LOCUS_49550 161319 163457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 163591 164454 gene locus_tag LOCUS_49560 163591 164454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 164578 165819 gene locus_tag LOCUS_49570 164578 165819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 165832 167448 gene locus_tag LOCUS_49580 165832 167448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 167995 169158 gene locus_tag LOCUS_49590 167995 169158 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_49590 169253 170092 gene locus_tag LOCUS_49600 169253 170092 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_49600 171428 170118 gene locus_tag LOCUS_49610 171428 170118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 171346 171762 gene locus_tag LOCUS_49620 171346 171762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 171773 172654 gene locus_tag LOCUS_49630 171773 172654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 172915 172658 gene locus_tag LOCUS_49640 172915 172658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 173883 172930 gene locus_tag LOCUS_49650 gene murB 173883 172930 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_49650 175273 173891 gene locus_tag LOCUS_49660 gene murC 175273 173891 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_49660 175333 176640 gene locus_tag LOCUS_49670 gene mutY 175333 176640 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_49670 177440 176739 gene locus_tag LOCUS_49680 177440 176739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 178210 177437 gene locus_tag LOCUS_49690 178210 177437 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_49690 180584 178374 gene locus_tag LOCUS_49700 180584 178374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 180694 181986 gene locus_tag LOCUS_49710 180694 181986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 182090 182677 gene locus_tag LOCUS_49720 182090 182677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 184243 182813 gene locus_tag LOCUS_49730 184243 182813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 185015 184740 gene locus_tag LOCUS_49740 185015 184740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49740 185623 184961 gene locus_tag LOCUS_49750 185623 184961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49750 186923 185748 gene locus_tag LOCUS_49760 186923 185748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 187809 186934 gene locus_tag LOCUS_49770 gene legD1 187809 186934 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_49770 189062 187809 gene locus_tag LOCUS_49780 189062 187809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 190524 189073 gene locus_tag LOCUS_49790 gene murF 190524 189073 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_49790 190645 191160 gene locus_tag LOCUS_49800 190645 191160 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_49800 191620 192741 gene locus_tag LOCUS_49810 gene mraY 191620 192741 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_49810 192814 194214 gene locus_tag LOCUS_49820 gene murD 192814 194214 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_49820 194282 195061 gene locus_tag LOCUS_49830 194282 195061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 195157 196026 gene locus_tag LOCUS_49840 195157 196026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 196363 196052 gene locus_tag LOCUS_49850 196363 196052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 196402 197280 gene locus_tag LOCUS_49860 196402 197280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 197328 198248 gene locus_tag LOCUS_49870 197328 198248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 198292 200562 gene locus_tag LOCUS_49880 gene cerN 198292 200562 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_49880 200577 201524 gene locus_tag LOCUS_49890 200577 201524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 202616 201531 gene locus_tag LOCUS_49900 202616 201531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 204305 203061 gene locus_tag LOCUS_49910 204305 203061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 204817 204377 gene locus_tag LOCUS_49920 204817 204377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 206431 205013 gene locus_tag LOCUS_49930 206431 205013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 207575 206421 gene locus_tag LOCUS_49940 207575 206421 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444889.1 protein_id gnl|my_center|LOCUS_49940 208028 207678 gene locus_tag LOCUS_49950 208028 207678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49950 208831 208490 gene locus_tag LOCUS_49960 208831 208490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 209075 209815 gene locus_tag LOCUS_49970 209075 209815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 209973 212360 gene locus_tag LOCUS_49980 209973 212360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 212394 213731 gene locus_tag LOCUS_49990 212394 213731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 213911 214516 gene locus_tag LOCUS_50000 213911 214516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 214522 214713 gene locus_tag LOCUS_50010 214522 214713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 214856 214707 gene locus_tag LOCUS_50020 214856 214707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 215389 215634 gene locus_tag LOCUS_50030 215389 215634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 215923 215660 gene locus_tag LOCUS_50040 215923 215660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 216351 215920 gene locus_tag LOCUS_50050 216351 215920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 216338 217012 gene locus_tag LOCUS_50060 216338 217012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 217904 216987 gene locus_tag LOCUS_50070 217904 216987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 218123 219904 gene locus_tag LOCUS_50080 218123 219904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 219908 223795 gene locus_tag LOCUS_50090 219908 223795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 223935 226607 gene locus_tag LOCUS_50100 223935 226607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 227577 226612 gene locus_tag LOCUS_50110 227577 226612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 228793 227648 gene locus_tag LOCUS_50120 228793 227648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 228869 230356 gene locus_tag LOCUS_50130 228869 230356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 231241 230381 gene locus_tag LOCUS_50140 231241 230381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50140 232068 231238 gene locus_tag LOCUS_50150 232068 231238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50150 232343 232065 gene locus_tag LOCUS_50160 232343 232065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50160 233329 232340 gene locus_tag LOCUS_50170 233329 232340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50170 234564 233323 gene locus_tag LOCUS_50180 234564 233323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 235206 234580 gene locus_tag LOCUS_50190 235206 234580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 236992 235844 gene locus_tag LOCUS_50200 236992 235844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50200 237648 237983 gene locus_tag LOCUS_50210 237648 237983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 237919 238365 gene locus_tag LOCUS_50220 237919 238365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 238344 238646 gene locus_tag LOCUS_50230 238344 238646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50230 238699 239487 gene locus_tag LOCUS_50240 238699 239487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 239445 240287 gene locus_tag LOCUS_50250 239445 240287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 240940 240542 gene locus_tag LOCUS_50260 240940 240542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 241083 241211 gene locus_tag LOCUS_50270 241083 241211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 241758 241937 gene locus_tag LOCUS_50280 241758 241937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 242419 242009 gene locus_tag LOCUS_50290 242419 242009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 243008 242475 gene locus_tag LOCUS_50300 243008 242475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 243816 243406 gene locus_tag LOCUS_50310 243816 243406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 245224 245388 gene locus_tag LOCUS_50320 245224 245388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 246985 245414 gene locus_tag LOCUS_50330 gene norR 246985 245414 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_50330 247128 247790 gene locus_tag LOCUS_50340 gene ytfE 247128 247790 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 protein_id gnl|my_center|LOCUS_50340 247865 248404 gene locus_tag LOCUS_50350 247865 248404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 248527 248333 gene locus_tag LOCUS_50360 248527 248333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 248788 250227 gene locus_tag LOCUS_50370 248788 250227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 250764 250246 gene locus_tag LOCUS_50380 250764 250246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 252568 250766 gene locus_tag LOCUS_50390 252568 250766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 254124 252565 gene locus_tag LOCUS_50400 254124 252565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 254741 254121 gene locus_tag LOCUS_50410 gene napG 254741 254121 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_50410 256845 254746 gene locus_tag LOCUS_50420 256845 254746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 257527 256751 gene locus_tag LOCUS_50430 257527 256751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50430 258392 257535 gene locus_tag LOCUS_50440 258392 257535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 258635 260152 gene locus_tag LOCUS_50450 258635 260152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 260161 261879 gene locus_tag LOCUS_50460 260161 261879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 262328 261876 gene locus_tag LOCUS_50470 262328 261876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 262572 263279 gene locus_tag LOCUS_50480 262572 263279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 263276 264826 gene locus_tag LOCUS_50490 263276 264826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 266020 264938 gene locus_tag LOCUS_50500 gene moaA 266020 264938 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969526.1 protein_id gnl|my_center|LOCUS_50500 267409 266462 gene locus_tag LOCUS_50510 267409 266462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 267691 267449 gene locus_tag LOCUS_50520 267691 267449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 268284 267688 gene locus_tag LOCUS_50530 268284 267688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50530 268772 268281 gene locus_tag LOCUS_50540 gene moaC 268772 268281 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_50540 269957 268779 gene locus_tag LOCUS_50550 269957 268779 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_50550 270310 270567 gene locus_tag LOCUS_50560 270310 270567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50560 270661 270918 gene locus_tag LOCUS_50570 270661 270918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 271920 274247 gene locus_tag LOCUS_50580 271920 274247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 274244 275230 gene locus_tag LOCUS_50590 274244 275230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 275248 276918 gene locus_tag LOCUS_50600 275248 276918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 277671 276931 gene locus_tag LOCUS_50610 277671 276931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 277804 278088 gene locus_tag LOCUS_50620 277804 278088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 279150 278176 gene locus_tag LOCUS_50630 279150 278176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 279695 279504 gene locus_tag LOCUS_50640 279695 279504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 280547 281023 gene locus_tag LOCUS_50650 280547 281023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 >Feature sequence13 2039 1032 gene locus_tag LOCUS_50660 2039 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 3388 2066 gene locus_tag LOCUS_50670 3388 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 4572 3388 gene locus_tag LOCUS_50680 4572 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50680 4974 5237 gene locus_tag LOCUS_50690 4974 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 6270 5323 gene locus_tag LOCUS_50700 6270 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50700 6440 6814 gene locus_tag LOCUS_50710 6440 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 8044 6953 gene locus_tag LOCUS_50720 gene mqnC 8044 6953 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_50720 7928 8311 gene locus_tag LOCUS_50730 7928 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 8314 9186 gene locus_tag LOCUS_50740 8314 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 9691 9170 gene locus_tag LOCUS_50750 9691 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 10030 10884 gene locus_tag LOCUS_50760 10030 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 12124 10871 gene locus_tag LOCUS_50770 12124 10871 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_50770 12114 13430 gene locus_tag LOCUS_50780 12114 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 14912 13530 gene locus_tag LOCUS_50790 14912 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 15973 18420 gene locus_tag LOCUS_50800 15973 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50800 20208 18598 gene locus_tag LOCUS_50810 gene murJ 20208 18598 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_50810 20473 21306 gene locus_tag LOCUS_50820 20473 21306 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_50820 21349 21804 gene locus_tag LOCUS_50830 gene dtd 21349 21804 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_50830 22767 22696 gene locus_tag LOCUS_t00700 22767 22696 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23442 22834 gene locus_tag LOCUS_50840 23442 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 23495 24139 gene locus_tag LOCUS_50850 23495 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 24490 24167 gene locus_tag LOCUS_50860 24490 24167 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_50860 25105 24494 gene locus_tag LOCUS_50870 25105 24494 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_50870 25214 26482 gene locus_tag LOCUS_50880 25214 26482 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_50880 26576 27313 gene locus_tag LOCUS_50890 26576 27313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_50890 28948 27329 gene locus_tag LOCUS_50900 28948 27329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 29155 29949 gene locus_tag LOCUS_50910 29155 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 29982 31277 gene locus_tag LOCUS_50920 29982 31277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 31454 32101 gene locus_tag LOCUS_50930 31454 32101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 32613 32281 gene locus_tag LOCUS_50940 gene trxA 32613 32281 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_50940 32757 33137 gene locus_tag LOCUS_50950 32757 33137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 33139 33966 gene locus_tag LOCUS_50960 33139 33966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 33963 35309 gene locus_tag LOCUS_50970 gene hemA 33963 35309 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 protein_id gnl|my_center|LOCUS_50970 35406 36392 gene locus_tag LOCUS_50980 gene hemC 35406 36392 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_50980 38340 36466 gene locus_tag LOCUS_50990 38340 36466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 39653 38373 gene locus_tag LOCUS_51000 39653 38373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 39773 40927 gene locus_tag LOCUS_51010 39773 40927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 40930 41784 gene locus_tag LOCUS_51020 40930 41784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 41781 42737 gene locus_tag LOCUS_51030 41781 42737 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_51030 43813 42797 gene locus_tag LOCUS_51040 gene ldeG 43813 42797 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 protein_id gnl|my_center|LOCUS_51040 44420 43806 gene locus_tag LOCUS_51050 44420 43806 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_51050 46117 44528 gene locus_tag LOCUS_51060 46117 44528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 46887 46192 gene locus_tag LOCUS_51070 46887 46192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 46950 48680 gene locus_tag LOCUS_51080 46950 48680 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_51080 49325 48693 gene locus_tag LOCUS_51090 49325 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 50420 49380 gene locus_tag LOCUS_51100 50420 49380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 50563 52047 gene locus_tag LOCUS_51110 50563 52047 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_51110 52919 52125 gene locus_tag LOCUS_51120 52919 52125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 53860 52916 gene locus_tag LOCUS_51130 53860 52916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 54048 54782 gene locus_tag LOCUS_51140 54048 54782 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_51140 55956 54904 gene locus_tag LOCUS_51150 55956 54904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 56946 55957 gene locus_tag LOCUS_51160 56946 55957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 57242 63535 gene locus_tag LOCUS_51170 57242 63535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 64042 63779 gene locus_tag LOCUS_51180 64042 63779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 64750 65817 gene locus_tag LOCUS_51190 gene argC 64750 65817 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_51190 65814 66653 gene locus_tag LOCUS_51200 gene argB 65814 66653 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_51200 66819 68042 gene locus_tag LOCUS_51210 66819 68042 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064899.1 protein_id gnl|my_center|LOCUS_51210 68399 69298 gene locus_tag LOCUS_51220 68399 69298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 71525 69426 gene locus_tag LOCUS_51230 gene shc 71525 69426 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_51230 72237 71536 gene locus_tag LOCUS_51240 72237 71536 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530032.1 protein_id gnl|my_center|LOCUS_51240 72417 73262 gene locus_tag LOCUS_51250 72417 73262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 73999 73277 gene locus_tag LOCUS_51260 73999 73277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 74086 75729 gene locus_tag LOCUS_51270 74086 75729 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_51270 75726 77051 gene locus_tag LOCUS_51280 75726 77051 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_51280 77901 77122 gene locus_tag LOCUS_51290 77901 77122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 77858 78349 gene locus_tag LOCUS_51300 77858 78349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 79452 78244 gene locus_tag LOCUS_51310 79452 78244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 79451 80224 gene locus_tag LOCUS_51320 79451 80224 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_51320 82127 80211 gene locus_tag LOCUS_51330 82127 80211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 83012 82197 gene locus_tag LOCUS_51340 83012 82197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 83849 83040 gene locus_tag LOCUS_51350 83849 83040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 87094 83873 gene locus_tag LOCUS_51360 87094 83873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 88164 87697 gene locus_tag LOCUS_51370 88164 87697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 89285 88239 gene locus_tag LOCUS_51380 89285 88239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 90194 89337 gene locus_tag LOCUS_51390 90194 89337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 90783 90199 gene locus_tag LOCUS_51400 90783 90199 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142963.1 protein_id gnl|my_center|LOCUS_51400 92415 90952 gene locus_tag LOCUS_51410 92415 90952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 93245 94948 gene locus_tag LOCUS_51420 93245 94948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 95499 94921 gene locus_tag LOCUS_51430 95499 94921 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143027.1 protein_id gnl|my_center|LOCUS_51430 96463 95543 gene locus_tag LOCUS_51440 gene yedA 96463 95543 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_51440 97555 96566 gene locus_tag LOCUS_51450 97555 96566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 99112 97670 gene locus_tag LOCUS_51460 99112 97670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 99942 99109 gene locus_tag LOCUS_51470 99942 99109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 101067 100078 gene locus_tag LOCUS_51480 101067 100078 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_51480 102076 101081 gene locus_tag LOCUS_51490 102076 101081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 103580 102303 gene locus_tag LOCUS_51500 103580 102303 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_51500 103636 104421 gene locus_tag LOCUS_51510 103636 104421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146462316.1 protein_id gnl|my_center|LOCUS_51510 104827 106482 gene locus_tag LOCUS_51520 104827 106482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 108298 106598 gene locus_tag LOCUS_51530 108298 106598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 109571 108663 gene locus_tag LOCUS_51540 109571 108663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 109938 109615 gene locus_tag LOCUS_51550 109938 109615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 109937 110965 gene locus_tag LOCUS_51560 109937 110965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 110962 111801 gene locus_tag LOCUS_51570 110962 111801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 112074 111826 gene locus_tag LOCUS_51580 112074 111826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 112049 113368 gene locus_tag LOCUS_51590 112049 113368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 113992 113513 gene locus_tag LOCUS_51600 113992 113513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 116771 114171 gene locus_tag LOCUS_51610 116771 114171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 121122 116734 gene locus_tag LOCUS_51620 121122 116734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51620 121194 122993 gene locus_tag LOCUS_51630 121194 122993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 123287 123925 gene locus_tag LOCUS_51640 123287 123925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 125009 124008 gene locus_tag LOCUS_51650 125009 124008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 124900 125442 gene locus_tag LOCUS_51660 124900 125442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 125488 126510 gene locus_tag LOCUS_51670 125488 126510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 126604 128247 gene locus_tag LOCUS_51680 126604 128247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 128616 130136 gene locus_tag LOCUS_51690 128616 130136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 130241 130798 gene locus_tag LOCUS_51700 130241 130798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 131045 131968 gene locus_tag LOCUS_51710 131045 131968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 132012 132410 gene locus_tag LOCUS_51720 132012 132410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 134593 132425 gene locus_tag LOCUS_51730 134593 132425 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_51730 136941 134599 gene locus_tag LOCUS_51740 136941 134599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 137590 136955 gene locus_tag LOCUS_51750 137590 136955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 138381 137587 gene locus_tag LOCUS_51760 138381 137587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 141626 138537 gene locus_tag LOCUS_51770 141626 138537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 142023 141616 gene locus_tag LOCUS_51780 142023 141616 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_51780 142737 142036 gene locus_tag LOCUS_51790 142737 142036 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_51790 143819 142734 gene locus_tag LOCUS_51800 143819 142734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 144618 143824 gene locus_tag LOCUS_51810 144618 143824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 146116 144632 gene locus_tag LOCUS_51820 146116 144632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 146649 146113 gene locus_tag LOCUS_51830 146649 146113 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_51830 146833 146654 gene locus_tag LOCUS_51840 146833 146654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648317.1 protein_id gnl|my_center|LOCUS_51840 147201 146830 gene locus_tag LOCUS_51850 147201 146830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_51850 147641 147204 gene locus_tag LOCUS_51860 147641 147204 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_51860 148822 147671 gene locus_tag LOCUS_51870 148822 147671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 149999 148827 gene locus_tag LOCUS_51880 149999 148827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 150612 150022 gene locus_tag LOCUS_51890 150612 150022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 151159 150809 gene locus_tag LOCUS_51900 151159 150809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 151062 152597 gene locus_tag LOCUS_51910 151062 152597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 152573 153034 gene locus_tag LOCUS_51920 152573 153034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 153100 154680 gene locus_tag LOCUS_51930 153100 154680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 154780 155298 gene locus_tag LOCUS_51940 154780 155298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 155259 155591 gene locus_tag LOCUS_51950 155259 155591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 155605 155829 gene locus_tag LOCUS_51960 155605 155829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 157197 155974 gene locus_tag LOCUS_51970 157197 155974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 157904 159601 gene locus_tag LOCUS_51980 157904 159601 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096504.1 protein_id gnl|my_center|LOCUS_51980 159961 160683 gene locus_tag LOCUS_51990 159961 160683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 162118 160691 gene locus_tag LOCUS_52000 162118 160691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 162992 162261 gene locus_tag LOCUS_52010 162992 162261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 163179 163925 gene locus_tag LOCUS_52020 163179 163925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 164058 165521 gene locus_tag LOCUS_52030 164058 165521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 166619 165546 gene locus_tag LOCUS_52040 166619 165546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 167230 166685 gene locus_tag LOCUS_52050 gene lspA 167230 166685 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 protein_id gnl|my_center|LOCUS_52050 167309 167650 gene locus_tag LOCUS_52060 167309 167650 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336246.1 protein_id gnl|my_center|LOCUS_52060 167652 168575 gene locus_tag LOCUS_52070 167652 168575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 167882 167964 gene locus_tag LOCUS_t00710 167882 167964 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 169630 168623 gene locus_tag LOCUS_52080 169630 168623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 170156 169755 gene locus_tag LOCUS_52090 170156 169755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 170716 170210 gene locus_tag LOCUS_52100 170716 170210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 171262 170750 gene locus_tag LOCUS_52110 171262 170750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 173528 171927 gene locus_tag LOCUS_52120 173528 171927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 174910 173660 gene locus_tag LOCUS_52130 174910 173660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 174837 175097 gene locus_tag LOCUS_52140 174837 175097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 179194 175217 gene locus_tag LOCUS_52150 179194 175217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 180938 179235 gene locus_tag LOCUS_52160 180938 179235 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_52160 182720 181095 gene locus_tag LOCUS_52170 182720 181095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 183367 182987 gene locus_tag LOCUS_52180 183367 182987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 183734 183504 gene locus_tag LOCUS_52190 183734 183504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 183630 184910 gene locus_tag LOCUS_52200 183630 184910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 185938 184946 gene locus_tag LOCUS_52210 185938 184946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 186166 186017 gene locus_tag LOCUS_52220 186166 186017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 186333 186557 gene locus_tag LOCUS_52230 186333 186557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 187258 186581 gene locus_tag LOCUS_52240 187258 186581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 189865 187472 gene locus_tag LOCUS_52250 189865 187472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 189973 190470 gene locus_tag LOCUS_52260 189973 190470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 191808 190486 gene locus_tag LOCUS_52270 191808 190486 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_52270 191923 193845 gene locus_tag LOCUS_52280 gene ftsH 191923 193845 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_52280 196917 193858 gene locus_tag LOCUS_52290 196917 193858 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_52290 198083 196917 gene locus_tag LOCUS_52300 198083 196917 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327094.1 protein_id gnl|my_center|LOCUS_52300 199437 198064 gene locus_tag LOCUS_52310 199437 198064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 200543 199434 gene locus_tag LOCUS_52320 200543 199434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 201106 200540 gene locus_tag LOCUS_52330 gene pmrA 201106 200540 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_52330 200993 201304 gene locus_tag LOCUS_52340 200993 201304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 201443 202996 gene locus_tag LOCUS_52350 201443 202996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 202984 203430 gene locus_tag LOCUS_52360 202984 203430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 203603 204526 gene locus_tag LOCUS_52370 203603 204526 CDS product SO2930 family diheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072835.1 protein_id gnl|my_center|LOCUS_52370 204664 205737 gene locus_tag LOCUS_52380 204664 205737 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_52380 206040 205747 gene locus_tag LOCUS_52390 206040 205747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 206472 206675 gene locus_tag LOCUS_52400 206472 206675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 206768 207685 gene locus_tag LOCUS_52410 206768 207685 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190190.1 protein_id gnl|my_center|LOCUS_52410 207812 211363 gene locus_tag LOCUS_52420 207812 211363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 212441 212770 gene locus_tag LOCUS_52430 212441 212770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 213898 212801 gene locus_tag LOCUS_52440 213898 212801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 214536 213895 gene locus_tag LOCUS_52450 214536 213895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 216217 214889 gene locus_tag LOCUS_52460 216217 214889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 216917 216252 gene locus_tag LOCUS_52470 216917 216252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 216996 217208 gene locus_tag LOCUS_52480 216996 217208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 217308 218045 gene locus_tag LOCUS_52490 217308 218045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 220257 218068 gene locus_tag LOCUS_52500 220257 218068 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403487.1 protein_id gnl|my_center|LOCUS_52500 221712 220360 gene locus_tag LOCUS_52510 221712 220360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 224195 221823 gene locus_tag LOCUS_52520 224195 221823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 225714 224242 gene locus_tag LOCUS_52530 225714 224242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 226432 227070 gene locus_tag LOCUS_52540 226432 227070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 228293 227808 gene locus_tag LOCUS_52550 228293 227808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 228937 228293 gene locus_tag LOCUS_52560 228937 228293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 230875 231975 gene locus_tag LOCUS_52570 230875 231975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 233748 232009 gene locus_tag LOCUS_52580 233748 232009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 234620 233751 gene locus_tag LOCUS_52590 234620 233751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 234715 237276 gene locus_tag LOCUS_52600 234715 237276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 237554 238027 gene locus_tag LOCUS_52610 237554 238027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 238484 238161 gene locus_tag LOCUS_52620 238484 238161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 238920 239342 gene locus_tag LOCUS_52630 238920 239342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 240535 240110 gene locus_tag LOCUS_52640 240535 240110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 240416 240865 gene locus_tag LOCUS_52650 240416 240865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52650 241034 241294 gene locus_tag LOCUS_52660 241034 241294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52660 242200 241415 gene locus_tag LOCUS_52670 gene istB 242200 241415 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_52670 242790 242197 gene locus_tag LOCUS_52680 242790 242197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 244376 242868 gene locus_tag LOCUS_52690 gene ltrA 244376 242868 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145832239.1 protein_id gnl|my_center|LOCUS_52690 244375 244935 gene locus_tag LOCUS_52700 244375 244935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 245133 244954 gene locus_tag LOCUS_52710 245133 244954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 246633 245377 gene locus_tag LOCUS_52720 246633 245377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 248955 248098 gene locus_tag LOCUS_52730 248955 248098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 250449 250009 gene locus_tag LOCUS_52740 250449 250009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 250781 250446 gene locus_tag LOCUS_52750 250781 250446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 251938 251015 gene locus_tag LOCUS_52760 251938 251015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 253585 252998 gene locus_tag LOCUS_52770 253585 252998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 >Feature sequence14 575 258 gene locus_tag LOCUS_52780 575 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 1138 557 gene locus_tag LOCUS_52790 1138 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 1959 1024 gene locus_tag LOCUS_52800 1959 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 2378 2962 gene locus_tag LOCUS_52810 2378 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 2977 3423 gene locus_tag LOCUS_52820 2977 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 3420 3941 gene locus_tag LOCUS_52830 3420 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 4510 4803 gene locus_tag LOCUS_52840 4510 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 4875 5690 gene locus_tag LOCUS_52850 4875 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 5694 6392 gene locus_tag LOCUS_52860 5694 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 6389 7234 gene locus_tag LOCUS_52870 6389 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 7739 8245 gene locus_tag LOCUS_52880 7739 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 8235 10637 gene locus_tag LOCUS_52890 8235 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 10745 11581 gene locus_tag LOCUS_52900 10745 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 11583 11981 gene locus_tag LOCUS_52910 11583 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 11978 12649 gene locus_tag LOCUS_52920 11978 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 12759 19757 gene locus_tag LOCUS_52930 12759 19757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 19766 20662 gene locus_tag LOCUS_52940 19766 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 20659 21585 gene locus_tag LOCUS_52950 20659 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 21613 21996 gene locus_tag LOCUS_52960 21613 21996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 22026 22703 gene locus_tag LOCUS_52970 22026 22703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 22706 22921 gene locus_tag LOCUS_52980 22706 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 22924 23217 gene locus_tag LOCUS_52990 22924 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 23214 23783 gene locus_tag LOCUS_53000 23214 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 23868 24509 gene locus_tag LOCUS_53010 23868 24509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 24484 24912 gene locus_tag LOCUS_53020 24484 24912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 24905 25732 gene locus_tag LOCUS_53030 24905 25732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 25799 26839 gene locus_tag LOCUS_53040 25799 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 26911 27504 gene locus_tag LOCUS_53050 26911 27504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 27508 27711 gene locus_tag LOCUS_53060 27508 27711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 27786 27968 gene locus_tag LOCUS_53070 27786 27968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 28044 28589 gene locus_tag LOCUS_53080 28044 28589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 29646 30023 gene locus_tag LOCUS_53090 29646 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 30381 32090 gene locus_tag LOCUS_53100 30381 32090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 32101 33711 gene locus_tag LOCUS_53110 32101 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 33783 34601 gene locus_tag LOCUS_53120 33783 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 34622 36034 gene locus_tag LOCUS_53130 34622 36034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 35973 37700 gene locus_tag LOCUS_53140 35973 37700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 37697 38047 gene locus_tag LOCUS_53150 37697 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 38047 40548 gene locus_tag LOCUS_53160 38047 40548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 40564 42999 gene locus_tag LOCUS_53170 40564 42999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 42896 44959 gene locus_tag LOCUS_53180 42896 44959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 45189 46364 gene locus_tag LOCUS_53190 45189 46364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 47098 47541 gene locus_tag LOCUS_53200 47098 47541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53200 47538 48551 gene locus_tag LOCUS_53210 47538 48551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53210 48733 49908 gene locus_tag LOCUS_53220 48733 49908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53220 49835 50290 gene locus_tag LOCUS_53230 49835 50290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 50355 50822 gene locus_tag LOCUS_53240 50355 50822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53240 50823 51170 gene locus_tag LOCUS_53250 50823 51170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53250 51157 52770 gene locus_tag LOCUS_53260 51157 52770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53260 52844 53746 gene locus_tag LOCUS_53270 52844 53746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53270 53839 54756 gene locus_tag LOCUS_53280 53839 54756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53280 56259 54877 gene locus_tag LOCUS_53290 56259 54877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 58827 56896 gene locus_tag LOCUS_53300 58827 56896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 59912 58827 gene locus_tag LOCUS_53310 59912 58827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 62250 60103 gene locus_tag LOCUS_53320 62250 60103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 63062 62247 gene locus_tag LOCUS_53330 63062 62247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 63646 63200 gene locus_tag LOCUS_53340 63646 63200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 64017 64313 gene locus_tag LOCUS_53350 64017 64313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 65203 64976 gene locus_tag LOCUS_53360 65203 64976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 65693 66169 gene locus_tag LOCUS_53370 65693 66169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 66157 66600 gene locus_tag LOCUS_53380 66157 66600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 67185 66796 gene locus_tag LOCUS_53390 67185 66796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 68130 67783 gene locus_tag LOCUS_53400 68130 67783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 68196 68405 gene locus_tag LOCUS_53410 68196 68405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 68779 69207 gene locus_tag LOCUS_53420 68779 69207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 70090 69317 gene locus_tag LOCUS_53430 70090 69317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 71399 70152 gene locus_tag LOCUS_53440 71399 70152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 72987 71470 gene locus_tag LOCUS_53450 72987 71470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 72869 73243 gene locus_tag LOCUS_53460 72869 73243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 73253 74917 gene locus_tag LOCUS_53470 73253 74917 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_53470 74986 75192 gene locus_tag LOCUS_53480 74986 75192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 75356 76330 gene locus_tag LOCUS_53490 75356 76330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 78072 77311 gene locus_tag LOCUS_53500 78072 77311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 78252 78485 gene locus_tag LOCUS_53510 78252 78485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 79533 78493 gene locus_tag LOCUS_53520 79533 78493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 80368 79550 gene locus_tag LOCUS_53530 80368 79550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53530 83340 81004 gene locus_tag LOCUS_53540 83340 81004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 85062 83440 gene locus_tag LOCUS_53550 85062 83440 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113489.1 protein_id gnl|my_center|LOCUS_53550 85332 86765 gene locus_tag LOCUS_53560 85332 86765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 87014 89149 gene locus_tag LOCUS_53570 87014 89149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 89815 89225 gene locus_tag LOCUS_53580 89815 89225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 90030 91142 gene locus_tag LOCUS_53590 90030 91142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 91181 92392 gene locus_tag LOCUS_53600 91181 92392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 92365 92913 gene locus_tag LOCUS_53610 92365 92913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 93250 94875 gene locus_tag LOCUS_53620 93250 94875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 95368 95144 gene locus_tag LOCUS_53630 95368 95144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 95730 95512 gene locus_tag LOCUS_53640 95730 95512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 96941 95850 gene locus_tag LOCUS_53650 96941 95850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53650 97663 96938 gene locus_tag LOCUS_53660 97663 96938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 97755 98960 gene locus_tag LOCUS_53670 97755 98960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 99223 101778 gene locus_tag LOCUS_53680 99223 101778 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_53680 103061 101928 gene locus_tag LOCUS_53690 103061 101928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 104578 103070 gene locus_tag LOCUS_53700 104578 103070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 106553 104679 gene locus_tag LOCUS_53710 106553 104679 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_53710 108290 106680 gene locus_tag LOCUS_53720 108290 106680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 108475 109833 gene locus_tag LOCUS_53730 108475 109833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 111153 109957 gene locus_tag LOCUS_53740 111153 109957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 113621 111477 gene locus_tag LOCUS_53750 113621 111477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 113509 115089 gene locus_tag LOCUS_53760 113509 115089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 115099 116514 gene locus_tag LOCUS_53770 115099 116514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 117345 116569 gene locus_tag LOCUS_53780 117345 116569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 117441 118094 gene locus_tag LOCUS_53790 gene msrA 117441 118094 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_53790 118958 118161 gene locus_tag LOCUS_53800 118958 118161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 118876 119790 gene locus_tag LOCUS_53810 118876 119790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 120816 119794 gene locus_tag LOCUS_53820 120816 119794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 121069 120821 gene locus_tag LOCUS_53830 121069 120821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 122162 121263 gene locus_tag LOCUS_53840 122162 121263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 122648 122983 gene locus_tag LOCUS_53850 122648 122983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 122976 123578 gene locus_tag LOCUS_53860 122976 123578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 125420 123582 gene locus_tag LOCUS_53870 125420 123582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 125651 126571 gene locus_tag LOCUS_53880 125651 126571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 126568 126987 gene locus_tag LOCUS_53890 126568 126987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 128473 127049 gene locus_tag LOCUS_53900 128473 127049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 128590 129981 gene locus_tag LOCUS_53910 128590 129981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53910 129978 130562 gene locus_tag LOCUS_53920 129978 130562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53920 130908 131138 gene locus_tag LOCUS_53930 130908 131138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 131702 131151 gene locus_tag LOCUS_53940 131702 131151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 133057 131816 gene locus_tag LOCUS_53950 gene rpoD 133057 131816 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476033.1 protein_id gnl|my_center|LOCUS_53950 133667 133227 gene locus_tag LOCUS_53960 133667 133227 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055011290.1 protein_id gnl|my_center|LOCUS_53960 134543 133959 gene locus_tag LOCUS_53970 134543 133959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 134807 136915 gene locus_tag LOCUS_53980 134807 136915 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_53980 137024 138070 gene locus_tag LOCUS_53990 137024 138070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 138144 138857 gene locus_tag LOCUS_54000 138144 138857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 139488 138874 gene locus_tag LOCUS_54010 139488 138874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 140158 139604 gene locus_tag LOCUS_54020 140158 139604 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258945.1 protein_id gnl|my_center|LOCUS_54020 140744 140160 gene locus_tag LOCUS_54030 140744 140160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 142011 140833 gene locus_tag LOCUS_54040 142011 140833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 142399 143370 gene locus_tag LOCUS_54050 142399 143370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_54050 143530 144843 gene locus_tag LOCUS_54060 143530 144843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_54060 144908 145516 gene locus_tag LOCUS_54070 144908 145516 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 protein_id gnl|my_center|LOCUS_54070 145669 146217 gene locus_tag LOCUS_54080 gene thpR 145669 146217 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 protein_id gnl|my_center|LOCUS_54080 146221 147159 gene locus_tag LOCUS_54090 146221 147159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_54090 147156 147980 gene locus_tag LOCUS_54100 147156 147980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 148218 148973 gene locus_tag LOCUS_54110 148218 148973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 149000 151222 gene locus_tag LOCUS_54120 149000 151222 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_54120 151226 156664 gene locus_tag LOCUS_54130 151226 156664 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_54130 156805 157599 gene locus_tag LOCUS_54140 156805 157599 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_54140 158127 157606 gene locus_tag LOCUS_54150 158127 157606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 158105 158476 gene locus_tag LOCUS_54160 158105 158476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 158864 158469 gene locus_tag LOCUS_54170 gene apaG 158864 158469 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 protein_id gnl|my_center|LOCUS_54170 159514 158954 gene locus_tag LOCUS_54180 159514 158954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 159548 160507 gene locus_tag LOCUS_54190 gene grxD 159548 160507 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038466.1 protein_id gnl|my_center|LOCUS_54190 160573 161031 gene locus_tag LOCUS_54200 160573 161031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 161785 161111 gene locus_tag LOCUS_54210 161785 161111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 163236 161728 gene locus_tag LOCUS_54220 163236 161728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 163854 163255 gene locus_tag LOCUS_54230 163854 163255 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_54230 164062 164553 gene locus_tag LOCUS_54240 164062 164553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 166946 164550 gene locus_tag LOCUS_54250 166946 164550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 167103 167606 gene locus_tag LOCUS_54260 167103 167606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 168126 167608 gene locus_tag LOCUS_54270 168126 167608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 171077 168117 gene locus_tag LOCUS_54280 171077 168117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 172412 171132 gene locus_tag LOCUS_54290 172412 171132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 173059 172403 gene locus_tag LOCUS_54300 173059 172403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 174128 173526 gene locus_tag LOCUS_54310 174128 173526 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262254.1 protein_id gnl|my_center|LOCUS_54310 174239 175453 gene locus_tag LOCUS_54320 174239 175453 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051831.1 protein_id gnl|my_center|LOCUS_54320 175475 176443 gene locus_tag LOCUS_54330 175475 176443 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_54330 176515 178971 gene locus_tag LOCUS_54340 gene qqaR 176515 178971 CDS product N-acyl homoserine lactone acylase QqaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_54340 179037 181457 gene locus_tag LOCUS_54350 179037 181457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 181711 183213 gene locus_tag LOCUS_54360 181711 183213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 183346 183948 gene locus_tag LOCUS_54370 183346 183948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 183964 184671 gene locus_tag LOCUS_54380 183964 184671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 184702 185385 gene locus_tag LOCUS_54390 184702 185385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 185373 186158 gene locus_tag LOCUS_54400 185373 186158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 187063 186287 gene locus_tag LOCUS_54410 187063 186287 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_54410 188715 187099 gene locus_tag LOCUS_54420 188715 187099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 188848 189696 gene locus_tag LOCUS_54430 188848 189696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 189696 191018 gene locus_tag LOCUS_54440 189696 191018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 194061 190993 gene locus_tag LOCUS_54450 194061 190993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 194356 195264 gene locus_tag LOCUS_54460 194356 195264 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_54460 195341 198172 gene locus_tag LOCUS_54470 195341 198172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 198350 199108 gene locus_tag LOCUS_54480 198350 199108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 199302 201038 gene locus_tag LOCUS_54490 199302 201038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 203458 201011 gene locus_tag LOCUS_54500 203458 201011 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_54500 204704 203463 gene locus_tag LOCUS_54510 204704 203463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 204791 205390 gene locus_tag LOCUS_54520 204791 205390 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_54520 205959 205417 gene locus_tag LOCUS_54530 205959 205417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 206456 205965 gene locus_tag LOCUS_54540 206456 205965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 207347 206559 gene locus_tag LOCUS_54550 207347 206559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 208349 207417 gene locus_tag LOCUS_54560 208349 207417 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064376.1 protein_id gnl|my_center|LOCUS_54560 208512 209696 gene locus_tag LOCUS_54570 gene ahcY 208512 209696 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_54570 209754 210464 gene locus_tag LOCUS_54580 209754 210464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 211181 210507 gene locus_tag LOCUS_54590 211181 210507 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565042.1 protein_id gnl|my_center|LOCUS_54590 211386 211745 gene locus_tag LOCUS_54600 211386 211745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 211742 212626 gene locus_tag LOCUS_54610 211742 212626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 212736 215615 gene locus_tag LOCUS_54620 212736 215615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 216567 215650 gene locus_tag LOCUS_54630 216567 215650 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 protein_id gnl|my_center|LOCUS_54630 216689 217033 gene locus_tag LOCUS_54640 216689 217033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 217974 217075 gene locus_tag LOCUS_54650 217974 217075 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263598.1 protein_id gnl|my_center|LOCUS_54650 218882 218040 gene locus_tag LOCUS_54660 218882 218040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 219231 220922 gene locus_tag LOCUS_54670 219231 220922 CDS product choice-of-anchor Q domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259743.1 protein_id gnl|my_center|LOCUS_54670 221069 221689 gene locus_tag LOCUS_54680 221069 221689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 222289 221741 gene locus_tag LOCUS_54690 222289 221741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 223147 222302 gene locus_tag LOCUS_54700 223147 222302 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_54700 223283 224725 gene locus_tag LOCUS_54710 223283 224725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 226181 224736 gene locus_tag LOCUS_54720 226181 224736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 229298 226233 gene locus_tag LOCUS_54730 229298 226233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 230107 230709 gene locus_tag LOCUS_54740 230107 230709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 231028 230744 gene locus_tag LOCUS_54750 231028 230744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 231376 231041 gene locus_tag LOCUS_54760 231376 231041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 231498 231686 gene locus_tag LOCUS_54770 231498 231686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 >Feature sequence15 1076 327 gene locus_tag LOCUS_54780 gene pyrH 1076 327 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_54780 1836 1171 gene locus_tag LOCUS_54790 gene tsf 1836 1171 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_54790 2713 1841 gene locus_tag LOCUS_54800 gene rpsB 2713 1841 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_54800 3094 3963 gene locus_tag LOCUS_54810 3094 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 3974 4555 gene locus_tag LOCUS_54820 3974 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 4569 6563 gene locus_tag LOCUS_54830 4569 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 6553 6675 gene locus_tag LOCUS_54840 6553 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 7751 6924 gene locus_tag LOCUS_54850 7751 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 7972 9357 gene locus_tag LOCUS_54860 7972 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 9411 10307 gene locus_tag LOCUS_54870 9411 10307 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_54870 11450 10389 gene locus_tag LOCUS_54880 11450 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 11733 12038 gene locus_tag LOCUS_54890 11733 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 12035 14179 gene locus_tag LOCUS_54900 12035 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 15291 14176 gene locus_tag LOCUS_54910 15291 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 15911 16396 gene locus_tag LOCUS_54920 15911 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 17329 16484 gene locus_tag LOCUS_54930 17329 16484 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_54930 17501 18508 gene locus_tag LOCUS_54940 17501 18508 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_54940 18524 19042 gene locus_tag LOCUS_54950 18524 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 19163 19507 gene locus_tag LOCUS_54960 19163 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 20183 19737 gene locus_tag LOCUS_54970 20183 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 22098 20215 gene locus_tag LOCUS_54980 22098 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 22097 23398 gene locus_tag LOCUS_54990 22097 23398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 23836 24498 gene locus_tag LOCUS_55000 23836 24498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 24641 25195 gene locus_tag LOCUS_55010 24641 25195 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_55010 25207 25845 gene locus_tag LOCUS_55020 gene sigM 25207 25845 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087658.1 protein_id gnl|my_center|LOCUS_55020 26021 27481 gene locus_tag LOCUS_55030 26021 27481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 27478 28608 gene locus_tag LOCUS_55040 27478 28608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 28656 32453 gene locus_tag LOCUS_55050 28656 32453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 33397 32597 gene locus_tag LOCUS_55060 33397 32597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 33624 34163 gene locus_tag LOCUS_55070 33624 34163 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388292.1 protein_id gnl|my_center|LOCUS_55070 34240 36111 gene locus_tag LOCUS_55080 34240 36111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 37240 36155 gene locus_tag LOCUS_55090 37240 36155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 37400 38956 gene locus_tag LOCUS_55100 37400 38956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 39979 38957 gene locus_tag LOCUS_55110 39979 38957 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039254.1 protein_id gnl|my_center|LOCUS_55110 41172 39976 gene locus_tag LOCUS_55120 41172 39976 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_55120 43061 41220 gene locus_tag LOCUS_55130 43061 41220 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921377.1 protein_id gnl|my_center|LOCUS_55130 43941 43132 gene locus_tag LOCUS_55140 43941 43132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 44019 44246 gene locus_tag LOCUS_55150 44019 44246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 44267 45877 gene locus_tag LOCUS_55160 44267 45877 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_55160 46438 46013 gene locus_tag LOCUS_55170 46438 46013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 46353 47675 gene locus_tag LOCUS_55180 46353 47675 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_55180 49196 47814 gene locus_tag LOCUS_55190 49196 47814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 51611 49350 gene locus_tag LOCUS_55200 51611 49350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 53220 52018 gene locus_tag LOCUS_55210 gene moeB 53220 52018 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_55210 53368 54399 gene locus_tag LOCUS_55220 53368 54399 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_55220 54415 55377 gene locus_tag LOCUS_55230 54415 55377 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035348.1 protein_id gnl|my_center|LOCUS_55230 55598 57439 gene locus_tag LOCUS_55240 55598 57439 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55240 57462 57692 gene locus_tag LOCUS_55250 57462 57692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 58556 57744 gene locus_tag LOCUS_55260 58556 57744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 61371 58789 gene locus_tag LOCUS_55270 61371 58789 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_55270 61609 62277 gene locus_tag LOCUS_55280 61609 62277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 64357 62288 gene locus_tag LOCUS_55290 64357 62288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 64482 65972 gene locus_tag LOCUS_55300 64482 65972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 66406 65993 gene locus_tag LOCUS_55310 66406 65993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 67113 66475 gene locus_tag LOCUS_55320 67113 66475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 67427 67218 gene locus_tag LOCUS_55330 67427 67218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 68672 67593 gene locus_tag LOCUS_55340 68672 67593 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_55340 68675 69202 gene locus_tag LOCUS_55350 68675 69202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55350 69124 69318 gene locus_tag LOCUS_55360 69124 69318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55360 69388 69963 gene locus_tag LOCUS_55370 69388 69963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 70527 69967 gene locus_tag LOCUS_55380 70527 69967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 71366 70611 gene locus_tag LOCUS_55390 71366 70611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 72080 71394 gene locus_tag LOCUS_55400 72080 71394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 72208 73902 gene locus_tag LOCUS_55410 72208 73902 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_55410 74101 74027 gene locus_tag LOCUS_t00720 74101 74027 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 74234 74731 gene locus_tag LOCUS_55420 74234 74731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 75299 74814 gene locus_tag LOCUS_55430 75299 74814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 76927 75299 gene locus_tag LOCUS_55440 76927 75299 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_55440 76998 77528 gene locus_tag LOCUS_55450 76998 77528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 78340 77534 gene locus_tag LOCUS_55460 78340 77534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 78990 78358 gene locus_tag LOCUS_55470 gene hisB 78990 78358 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_55470 79603 78995 gene locus_tag LOCUS_55480 79603 78995 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_55480 80973 79621 gene locus_tag LOCUS_55490 80973 79621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 81829 81170 gene locus_tag LOCUS_55500 81829 81170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 83160 81826 gene locus_tag LOCUS_55510 83160 81826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 83877 83344 gene locus_tag LOCUS_55520 83877 83344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 84449 83877 gene locus_tag LOCUS_55530 84449 83877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 85175 84543 gene locus_tag LOCUS_55540 85175 84543 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245835.1 protein_id gnl|my_center|LOCUS_55540 85983 85336 gene locus_tag LOCUS_55550 85983 85336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 87695 86184 gene locus_tag LOCUS_55560 87695 86184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 91203 87763 gene locus_tag LOCUS_55570 91203 87763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 93599 91209 gene locus_tag LOCUS_55580 93599 91209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 94601 93729 gene locus_tag LOCUS_55590 94601 93729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 97437 94720 gene locus_tag LOCUS_55600 97437 94720 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_55600 97628 107941 gene locus_tag LOCUS_55610 97628 107941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 108249 108079 gene locus_tag LOCUS_55620 108249 108079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 109139 108261 gene locus_tag LOCUS_55630 109139 108261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 109806 109144 gene locus_tag LOCUS_55640 109806 109144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 110451 110041 gene locus_tag LOCUS_55650 110451 110041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 110420 110707 gene locus_tag LOCUS_55660 110420 110707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 112250 110769 gene locus_tag LOCUS_55670 112250 110769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 112812 112267 gene locus_tag LOCUS_55680 112812 112267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 113060 115897 gene locus_tag LOCUS_55690 113060 115897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 115984 117294 gene locus_tag LOCUS_55700 115984 117294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 118351 117461 gene locus_tag LOCUS_55710 118351 117461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 119896 118406 gene locus_tag LOCUS_55720 119896 118406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 121517 120099 gene locus_tag LOCUS_55730 121517 120099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 122092 121589 gene locus_tag LOCUS_55740 122092 121589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 122318 124015 gene locus_tag LOCUS_55750 122318 124015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 124012 125424 gene locus_tag LOCUS_55760 124012 125424 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921825.1 protein_id gnl|my_center|LOCUS_55760 125541 127034 gene locus_tag LOCUS_55770 125541 127034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 128613 127039 gene locus_tag LOCUS_55780 128613 127039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 128644 129501 gene locus_tag LOCUS_55790 128644 129501 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_55790 129501 130718 gene locus_tag LOCUS_55800 129501 130718 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814068.1 protein_id gnl|my_center|LOCUS_55800 130900 131715 gene locus_tag LOCUS_55810 130900 131715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 131798 132547 gene locus_tag LOCUS_55820 131798 132547 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369923.1 protein_id gnl|my_center|LOCUS_55820 133034 132594 gene locus_tag LOCUS_55830 133034 132594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 133837 133076 gene locus_tag LOCUS_55840 133837 133076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 133978 134583 gene locus_tag LOCUS_55850 133978 134583 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328127.1 protein_id gnl|my_center|LOCUS_55850 134621 135979 gene locus_tag LOCUS_55860 134621 135979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55860 136924 135980 gene locus_tag LOCUS_55870 136924 135980 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_55870 139090 137147 gene locus_tag LOCUS_55880 139090 137147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 140343 139219 gene locus_tag LOCUS_55890 140343 139219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 141241 140429 gene locus_tag LOCUS_55900 141241 140429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 141412 141774 gene locus_tag LOCUS_55910 141412 141774 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_55910 142171 141782 gene locus_tag LOCUS_55920 142171 141782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 142296 142859 gene locus_tag LOCUS_55930 142296 142859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 143535 142846 gene locus_tag LOCUS_55940 143535 142846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 143607 144773 gene locus_tag LOCUS_55950 143607 144773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 144903 148379 gene locus_tag LOCUS_55960 144903 148379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 150290 148398 gene locus_tag LOCUS_55970 150290 148398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 151669 150593 gene locus_tag LOCUS_55980 151669 150593 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080445.1 protein_id gnl|my_center|LOCUS_55980 151769 152671 gene locus_tag LOCUS_55990 151769 152671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 153542 152769 gene locus_tag LOCUS_56000 153542 152769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 153607 154491 gene locus_tag LOCUS_56010 153607 154491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 154647 156452 gene locus_tag LOCUS_56020 154647 156452 CDS product choice-of-anchor Q domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259743.1 protein_id gnl|my_center|LOCUS_56020 156498 157592 gene locus_tag LOCUS_56030 156498 157592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 157788 159278 gene locus_tag LOCUS_56040 157788 159278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 159608 159291 gene locus_tag LOCUS_56050 159608 159291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 161577 160420 gene locus_tag LOCUS_56060 161577 160420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 161885 162364 gene locus_tag LOCUS_56070 161885 162364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 162695 163120 gene locus_tag LOCUS_56080 162695 163120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 163383 163538 gene locus_tag LOCUS_56090 163383 163538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 163810 164442 gene locus_tag LOCUS_56100 163810 164442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 165002 164733 gene locus_tag LOCUS_56110 165002 164733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56110 165349 167421 gene locus_tag LOCUS_56120 165349 167421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 168739 167444 gene locus_tag LOCUS_56130 168739 167444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 169752 168694 gene locus_tag LOCUS_56140 169752 168694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 171674 169836 gene locus_tag LOCUS_56150 171674 169836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 171791 172660 gene locus_tag LOCUS_56160 171791 172660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 173886 172678 gene locus_tag LOCUS_56170 173886 172678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 175400 174027 gene locus_tag LOCUS_56180 gene dbpA 175400 174027 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940864.1 protein_id gnl|my_center|LOCUS_56180 175291 175554 gene locus_tag LOCUS_56190 175291 175554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 175572 176519 gene locus_tag LOCUS_56200 175572 176519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 176529 177965 gene locus_tag LOCUS_56210 176529 177965 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974998.1 protein_id gnl|my_center|LOCUS_56210 179163 177991 gene locus_tag LOCUS_56220 179163 177991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 179383 180024 gene locus_tag LOCUS_56230 179383 180024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 180374 180036 gene locus_tag LOCUS_56240 180374 180036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 180573 181562 gene locus_tag LOCUS_56250 180573 181562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 182109 181741 gene locus_tag LOCUS_56260 182109 181741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 182018 183130 gene locus_tag LOCUS_56270 182018 183130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 183818 183189 gene locus_tag LOCUS_56280 183818 183189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 183973 183878 gene locus_tag LOCUS_t00730 183973 183878 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 184123 186237 gene locus_tag LOCUS_56290 184123 186237 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_56290 186240 187535 gene locus_tag LOCUS_56300 186240 187535 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_56300 187887 190163 gene locus_tag LOCUS_56310 187887 190163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 191174 190179 gene locus_tag LOCUS_56320 191174 190179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 191792 191181 gene locus_tag LOCUS_56330 191792 191181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 192869 191820 gene locus_tag LOCUS_56340 192869 191820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 195643 193097 gene locus_tag LOCUS_56350 195643 193097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 197291 196011 gene locus_tag LOCUS_56360 197291 196011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 199965 197545 gene locus_tag LOCUS_56370 199965 197545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 203014 200009 gene locus_tag LOCUS_56380 203014 200009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 205016 203235 gene locus_tag LOCUS_56390 205016 203235 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539143.1 protein_id gnl|my_center|LOCUS_56390 205932 205045 gene locus_tag LOCUS_56400 205932 205045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 206324 206671 gene locus_tag LOCUS_56410 206324 206671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 206668 207804 gene locus_tag LOCUS_56420 206668 207804 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_56420 209337 207829 gene locus_tag LOCUS_56430 209337 207829 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928587.1 protein_id gnl|my_center|LOCUS_56430 211334 210039 gene locus_tag LOCUS_56440 211334 210039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442181.1 protein_id gnl|my_center|LOCUS_56440 211938 211384 gene locus_tag LOCUS_56450 211938 211384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 213167 212127 gene locus_tag LOCUS_56460 213167 212127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 213460 213332 gene locus_tag LOCUS_56470 213460 213332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 213753 213457 gene locus_tag LOCUS_56480 213753 213457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56480 214735 214259 gene locus_tag LOCUS_56490 214735 214259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 215429 214740 gene locus_tag LOCUS_56500 215429 214740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 215871 215368 gene locus_tag LOCUS_56510 215871 215368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56510 216337 216017 gene locus_tag LOCUS_56520 216337 216017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 216648 216235 gene locus_tag LOCUS_56530 216648 216235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 217079 216795 gene locus_tag LOCUS_56540 217079 216795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 216969 217256 gene locus_tag LOCUS_56550 216969 217256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 218093 218245 gene locus_tag LOCUS_56560 218093 218245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 >Feature sequence16 590 1192 gene locus_tag LOCUS_56570 590 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 1267 1578 gene locus_tag LOCUS_56580 1267 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 2294 1503 gene locus_tag LOCUS_56590 2294 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 2597 4042 gene locus_tag LOCUS_56600 2597 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 4517 4029 gene locus_tag LOCUS_56610 4517 4029 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_56610 5437 4604 gene locus_tag LOCUS_56620 5437 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 6753 5464 gene locus_tag LOCUS_56630 6753 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 8298 7063 gene locus_tag LOCUS_56640 8298 7063 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_56640 8741 8346 gene locus_tag LOCUS_56650 8741 8346 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_56650 8859 11777 gene locus_tag LOCUS_56660 8859 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 15749 11853 gene locus_tag LOCUS_56670 15749 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 19354 15746 gene locus_tag LOCUS_56680 19354 15746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 21357 19378 gene locus_tag LOCUS_56690 21357 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 26065 21371 gene locus_tag LOCUS_56700 26065 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 28570 26096 gene locus_tag LOCUS_56710 28570 26096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 28720 31128 gene locus_tag LOCUS_56720 gene ppsA 28720 31128 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 protein_id gnl|my_center|LOCUS_56720 31165 31725 gene locus_tag LOCUS_56730 31165 31725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 32945 31728 gene locus_tag LOCUS_56740 32945 31728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_56740 33670 32942 gene locus_tag LOCUS_56750 33670 32942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971886.1 protein_id gnl|my_center|LOCUS_56750 34875 33667 gene locus_tag LOCUS_56760 34875 33667 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_56760 35304 36755 gene locus_tag LOCUS_56770 35304 36755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 36912 37442 gene locus_tag LOCUS_56780 36912 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 37619 38722 gene locus_tag LOCUS_56790 37619 38722 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975759.1 protein_id gnl|my_center|LOCUS_56790 41136 38770 gene locus_tag LOCUS_56800 41136 38770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 42614 41133 gene locus_tag LOCUS_56810 42614 41133 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223302.1 protein_id gnl|my_center|LOCUS_56810 42736 44136 gene locus_tag LOCUS_56820 42736 44136 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_56820 44242 46029 gene locus_tag LOCUS_56830 44242 46029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 46549 46106 gene locus_tag LOCUS_56840 46549 46106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 48997 46712 gene locus_tag LOCUS_56850 48997 46712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 49048 49851 gene locus_tag LOCUS_56860 49048 49851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 53140 49949 gene locus_tag LOCUS_56870 53140 49949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 53424 56384 gene locus_tag LOCUS_56880 53424 56384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 56495 57139 gene locus_tag LOCUS_56890 56495 57139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 57293 58585 gene locus_tag LOCUS_56900 57293 58585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 59220 58588 gene locus_tag LOCUS_56910 59220 58588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 59767 59297 gene locus_tag LOCUS_56920 59767 59297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 60471 60007 gene locus_tag LOCUS_56930 60471 60007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 62056 60794 gene locus_tag LOCUS_56940 62056 60794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 62944 62297 gene locus_tag LOCUS_56950 62944 62297 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_56950 66867 62941 gene locus_tag LOCUS_56960 66867 62941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 68952 67141 gene locus_tag LOCUS_56970 68952 67141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 69408 69019 gene locus_tag LOCUS_56980 69408 69019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 70174 69755 gene locus_tag LOCUS_56990 70174 69755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 70275 71711 gene locus_tag LOCUS_57000 gene hcp 70275 71711 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391685.1 protein_id gnl|my_center|LOCUS_57000 72098 73858 gene locus_tag LOCUS_57010 72098 73858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 73761 74978 gene locus_tag LOCUS_57020 73761 74978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 75371 74979 gene locus_tag LOCUS_57030 75371 74979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 75432 77018 gene locus_tag LOCUS_57040 75432 77018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 77228 78781 gene locus_tag LOCUS_57050 77228 78781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 79873 78860 gene locus_tag LOCUS_57060 79873 78860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 81222 79942 gene locus_tag LOCUS_57070 81222 79942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 81482 81180 gene locus_tag LOCUS_57080 81482 81180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 82435 81593 gene locus_tag LOCUS_57090 82435 81593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 83758 82613 gene locus_tag LOCUS_57100 83758 82613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 85969 83861 gene locus_tag LOCUS_57110 85969 83861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 86094 86858 gene locus_tag LOCUS_57120 86094 86858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 87495 86863 gene locus_tag LOCUS_57130 87495 86863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 88736 87507 gene locus_tag LOCUS_57140 88736 87507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_57140 89476 88733 gene locus_tag LOCUS_57150 89476 88733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_57150 91034 89478 gene locus_tag LOCUS_57160 91034 89478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 92486 91086 gene locus_tag LOCUS_57170 92486 91086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 92586 93902 gene locus_tag LOCUS_57180 92586 93902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 93911 94552 gene locus_tag LOCUS_57190 93911 94552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 94677 95033 gene locus_tag LOCUS_57200 94677 95033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 97160 95052 gene locus_tag LOCUS_57210 97160 95052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 97288 99303 gene locus_tag LOCUS_57220 97288 99303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 99441 100364 gene locus_tag LOCUS_57230 99441 100364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 100496 101053 gene locus_tag LOCUS_57240 100496 101053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 101104 102195 gene locus_tag LOCUS_57250 gene rlmN 101104 102195 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_57250 102923 102174 gene locus_tag LOCUS_57260 102923 102174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 103007 106150 gene locus_tag LOCUS_57270 103007 106150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 106158 107906 gene locus_tag LOCUS_57280 106158 107906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 108284 109153 gene locus_tag LOCUS_57290 108284 109153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 109084 109893 gene locus_tag LOCUS_57300 109084 109893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 110102 111388 gene locus_tag LOCUS_57310 110102 111388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 111637 111392 gene locus_tag LOCUS_57320 111637 111392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 111522 113171 gene locus_tag LOCUS_57330 111522 113171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 113168 113707 gene locus_tag LOCUS_57340 113168 113707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 114926 113775 gene locus_tag LOCUS_57350 114926 113775 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_57350 115501 114923 gene locus_tag LOCUS_57360 115501 114923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57360 116313 115474 gene locus_tag LOCUS_57370 116313 115474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57370 116368 117549 gene locus_tag LOCUS_57380 116368 117549 CDS product 7-dehydrocholesterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958044.1 protein_id gnl|my_center|LOCUS_57380 119023 117692 gene locus_tag LOCUS_57390 119023 117692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 119004 120128 gene locus_tag LOCUS_57400 119004 120128 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105223.1 protein_id gnl|my_center|LOCUS_57400 121158 120238 gene locus_tag LOCUS_57410 121158 120238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 122472 121351 gene locus_tag LOCUS_57420 122472 121351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 123862 122519 gene locus_tag LOCUS_57430 123862 122519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 123861 127370 gene locus_tag LOCUS_57440 123861 127370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224789.1 protein_id gnl|my_center|LOCUS_57440 128336 127371 gene locus_tag LOCUS_57450 128336 127371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 128836 131892 gene locus_tag LOCUS_57460 128836 131892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 132429 132623 gene locus_tag LOCUS_57470 132429 132623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 133622 133942 gene locus_tag LOCUS_57480 133622 133942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 134305 134526 gene locus_tag LOCUS_57490 134305 134526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 135194 134430 gene locus_tag LOCUS_57500 135194 134430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 136389 136177 gene locus_tag LOCUS_57510 136389 136177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 136682 136278 gene locus_tag LOCUS_57520 136682 136278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 137940 136675 gene locus_tag LOCUS_57530 137940 136675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 138983 137937 gene locus_tag LOCUS_57540 gene ahbD 138983 137937 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_57540 139832 139134 gene locus_tag LOCUS_57550 139832 139134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57550 140419 139832 gene locus_tag LOCUS_57560 140419 139832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 141251 140778 gene locus_tag LOCUS_57570 141251 140778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 142127 141426 gene locus_tag LOCUS_57580 142127 141426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 142206 142514 gene locus_tag LOCUS_57590 142206 142514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 142466 142984 gene locus_tag LOCUS_57600 142466 142984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 143234 143773 gene locus_tag LOCUS_57610 143234 143773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 145613 143886 gene locus_tag LOCUS_57620 145613 143886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 146260 145676 gene locus_tag LOCUS_57630 146260 145676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 146467 146297 gene locus_tag LOCUS_57640 146467 146297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 147045 146413 gene locus_tag LOCUS_57650 147045 146413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 147633 149345 gene locus_tag LOCUS_57660 147633 149345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 149815 149249 gene locus_tag LOCUS_57670 149815 149249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 150549 149809 gene locus_tag LOCUS_57680 150549 149809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 151538 150546 gene locus_tag LOCUS_57690 151538 150546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 152946 151603 gene locus_tag LOCUS_57700 gene hemW 152946 151603 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170072.1 protein_id gnl|my_center|LOCUS_57700 153757 152948 gene locus_tag LOCUS_57710 153757 152948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 154163 153780 gene locus_tag LOCUS_57720 154163 153780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 154297 154839 gene locus_tag LOCUS_57730 154297 154839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 154964 155614 gene locus_tag LOCUS_57740 154964 155614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 157300 155687 gene locus_tag LOCUS_57750 157300 155687 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_57750 157388 157963 gene locus_tag LOCUS_57760 157388 157963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 158058 159014 gene locus_tag LOCUS_57770 158058 159014 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385239.1 protein_id gnl|my_center|LOCUS_57770 159454 159041 gene locus_tag LOCUS_57780 159454 159041 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_57780 159579 159451 gene locus_tag LOCUS_57790 159579 159451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 160857 159631 gene locus_tag LOCUS_57800 160857 159631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 160949 161758 gene locus_tag LOCUS_57810 160949 161758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 161885 163252 gene locus_tag LOCUS_57820 161885 163252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 164556 163234 gene locus_tag LOCUS_57830 164556 163234 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_57830 165261 164656 gene locus_tag LOCUS_57840 165261 164656 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727992.1 protein_id gnl|my_center|LOCUS_57840 165182 167050 gene locus_tag LOCUS_57850 165182 167050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 168106 167069 gene locus_tag LOCUS_57860 gene mtnA 168106 167069 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_57860 168345 169292 gene locus_tag LOCUS_57870 168345 169292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 170738 169455 gene locus_tag LOCUS_57880 gene lysA 170738 169455 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_57880 172043 171423 gene locus_tag LOCUS_57890 172043 171423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 172845 172078 gene locus_tag LOCUS_57900 172845 172078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 173066 174061 gene locus_tag LOCUS_57910 gene rsmH 173066 174061 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_57910 174058 174582 gene locus_tag LOCUS_57920 174058 174582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 174579 176615 gene locus_tag LOCUS_57930 174579 176615 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_57930 176938 176594 gene locus_tag LOCUS_57940 176938 176594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 176907 177296 gene locus_tag LOCUS_57950 176907 177296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 178268 177402 gene locus_tag LOCUS_57960 178268 177402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 178523 179272 gene locus_tag LOCUS_57970 178523 179272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 179368 180855 gene locus_tag LOCUS_57980 179368 180855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 182178 180904 gene locus_tag LOCUS_57990 182178 180904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 182683 183492 gene locus_tag LOCUS_58000 182683 183492 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102098.1 protein_id gnl|my_center|LOCUS_58000 183502 185136 gene locus_tag LOCUS_58010 183502 185136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 185129 185728 gene locus_tag LOCUS_58020 185129 185728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 186647 187462 gene locus_tag LOCUS_58030 186647 187462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58030 187459 187713 gene locus_tag LOCUS_58040 187459 187713 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141941.1 protein_id gnl|my_center|LOCUS_58040 187710 188600 gene locus_tag LOCUS_58050 187710 188600 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141938.1 protein_id gnl|my_center|LOCUS_58050 189502 188660 gene locus_tag LOCUS_58060 189502 188660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 189604 190089 gene locus_tag LOCUS_58070 189604 190089 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_58070 190104 191291 gene locus_tag LOCUS_58080 190104 191291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 192360 191266 gene locus_tag LOCUS_58090 192360 191266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 193665 192436 gene locus_tag LOCUS_58100 193665 192436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 194671 193712 gene locus_tag LOCUS_58110 194671 193712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 195845 194709 gene locus_tag LOCUS_58120 195845 194709 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_58120 196069 197205 gene locus_tag LOCUS_58130 196069 197205 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858082.1 protein_id gnl|my_center|LOCUS_58130 197755 197252 gene locus_tag LOCUS_58140 197755 197252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 197858 198196 gene locus_tag LOCUS_58150 197858 198196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 >Feature sequence17 962 774 gene locus_tag LOCUS_58160 962 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 1281 1526 gene locus_tag LOCUS_58170 1281 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 4089 2749 gene locus_tag LOCUS_58180 4089 2749 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_58180 4174 6321 gene locus_tag LOCUS_58190 4174 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 6565 7026 gene locus_tag LOCUS_58200 6565 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58200 7187 8842 gene locus_tag LOCUS_58210 7187 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 10139 8916 gene locus_tag LOCUS_58220 10139 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 11417 10809 gene locus_tag LOCUS_58230 11417 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 11505 11822 gene locus_tag LOCUS_58240 11505 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 12938 11916 gene locus_tag LOCUS_58250 12938 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 14251 12983 gene locus_tag LOCUS_58260 14251 12983 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_58260 14493 15029 gene locus_tag LOCUS_58270 14493 15029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943969.1 protein_id gnl|my_center|LOCUS_58270 15209 17059 gene locus_tag LOCUS_58280 15209 17059 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994007.1 protein_id gnl|my_center|LOCUS_58280 17980 17174 gene locus_tag LOCUS_58290 17980 17174 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036342.1 protein_id gnl|my_center|LOCUS_58290 19174 18149 gene locus_tag LOCUS_58300 19174 18149 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_58300 19546 21327 gene locus_tag LOCUS_58310 19546 21327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 22797 21454 gene locus_tag LOCUS_58320 22797 21454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 24385 22889 gene locus_tag LOCUS_58330 24385 22889 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922400.1 protein_id gnl|my_center|LOCUS_58330 25155 24400 gene locus_tag LOCUS_58340 25155 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 26360 25152 gene locus_tag LOCUS_58350 26360 25152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 27863 26556 gene locus_tag LOCUS_58360 gene preA 27863 26556 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895509.1 protein_id gnl|my_center|LOCUS_58360 29202 27856 gene locus_tag LOCUS_58370 29202 27856 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_58370 29409 30239 gene locus_tag LOCUS_58380 29409 30239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 30247 30603 gene locus_tag LOCUS_58390 30247 30603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 30606 31466 gene locus_tag LOCUS_58400 30606 31466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 31476 32369 gene locus_tag LOCUS_58410 31476 32369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 32440 33588 gene locus_tag LOCUS_58420 gene rlmN 32440 33588 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_58420 33733 34983 gene locus_tag LOCUS_58430 33733 34983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 35018 35311 gene locus_tag LOCUS_58440 35018 35311 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_58440 35334 35795 gene locus_tag LOCUS_58450 35334 35795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 35900 36748 gene locus_tag LOCUS_58460 35900 36748 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143535.1 protein_id gnl|my_center|LOCUS_58460 36780 37115 gene locus_tag LOCUS_58470 36780 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 37091 38461 gene locus_tag LOCUS_58480 37091 38461 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552083.1 protein_id gnl|my_center|LOCUS_58480 38517 39638 gene locus_tag LOCUS_58490 38517 39638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 39625 40392 gene locus_tag LOCUS_58500 39625 40392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 41608 40400 gene locus_tag LOCUS_58510 41608 40400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 42829 41657 gene locus_tag LOCUS_58520 42829 41657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 43415 43101 gene locus_tag LOCUS_58530 43415 43101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 44813 44184 gene locus_tag LOCUS_58540 44813 44184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 45831 45004 gene locus_tag LOCUS_58550 45831 45004 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_58550 48772 45824 gene locus_tag LOCUS_58560 gene purL 48772 45824 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_58560 49301 49891 gene locus_tag LOCUS_58570 49301 49891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 50730 49969 gene locus_tag LOCUS_58580 50730 49969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 53137 51782 gene locus_tag LOCUS_58590 53137 51782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 53236 53430 gene locus_tag LOCUS_58600 53236 53430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 56205 53503 gene locus_tag LOCUS_58610 gene leuS 56205 53503 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_58610 56885 56385 gene locus_tag LOCUS_58620 56885 56385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 59090 56955 gene locus_tag LOCUS_58630 59090 56955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 59379 62771 gene locus_tag LOCUS_58640 59379 62771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 62857 63561 gene locus_tag LOCUS_58650 62857 63561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 64491 63550 gene locus_tag LOCUS_58660 64491 63550 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190190.1 protein_id gnl|my_center|LOCUS_58660 66246 64681 gene locus_tag LOCUS_58670 66246 64681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 66206 66580 gene locus_tag LOCUS_58680 66206 66580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 66584 66793 gene locus_tag LOCUS_58690 66584 66793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 68696 66780 gene locus_tag LOCUS_58700 68696 66780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 70685 68856 gene locus_tag LOCUS_58710 70685 68856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 71505 70780 gene locus_tag LOCUS_58720 71505 70780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 72578 71514 gene locus_tag LOCUS_58730 72578 71514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 73630 72575 gene locus_tag LOCUS_58740 73630 72575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 74062 75258 gene locus_tag LOCUS_58750 gene purT 74062 75258 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468082.1 protein_id gnl|my_center|LOCUS_58750 75455 77005 gene locus_tag LOCUS_58760 75455 77005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 80221 77054 gene locus_tag LOCUS_58770 80221 77054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 81295 80276 gene locus_tag LOCUS_58780 81295 80276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 82139 81315 gene locus_tag LOCUS_58790 82139 81315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 82244 83818 gene locus_tag LOCUS_58800 82244 83818 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_58800 83881 85572 gene locus_tag LOCUS_58810 83881 85572 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_58810 85711 86337 gene locus_tag LOCUS_58820 85711 86337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 90171 86338 gene locus_tag LOCUS_58830 90171 86338 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119761.1 protein_id gnl|my_center|LOCUS_58830 90340 91557 gene locus_tag LOCUS_58840 90340 91557 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_58840 91621 92292 gene locus_tag LOCUS_58850 91621 92292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 92289 93233 gene locus_tag LOCUS_58860 92289 93233 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531135.1 protein_id gnl|my_center|LOCUS_58860 93353 95017 gene locus_tag LOCUS_58870 93353 95017 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_58870 95618 95085 gene locus_tag LOCUS_58880 95618 95085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 95890 96474 gene locus_tag LOCUS_58890 95890 96474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 96471 97286 gene locus_tag LOCUS_58900 96471 97286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 97301 98611 gene locus_tag LOCUS_58910 97301 98611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 98654 99127 gene locus_tag LOCUS_58920 98654 99127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 99133 99576 gene locus_tag LOCUS_58930 99133 99576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 99587 100069 gene locus_tag LOCUS_58940 99587 100069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 100072 100284 gene locus_tag LOCUS_58950 100072 100284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 100301 101047 gene locus_tag LOCUS_58960 100301 101047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 101044 102663 gene locus_tag LOCUS_58970 101044 102663 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_58970 102678 102854 gene locus_tag LOCUS_58980 102678 102854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 102851 103279 gene locus_tag LOCUS_58990 102851 103279 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_58990 103283 103717 gene locus_tag LOCUS_59000 103283 103717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 103720 108051 gene locus_tag LOCUS_59010 103720 108051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 108068 109975 gene locus_tag LOCUS_59020 108068 109975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 110000 113857 gene locus_tag LOCUS_59030 110000 113857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 113867 115738 gene locus_tag LOCUS_59040 113867 115738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 115735 117081 gene locus_tag LOCUS_59050 115735 117081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 117170 119173 gene locus_tag LOCUS_59060 117170 119173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 119395 119895 gene locus_tag LOCUS_59070 119395 119895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 122061 119794 gene locus_tag LOCUS_59080 122061 119794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 123017 122064 gene locus_tag LOCUS_59090 123017 122064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 123243 124661 gene locus_tag LOCUS_59100 123243 124661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 124661 126670 gene locus_tag LOCUS_59110 124661 126670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 126723 127895 gene locus_tag LOCUS_59120 126723 127895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 127906 129627 gene locus_tag LOCUS_59130 127906 129627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 129648 130547 gene locus_tag LOCUS_59140 129648 130547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 131344 130634 gene locus_tag LOCUS_59150 131344 130634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 134048 131388 gene locus_tag LOCUS_59160 134048 131388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 134996 134064 gene locus_tag LOCUS_59170 134996 134064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 135178 135720 gene locus_tag LOCUS_59180 135178 135720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 137235 135766 gene locus_tag LOCUS_59190 137235 135766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59190 138706 137240 gene locus_tag LOCUS_59200 138706 137240 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_59200 138906 138709 gene locus_tag LOCUS_59210 138906 138709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 138993 139469 gene locus_tag LOCUS_59220 138993 139469 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_59220 139712 140131 gene locus_tag LOCUS_59230 139712 140131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 140263 141561 gene locus_tag LOCUS_59240 140263 141561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 143111 141570 gene locus_tag LOCUS_59250 143111 141570 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479895.1 protein_id gnl|my_center|LOCUS_59250 143544 143239 gene locus_tag LOCUS_59260 143544 143239 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_59260 143759 144628 gene locus_tag LOCUS_59270 143759 144628 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_59270 144649 146274 gene locus_tag LOCUS_59280 gene atuC 144649 146274 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_59280 146296 147450 gene locus_tag LOCUS_59290 gene atuD 146296 147450 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_59290 147480 148307 gene locus_tag LOCUS_59300 gene atuE 147480 148307 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_59300 148327 150210 gene locus_tag LOCUS_59310 gene atuF 148327 150210 CDS product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_59310 150207 150365 gene locus_tag LOCUS_59320 150207 150365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 150384 150629 gene locus_tag LOCUS_59330 150384 150629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 151159 152025 gene locus_tag LOCUS_59340 151159 152025 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_59340 152132 153286 gene locus_tag LOCUS_59350 152132 153286 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172653.1 protein_id gnl|my_center|LOCUS_59350 153322 155118 gene locus_tag LOCUS_59360 153322 155118 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930188.1 protein_id gnl|my_center|LOCUS_59360 155174 155977 gene locus_tag LOCUS_59370 155174 155977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_59370 157083 155983 gene locus_tag LOCUS_59380 157083 155983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 157302 157610 gene locus_tag LOCUS_59390 157302 157610 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_59390 158023 158592 gene locus_tag LOCUS_59400 158023 158592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 158612 159286 gene locus_tag LOCUS_59410 158612 159286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 159340 159864 gene locus_tag LOCUS_59420 159340 159864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 161449 159869 gene locus_tag LOCUS_59430 161449 159869 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 protein_id gnl|my_center|LOCUS_59430 163359 161503 gene locus_tag LOCUS_59440 163359 161503 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_59440 164368 163409 gene locus_tag LOCUS_59450 164368 163409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 165424 164516 gene locus_tag LOCUS_59460 165424 164516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 165722 166588 gene locus_tag LOCUS_59470 165722 166588 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_59470 166619 167992 gene locus_tag LOCUS_59480 gene hydA 166619 167992 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099919.1 protein_id gnl|my_center|LOCUS_59480 168173 169159 gene locus_tag LOCUS_59490 168173 169159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 169604 170506 gene locus_tag LOCUS_59500 169604 170506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 171444 170518 gene locus_tag LOCUS_59510 171444 170518 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_59510 171529 172047 gene locus_tag LOCUS_59520 171529 172047 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_59520 172141 173049 gene locus_tag LOCUS_59530 172141 173049 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113539.1 protein_id gnl|my_center|LOCUS_59530 173131 174630 gene locus_tag LOCUS_59540 173131 174630 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_59540 174645 175988 gene locus_tag LOCUS_59550 174645 175988 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_59550 176009 176731 gene locus_tag LOCUS_59560 176009 176731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 177221 179728 gene locus_tag LOCUS_59570 177221 179728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 179734 180801 gene locus_tag LOCUS_59580 179734 180801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 182392 180875 gene locus_tag LOCUS_59590 182392 180875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 182558 183265 gene locus_tag LOCUS_59600 182558 183265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 183272 183967 gene locus_tag LOCUS_59610 183272 183967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 184725 183943 gene locus_tag LOCUS_59620 184725 183943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 184768 185421 gene locus_tag LOCUS_59630 184768 185421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 185899 185480 gene locus_tag LOCUS_59640 185899 185480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 185865 187241 gene locus_tag LOCUS_59650 185865 187241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 187514 188551 gene locus_tag LOCUS_59660 187514 188551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 189189 188560 gene locus_tag LOCUS_59670 189189 188560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 189798 189196 gene locus_tag LOCUS_59680 189798 189196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 190003 190866 gene locus_tag LOCUS_59690 190003 190866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 191472 191900 gene locus_tag LOCUS_59700 191472 191900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 192274 192065 gene locus_tag LOCUS_59710 192274 192065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 192352 192573 gene locus_tag LOCUS_59720 192352 192573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 192581 192736 gene locus_tag LOCUS_59730 192581 192736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 193102 193263 gene locus_tag LOCUS_59740 193102 193263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 193948 194415 gene locus_tag LOCUS_59750 193948 194415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 >Feature sequence18 1058 435 gene locus_tag LOCUS_59760 1058 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 1459 1055 gene locus_tag LOCUS_59770 1459 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 2477 1470 gene locus_tag LOCUS_59780 2477 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59780 2590 2961 gene locus_tag LOCUS_59790 2590 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 4969 2978 gene locus_tag LOCUS_59800 4969 2978 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 protein_id gnl|my_center|LOCUS_59800 6345 5083 gene locus_tag LOCUS_59810 6345 5083 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_59810 6241 6486 gene locus_tag LOCUS_59820 6241 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 6502 7389 gene locus_tag LOCUS_59830 6502 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 8080 7466 gene locus_tag LOCUS_59840 8080 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 8373 12647 gene locus_tag LOCUS_59850 8373 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 14180 13026 gene locus_tag LOCUS_59860 14180 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 14222 15631 gene locus_tag LOCUS_59870 14222 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 16411 15665 gene locus_tag LOCUS_59880 16411 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 17106 16408 gene locus_tag LOCUS_59890 17106 16408 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_59890 18208 17108 gene locus_tag LOCUS_59900 18208 17108 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_59900 19453 18266 gene locus_tag LOCUS_59910 19453 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 21980 19464 gene locus_tag LOCUS_59920 21980 19464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 22105 23046 gene locus_tag LOCUS_59930 22105 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 23898 23122 gene locus_tag LOCUS_59940 23898 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 24087 26174 gene locus_tag LOCUS_59950 24087 26174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 27239 26202 gene locus_tag LOCUS_59960 27239 26202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 27447 28244 gene locus_tag LOCUS_59970 27447 28244 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_59970 28404 29852 gene locus_tag LOCUS_59980 28404 29852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 29825 31504 gene locus_tag LOCUS_59990 29825 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 31533 33371 gene locus_tag LOCUS_60000 31533 33371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 33984 33361 gene locus_tag LOCUS_60010 33984 33361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 34738 33992 gene locus_tag LOCUS_60020 34738 33992 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_60020 34930 36486 gene locus_tag LOCUS_60030 34930 36486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 37138 36536 gene locus_tag LOCUS_60040 37138 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 37869 37159 gene locus_tag LOCUS_60050 37869 37159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 38686 37889 gene locus_tag LOCUS_60060 38686 37889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 38786 39424 gene locus_tag LOCUS_60070 38786 39424 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_60070 39417 40628 gene locus_tag LOCUS_60080 39417 40628 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_60080 41284 40529 gene locus_tag LOCUS_60090 41284 40529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 42282 41326 gene locus_tag LOCUS_60100 42282 41326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 44375 42333 gene locus_tag LOCUS_60110 44375 42333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 45373 44585 gene locus_tag LOCUS_60120 45373 44585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 46307 45537 gene locus_tag LOCUS_60130 46307 45537 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138735.1 protein_id gnl|my_center|LOCUS_60130 46402 46833 gene locus_tag LOCUS_60140 gene trxC 46402 46833 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_60140 46837 47979 gene locus_tag LOCUS_60150 46837 47979 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_60150 47976 48515 gene locus_tag LOCUS_60160 47976 48515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 48516 49616 gene locus_tag LOCUS_60170 48516 49616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 49736 50137 gene locus_tag LOCUS_60180 49736 50137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 52051 50189 gene locus_tag LOCUS_60190 52051 50189 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_60190 53016 52048 gene locus_tag LOCUS_60200 53016 52048 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_60200 53876 53016 gene locus_tag LOCUS_60210 53876 53016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 54301 53900 gene locus_tag LOCUS_60220 54301 53900 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_60220 54466 54660 gene locus_tag LOCUS_60230 54466 54660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 54731 56752 gene locus_tag LOCUS_60240 54731 56752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 59062 56900 gene locus_tag LOCUS_60250 59062 56900 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_60250 59184 61865 gene locus_tag LOCUS_60260 59184 61865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 62888 61956 gene locus_tag LOCUS_60270 62888 61956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 63744 63016 gene locus_tag LOCUS_60280 63744 63016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 64808 63768 gene locus_tag LOCUS_60290 64808 63768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 65236 64805 gene locus_tag LOCUS_60300 65236 64805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 65309 66535 gene locus_tag LOCUS_60310 65309 66535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 68104 66569 gene locus_tag LOCUS_60320 68104 66569 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680223.1 protein_id gnl|my_center|LOCUS_60320 68255 68788 gene locus_tag LOCUS_60330 68255 68788 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_60330 69028 70005 gene locus_tag LOCUS_60340 69028 70005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 70013 70993 gene locus_tag LOCUS_60350 70013 70993 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259009.1 protein_id gnl|my_center|LOCUS_60350 71041 72861 gene locus_tag LOCUS_60360 71041 72861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 73031 75007 gene locus_tag LOCUS_60370 73031 75007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 75168 76565 gene locus_tag LOCUS_60380 75168 76565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 77691 76606 gene locus_tag LOCUS_60390 77691 76606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 79523 77799 gene locus_tag LOCUS_60400 79523 77799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 79773 80921 gene locus_tag LOCUS_60410 gene dusB 79773 80921 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_60410 83128 80969 gene locus_tag LOCUS_60420 83128 80969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 85306 85914 gene locus_tag LOCUS_60430 85306 85914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 86158 86805 gene locus_tag LOCUS_60440 86158 86805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 88011 86887 gene locus_tag LOCUS_60450 88011 86887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_60450 89383 87992 gene locus_tag LOCUS_60460 89383 87992 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_60460 89506 90138 gene locus_tag LOCUS_60470 gene udk 89506 90138 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_60470 90453 94676 gene locus_tag LOCUS_60480 90453 94676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 94898 95938 gene locus_tag LOCUS_60490 94898 95938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60490 95935 96138 gene locus_tag LOCUS_60500 95935 96138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60500 96714 96208 gene locus_tag LOCUS_60510 96714 96208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 98520 96829 gene locus_tag LOCUS_60520 98520 96829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 98636 100315 gene locus_tag LOCUS_60530 98636 100315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 100513 102123 gene locus_tag LOCUS_60540 100513 102123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 102279 102455 gene locus_tag LOCUS_60550 102279 102455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 102945 104297 gene locus_tag LOCUS_60560 102945 104297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 104313 104702 gene locus_tag LOCUS_60570 104313 104702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 104706 105476 gene locus_tag LOCUS_60580 104706 105476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 106863 105454 gene locus_tag LOCUS_60590 106863 105454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 106878 107897 gene locus_tag LOCUS_60600 106878 107897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 107900 109258 gene locus_tag LOCUS_60610 107900 109258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 109255 109890 gene locus_tag LOCUS_60620 109255 109890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 109894 110544 gene locus_tag LOCUS_60630 109894 110544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 110541 110966 gene locus_tag LOCUS_60640 110541 110966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 110985 111452 gene locus_tag LOCUS_60650 110985 111452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 111472 112914 gene locus_tag LOCUS_60660 111472 112914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 112911 114311 gene locus_tag LOCUS_60670 112911 114311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 114318 115952 gene locus_tag LOCUS_60680 114318 115952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 115966 116712 gene locus_tag LOCUS_60690 115966 116712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 116755 117177 gene locus_tag LOCUS_60700 116755 117177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 117233 118654 gene locus_tag LOCUS_60710 117233 118654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 119621 118662 gene locus_tag LOCUS_60720 119621 118662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 121295 119682 gene locus_tag LOCUS_60730 121295 119682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 124549 121292 gene locus_tag LOCUS_60740 124549 121292 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_60740 125598 124546 gene locus_tag LOCUS_60750 125598 124546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 126278 125595 gene locus_tag LOCUS_60760 126278 125595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 127816 126530 gene locus_tag LOCUS_60770 127816 126530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 129204 127813 gene locus_tag LOCUS_60780 129204 127813 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_60780 129918 129304 gene locus_tag LOCUS_60790 129918 129304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 130015 130650 gene locus_tag LOCUS_60800 130015 130650 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643893.1 protein_id gnl|my_center|LOCUS_60800 130661 131098 gene locus_tag LOCUS_60810 130661 131098 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897271.1 protein_id gnl|my_center|LOCUS_60810 131128 132108 gene locus_tag LOCUS_60820 gene hemB 131128 132108 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_60820 132113 133351 gene locus_tag LOCUS_60830 132113 133351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 134385 133285 gene locus_tag LOCUS_60840 134385 133285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 135353 134394 gene locus_tag LOCUS_60850 gene pip 135353 134394 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_60850 135271 135552 gene locus_tag LOCUS_60860 135271 135552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 135565 137997 gene locus_tag LOCUS_60870 135565 137997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 138158 142294 gene locus_tag LOCUS_60880 138158 142294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 142344 143423 gene locus_tag LOCUS_60890 142344 143423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 143545 144495 gene locus_tag LOCUS_60900 143545 144495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 144492 146237 gene locus_tag LOCUS_60910 144492 146237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 147642 146347 gene locus_tag LOCUS_60920 147642 146347 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_60920 147863 149113 gene locus_tag LOCUS_60930 147863 149113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_60930 150734 149130 gene locus_tag LOCUS_60940 150734 149130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 151219 150830 gene locus_tag LOCUS_60950 151219 150830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 151446 152672 gene locus_tag LOCUS_60960 151446 152672 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532433.1 protein_id gnl|my_center|LOCUS_60960 152798 153481 gene locus_tag LOCUS_60970 152798 153481 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080152.1 protein_id gnl|my_center|LOCUS_60970 153903 154685 gene locus_tag LOCUS_60980 153903 154685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 154923 157412 gene locus_tag LOCUS_60990 gene lon 154923 157412 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_60990 157613 159088 gene locus_tag LOCUS_61000 157613 159088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 160060 159194 gene locus_tag LOCUS_61010 160060 159194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 160821 160132 gene locus_tag LOCUS_61020 160821 160132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 160721 161446 gene locus_tag LOCUS_61030 160721 161446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 162038 163563 gene locus_tag LOCUS_r00040 162038 163563 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 163730 163806 gene locus_tag LOCUS_t00740 163730 163806 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 163846 163919 gene locus_tag LOCUS_t00750 163846 163919 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 164263 167204 gene locus_tag LOCUS_r00050 164263 167204 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 167365 167476 gene locus_tag LOCUS_r00060 167365 167476 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 167723 168808 gene locus_tag LOCUS_61040 167723 168808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61040 169793 168990 gene locus_tag LOCUS_61050 169793 168990 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_61050 169927 170319 gene locus_tag LOCUS_61060 169927 170319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 171370 170282 gene locus_tag LOCUS_61070 171370 170282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_61070 172084 171509 gene locus_tag LOCUS_61080 172084 171509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 172418 172161 gene locus_tag LOCUS_61090 172418 172161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 173674 172469 gene locus_tag LOCUS_61100 173674 172469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61100 175515 173935 gene locus_tag LOCUS_61110 175515 173935 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118670.1 protein_id gnl|my_center|LOCUS_61110 175772 175518 gene locus_tag LOCUS_61120 175772 175518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 175963 175775 gene locus_tag LOCUS_61130 175963 175775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 177297 175987 gene locus_tag LOCUS_61140 177297 175987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 177977 177294 gene locus_tag LOCUS_61150 177977 177294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61150 178818 178045 gene locus_tag LOCUS_61160 178818 178045 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 protein_id gnl|my_center|LOCUS_61160 180278 178968 gene locus_tag LOCUS_61170 180278 178968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 180934 180287 gene locus_tag LOCUS_61180 180934 180287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 181057 182949 gene locus_tag LOCUS_61190 181057 182949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 183825 185951 gene locus_tag LOCUS_61200 183825 185951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61200 187438 187623 gene locus_tag LOCUS_61210 187438 187623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 187777 188721 gene locus_tag LOCUS_61220 187777 188721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 188750 189163 gene locus_tag LOCUS_61230 188750 189163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 >Feature sequence19 949 650 gene locus_tag LOCUS_61240 gene hypC 949 650 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 protein_id gnl|my_center|LOCUS_61240 2568 961 gene locus_tag LOCUS_61250 2568 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61250 3323 2568 gene locus_tag LOCUS_61260 3323 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61260 3664 3389 gene locus_tag LOCUS_61270 3664 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61270 4830 3754 gene locus_tag LOCUS_61280 4830 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61280 5173 4802 gene locus_tag LOCUS_61290 5173 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 7246 5237 gene locus_tag LOCUS_61300 7246 5237 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 protein_id gnl|my_center|LOCUS_61300 8326 7586 gene locus_tag LOCUS_61310 8326 7586 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_61310 8539 10401 gene locus_tag LOCUS_61320 8539 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 10398 10676 gene locus_tag LOCUS_61330 10398 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 11780 10680 gene locus_tag LOCUS_61340 11780 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 11910 13568 gene locus_tag LOCUS_61350 11910 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 13844 13578 gene locus_tag LOCUS_61360 13844 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 13726 14721 gene locus_tag LOCUS_61370 13726 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 14691 15641 gene locus_tag LOCUS_61380 14691 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 16330 16644 gene locus_tag LOCUS_61390 16330 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 16658 17791 gene locus_tag LOCUS_61400 16658 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 18329 17853 gene locus_tag LOCUS_61410 18329 17853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 19636 18326 gene locus_tag LOCUS_61420 19636 18326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 20811 19633 gene locus_tag LOCUS_61430 20811 19633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 21818 20808 gene locus_tag LOCUS_61440 21818 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 22396 21968 gene locus_tag LOCUS_61450 22396 21968 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405173.1 protein_id gnl|my_center|LOCUS_61450 23449 22400 gene locus_tag LOCUS_61460 gene arsB 23449 22400 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_61460 23846 23508 gene locus_tag LOCUS_61470 23846 23508 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_61470 23743 25734 gene locus_tag LOCUS_61480 gene arsA 23743 25734 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095196.1 protein_id gnl|my_center|LOCUS_61480 25847 26635 gene locus_tag LOCUS_61490 25847 26635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 27172 26660 gene locus_tag LOCUS_61500 27172 26660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 27320 29449 gene locus_tag LOCUS_61510 27320 29449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 29691 29473 gene locus_tag LOCUS_61520 29691 29473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 30692 29688 gene locus_tag LOCUS_61530 30692 29688 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046118260.1 protein_id gnl|my_center|LOCUS_61530 33499 30689 gene locus_tag LOCUS_61540 33499 30689 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_61540 34934 33615 gene locus_tag LOCUS_61550 gene ftsW 34934 33615 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_61550 35159 36280 gene locus_tag LOCUS_61560 35159 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 36448 37650 gene locus_tag LOCUS_61570 36448 37650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 38075 37752 gene locus_tag LOCUS_61580 38075 37752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61580 38229 39809 gene locus_tag LOCUS_61590 38229 39809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 40475 39816 gene locus_tag LOCUS_61600 40475 39816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207502.1 protein_id gnl|my_center|LOCUS_61600 41548 40472 gene locus_tag LOCUS_61610 41548 40472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 42256 41600 gene locus_tag LOCUS_61620 gene nth 42256 41600 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_61620 42413 43243 gene locus_tag LOCUS_61630 42413 43243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 43254 43637 gene locus_tag LOCUS_61640 gene gloA 43254 43637 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_61640 43754 45292 gene locus_tag LOCUS_61650 43754 45292 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_61650 45319 48357 gene locus_tag LOCUS_61660 45319 48357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 51089 48282 gene locus_tag LOCUS_61670 51089 48282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 52231 51110 gene locus_tag LOCUS_61680 52231 51110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 52466 53686 gene locus_tag LOCUS_61690 52466 53686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 53754 53921 gene locus_tag LOCUS_61700 53754 53921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 54030 56276 gene locus_tag LOCUS_61710 54030 56276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 56671 56441 gene locus_tag LOCUS_61720 56671 56441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 56559 57755 gene locus_tag LOCUS_61730 56559 57755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 57877 59244 gene locus_tag LOCUS_61740 57877 59244 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 protein_id gnl|my_center|LOCUS_61740 62041 61064 gene locus_tag LOCUS_61750 gene meaB 62041 61064 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_61750 62139 63164 gene locus_tag LOCUS_61760 62139 63164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 63296 64921 gene locus_tag LOCUS_61770 63296 64921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 65920 64925 gene locus_tag LOCUS_61780 65920 64925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 67644 65950 gene locus_tag LOCUS_61790 gene dacB 67644 65950 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369511.1 protein_id gnl|my_center|LOCUS_61790 69250 67802 gene locus_tag LOCUS_61800 69250 67802 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546469.1 protein_id gnl|my_center|LOCUS_61800 69825 69523 gene locus_tag LOCUS_61810 69825 69523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61810 72465 69847 gene locus_tag LOCUS_61820 72465 69847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 72975 72766 gene locus_tag LOCUS_61830 72975 72766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 73051 73785 gene locus_tag LOCUS_61840 73051 73785 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_61840 73823 75247 gene locus_tag LOCUS_61850 73823 75247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 75263 75586 gene locus_tag LOCUS_61860 75263 75586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 75703 76374 gene locus_tag LOCUS_61870 gene pyrE 75703 76374 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806179.1 protein_id gnl|my_center|LOCUS_61870 76472 76984 gene locus_tag LOCUS_61880 76472 76984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61880 77920 77024 gene locus_tag LOCUS_61890 77920 77024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 78193 82221 gene locus_tag LOCUS_61900 78193 82221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 82375 83334 gene locus_tag LOCUS_61910 82375 83334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61910 83334 83828 gene locus_tag LOCUS_61920 83334 83828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 84036 84554 gene locus_tag LOCUS_61930 84036 84554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 86527 84617 gene locus_tag LOCUS_61940 86527 84617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 86630 88174 gene locus_tag LOCUS_61950 86630 88174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 88726 88301 gene locus_tag LOCUS_61960 88726 88301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 89300 88863 gene locus_tag LOCUS_61970 89300 88863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 89467 90246 gene locus_tag LOCUS_61980 89467 90246 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031563.1 protein_id gnl|my_center|LOCUS_61980 90332 92341 gene locus_tag LOCUS_61990 90332 92341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 94585 92459 gene locus_tag LOCUS_62000 94585 92459 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_62000 95146 94703 gene locus_tag LOCUS_62010 95146 94703 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_62010 96091 95222 gene locus_tag LOCUS_62020 gene truA 96091 95222 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_62020 97632 96199 gene locus_tag LOCUS_62030 97632 96199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 98987 97629 gene locus_tag LOCUS_62040 98987 97629 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 protein_id gnl|my_center|LOCUS_62040 101110 98999 gene locus_tag LOCUS_62050 101110 98999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921383.1 protein_id gnl|my_center|LOCUS_62050 101396 101103 gene locus_tag LOCUS_62060 101396 101103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 101475 102377 gene locus_tag LOCUS_62070 gene nhaR 101475 102377 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_62070 102403 103032 gene locus_tag LOCUS_62080 102403 103032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 104674 103136 gene locus_tag LOCUS_62090 104674 103136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 106794 104773 gene locus_tag LOCUS_62100 106794 104773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 108450 106885 gene locus_tag LOCUS_62110 108450 106885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 110948 108528 gene locus_tag LOCUS_62120 110948 108528 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396873.1 protein_id gnl|my_center|LOCUS_62120 113468 111027 gene locus_tag LOCUS_62130 113468 111027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 116808 113518 gene locus_tag LOCUS_62140 116808 113518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 118601 116805 gene locus_tag LOCUS_62150 118601 116805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 119115 118681 gene locus_tag LOCUS_62160 119115 118681 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_62160 119284 119850 gene locus_tag LOCUS_62170 119284 119850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 119850 120581 gene locus_tag LOCUS_62180 119850 120581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 121015 120626 gene locus_tag LOCUS_62190 121015 120626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 122626 121067 gene locus_tag LOCUS_62200 122626 121067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 122692 123987 gene locus_tag LOCUS_62210 122692 123987 CDS product pectin acetylesterase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186493.1 protein_id gnl|my_center|LOCUS_62210 124040 124399 gene locus_tag LOCUS_62220 124040 124399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 124825 124418 gene locus_tag LOCUS_62230 124825 124418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_62230 126585 124774 gene locus_tag LOCUS_62240 126585 124774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62240 126788 127612 gene locus_tag LOCUS_62250 126788 127612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 127771 129609 gene locus_tag LOCUS_62260 127771 129609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 130483 129542 gene locus_tag LOCUS_62270 130483 129542 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259475.1 protein_id gnl|my_center|LOCUS_62270 131412 130486 gene locus_tag LOCUS_62280 131412 130486 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118998.1 protein_id gnl|my_center|LOCUS_62280 132875 131445 gene locus_tag LOCUS_62290 132875 131445 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_62290 133067 134305 gene locus_tag LOCUS_62300 133067 134305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 134391 135842 gene locus_tag LOCUS_62310 134391 135842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 136472 135888 gene locus_tag LOCUS_62320 136472 135888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 137073 136555 gene locus_tag LOCUS_62330 137073 136555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 137021 137476 gene locus_tag LOCUS_62340 137021 137476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 137617 138246 gene locus_tag LOCUS_62350 137617 138246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 138575 139618 gene locus_tag LOCUS_62360 138575 139618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62360 139566 139886 gene locus_tag LOCUS_62370 139566 139886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 139852 140031 gene locus_tag LOCUS_62380 139852 140031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 141239 141373 gene locus_tag LOCUS_62390 141239 141373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 141886 141374 gene locus_tag LOCUS_62400 141886 141374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 143113 142787 gene locus_tag LOCUS_62410 143113 142787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 143898 143131 gene locus_tag LOCUS_62420 143898 143131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 145190 144396 gene locus_tag LOCUS_62430 145190 144396 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_62430 147782 145563 gene locus_tag LOCUS_62440 147782 145563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 148390 148611 gene locus_tag LOCUS_62450 148390 148611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 152042 149013 gene locus_tag LOCUS_62460 152042 149013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 152920 152039 gene locus_tag LOCUS_62470 152920 152039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 153694 153065 gene locus_tag LOCUS_62480 153694 153065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 153788 154696 gene locus_tag LOCUS_62490 153788 154696 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113182.1 protein_id gnl|my_center|LOCUS_62490 155554 154712 gene locus_tag LOCUS_62500 155554 154712 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921869.1 protein_id gnl|my_center|LOCUS_62500 156600 155575 gene locus_tag LOCUS_62510 156600 155575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 157563 156625 gene locus_tag LOCUS_62520 157563 156625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 158339 157563 gene locus_tag LOCUS_62530 158339 157563 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_62530 159664 158432 gene locus_tag LOCUS_62540 159664 158432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 160772 159792 gene locus_tag LOCUS_62550 160772 159792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 160883 161620 gene locus_tag LOCUS_62560 160883 161620 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_62560 162442 161627 gene locus_tag LOCUS_62570 162442 161627 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_62570 162524 163015 gene locus_tag LOCUS_62580 162524 163015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 163603 163025 gene locus_tag LOCUS_62590 163603 163025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 164479 163709 gene locus_tag LOCUS_62600 164479 163709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 165855 164476 gene locus_tag LOCUS_62610 165855 164476 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 protein_id gnl|my_center|LOCUS_62610 166004 165861 gene locus_tag LOCUS_62620 166004 165861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 166360 166172 gene locus_tag LOCUS_62630 166360 166172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 168927 166360 gene locus_tag LOCUS_62640 168927 166360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 169115 170653 gene locus_tag LOCUS_62650 169115 170653 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_62650 170693 172234 gene locus_tag LOCUS_62660 170693 172234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 173120 172335 gene locus_tag LOCUS_62670 173120 172335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 174849 173275 gene locus_tag LOCUS_62680 174849 173275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 174839 175267 gene locus_tag LOCUS_62690 174839 175267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 175280 175576 gene locus_tag LOCUS_62700 175280 175576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 175941 175462 gene locus_tag LOCUS_62710 175941 175462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 176041 178263 gene locus_tag LOCUS_62720 176041 178263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 178435 180039 gene locus_tag LOCUS_62730 178435 180039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 180278 180802 gene locus_tag LOCUS_62740 180278 180802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62740 180876 181472 gene locus_tag LOCUS_62750 180876 181472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 181650 182729 gene locus_tag LOCUS_62760 181650 182729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 182726 183328 gene locus_tag LOCUS_62770 182726 183328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 183325 184125 gene locus_tag LOCUS_62780 183325 184125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 >Feature sequence20 2053 2490 gene locus_tag LOCUS_62790 2053 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 3383 2508 gene locus_tag LOCUS_62800 3383 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 3700 5064 gene locus_tag LOCUS_62810 3700 5064 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_62810 6648 5122 gene locus_tag LOCUS_62820 6648 5122 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_62820 7821 6688 gene locus_tag LOCUS_62830 7821 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 10867 7865 gene locus_tag LOCUS_62840 10867 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 11716 10928 gene locus_tag LOCUS_62850 11716 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 12949 11909 gene locus_tag LOCUS_62860 12949 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 13240 13067 gene locus_tag LOCUS_62870 13240 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 14187 13276 gene locus_tag LOCUS_62880 14187 13276 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190190.1 protein_id gnl|my_center|LOCUS_62880 16779 14209 gene locus_tag LOCUS_62890 16779 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 16999 17616 gene locus_tag LOCUS_62900 gene gstA 16999 17616 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816371.1 protein_id gnl|my_center|LOCUS_62900 17692 19887 gene locus_tag LOCUS_62910 gene katG 17692 19887 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444101.1 protein_id gnl|my_center|LOCUS_62910 20671 19916 gene locus_tag LOCUS_62920 20671 19916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 21246 20731 gene locus_tag LOCUS_62930 21246 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 23016 21784 gene locus_tag LOCUS_62940 23016 21784 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_62940 23317 23048 gene locus_tag LOCUS_62950 23317 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 23226 23408 gene locus_tag LOCUS_62960 23226 23408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62960 25835 23427 gene locus_tag LOCUS_62970 25835 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 26750 26034 gene locus_tag LOCUS_62980 26750 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 27673 26723 gene locus_tag LOCUS_62990 27673 26723 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031570.1 protein_id gnl|my_center|LOCUS_62990 27812 28699 gene locus_tag LOCUS_63000 27812 28699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 28701 28898 gene locus_tag LOCUS_63010 28701 28898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 29217 28981 gene locus_tag LOCUS_63020 29217 28981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 30101 29208 gene locus_tag LOCUS_63030 30101 29208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 30537 30076 gene locus_tag LOCUS_63040 30537 30076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 31161 32456 gene locus_tag LOCUS_63050 31161 32456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63050 32368 32586 gene locus_tag LOCUS_63060 32368 32586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 33969 33097 gene locus_tag LOCUS_63070 33969 33097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 35111 33966 gene locus_tag LOCUS_63080 gene tgt 35111 33966 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938027.1 protein_id gnl|my_center|LOCUS_63080 35163 35969 gene locus_tag LOCUS_63090 35163 35969 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_63090 35966 37168 gene locus_tag LOCUS_63100 35966 37168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 37542 38306 gene locus_tag LOCUS_63110 37542 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 38473 38985 gene locus_tag LOCUS_63120 38473 38985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 39014 40132 gene locus_tag LOCUS_63130 39014 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 40819 40178 gene locus_tag LOCUS_63140 40819 40178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 40848 41210 gene locus_tag LOCUS_63150 40848 41210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 41902 41192 gene locus_tag LOCUS_63160 41902 41192 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 protein_id gnl|my_center|LOCUS_63160 43246 41960 gene locus_tag LOCUS_63170 43246 41960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 43146 43382 gene locus_tag LOCUS_63180 43146 43382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 43940 43521 gene locus_tag LOCUS_63190 43940 43521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 44488 43937 gene locus_tag LOCUS_63200 44488 43937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 46323 44560 gene locus_tag LOCUS_63210 46323 44560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 47462 46395 gene locus_tag LOCUS_63220 47462 46395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 47508 48107 gene locus_tag LOCUS_63230 47508 48107 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_63230 48217 49755 gene locus_tag LOCUS_63240 48217 49755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 51325 49742 gene locus_tag LOCUS_63250 51325 49742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 53218 51500 gene locus_tag LOCUS_63260 53218 51500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 54190 53225 gene locus_tag LOCUS_63270 54190 53225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 56868 54187 gene locus_tag LOCUS_63280 56868 54187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 57850 57104 gene locus_tag LOCUS_63290 57850 57104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 57930 58697 gene locus_tag LOCUS_63300 57930 58697 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_63300 58732 59202 gene locus_tag LOCUS_63310 58732 59202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 60457 59255 gene locus_tag LOCUS_63320 60457 59255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 61286 60525 gene locus_tag LOCUS_63330 61286 60525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 66589 61310 gene locus_tag LOCUS_63340 66589 61310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 66898 67050 gene locus_tag LOCUS_63350 66898 67050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 67149 67301 gene locus_tag LOCUS_63360 67149 67301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 68563 67610 gene locus_tag LOCUS_63370 68563 67610 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_63370 68572 69816 gene locus_tag LOCUS_63380 68572 69816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 70410 69871 gene locus_tag LOCUS_63390 70410 69871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 71388 70474 gene locus_tag LOCUS_63400 71388 70474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 71526 74420 gene locus_tag LOCUS_63410 71526 74420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 75364 74504 gene locus_tag LOCUS_63420 75364 74504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 76471 75428 gene locus_tag LOCUS_63430 76471 75428 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_63430 76953 76516 gene locus_tag LOCUS_63440 76953 76516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 77574 77224 gene locus_tag LOCUS_63450 77574 77224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 79178 77592 gene locus_tag LOCUS_63460 79178 77592 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_63460 81148 79511 gene locus_tag LOCUS_63470 81148 79511 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_63470 84341 81138 gene locus_tag LOCUS_63480 84341 81138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 84492 86144 gene locus_tag LOCUS_63490 84492 86144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 86766 86161 gene locus_tag LOCUS_63500 86766 86161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 87706 86768 gene locus_tag LOCUS_63510 87706 86768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 87814 88341 gene locus_tag LOCUS_63520 87814 88341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 88344 88856 gene locus_tag LOCUS_63530 88344 88856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 89733 88903 gene locus_tag LOCUS_63540 89733 88903 CDS product fatty acid desaturase CarF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846138.1 protein_id gnl|my_center|LOCUS_63540 91271 89895 gene locus_tag LOCUS_63550 91271 89895 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_63550 91407 92108 gene locus_tag LOCUS_63560 91407 92108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 92186 93619 gene locus_tag LOCUS_63570 92186 93619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 93642 94406 gene locus_tag LOCUS_63580 93642 94406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 94538 95695 gene locus_tag LOCUS_63590 94538 95695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 96910 95750 gene locus_tag LOCUS_63600 96910 95750 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_63600 97839 96907 gene locus_tag LOCUS_63610 97839 96907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 98388 98020 gene locus_tag LOCUS_63620 98388 98020 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_63620 98423 99226 gene locus_tag LOCUS_63630 gene yhdJ 98423 99226 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 protein_id gnl|my_center|LOCUS_63630 99393 100694 gene locus_tag LOCUS_63640 99393 100694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 100842 101273 gene locus_tag LOCUS_63650 100842 101273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121337.1 protein_id gnl|my_center|LOCUS_63650 101485 101937 gene locus_tag LOCUS_63660 101485 101937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 101825 102151 gene locus_tag LOCUS_63670 101825 102151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 102160 103899 gene locus_tag LOCUS_63680 102160 103899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63680 105251 103878 gene locus_tag LOCUS_63690 105251 103878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 105328 106485 gene locus_tag LOCUS_63700 105328 106485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 106656 107345 gene locus_tag LOCUS_63710 106656 107345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 107364 107771 gene locus_tag LOCUS_63720 107364 107771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 107976 108623 gene locus_tag LOCUS_63730 107976 108623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 108749 109567 gene locus_tag LOCUS_63740 108749 109567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 110917 109637 gene locus_tag LOCUS_63750 110917 109637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 111610 110951 gene locus_tag LOCUS_63760 111610 110951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 111790 113337 gene locus_tag LOCUS_63770 111790 113337 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_63770 113363 114004 gene locus_tag LOCUS_63780 113363 114004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 115111 114005 gene locus_tag LOCUS_63790 115111 114005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 115812 115156 gene locus_tag LOCUS_63800 115812 115156 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113986.1 protein_id gnl|my_center|LOCUS_63800 117210 115849 gene locus_tag LOCUS_63810 gene serS 117210 115849 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_63810 117327 117548 gene locus_tag LOCUS_63820 117327 117548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 117811 119502 gene locus_tag LOCUS_63830 117811 119502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 119546 120601 gene locus_tag LOCUS_63840 119546 120601 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_63840 120606 121616 gene locus_tag LOCUS_63850 gene trpS 120606 121616 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_63850 121903 122574 gene locus_tag LOCUS_63860 121903 122574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 122559 123455 gene locus_tag LOCUS_63870 122559 123455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 123562 124395 gene locus_tag LOCUS_63880 123562 124395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 124495 125130 gene locus_tag LOCUS_63890 124495 125130 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_63890 125207 125797 gene locus_tag LOCUS_63900 125207 125797 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_63900 127358 125850 gene locus_tag LOCUS_63910 127358 125850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 127481 129268 gene locus_tag LOCUS_63920 127481 129268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 129283 129903 gene locus_tag LOCUS_63930 129283 129903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 129926 130237 gene locus_tag LOCUS_63940 129926 130237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 131198 130248 gene locus_tag LOCUS_63950 131198 130248 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_63950 131354 131710 gene locus_tag LOCUS_63960 131354 131710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 132665 131676 gene locus_tag LOCUS_63970 132665 131676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 132924 133742 gene locus_tag LOCUS_63980 132924 133742 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769649.1 protein_id gnl|my_center|LOCUS_63980 133739 134713 gene locus_tag LOCUS_63990 133739 134713 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 protein_id gnl|my_center|LOCUS_63990 134800 136410 gene locus_tag LOCUS_64000 134800 136410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64000 136407 138533 gene locus_tag LOCUS_64010 136407 138533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 138552 139745 gene locus_tag LOCUS_64020 138552 139745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64020 139733 140383 gene locus_tag LOCUS_64030 139733 140383 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768246.1 protein_id gnl|my_center|LOCUS_64030 140414 141370 gene locus_tag LOCUS_64040 140414 141370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 143130 141406 gene locus_tag LOCUS_64050 143130 141406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 143301 144758 gene locus_tag LOCUS_64060 143301 144758 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_64060 144816 146069 gene locus_tag LOCUS_64070 144816 146069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 146175 147857 gene locus_tag LOCUS_64080 146175 147857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 147854 148936 gene locus_tag LOCUS_64090 147854 148936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 151004 148950 gene locus_tag LOCUS_64100 gene rnr 151004 148950 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_64100 152297 151005 gene locus_tag LOCUS_64110 152297 151005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 152482 153387 gene locus_tag LOCUS_64120 152482 153387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 154342 155472 gene locus_tag LOCUS_64130 154342 155472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64130 155526 156770 gene locus_tag LOCUS_64140 155526 156770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 157689 157342 gene locus_tag LOCUS_64150 157689 157342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64150 158625 158801 gene locus_tag LOCUS_64160 158625 158801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 159174 158890 gene locus_tag LOCUS_64170 159174 158890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 159498 159286 gene locus_tag LOCUS_64180 159498 159286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 160571 159495 gene locus_tag LOCUS_64190 160571 159495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64190 161623 161108 gene locus_tag LOCUS_64200 161623 161108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 162224 161760 gene locus_tag LOCUS_64210 162224 161760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 163773 162817 gene locus_tag LOCUS_64220 163773 162817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64220 164438 164247 gene locus_tag LOCUS_64230 164438 164247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 164959 164582 gene locus_tag LOCUS_64240 164959 164582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 165210 166433 gene locus_tag LOCUS_64250 165210 166433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 166552 167010 gene locus_tag LOCUS_64260 166552 167010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64260 167007 168341 gene locus_tag LOCUS_64270 167007 168341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64270 169434 169300 gene locus_tag LOCUS_64280 169434 169300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 170022 169870 gene locus_tag LOCUS_64290 170022 169870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 170662 170465 gene locus_tag LOCUS_64300 170662 170465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 171337 170684 gene locus_tag LOCUS_64310 171337 170684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 171230 172804 gene locus_tag LOCUS_64320 171230 172804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 173878 173468 gene locus_tag LOCUS_64330 173878 173468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64330 174293 175315 gene locus_tag LOCUS_64340 174293 175315 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920949.1 protein_id gnl|my_center|LOCUS_64340 177788 177459 gene locus_tag LOCUS_64350 177788 177459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 178347 178066 gene locus_tag LOCUS_64360 178347 178066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 179091 178795 gene locus_tag LOCUS_64370 179091 178795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 >Feature sequence21 860 2362 gene locus_tag LOCUS_64380 860 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 3570 2416 gene locus_tag LOCUS_64390 3570 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 3624 4334 gene locus_tag LOCUS_64400 3624 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 4402 6162 gene locus_tag LOCUS_64410 4402 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 7695 6451 gene locus_tag LOCUS_64420 7695 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 7949 7749 gene locus_tag LOCUS_64430 7949 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 8234 7995 gene locus_tag LOCUS_64440 8234 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 8522 8280 gene locus_tag LOCUS_64450 8522 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 8925 8626 gene locus_tag LOCUS_64460 8925 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 9622 9005 gene locus_tag LOCUS_64470 9622 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 10060 9635 gene locus_tag LOCUS_64480 10060 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 10382 10894 gene locus_tag LOCUS_64490 10382 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 11586 10852 gene locus_tag LOCUS_64500 11586 10852 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266528.1 protein_id gnl|my_center|LOCUS_64500 12609 11683 gene locus_tag LOCUS_64510 12609 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 12885 13661 gene locus_tag LOCUS_64520 12885 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 14373 13687 gene locus_tag LOCUS_64530 14373 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 15051 14383 gene locus_tag LOCUS_64540 15051 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 16060 15167 gene locus_tag LOCUS_64550 16060 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970274.1 protein_id gnl|my_center|LOCUS_64550 18164 16080 gene locus_tag LOCUS_64560 18164 16080 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 protein_id gnl|my_center|LOCUS_64560 19576 18161 gene locus_tag LOCUS_64570 19576 18161 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_64570 21406 19754 gene locus_tag LOCUS_64580 21406 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 21614 22882 gene locus_tag LOCUS_64590 21614 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 22935 23564 gene locus_tag LOCUS_64600 22935 23564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 23671 24135 gene locus_tag LOCUS_64610 23671 24135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 24582 25118 gene locus_tag LOCUS_64620 24582 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 25129 25929 gene locus_tag LOCUS_64630 25129 25929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 25961 27340 gene locus_tag LOCUS_64640 25961 27340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 28747 27353 gene locus_tag LOCUS_64650 28747 27353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 29739 28792 gene locus_tag LOCUS_64660 29739 28792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 30242 29736 gene locus_tag LOCUS_64670 30242 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 31312 30290 gene locus_tag LOCUS_64680 31312 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 31491 31583 gene locus_tag LOCUS_t00760 31491 31583 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32520 33788 gene locus_tag LOCUS_64690 32520 33788 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_64690 33882 34715 gene locus_tag LOCUS_64700 33882 34715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 36147 34696 gene locus_tag LOCUS_64710 36147 34696 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_64710 37103 36144 gene locus_tag LOCUS_64720 37103 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 37230 38402 gene locus_tag LOCUS_64730 37230 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 38399 38983 gene locus_tag LOCUS_64740 38399 38983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 41230 39008 gene locus_tag LOCUS_64750 41230 39008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 41329 41886 gene locus_tag LOCUS_64760 41329 41886 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268649.1 protein_id gnl|my_center|LOCUS_64760 41892 42803 gene locus_tag LOCUS_64770 41892 42803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 43986 42814 gene locus_tag LOCUS_64780 43986 42814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64780 44669 43983 gene locus_tag LOCUS_64790 44669 43983 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_64790 45244 44666 gene locus_tag LOCUS_64800 45244 44666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64800 45718 45368 gene locus_tag LOCUS_64810 45718 45368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64810 46905 45724 gene locus_tag LOCUS_64820 46905 45724 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_64820 49954 46943 gene locus_tag LOCUS_64830 49954 46943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 50130 51335 gene locus_tag LOCUS_64840 50130 51335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 52419 51337 gene locus_tag LOCUS_64850 52419 51337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 52575 52919 gene locus_tag LOCUS_64860 52575 52919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 53732 52947 gene locus_tag LOCUS_64870 53732 52947 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_64870 53707 53901 gene locus_tag LOCUS_64880 53707 53901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 54824 53841 gene locus_tag LOCUS_64890 54824 53841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 56598 54964 gene locus_tag LOCUS_64900 56598 54964 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_64900 56728 58413 gene locus_tag LOCUS_64910 56728 58413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 58902 58417 gene locus_tag LOCUS_64920 58902 58417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 60598 59018 gene locus_tag LOCUS_64930 60598 59018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 60747 61373 gene locus_tag LOCUS_64940 60747 61373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 61391 62041 gene locus_tag LOCUS_64950 61391 62041 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_64950 63412 62114 gene locus_tag LOCUS_64960 63412 62114 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_64960 63487 63915 gene locus_tag LOCUS_64970 63487 63915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 65161 63989 gene locus_tag LOCUS_64980 gene proB 65161 63989 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_64980 66476 65310 gene locus_tag LOCUS_64990 66476 65310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 67424 66558 gene locus_tag LOCUS_65000 67424 66558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 68530 67421 gene locus_tag LOCUS_65010 gene aroC 68530 67421 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_65010 69444 68548 gene locus_tag LOCUS_65020 gene pcaD 69444 68548 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392054.1 protein_id gnl|my_center|LOCUS_65020 69513 69821 gene locus_tag LOCUS_65030 69513 69821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 69863 70258 gene locus_tag LOCUS_65040 69863 70258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65040 70524 70210 gene locus_tag LOCUS_65050 70524 70210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 70409 73108 gene locus_tag LOCUS_65060 70409 73108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 73505 73116 gene locus_tag LOCUS_65070 73505 73116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 74166 73528 gene locus_tag LOCUS_65080 74166 73528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 74608 74333 gene locus_tag LOCUS_65090 74608 74333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65090 74773 75855 gene locus_tag LOCUS_65100 74773 75855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65100 76515 75937 gene locus_tag LOCUS_65110 76515 75937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65110 76605 77552 gene locus_tag LOCUS_65120 76605 77552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 79069 77519 gene locus_tag LOCUS_65130 79069 77519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 80340 79066 gene locus_tag LOCUS_65140 80340 79066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65140 80963 80337 gene locus_tag LOCUS_65150 80963 80337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 81043 82167 gene locus_tag LOCUS_65160 81043 82167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65160 82169 83332 gene locus_tag LOCUS_65170 gene solA 82169 83332 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_65170 83405 83842 gene locus_tag LOCUS_65180 83405 83842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 83981 84784 gene locus_tag LOCUS_65190 83981 84784 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_65190 85870 84803 gene locus_tag LOCUS_65200 85870 84803 CDS product 7-dehydrocholesterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958044.1 protein_id gnl|my_center|LOCUS_65200 86571 85957 gene locus_tag LOCUS_65210 86571 85957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 86694 86966 gene locus_tag LOCUS_65220 86694 86966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 88745 86985 gene locus_tag LOCUS_65230 88745 86985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 89025 88759 gene locus_tag LOCUS_65240 89025 88759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 89036 90586 gene locus_tag LOCUS_65250 89036 90586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 90856 90656 gene locus_tag LOCUS_65260 90856 90656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 92184 90892 gene locus_tag LOCUS_65270 92184 90892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 92249 93622 gene locus_tag LOCUS_65280 92249 93622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 94397 93678 gene locus_tag LOCUS_65290 94397 93678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 95824 94478 gene locus_tag LOCUS_65300 95824 94478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65300 95721 95993 gene locus_tag LOCUS_65310 95721 95993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 96215 97177 gene locus_tag LOCUS_65320 96215 97177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65320 98672 97191 gene locus_tag LOCUS_65330 98672 97191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 100029 98674 gene locus_tag LOCUS_65340 100029 98674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 100570 100175 gene locus_tag LOCUS_65350 100570 100175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 100814 103300 gene locus_tag LOCUS_65360 gene mgtA 100814 103300 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_65360 103864 103313 gene locus_tag LOCUS_65370 103864 103313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 104722 103913 gene locus_tag LOCUS_65380 104722 103913 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 protein_id gnl|my_center|LOCUS_65380 106118 104796 gene locus_tag LOCUS_65390 106118 104796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 106021 106263 gene locus_tag LOCUS_65400 106021 106263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 106480 107115 gene locus_tag LOCUS_65410 106480 107115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 109123 107141 gene locus_tag LOCUS_65420 109123 107141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 109354 109656 gene locus_tag LOCUS_65430 109354 109656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 109903 110619 gene locus_tag LOCUS_65440 109903 110619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 110702 111568 gene locus_tag LOCUS_65450 110702 111568 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_65450 111637 112065 gene locus_tag LOCUS_65460 111637 112065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 112101 112619 gene locus_tag LOCUS_65470 112101 112619 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123255.1 protein_id gnl|my_center|LOCUS_65470 112691 113080 gene locus_tag LOCUS_65480 112691 113080 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_65480 114450 113089 gene locus_tag LOCUS_65490 114450 113089 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_65490 116180 114450 gene locus_tag LOCUS_65500 116180 114450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 117217 116177 gene locus_tag LOCUS_65510 117217 116177 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_65510 117690 117283 gene locus_tag LOCUS_65520 117690 117283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 118562 117717 gene locus_tag LOCUS_65530 118562 117717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 118972 118559 gene locus_tag LOCUS_65540 118972 118559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 119452 118982 gene locus_tag LOCUS_65550 119452 118982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 120356 119724 gene locus_tag LOCUS_65560 120356 119724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65560 121128 120478 gene locus_tag LOCUS_65570 121128 120478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 121275 122777 gene locus_tag LOCUS_65580 121275 122777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 123056 122781 gene locus_tag LOCUS_65590 123056 122781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 123766 123167 gene locus_tag LOCUS_65600 123766 123167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 125106 123793 gene locus_tag LOCUS_65610 125106 123793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 125202 126143 gene locus_tag LOCUS_65620 125202 126143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65620 128110 126158 gene locus_tag LOCUS_65630 gene acs 128110 126158 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_65630 128244 129098 gene locus_tag LOCUS_65640 128244 129098 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687893.1 protein_id gnl|my_center|LOCUS_65640 129334 134964 gene locus_tag LOCUS_65650 129334 134964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 135870 134998 gene locus_tag LOCUS_65660 135870 134998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 137584 135932 gene locus_tag LOCUS_65670 137584 135932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65670 137745 138176 gene locus_tag LOCUS_65680 137745 138176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 138747 138316 gene locus_tag LOCUS_65690 138747 138316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 139049 139717 gene locus_tag LOCUS_65700 139049 139717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 139863 144479 gene locus_tag LOCUS_65710 139863 144479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65710 144519 145958 gene locus_tag LOCUS_65720 144519 145958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 146303 147706 gene locus_tag LOCUS_65730 146303 147706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 149862 147745 gene locus_tag LOCUS_65740 149862 147745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 151390 150086 gene locus_tag LOCUS_65750 151390 150086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 153362 151848 gene locus_tag LOCUS_65760 153362 151848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 153627 154811 gene locus_tag LOCUS_65770 153627 154811 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494103.1 protein_id gnl|my_center|LOCUS_65770 154811 156019 gene locus_tag LOCUS_65780 154811 156019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_65780 156024 156716 gene locus_tag LOCUS_65790 156024 156716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918816.1 protein_id gnl|my_center|LOCUS_65790 156798 158201 gene locus_tag LOCUS_65800 156798 158201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 158327 159667 gene locus_tag LOCUS_65810 158327 159667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65810 160571 159672 gene locus_tag LOCUS_65820 160571 159672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 162165 160792 gene locus_tag LOCUS_65830 162165 160792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 163904 162162 gene locus_tag LOCUS_65840 163904 162162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 164105 165010 gene locus_tag LOCUS_65850 164105 165010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 165161 165949 gene locus_tag LOCUS_65860 165161 165949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 167319 166033 gene locus_tag LOCUS_65870 167319 166033 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_65870 168682 167312 gene locus_tag LOCUS_65880 168682 167312 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_65880 168847 170583 gene locus_tag LOCUS_65890 168847 170583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 171522 170749 gene locus_tag LOCUS_65900 171522 170749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65900 172276 171593 gene locus_tag LOCUS_65910 172276 171593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 >Feature sequence22 363 2636 gene locus_tag LOCUS_65920 363 2636 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_65920 2811 3311 gene locus_tag LOCUS_65930 2811 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 3315 3548 gene locus_tag LOCUS_65940 3315 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 3559 4011 gene locus_tag LOCUS_65950 gene rplI 3559 4011 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_65950 4330 4079 gene locus_tag LOCUS_65960 4330 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 5075 4410 gene locus_tag LOCUS_65970 5075 4410 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_65970 5127 6551 gene locus_tag LOCUS_65980 gene dnaB 5127 6551 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_65980 6772 7818 gene locus_tag LOCUS_65990 6772 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 7909 8724 gene locus_tag LOCUS_66000 7909 8724 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_66000 8876 11803 gene locus_tag LOCUS_66010 8876 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 12258 11872 gene locus_tag LOCUS_66020 12258 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 13256 12282 gene locus_tag LOCUS_66030 13256 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 13915 13361 gene locus_tag LOCUS_66040 gene tsaA 13915 13361 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943048.1 protein_id gnl|my_center|LOCUS_66040 14279 13926 gene locus_tag LOCUS_66050 14279 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 14170 15603 gene locus_tag LOCUS_66060 14170 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 15667 17013 gene locus_tag LOCUS_66070 15667 17013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_66070 15982 16070 gene locus_tag LOCUS_t00770 15982 16070 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17972 21262 gene locus_tag LOCUS_66080 17972 21262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 21565 21347 gene locus_tag LOCUS_66090 21565 21347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 23970 21940 gene locus_tag LOCUS_66100 23970 21940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 25791 24013 gene locus_tag LOCUS_66110 25791 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 26012 27247 gene locus_tag LOCUS_66120 26012 27247 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_66120 27288 29807 gene locus_tag LOCUS_66130 27288 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66130 30077 30415 gene locus_tag LOCUS_66140 30077 30415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 31298 31014 gene locus_tag LOCUS_66150 31298 31014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 31454 32047 gene locus_tag LOCUS_66160 31454 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66160 32350 32153 gene locus_tag LOCUS_66170 32350 32153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 32477 32731 gene locus_tag LOCUS_66180 32477 32731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 33438 33737 gene locus_tag LOCUS_66190 33438 33737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 33859 34296 gene locus_tag LOCUS_66200 33859 34296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 34374 34877 gene locus_tag LOCUS_66210 34374 34877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 35043 35429 gene locus_tag LOCUS_66220 35043 35429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 36553 35486 gene locus_tag LOCUS_66230 36553 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 36943 36773 gene locus_tag LOCUS_66240 36943 36773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 38354 37539 gene locus_tag LOCUS_66250 38354 37539 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_66250 39341 38439 gene locus_tag LOCUS_66260 39341 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 39935 41287 gene locus_tag LOCUS_66270 39935 41287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 41819 41310 gene locus_tag LOCUS_66280 41819 41310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 41856 42086 gene locus_tag LOCUS_66290 41856 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 42120 43043 gene locus_tag LOCUS_66300 42120 43043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66300 46075 43127 gene locus_tag LOCUS_66310 46075 43127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 46850 46170 gene locus_tag LOCUS_66320 46850 46170 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_66320 47272 48336 gene locus_tag LOCUS_66330 47272 48336 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189831439.1 protein_id gnl|my_center|LOCUS_66330 48452 48976 gene locus_tag LOCUS_66340 48452 48976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 49672 48995 gene locus_tag LOCUS_66350 49672 48995 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_66350 49708 52455 gene locus_tag LOCUS_66360 49708 52455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 52571 53176 gene locus_tag LOCUS_66370 52571 53176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66370 53935 53177 gene locus_tag LOCUS_66380 53935 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 54119 54859 gene locus_tag LOCUS_66390 54119 54859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 56270 54930 gene locus_tag LOCUS_66400 56270 54930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66400 56188 56439 gene locus_tag LOCUS_66410 56188 56439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 56725 57336 gene locus_tag LOCUS_66420 56725 57336 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 protein_id gnl|my_center|LOCUS_66420 57901 57374 gene locus_tag LOCUS_66430 57901 57374 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479987.1 protein_id gnl|my_center|LOCUS_66430 58039 58290 gene locus_tag LOCUS_66440 58039 58290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 59722 58340 gene locus_tag LOCUS_66450 59722 58340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 60598 59870 gene locus_tag LOCUS_66460 60598 59870 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552039.1 protein_id gnl|my_center|LOCUS_66460 61767 61384 gene locus_tag LOCUS_66470 61767 61384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66470 61956 61768 gene locus_tag LOCUS_66480 61956 61768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 61858 62751 gene locus_tag LOCUS_66490 61858 62751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 62744 64339 gene locus_tag LOCUS_66500 62744 64339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 64881 64579 gene locus_tag LOCUS_66510 64881 64579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 65738 64977 gene locus_tag LOCUS_66520 65738 64977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 66403 66831 gene locus_tag LOCUS_66530 66403 66831 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_66530 66901 68286 gene locus_tag LOCUS_66540 66901 68286 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_66540 68295 68879 gene locus_tag LOCUS_66550 68295 68879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 68889 69395 gene locus_tag LOCUS_66560 68889 69395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 70030 69365 gene locus_tag LOCUS_66570 70030 69365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 70834 70100 gene locus_tag LOCUS_66580 70834 70100 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_66580 71923 70901 gene locus_tag LOCUS_66590 71923 70901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 72524 71955 gene locus_tag LOCUS_66600 72524 71955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 73725 72832 gene locus_tag LOCUS_66610 73725 72832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66610 74366 73806 gene locus_tag LOCUS_66620 74366 73806 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 protein_id gnl|my_center|LOCUS_66620 75911 74409 gene locus_tag LOCUS_66630 75911 74409 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_66630 77370 75919 gene locus_tag LOCUS_66640 77370 75919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66640 78870 77527 gene locus_tag LOCUS_66650 78870 77527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 79261 79767 gene locus_tag LOCUS_66660 79261 79767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 80121 81587 gene locus_tag LOCUS_66670 80121 81587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 81709 82587 gene locus_tag LOCUS_66680 81709 82587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 82748 82566 gene locus_tag LOCUS_66690 82748 82566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66690 84750 82762 gene locus_tag LOCUS_66700 84750 82762 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_66700 86485 84788 gene locus_tag LOCUS_66710 86485 84788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 86737 87426 gene locus_tag LOCUS_66720 86737 87426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 87529 89847 gene locus_tag LOCUS_66730 87529 89847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 90931 89858 gene locus_tag LOCUS_66740 90931 89858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 91743 90931 gene locus_tag LOCUS_66750 91743 90931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 92458 91736 gene locus_tag LOCUS_66760 92458 91736 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_66760 93223 92465 gene locus_tag LOCUS_66770 93223 92465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 93717 95447 gene locus_tag LOCUS_66780 93717 95447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 96653 95451 gene locus_tag LOCUS_66790 96653 95451 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 protein_id gnl|my_center|LOCUS_66790 97510 96716 gene locus_tag LOCUS_66800 97510 96716 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921367.1 protein_id gnl|my_center|LOCUS_66800 99176 97518 gene locus_tag LOCUS_66810 99176 97518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 99316 100365 gene locus_tag LOCUS_66820 99316 100365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66820 103690 100388 gene locus_tag LOCUS_66830 103690 100388 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_66830 105263 103770 gene locus_tag LOCUS_66840 105263 103770 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074194.1 protein_id gnl|my_center|LOCUS_66840 106793 105342 gene locus_tag LOCUS_66850 106793 105342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66850 106864 107307 gene locus_tag LOCUS_66860 106864 107307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 107473 109002 gene locus_tag LOCUS_66870 107473 109002 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403039.1 protein_id gnl|my_center|LOCUS_66870 108918 109925 gene locus_tag LOCUS_66880 108918 109925 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_66880 111122 110085 gene locus_tag LOCUS_66890 111122 110085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 112447 111275 gene locus_tag LOCUS_66900 112447 111275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 113889 112567 gene locus_tag LOCUS_66910 113889 112567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 113888 115255 gene locus_tag LOCUS_66920 113888 115255 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_66920 115280 116260 gene locus_tag LOCUS_66930 115280 116260 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742233.1 protein_id gnl|my_center|LOCUS_66930 116322 117392 gene locus_tag LOCUS_66940 116322 117392 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_66940 117563 117898 gene locus_tag LOCUS_66950 117563 117898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 117895 118872 gene locus_tag LOCUS_66960 117895 118872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 118954 119619 gene locus_tag LOCUS_66970 118954 119619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 121651 119540 gene locus_tag LOCUS_66980 121651 119540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 122928 121741 gene locus_tag LOCUS_66990 122928 121741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66990 123334 122960 gene locus_tag LOCUS_67000 123334 122960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 125930 123432 gene locus_tag LOCUS_67010 125930 123432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 126369 125953 gene locus_tag LOCUS_67020 126369 125953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_67020 127600 126488 gene locus_tag LOCUS_67030 127600 126488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 127994 127701 gene locus_tag LOCUS_67040 127994 127701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 128410 127991 gene locus_tag LOCUS_67050 128410 127991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 129566 128490 gene locus_tag LOCUS_67060 gene amrS 129566 128490 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_67060 130144 129563 gene locus_tag LOCUS_67070 130144 129563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67070 130947 130141 gene locus_tag LOCUS_67080 gene amrB 130947 130141 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_67080 131116 132381 gene locus_tag LOCUS_67090 131116 132381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 132378 133574 gene locus_tag LOCUS_67100 132378 133574 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614666.1 protein_id gnl|my_center|LOCUS_67100 133576 136689 gene locus_tag LOCUS_67110 133576 136689 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_67110 139459 136694 gene locus_tag LOCUS_67120 139459 136694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 139506 140855 gene locus_tag LOCUS_67130 139506 140855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 141704 140859 gene locus_tag LOCUS_67140 141704 140859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 141802 142878 gene locus_tag LOCUS_67150 141802 142878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 143019 143387 gene locus_tag LOCUS_67160 143019 143387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 143542 145158 gene locus_tag LOCUS_67170 143542 145158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 145267 146808 gene locus_tag LOCUS_67180 145267 146808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 146887 147366 gene locus_tag LOCUS_67190 146887 147366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 147634 148431 gene locus_tag LOCUS_67200 147634 148431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 148597 149904 gene locus_tag LOCUS_67210 148597 149904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 149982 151934 gene locus_tag LOCUS_67220 149982 151934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67220 152366 153430 gene locus_tag LOCUS_67230 152366 153430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_67230 155533 154328 gene locus_tag LOCUS_67240 155533 154328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 156132 155530 gene locus_tag LOCUS_67250 156132 155530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 157199 156081 gene locus_tag LOCUS_67260 157199 156081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 157592 158821 gene locus_tag LOCUS_67270 157592 158821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 >Feature sequence23 391 585 gene locus_tag LOCUS_67280 gene rpmD 391 585 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693169.1 protein_id gnl|my_center|LOCUS_67280 599 1069 gene locus_tag LOCUS_67290 gene rplO 599 1069 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088136.1 protein_id gnl|my_center|LOCUS_67290 1290 2606 gene locus_tag LOCUS_67300 gene secY 1290 2606 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_67300 2698 2931 gene locus_tag LOCUS_67310 2698 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 3084 3458 gene locus_tag LOCUS_67320 gene rpsM 3084 3458 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_67320 3462 3872 gene locus_tag LOCUS_67330 gene rpsK 3462 3872 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495225.1 protein_id gnl|my_center|LOCUS_67330 3876 4505 gene locus_tag LOCUS_67340 gene rpsD 3876 4505 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_67340 4518 5531 gene locus_tag LOCUS_67350 4518 5531 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_67350 5592 6008 gene locus_tag LOCUS_67360 5592 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 6709 6104 gene locus_tag LOCUS_67370 6709 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 6850 7137 gene locus_tag LOCUS_67380 6850 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 7127 7744 gene locus_tag LOCUS_67390 gene sctR 7127 7744 CDS product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037381869.1 protein_id gnl|my_center|LOCUS_67390 7741 8010 gene locus_tag LOCUS_67400 7741 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 8039 8734 gene locus_tag LOCUS_67410 8039 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 8848 10185 gene locus_tag LOCUS_67420 8848 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 11130 10192 gene locus_tag LOCUS_67430 11130 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 13800 11362 gene locus_tag LOCUS_67440 gene lon 13800 11362 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_67440 14304 14660 gene locus_tag LOCUS_67450 14304 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 14772 15368 gene locus_tag LOCUS_67460 14772 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 15365 17905 gene locus_tag LOCUS_67470 gene priA 15365 17905 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_67470 18601 17921 gene locus_tag LOCUS_67480 18601 17921 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_67480 19059 21161 gene locus_tag LOCUS_67490 19059 21161 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_67490 21169 21933 gene locus_tag LOCUS_67500 21169 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 21945 22754 gene locus_tag LOCUS_67510 21945 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 23285 22818 gene locus_tag LOCUS_67520 23285 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 23455 25500 gene locus_tag LOCUS_67530 23455 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 25497 26456 gene locus_tag LOCUS_67540 gene fmt 25497 26456 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_67540 27308 26463 gene locus_tag LOCUS_67550 gene udp 27308 26463 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_67550 28069 27308 gene locus_tag LOCUS_67560 gene deoC 28069 27308 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256596.1 protein_id gnl|my_center|LOCUS_67560 28578 28129 gene locus_tag LOCUS_67570 28578 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 31424 28953 gene locus_tag LOCUS_67580 31424 28953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 31484 31633 gene locus_tag LOCUS_67590 31484 31633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 32160 31642 gene locus_tag LOCUS_67600 32160 31642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 32216 32872 gene locus_tag LOCUS_67610 32216 32872 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809037.1 protein_id gnl|my_center|LOCUS_67610 32957 35107 gene locus_tag LOCUS_67620 32957 35107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67620 35214 36176 gene locus_tag LOCUS_67630 35214 36176 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938694.1 protein_id gnl|my_center|LOCUS_67630 38794 36320 gene locus_tag LOCUS_67640 38794 36320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 39891 38791 gene locus_tag LOCUS_67650 39891 38791 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_67650 40448 39888 gene locus_tag LOCUS_67660 40448 39888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 40617 42719 gene locus_tag LOCUS_67670 40617 42719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 42889 43086 gene locus_tag LOCUS_67680 42889 43086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 43192 44301 gene locus_tag LOCUS_67690 43192 44301 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_67690 44456 45553 gene locus_tag LOCUS_67700 44456 45553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 45572 48103 gene locus_tag LOCUS_67710 45572 48103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 48640 48263 gene locus_tag LOCUS_67720 48640 48263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 49965 48790 gene locus_tag LOCUS_67730 49965 48790 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921422.1 protein_id gnl|my_center|LOCUS_67730 51036 50026 gene locus_tag LOCUS_67740 51036 50026 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085629.1 protein_id gnl|my_center|LOCUS_67740 51138 52367 gene locus_tag LOCUS_67750 51138 52367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67750 52343 52798 gene locus_tag LOCUS_67760 52343 52798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67760 52827 53264 gene locus_tag LOCUS_67770 52827 53264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 53380 53661 gene locus_tag LOCUS_67780 53380 53661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 54775 53666 gene locus_tag LOCUS_67790 54775 53666 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538117.1 protein_id gnl|my_center|LOCUS_67790 55676 54777 gene locus_tag LOCUS_67800 55676 54777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 55693 55974 gene locus_tag LOCUS_67810 55693 55974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 56632 57729 gene locus_tag LOCUS_67820 56632 57729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 58791 59474 gene locus_tag LOCUS_67830 58791 59474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 60694 60497 gene locus_tag LOCUS_67840 60694 60497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 61941 60706 gene locus_tag LOCUS_67850 61941 60706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 63452 62046 gene locus_tag LOCUS_67860 63452 62046 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_67860 63600 63836 gene locus_tag LOCUS_67870 63600 63836 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_67870 63847 64464 gene locus_tag LOCUS_67880 63847 64464 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_67880 64479 65867 gene locus_tag LOCUS_67890 64479 65867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 69998 65895 gene locus_tag LOCUS_67900 69998 65895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 69917 70612 gene locus_tag LOCUS_67910 69917 70612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67910 71850 70588 gene locus_tag LOCUS_67920 71850 70588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67920 73361 71853 gene locus_tag LOCUS_67930 73361 71853 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_67930 76502 73458 gene locus_tag LOCUS_67940 76502 73458 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165792415.1 protein_id gnl|my_center|LOCUS_67940 77049 76510 gene locus_tag LOCUS_67950 77049 76510 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_67950 77862 77065 gene locus_tag LOCUS_67960 77862 77065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 78190 77918 gene locus_tag LOCUS_67970 78190 77918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67970 78078 79652 gene locus_tag LOCUS_67980 78078 79652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 79631 84346 gene locus_tag LOCUS_67990 79631 84346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67990 84941 84327 gene locus_tag LOCUS_68000 84941 84327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 86269 84986 gene locus_tag LOCUS_68010 86269 84986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 86331 86912 gene locus_tag LOCUS_68020 86331 86912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68020 87275 87592 gene locus_tag LOCUS_68030 87275 87592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 88700 87633 gene locus_tag LOCUS_68040 88700 87633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 89151 89783 gene locus_tag LOCUS_68050 gene sigM 89151 89783 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087658.1 protein_id gnl|my_center|LOCUS_68050 89844 93287 gene locus_tag LOCUS_68060 89844 93287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 93993 93526 gene locus_tag LOCUS_68070 93993 93526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 95041 94046 gene locus_tag LOCUS_68080 95041 94046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 95195 95887 gene locus_tag LOCUS_68090 95195 95887 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_68090 96123 96581 gene locus_tag LOCUS_68100 96123 96581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68100 97705 96593 gene locus_tag LOCUS_68110 97705 96593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68110 97808 98500 gene locus_tag LOCUS_68120 97808 98500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68120 98728 99489 gene locus_tag LOCUS_68130 98728 99489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68130 100267 99542 gene locus_tag LOCUS_68140 100267 99542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 100421 100816 gene locus_tag LOCUS_68150 100421 100816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 100801 101661 gene locus_tag LOCUS_68160 100801 101661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68160 101756 102331 gene locus_tag LOCUS_68170 101756 102331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 103135 102341 gene locus_tag LOCUS_68180 103135 102341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 103384 103977 gene locus_tag LOCUS_68190 103384 103977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68190 105051 104002 gene locus_tag LOCUS_68200 105051 104002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68200 105157 106407 gene locus_tag LOCUS_68210 105157 106407 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_68210 107479 106412 gene locus_tag LOCUS_68220 107479 106412 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_68220 107919 107512 gene locus_tag LOCUS_68230 gene trxA 107919 107512 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_68230 108828 107962 gene locus_tag LOCUS_68240 108828 107962 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_68240 108914 109393 gene locus_tag LOCUS_68250 108914 109393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68250 110496 109441 gene locus_tag LOCUS_68260 110496 109441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 110749 111579 gene locus_tag LOCUS_68270 110749 111579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 111910 111623 gene locus_tag LOCUS_68280 111910 111623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 112064 112327 gene locus_tag LOCUS_68290 112064 112327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 112440 113249 gene locus_tag LOCUS_68300 112440 113249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 113250 114146 gene locus_tag LOCUS_68310 113250 114146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 115181 114159 gene locus_tag LOCUS_68320 115181 114159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 115659 115507 gene locus_tag LOCUS_68330 115659 115507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 115803 116486 gene locus_tag LOCUS_68340 115803 116486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 116571 116837 gene locus_tag LOCUS_68350 116571 116837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 117077 117754 gene locus_tag LOCUS_68360 117077 117754 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_68360 118549 117842 gene locus_tag LOCUS_68370 118549 117842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68370 118938 118750 gene locus_tag LOCUS_68380 118938 118750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 119048 120700 gene locus_tag LOCUS_68390 119048 120700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68390 120687 121847 gene locus_tag LOCUS_68400 120687 121847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 123858 121864 gene locus_tag LOCUS_68410 123858 121864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68410 124179 124901 gene locus_tag LOCUS_68420 124179 124901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 126049 124967 gene locus_tag LOCUS_68430 126049 124967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 126165 126344 gene locus_tag LOCUS_68440 126165 126344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 127174 126341 gene locus_tag LOCUS_68450 127174 126341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 127056 128186 gene locus_tag LOCUS_68460 127056 128186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 128188 129234 gene locus_tag LOCUS_68470 128188 129234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 129821 129558 gene locus_tag LOCUS_68480 129821 129558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68480 129723 130070 gene locus_tag LOCUS_68490 129723 130070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 130691 130149 gene locus_tag LOCUS_68500 130691 130149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 131163 130786 gene locus_tag LOCUS_68510 131163 130786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68510 131044 131643 gene locus_tag LOCUS_68520 gene rpoE 131044 131643 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_68520 131743 134712 gene locus_tag LOCUS_68530 131743 134712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 134975 136150 gene locus_tag LOCUS_68540 134975 136150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 136147 137883 gene locus_tag LOCUS_68550 136147 137883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68550 138444 138725 gene locus_tag LOCUS_68560 138444 138725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 138829 143937 gene locus_tag LOCUS_68570 138829 143937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68570 144946 144053 gene locus_tag LOCUS_68580 144946 144053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 145922 145485 gene locus_tag LOCUS_68590 145922 145485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 146615 146319 gene locus_tag LOCUS_68600 146615 146319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 147843 147550 gene locus_tag LOCUS_68610 147843 147550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 147733 148254 gene locus_tag LOCUS_68620 147733 148254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68620 148858 149193 gene locus_tag LOCUS_68630 148858 149193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 149289 149603 gene locus_tag LOCUS_68640 149289 149603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68640 151071 150706 gene locus_tag LOCUS_68650 151071 150706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68650 >Feature sequence24 265 1455 gene locus_tag LOCUS_68660 265 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 1642 2445 gene locus_tag LOCUS_68670 1642 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68670 2587 4128 gene locus_tag LOCUS_68680 2587 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68680 4125 6161 gene locus_tag LOCUS_68690 4125 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690 6128 6442 gene locus_tag LOCUS_68700 6128 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 6693 7145 gene locus_tag LOCUS_68710 6693 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68710 7142 8503 gene locus_tag LOCUS_68720 7142 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 9352 11052 gene locus_tag LOCUS_68730 gene kdpA 9352 11052 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_68730 11068 13137 gene locus_tag LOCUS_68740 gene kdpB 11068 13137 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_68740 13151 13726 gene locus_tag LOCUS_68750 gene kdpC 13151 13726 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_68750 13713 16406 gene locus_tag LOCUS_68760 13713 16406 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_68760 16403 17107 gene locus_tag LOCUS_68770 gene kdpE 16403 17107 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186082.1 protein_id gnl|my_center|LOCUS_68770 18254 17133 gene locus_tag LOCUS_68780 18254 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68780 18587 21265 gene locus_tag LOCUS_68790 18587 21265 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035944.1 protein_id gnl|my_center|LOCUS_68790 21246 21380 gene locus_tag LOCUS_68800 21246 21380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 21453 24449 gene locus_tag LOCUS_68810 21453 24449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68810 25781 24456 gene locus_tag LOCUS_68820 gene mnmE 25781 24456 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_68820 27064 25934 gene locus_tag LOCUS_68830 gene mnmA 27064 25934 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038010.1 protein_id gnl|my_center|LOCUS_68830 28002 27118 gene locus_tag LOCUS_68840 28002 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_68840 28433 28083 gene locus_tag LOCUS_68850 28433 28083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 31191 28507 gene locus_tag LOCUS_68860 31191 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68860 31664 33901 gene locus_tag LOCUS_68870 31664 33901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68870 34106 34474 gene locus_tag LOCUS_68880 34106 34474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68880 35139 34543 gene locus_tag LOCUS_68890 35139 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 35447 35136 gene locus_tag LOCUS_68900 35447 35136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 35474 37126 gene locus_tag LOCUS_68910 35474 37126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 37891 37277 gene locus_tag LOCUS_68920 37891 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 38183 38545 gene locus_tag LOCUS_68930 38183 38545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68930 38509 39156 gene locus_tag LOCUS_68940 38509 39156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68940 39258 39425 gene locus_tag LOCUS_68950 39258 39425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68950 39528 41450 gene locus_tag LOCUS_68960 39528 41450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 41656 43518 gene locus_tag LOCUS_68970 41656 43518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 46481 43524 gene locus_tag LOCUS_68980 46481 43524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68980 47685 46561 gene locus_tag LOCUS_68990 47685 46561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 49184 48483 gene locus_tag LOCUS_69000 49184 48483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 50440 49223 gene locus_tag LOCUS_69010 50440 49223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 50678 50445 gene locus_tag LOCUS_69020 50678 50445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 51084 50854 gene locus_tag LOCUS_69030 51084 50854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 51673 51086 gene locus_tag LOCUS_69040 51673 51086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 52862 51693 gene locus_tag LOCUS_69050 52862 51693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69050 53506 52889 gene locus_tag LOCUS_69060 53506 52889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 53811 53503 gene locus_tag LOCUS_69070 53811 53503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 54026 53823 gene locus_tag LOCUS_69080 54026 53823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69080 54706 54023 gene locus_tag LOCUS_69090 54706 54023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69090 55288 54716 gene locus_tag LOCUS_69100 55288 54716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 56177 55281 gene locus_tag LOCUS_69110 56177 55281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69110 59513 56214 gene locus_tag LOCUS_69120 59513 56214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69120 63296 59517 gene locus_tag LOCUS_69130 63296 59517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 65614 63359 gene locus_tag LOCUS_69140 65614 63359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69140 66484 65675 gene locus_tag LOCUS_69150 66484 65675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 66897 66484 gene locus_tag LOCUS_69160 66897 66484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 67674 66973 gene locus_tag LOCUS_69170 67674 66973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 69590 67677 gene locus_tag LOCUS_69180 69590 67677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 69994 69587 gene locus_tag LOCUS_69190 69994 69587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69190 71015 69984 gene locus_tag LOCUS_69200 71015 69984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69200 71743 71012 gene locus_tag LOCUS_69210 71743 71012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 72617 71868 gene locus_tag LOCUS_69220 72617 71868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 73492 72620 gene locus_tag LOCUS_69230 73492 72620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 74066 73542 gene locus_tag LOCUS_69240 74066 73542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 74208 74041 gene locus_tag LOCUS_69250 74208 74041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 74644 74423 gene locus_tag LOCUS_69260 74644 74423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69260 75000 74641 gene locus_tag LOCUS_69270 75000 74641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69270 75446 74997 gene locus_tag LOCUS_69280 75446 74997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 75973 75443 gene locus_tag LOCUS_69290 75973 75443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69290 76792 76166 gene locus_tag LOCUS_69300 76792 76166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 77155 76796 gene locus_tag LOCUS_69310 77155 76796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 78103 77696 gene locus_tag LOCUS_69320 78103 77696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 80187 78019 gene locus_tag LOCUS_69330 80187 78019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 80186 80707 gene locus_tag LOCUS_69340 80186 80707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 80772 81185 gene locus_tag LOCUS_69350 80772 81185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 81188 82942 gene locus_tag LOCUS_69360 81188 82942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 83842 82964 gene locus_tag LOCUS_69370 83842 82964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 85707 85114 gene locus_tag LOCUS_69380 85707 85114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 87068 85704 gene locus_tag LOCUS_69390 87068 85704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 87838 87176 gene locus_tag LOCUS_69400 87838 87176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 87927 88160 gene locus_tag LOCUS_69410 87927 88160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 88543 89517 gene locus_tag LOCUS_69420 88543 89517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69420 90021 89707 gene locus_tag LOCUS_69430 90021 89707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69430 91168 90914 gene locus_tag LOCUS_69440 91168 90914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 91754 91233 gene locus_tag LOCUS_69450 91754 91233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69450 >Feature sequence25 500 306 gene locus_tag LOCUS_69460 500 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 1515 1919 gene locus_tag LOCUS_69470 1515 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 3278 2595 gene locus_tag LOCUS_69480 3278 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69480 5427 4636 gene locus_tag LOCUS_69490 5427 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69490 8583 5869 gene locus_tag LOCUS_69500 8583 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69500 9873 8599 gene locus_tag LOCUS_69510 9873 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69510 10669 10241 gene locus_tag LOCUS_69520 10669 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 11118 10708 gene locus_tag LOCUS_69530 11118 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 12045 11290 gene locus_tag LOCUS_69540 12045 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69540 12928 12425 gene locus_tag LOCUS_69550 12928 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 12833 13063 gene locus_tag LOCUS_69560 12833 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 13060 13263 gene locus_tag LOCUS_69570 13060 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 15257 13281 gene locus_tag LOCUS_69580 15257 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 15629 15270 gene locus_tag LOCUS_69590 15629 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 15960 15691 gene locus_tag LOCUS_69600 15960 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69600 18069 15970 gene locus_tag LOCUS_69610 18069 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69610 20045 17958 gene locus_tag LOCUS_69620 20045 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 20466 20017 gene locus_tag LOCUS_69630 20466 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 23006 20349 gene locus_tag LOCUS_69640 23006 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69640 23323 23003 gene locus_tag LOCUS_69650 23323 23003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69650 23390 23869 gene locus_tag LOCUS_69660 23390 23869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 24640 24927 gene locus_tag LOCUS_69670 24640 24927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 25640 26278 gene locus_tag LOCUS_69680 25640 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 26503 26676 gene locus_tag LOCUS_69690 26503 26676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69690 26689 27234 gene locus_tag LOCUS_69700 26689 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 27239 27598 gene locus_tag LOCUS_69710 27239 27598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69710 27573 27866 gene locus_tag LOCUS_69720 27573 27866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 27879 28601 gene locus_tag LOCUS_69730 27879 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69730 28602 29498 gene locus_tag LOCUS_69740 28602 29498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 29647 30441 gene locus_tag LOCUS_69750 29647 30441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69750 30327 30575 gene locus_tag LOCUS_69760 30327 30575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 30585 31172 gene locus_tag LOCUS_69770 30585 31172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 31169 31825 gene locus_tag LOCUS_69780 31169 31825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 31829 32620 gene locus_tag LOCUS_69790 31829 32620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 33630 33814 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtggcttgacgtcgctggcgggcctagcg 34053 34589 gene locus_tag LOCUS_69800 34053 34589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69800 34779 35177 gene locus_tag LOCUS_69810 34779 35177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69810 35212 35865 gene locus_tag LOCUS_69820 35212 35865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 35875 36432 gene locus_tag LOCUS_69830 35875 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 36318 38768 gene locus_tag LOCUS_69840 36318 38768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 38788 38976 gene locus_tag LOCUS_69850 38788 38976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 40241 39141 gene locus_tag LOCUS_69860 40241 39141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 40180 40608 gene locus_tag LOCUS_69870 40180 40608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 42026 40650 gene locus_tag LOCUS_69880 42026 40650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 42123 42467 gene locus_tag LOCUS_69890 42123 42467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 42902 42468 gene locus_tag LOCUS_69900 42902 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69900 43606 42899 gene locus_tag LOCUS_69910 43606 42899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69910 44126 43587 gene locus_tag LOCUS_69920 44126 43587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 44256 44738 gene locus_tag LOCUS_69930 44256 44738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 44701 45354 gene locus_tag LOCUS_69940 44701 45354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69940 46074 45358 gene locus_tag LOCUS_69950 46074 45358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_69950 45961 46350 gene locus_tag LOCUS_69960 45961 46350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 46521 47627 gene locus_tag LOCUS_69970 46521 47627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69970 48061 47624 gene locus_tag LOCUS_69980 48061 47624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69980 48027 49268 gene locus_tag LOCUS_69990 48027 49268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 49426 49352 gene locus_tag LOCUS_t00780 49426 49352 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 49818 49558 gene locus_tag LOCUS_70000 49818 49558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 49720 50106 gene locus_tag LOCUS_70010 49720 50106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70010 50768 50358 gene locus_tag LOCUS_70020 50768 50358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 50958 52814 gene locus_tag LOCUS_70030 50958 52814 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_70030 52891 53370 gene locus_tag LOCUS_70040 52891 53370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70040 53383 53637 gene locus_tag LOCUS_70050 53383 53637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70050 53641 55782 gene locus_tag LOCUS_70060 53641 55782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70060 55779 57272 gene locus_tag LOCUS_70070 55779 57272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70070 57269 58954 gene locus_tag LOCUS_70080 57269 58954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70080 60164 59139 gene locus_tag LOCUS_70090 60164 59139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70090 64343 60531 gene locus_tag LOCUS_70100 64343 60531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 65531 64485 gene locus_tag LOCUS_70110 65531 64485 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_70110 65733 67109 gene locus_tag LOCUS_70120 65733 67109 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_70120 67604 67125 gene locus_tag LOCUS_70130 67604 67125 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170040.1 protein_id gnl|my_center|LOCUS_70130 69071 67764 gene locus_tag LOCUS_70140 69071 67764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70140 69640 71847 gene locus_tag LOCUS_70150 69640 71847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70150 73871 72720 gene locus_tag LOCUS_70160 73871 72720 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_70160 76254 73897 gene locus_tag LOCUS_70170 76254 73897 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228275.1 protein_id gnl|my_center|LOCUS_70170 76424 78907 gene locus_tag LOCUS_70180 76424 78907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 79042 79560 gene locus_tag LOCUS_70190 79042 79560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 79611 81662 gene locus_tag LOCUS_70200 gene metG 79611 81662 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262543.1 protein_id gnl|my_center|LOCUS_70200 82537 81728 gene locus_tag LOCUS_70210 82537 81728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 82719 83831 gene locus_tag LOCUS_70220 82719 83831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 83882 84175 gene locus_tag LOCUS_70230 83882 84175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 85165 84410 gene locus_tag LOCUS_70240 85165 84410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 86422 86871 gene locus_tag LOCUS_70250 86422 86871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 87530 86970 gene locus_tag LOCUS_70260 87530 86970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70260 88046 87774 gene locus_tag LOCUS_70270 88046 87774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 >Feature sequence26 1626 424 gene locus_tag LOCUS_70280 1626 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70280 3310 2144 gene locus_tag LOCUS_70290 3310 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 6107 3651 gene locus_tag LOCUS_70300 6107 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 7873 6104 gene locus_tag LOCUS_70310 gene thiC 7873 6104 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_70310 8351 9889 gene locus_tag LOCUS_70320 8351 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 11269 9995 gene locus_tag LOCUS_70330 11269 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70330 11640 11410 gene locus_tag LOCUS_70340 11640 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 12042 11695 gene locus_tag LOCUS_70350 12042 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 11924 12370 gene locus_tag LOCUS_70360 11924 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 12563 13273 gene locus_tag LOCUS_70370 12563 13273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_70370 13275 15044 gene locus_tag LOCUS_70380 gene phoR 13275 15044 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_70380 16442 15123 gene locus_tag LOCUS_70390 16442 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 17668 16493 gene locus_tag LOCUS_70400 17668 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 17725 18561 gene locus_tag LOCUS_70410 17725 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 22229 18660 gene locus_tag LOCUS_70420 22229 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 22289 23245 gene locus_tag LOCUS_70430 22289 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 23987 23358 gene locus_tag LOCUS_70440 gene sigM 23987 23358 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087658.1 protein_id gnl|my_center|LOCUS_70440 25940 24048 gene locus_tag LOCUS_70450 25940 24048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70450 26920 26090 gene locus_tag LOCUS_70460 26920 26090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70460 26995 28065 gene locus_tag LOCUS_70470 26995 28065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 29206 28070 gene locus_tag LOCUS_70480 gene rsgA 29206 28070 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943166.1 protein_id gnl|my_center|LOCUS_70480 30743 29253 gene locus_tag LOCUS_70490 30743 29253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 31636 30947 gene locus_tag LOCUS_70500 31636 30947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 31809 34805 gene locus_tag LOCUS_70510 31809 34805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 35035 36099 gene locus_tag LOCUS_70520 35035 36099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 36113 38104 gene locus_tag LOCUS_70530 36113 38104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 39914 38232 gene locus_tag LOCUS_70540 39914 38232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 39998 41116 gene locus_tag LOCUS_70550 39998 41116 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079994.1 protein_id gnl|my_center|LOCUS_70550 41442 43358 gene locus_tag LOCUS_70560 41442 43358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 43361 44254 gene locus_tag LOCUS_70570 43361 44254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70570 44870 44382 gene locus_tag LOCUS_70580 44870 44382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 45137 46555 gene locus_tag LOCUS_70590 45137 46555 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_70590 46575 47639 gene locus_tag LOCUS_70600 46575 47639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 47636 50032 gene locus_tag LOCUS_70610 gene gspD 47636 50032 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_70610 50063 51907 gene locus_tag LOCUS_70620 gene gspE 50063 51907 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_70620 51912 53156 gene locus_tag LOCUS_70630 gene exeF 51912 53156 CDS product GspF family T2SS innner membrane protein variant ExeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704542.1 protein_id gnl|my_center|LOCUS_70630 53186 53635 gene locus_tag LOCUS_70640 53186 53635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70640 53657 54619 gene locus_tag LOCUS_70650 53657 54619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70650 54619 55362 gene locus_tag LOCUS_70660 54619 55362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70660 55413 56072 gene locus_tag LOCUS_70670 55413 56072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 56080 57411 gene locus_tag LOCUS_70680 56080 57411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 57418 59178 gene locus_tag LOCUS_70690 57418 59178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 59175 59792 gene locus_tag LOCUS_70700 59175 59792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70700 59789 61300 gene locus_tag LOCUS_70710 59789 61300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70710 61642 63024 gene locus_tag LOCUS_70720 61642 63024 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_70720 68325 63190 gene locus_tag LOCUS_70730 68325 63190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 73202 68322 gene locus_tag LOCUS_70740 73202 68322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 74012 73263 gene locus_tag LOCUS_70750 74012 73263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70750 74049 76730 gene locus_tag LOCUS_70760 74049 76730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70760 76730 77464 gene locus_tag LOCUS_70770 76730 77464 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_70770 77475 78131 gene locus_tag LOCUS_70780 77475 78131 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028650.1 protein_id gnl|my_center|LOCUS_70780 79075 78185 gene locus_tag LOCUS_70790 79075 78185 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865083.1 protein_id gnl|my_center|LOCUS_70790 79046 79174 gene locus_tag LOCUS_70800 79046 79174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70800 79358 80389 gene locus_tag LOCUS_70810 79358 80389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 80368 81102 gene locus_tag LOCUS_70820 80368 81102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 81086 82069 gene locus_tag LOCUS_70830 81086 82069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 82000 82881 gene locus_tag LOCUS_70840 82000 82881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 82878 83555 gene locus_tag LOCUS_70850 82878 83555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70850 >Feature sequence27 1547 165 gene locus_tag LOCUS_70860 1547 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 1432 1878 gene locus_tag LOCUS_70870 1432 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70870 4076 2079 gene locus_tag LOCUS_70880 4076 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 5380 4130 gene locus_tag LOCUS_70890 5380 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 6451 5546 gene locus_tag LOCUS_70900 6451 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70900 6345 6554 gene locus_tag LOCUS_70910 6345 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70910 6608 9064 gene locus_tag LOCUS_70920 6608 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70920 9054 9692 gene locus_tag LOCUS_70930 9054 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 9689 10651 gene locus_tag LOCUS_70940 9689 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70940 10667 11137 gene locus_tag LOCUS_70950 10667 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70950 11902 11282 gene locus_tag LOCUS_70960 11902 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70960 14274 11908 gene locus_tag LOCUS_70970 14274 11908 CDS product bifunctional glycerol-3-phosphate dehydrogenase/glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208355.1 protein_id gnl|my_center|LOCUS_70970 15004 14291 gene locus_tag LOCUS_70980 15004 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 15407 14982 gene locus_tag LOCUS_70990 15407 14982 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707154.1 protein_id gnl|my_center|LOCUS_70990 16975 15404 gene locus_tag LOCUS_71000 16975 15404 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707155.1 protein_id gnl|my_center|LOCUS_71000 17892 16972 gene locus_tag LOCUS_71010 17892 16972 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_71010 18659 17898 gene locus_tag LOCUS_71020 18659 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_71020 20535 18652 gene locus_tag LOCUS_71030 20535 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71030 21143 20532 gene locus_tag LOCUS_71040 21143 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460553.1 protein_id gnl|my_center|LOCUS_71040 21429 21148 gene locus_tag LOCUS_71050 21429 21148 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081091609.1 protein_id gnl|my_center|LOCUS_71050 21551 22330 gene locus_tag LOCUS_71060 21551 22330 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_71060 22500 24353 gene locus_tag LOCUS_71070 22500 24353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71070 24450 25706 gene locus_tag LOCUS_71080 24450 25706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 26017 25742 gene locus_tag LOCUS_71090 26017 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 26274 26071 gene locus_tag LOCUS_71100 26274 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71100 28879 27176 gene locus_tag LOCUS_71110 28879 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71110 29480 28908 gene locus_tag LOCUS_71120 29480 28908 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216841.1 protein_id gnl|my_center|LOCUS_71120 30226 29477 gene locus_tag LOCUS_71130 30226 29477 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061344.1 protein_id gnl|my_center|LOCUS_71130 30308 30697 gene locus_tag LOCUS_71140 30308 30697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 32221 30755 gene locus_tag LOCUS_71150 32221 30755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71150 35622 32452 gene locus_tag LOCUS_71160 35622 32452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 36316 35705 gene locus_tag LOCUS_71170 gene sigM 36316 35705 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087658.1 protein_id gnl|my_center|LOCUS_71170 36459 37493 gene locus_tag LOCUS_71180 36459 37493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 37694 38323 gene locus_tag LOCUS_71190 37694 38323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71190 39133 38405 gene locus_tag LOCUS_71200 39133 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 39099 39512 gene locus_tag LOCUS_71210 39099 39512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71210 40644 39499 gene locus_tag LOCUS_71220 40644 39499 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_71220 43109 40641 gene locus_tag LOCUS_71230 43109 40641 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_71230 44326 43118 gene locus_tag LOCUS_71240 44326 43118 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_71240 45851 44343 gene locus_tag LOCUS_71250 45851 44343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 46567 45866 gene locus_tag LOCUS_71260 46567 45866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 46690 47619 gene locus_tag LOCUS_71270 46690 47619 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242008.1 protein_id gnl|my_center|LOCUS_71270 47717 48094 gene locus_tag LOCUS_71280 47717 48094 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_71280 48216 49979 gene locus_tag LOCUS_71290 48216 49979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71290 50127 51491 gene locus_tag LOCUS_71300 50127 51491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71300 52407 51565 gene locus_tag LOCUS_71310 52407 51565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71310 52406 53986 gene locus_tag LOCUS_71320 52406 53986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71320 53986 54690 gene locus_tag LOCUS_71330 53986 54690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71330 54929 55345 gene locus_tag LOCUS_71340 54929 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 56495 55449 gene locus_tag LOCUS_71350 56495 55449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 56908 56447 gene locus_tag LOCUS_71360 56908 56447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 56915 57979 gene locus_tag LOCUS_71370 56915 57979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71370 57976 58275 gene locus_tag LOCUS_71380 57976 58275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71380 58392 59951 gene locus_tag LOCUS_71390 58392 59951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71390 61240 61022 gene locus_tag LOCUS_71400 61240 61022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 63916 61634 gene locus_tag LOCUS_71410 63916 61634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 65355 63916 gene locus_tag LOCUS_71420 65355 63916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71420 65522 65343 gene locus_tag LOCUS_71430 65522 65343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 65973 65506 gene locus_tag LOCUS_71440 65973 65506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71440 67355 65916 gene locus_tag LOCUS_71450 67355 65916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71450 67952 68779 gene locus_tag LOCUS_71460 67952 68779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71460 70225 69929 gene locus_tag LOCUS_71470 70225 69929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71470 70318 71355 gene locus_tag LOCUS_71480 70318 71355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 71352 72137 gene locus_tag LOCUS_71490 gene istB 71352 72137 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_71490 72659 73024 gene locus_tag LOCUS_71500 72659 73024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 73268 74281 gene locus_tag LOCUS_71510 73268 74281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71510 74401 75084 gene locus_tag LOCUS_71520 74401 75084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71520 75546 75788 gene locus_tag LOCUS_71530 75546 75788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 77098 75698 gene locus_tag LOCUS_71540 77098 75698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 77589 77092 gene locus_tag LOCUS_71550 77589 77092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71550 78250 78465 gene locus_tag LOCUS_71560 78250 78465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71560 >Feature sequence28 3253 1193 gene locus_tag LOCUS_71570 3253 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71570 3888 3253 gene locus_tag LOCUS_71580 3888 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 4667 3885 gene locus_tag LOCUS_71590 4667 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 5268 4771 gene locus_tag LOCUS_71600 5268 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 6760 5981 gene locus_tag LOCUS_71610 6760 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71610 7164 6760 gene locus_tag LOCUS_71620 7164 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 7444 7151 gene locus_tag LOCUS_71630 7444 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71630 7338 7733 gene locus_tag LOCUS_71640 7338 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 8237 7812 gene locus_tag LOCUS_71650 8237 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71650 8262 8456 gene locus_tag LOCUS_71660 8262 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 8547 10304 gene locus_tag LOCUS_71670 8547 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71670 10307 12346 gene locus_tag LOCUS_71680 10307 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 12252 12617 gene locus_tag LOCUS_71690 12252 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 12646 14100 gene locus_tag LOCUS_71700 12646 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71700 14081 14353 gene locus_tag LOCUS_71710 14081 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71710 14576 16243 gene locus_tag LOCUS_71720 14576 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 17178 16858 gene locus_tag LOCUS_71730 17178 16858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71730 17638 18432 gene locus_tag LOCUS_71740 17638 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71740 18752 19252 gene locus_tag LOCUS_71750 18752 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71750 20380 19613 gene locus_tag LOCUS_71760 20380 19613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71760 21340 20645 gene locus_tag LOCUS_71770 21340 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71770 22286 21351 gene locus_tag LOCUS_71780 22286 21351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 24226 22283 gene locus_tag LOCUS_71790 24226 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71790 25028 24435 gene locus_tag LOCUS_71800 25028 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 25406 25233 gene locus_tag LOCUS_71810 25406 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71810 27373 25424 gene locus_tag LOCUS_71820 27373 25424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71820 27728 28327 gene locus_tag LOCUS_71830 27728 28327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 28363 28773 gene locus_tag LOCUS_71840 28363 28773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 28770 29138 gene locus_tag LOCUS_71850 28770 29138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71850 29239 30018 gene locus_tag LOCUS_71860 29239 30018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71860 30073 30945 gene locus_tag LOCUS_71870 30073 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71870 30948 31388 gene locus_tag LOCUS_71880 30948 31388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71880 31385 31687 gene locus_tag LOCUS_71890 31385 31687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71890 31684 33165 gene locus_tag LOCUS_71900 31684 33165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71900 33165 33548 gene locus_tag LOCUS_71910 33165 33548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71910 33538 33978 gene locus_tag LOCUS_71920 33538 33978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 34334 35824 gene locus_tag LOCUS_71930 34334 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71930 35827 36588 gene locus_tag LOCUS_71940 35827 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71940 37068 37226 gene locus_tag LOCUS_71950 37068 37226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 37216 37407 gene locus_tag LOCUS_71960 37216 37407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71960 37397 38062 gene locus_tag LOCUS_71970 37397 38062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71970 38085 41963 gene locus_tag LOCUS_71980 38085 41963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71980 41944 43941 gene locus_tag LOCUS_71990 41944 43941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 43938 44564 gene locus_tag LOCUS_72000 43938 44564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 44763 47774 gene locus_tag LOCUS_72010 44763 47774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72010 47771 48118 gene locus_tag LOCUS_72020 47771 48118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 48120 49019 gene locus_tag LOCUS_72030 48120 49019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72030 49012 49602 gene locus_tag LOCUS_72040 49012 49602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 49614 50300 gene locus_tag LOCUS_72050 49614 50300 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496405.1 protein_id gnl|my_center|LOCUS_72050 50297 50515 gene locus_tag LOCUS_72060 50297 50515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72060 50512 50808 gene locus_tag LOCUS_72070 50512 50808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72070 50838 51410 gene locus_tag LOCUS_72080 50838 51410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 51447 52355 gene locus_tag LOCUS_72090 51447 52355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72090 52378 52641 gene locus_tag LOCUS_72100 52378 52641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72100 52670 53257 gene locus_tag LOCUS_72110 52670 53257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72110 53259 53489 gene locus_tag LOCUS_72120 53259 53489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72120 53523 53759 gene locus_tag LOCUS_72130 53523 53759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72130 53764 55014 gene locus_tag LOCUS_72140 53764 55014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 55059 55757 gene locus_tag LOCUS_72150 55059 55757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72150 55762 56421 gene locus_tag LOCUS_72160 55762 56421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72160 56695 58035 gene locus_tag LOCUS_72170 56695 58035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72170 59374 59042 gene locus_tag LOCUS_72180 59374 59042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72180 59771 60751 gene locus_tag LOCUS_72190 59771 60751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72190 61371 61063 gene locus_tag LOCUS_72200 61371 61063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72200 61558 61821 gene locus_tag LOCUS_72210 61558 61821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72210 >Feature sequence29 497 655 gene locus_tag LOCUS_72220 497 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72220 683 1525 gene locus_tag LOCUS_72230 683 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72230 1842 1988 gene locus_tag LOCUS_72240 1842 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72240 2677 2066 gene locus_tag LOCUS_72250 2677 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72250 3118 2843 gene locus_tag LOCUS_72260 3118 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72260 4005 3724 gene locus_tag LOCUS_72270 4005 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72270 5378 4119 gene locus_tag LOCUS_72280 5378 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72280 7218 5446 gene locus_tag LOCUS_72290 7218 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72290 7470 8264 gene locus_tag LOCUS_72300 7470 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72300 9651 9067 gene locus_tag LOCUS_72310 gene yajL 9651 9067 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208657.1 protein_id gnl|my_center|LOCUS_72310 10605 9817 gene locus_tag LOCUS_72320 10605 9817 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_72320 10654 12075 gene locus_tag LOCUS_72330 10654 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72330 12078 14033 gene locus_tag LOCUS_72340 12078 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72340 14580 14047 gene locus_tag LOCUS_72350 14580 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 14953 15795 gene locus_tag LOCUS_72360 14953 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72360 17181 15805 gene locus_tag LOCUS_72370 17181 15805 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532347.1 protein_id gnl|my_center|LOCUS_72370 18611 17178 gene locus_tag LOCUS_72380 gene tldD 18611 17178 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 protein_id gnl|my_center|LOCUS_72380 19278 18895 gene locus_tag LOCUS_72390 19278 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 19610 19305 gene locus_tag LOCUS_72400 gene rpsN 19610 19305 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 protein_id gnl|my_center|LOCUS_72400 21163 19721 gene locus_tag LOCUS_72410 21163 19721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72410 23959 22088 gene locus_tag LOCUS_72420 23959 22088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72420 25121 24030 gene locus_tag LOCUS_72430 25121 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72430 25832 25140 gene locus_tag LOCUS_72440 25832 25140 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811062.1 protein_id gnl|my_center|LOCUS_72440 26024 27289 gene locus_tag LOCUS_72450 26024 27289 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_72450 27916 27386 gene locus_tag LOCUS_72460 27916 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72460 28443 27958 gene locus_tag LOCUS_72470 28443 27958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 28596 29036 gene locus_tag LOCUS_72480 28596 29036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 29879 29106 gene locus_tag LOCUS_72490 29879 29106 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976345.1 protein_id gnl|my_center|LOCUS_72490 30095 29889 gene locus_tag LOCUS_72500 30095 29889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72500 30119 30295 gene locus_tag LOCUS_72510 30119 30295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72510 31016 30369 gene locus_tag LOCUS_72520 31016 30369 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_72520 31546 31076 gene locus_tag LOCUS_72530 31546 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72530 33324 31459 gene locus_tag LOCUS_72540 33324 31459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72540 34073 33498 gene locus_tag LOCUS_72550 34073 33498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72550 34465 34070 gene locus_tag LOCUS_72560 34465 34070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72560 35999 34563 gene locus_tag LOCUS_72570 35999 34563 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946795.1 protein_id gnl|my_center|LOCUS_72570 38919 36061 gene locus_tag LOCUS_72580 38919 36061 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_72580 41391 39070 gene locus_tag LOCUS_72590 41391 39070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72590 42278 41391 gene locus_tag LOCUS_72600 42278 41391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72600 43108 42188 gene locus_tag LOCUS_72610 43108 42188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72610 43161 43793 gene locus_tag LOCUS_72620 43161 43793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 43909 44838 gene locus_tag LOCUS_72630 43909 44838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72630 44853 45356 gene locus_tag LOCUS_72640 44853 45356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72640 45335 45550 gene locus_tag LOCUS_72650 45335 45550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 45601 46692 gene locus_tag LOCUS_72660 45601 46692 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292552.1 protein_id gnl|my_center|LOCUS_72660 47481 46711 gene locus_tag LOCUS_72670 gene map 47481 46711 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197098.1 protein_id gnl|my_center|LOCUS_72670 47578 47895 gene locus_tag LOCUS_72680 47578 47895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 48603 48127 gene locus_tag LOCUS_72690 48603 48127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 48749 49507 gene locus_tag LOCUS_72700 48749 49507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 49651 51357 gene locus_tag LOCUS_72710 49651 51357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72710 51524 52813 gene locus_tag LOCUS_72720 51524 52813 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188359.1 protein_id gnl|my_center|LOCUS_72720 52820 54289 gene locus_tag LOCUS_72730 52820 54289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 56060 54309 gene locus_tag LOCUS_72740 56060 54309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 56162 57397 gene locus_tag LOCUS_72750 56162 57397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72750 57564 58757 gene locus_tag LOCUS_72760 57564 58757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72760 60381 58762 gene locus_tag LOCUS_72770 60381 58762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72770 >Feature sequence30 4068 3823 gene locus_tag LOCUS_72780 4068 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72780 4726 4995 gene locus_tag LOCUS_72790 4726 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 5350 7989 gene locus_tag LOCUS_72800 5350 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72800 8000 8848 gene locus_tag LOCUS_72810 8000 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72810 9329 8952 gene locus_tag LOCUS_72820 9329 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72820 9997 9326 gene locus_tag LOCUS_72830 9997 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72830 10124 12220 gene locus_tag LOCUS_72840 10124 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72840 13294 12365 gene locus_tag LOCUS_72850 13294 12365 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459673.1 protein_id gnl|my_center|LOCUS_72850 13413 13961 gene locus_tag LOCUS_72860 13413 13961 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 protein_id gnl|my_center|LOCUS_72860 13972 14436 gene locus_tag LOCUS_72870 13972 14436 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_72870 14455 15072 gene locus_tag LOCUS_72880 14455 15072 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974933.1 protein_id gnl|my_center|LOCUS_72880 15069 15962 gene locus_tag LOCUS_72890 15069 15962 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974934.1 protein_id gnl|my_center|LOCUS_72890 16446 17984 gene locus_tag LOCUS_72900 16446 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 18445 17930 gene locus_tag LOCUS_72910 18445 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72910 18348 19715 gene locus_tag LOCUS_72920 18348 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 19852 20283 gene locus_tag LOCUS_72930 19852 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72930 20331 21473 gene locus_tag LOCUS_72940 20331 21473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72940 21562 22443 gene locus_tag LOCUS_72950 21562 22443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72950 23362 22472 gene locus_tag LOCUS_72960 23362 22472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72960 23628 25010 gene locus_tag LOCUS_72970 23628 25010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72970 25025 26419 gene locus_tag LOCUS_72980 25025 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72980 26612 29410 gene locus_tag LOCUS_72990 26612 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72990 29407 30258 gene locus_tag LOCUS_73000 29407 30258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73000 30431 31195 gene locus_tag LOCUS_73010 30431 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73010 31676 31245 gene locus_tag LOCUS_73020 31676 31245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73020 34782 31690 gene locus_tag LOCUS_73030 34782 31690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73030 34926 36110 gene locus_tag LOCUS_73040 34926 36110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73040 36238 37731 gene locus_tag LOCUS_73050 36238 37731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73050 39930 37813 gene locus_tag LOCUS_73060 39930 37813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 40436 40176 gene locus_tag LOCUS_73070 40436 40176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73070 40321 40896 gene locus_tag LOCUS_73080 40321 40896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73080 43606 40961 gene locus_tag LOCUS_73090 43606 40961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73090 44445 43726 gene locus_tag LOCUS_73100 44445 43726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 44656 45246 gene locus_tag LOCUS_73110 44656 45246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73110 46080 45268 gene locus_tag LOCUS_73120 46080 45268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73120 46310 47602 gene locus_tag LOCUS_73130 46310 47602 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_73130 47718 49166 gene locus_tag LOCUS_73140 47718 49166 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225960.1 protein_id gnl|my_center|LOCUS_73140 49501 49115 gene locus_tag LOCUS_73150 49501 49115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 49437 50837 gene locus_tag LOCUS_73160 49437 50837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73160 50894 51373 gene locus_tag LOCUS_73170 50894 51373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73170 52450 51428 gene locus_tag LOCUS_73180 52450 51428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 53769 52951 gene locus_tag LOCUS_73190 53769 52951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73190 54151 53753 gene locus_tag LOCUS_73200 54151 53753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73200 54861 54469 gene locus_tag LOCUS_73210 54861 54469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73210 55278 54871 gene locus_tag LOCUS_73220 55278 54871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 55654 55271 gene locus_tag LOCUS_73230 55654 55271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73230 57111 55660 gene locus_tag LOCUS_73240 57111 55660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73240 57191 58045 gene locus_tag LOCUS_73250 57191 58045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73250 59282 58974 gene locus_tag LOCUS_73260 59282 58974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73260 59362 59814 gene locus_tag LOCUS_73270 59362 59814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73270 >Feature sequence31 1910 1548 gene locus_tag LOCUS_73280 1910 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73280 2947 1907 gene locus_tag LOCUS_73290 2947 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73290 2832 3242 gene locus_tag LOCUS_73300 2832 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73300 4336 3194 gene locus_tag LOCUS_73310 4336 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73310 5175 5651 gene locus_tag LOCUS_73320 5175 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73320 5688 7121 gene locus_tag LOCUS_73330 5688 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_73330 7171 8133 gene locus_tag LOCUS_73340 7171 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73340 9302 8232 gene locus_tag LOCUS_73350 9302 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73350 9850 9407 gene locus_tag LOCUS_73360 9850 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 11067 9862 gene locus_tag LOCUS_73370 11067 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_73370 11501 11115 gene locus_tag LOCUS_73380 11501 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73380 11785 11525 gene locus_tag LOCUS_73390 11785 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73390 11669 12256 gene locus_tag LOCUS_73400 11669 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73400 12372 13460 gene locus_tag LOCUS_73410 12372 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73410 16349 13536 gene locus_tag LOCUS_73420 16349 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 17091 16462 gene locus_tag LOCUS_73430 17091 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 17221 20118 gene locus_tag LOCUS_73440 17221 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73440 20115 22082 gene locus_tag LOCUS_73450 20115 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73450 22095 23207 gene locus_tag LOCUS_73460 22095 23207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 24017 23424 gene locus_tag LOCUS_73470 24017 23424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73470 24034 24660 gene locus_tag LOCUS_73480 24034 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73480 27489 24739 gene locus_tag LOCUS_73490 27489 24739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 30177 27547 gene locus_tag LOCUS_73500 gene pepN 30177 27547 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_73500 30535 32439 gene locus_tag LOCUS_73510 30535 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 32632 34791 gene locus_tag LOCUS_73520 32632 34791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73520 34937 37750 gene locus_tag LOCUS_73530 34937 37750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73530 38455 37763 gene locus_tag LOCUS_73540 38455 37763 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_73540 38547 39038 gene locus_tag LOCUS_73550 38547 39038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73550 39174 39890 gene locus_tag LOCUS_73560 39174 39890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73560 40681 39887 gene locus_tag LOCUS_73570 40681 39887 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_73570 42023 40758 gene locus_tag LOCUS_73580 42023 40758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73580 42120 42608 gene locus_tag LOCUS_73590 42120 42608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73590 45852 42568 gene locus_tag LOCUS_73600 gene carB 45852 42568 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704965.1 protein_id gnl|my_center|LOCUS_73600 47010 45859 gene locus_tag LOCUS_73610 gene carA 47010 45859 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418665.1 protein_id gnl|my_center|LOCUS_73610 47190 48218 gene locus_tag LOCUS_73620 47190 48218 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_73620 48232 49455 gene locus_tag LOCUS_73630 48232 49455 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037391.1 protein_id gnl|my_center|LOCUS_73630 49467 50171 gene locus_tag LOCUS_73640 49467 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73640 50168 50557 gene locus_tag LOCUS_73650 50168 50557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73650 50582 51892 gene locus_tag LOCUS_73660 50582 51892 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055042.1 protein_id gnl|my_center|LOCUS_73660 52197 53327 gene locus_tag LOCUS_73670 gene argC 52197 53327 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037387.1 protein_id gnl|my_center|LOCUS_73670 53296 54606 gene locus_tag LOCUS_73680 53296 54606 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037386.1 protein_id gnl|my_center|LOCUS_73680 55846 54701 gene locus_tag LOCUS_73690 55846 54701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 57047 55998 gene locus_tag LOCUS_73700 57047 55998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73700 57658 57047 gene locus_tag LOCUS_73710 57658 57047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73710 >Feature sequence32 117 533 gene locus_tag LOCUS_73720 117 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73720 2236 1964 gene locus_tag LOCUS_73730 2236 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73730 2638 3891 gene locus_tag LOCUS_73740 2638 3891 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_73740 4657 3962 gene locus_tag LOCUS_73750 4657 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73750 5085 5315 gene locus_tag LOCUS_73760 5085 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73760 5758 6552 gene locus_tag LOCUS_73770 5758 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_73770 6583 7365 gene locus_tag LOCUS_73780 6583 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_73780 7358 10441 gene locus_tag LOCUS_73790 7358 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 14706 10567 gene locus_tag LOCUS_73800 14706 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206868.1 protein_id gnl|my_center|LOCUS_73800 15699 14848 gene locus_tag LOCUS_73810 15699 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73810 16655 18583 gene locus_tag LOCUS_73820 16655 18583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 18593 19480 gene locus_tag LOCUS_73830 18593 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73830 19494 21227 gene locus_tag LOCUS_73840 19494 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73840 21344 22486 gene locus_tag LOCUS_73850 21344 22486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 23020 22613 gene locus_tag LOCUS_73860 23020 22613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73860 23499 23053 gene locus_tag LOCUS_73870 23499 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 24403 23768 gene locus_tag LOCUS_73880 24403 23768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73880 30105 24400 gene locus_tag LOCUS_73890 30105 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73890 34107 30565 gene locus_tag LOCUS_73900 34107 30565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73900 35081 34590 gene locus_tag LOCUS_73910 35081 34590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73910 35179 35562 gene locus_tag LOCUS_73920 35179 35562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73920 36235 35639 gene locus_tag LOCUS_73930 36235 35639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73930 36549 36235 gene locus_tag LOCUS_73940 36549 36235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73940 37413 36769 gene locus_tag LOCUS_73950 37413 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 37393 37605 gene locus_tag LOCUS_73960 37393 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 37853 38398 gene locus_tag LOCUS_73970 37853 38398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 38395 38841 gene locus_tag LOCUS_73980 38395 38841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73980 38838 39203 gene locus_tag LOCUS_73990 38838 39203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73990 39263 39472 gene locus_tag LOCUS_74000 39263 39472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74000 39613 40173 gene locus_tag LOCUS_74010 39613 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74010 40152 40391 gene locus_tag LOCUS_74020 40152 40391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74020 40446 42074 gene locus_tag LOCUS_74030 40446 42074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74030 42071 42928 gene locus_tag LOCUS_74040 42071 42928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74040 42925 43962 gene locus_tag LOCUS_74050 42925 43962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74050 43941 44180 gene locus_tag LOCUS_74060 43941 44180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74060 >Feature sequence33 1329 1195 gene locus_tag LOCUS_74070 1329 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74070 4464 4288 gene locus_tag LOCUS_74080 4464 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_74080 4920 4699 gene locus_tag LOCUS_74090 4920 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74090 8054 8770 gene locus_tag LOCUS_74100 8054 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74100 8954 9418 gene locus_tag LOCUS_74110 8954 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74110 9522 10328 gene locus_tag LOCUS_74120 9522 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74120 10407 11255 gene locus_tag LOCUS_74130 10407 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74130 11819 11394 gene locus_tag LOCUS_74140 11819 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74140 12665 13060 gene locus_tag LOCUS_74150 12665 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 13074 14405 gene locus_tag LOCUS_74160 13074 14405 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_74160 14811 14413 gene locus_tag LOCUS_74170 14811 14413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74170 16717 14897 gene locus_tag LOCUS_74180 16717 14897 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704599.1 protein_id gnl|my_center|LOCUS_74180 17072 17512 gene locus_tag LOCUS_74190 17072 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74190 17913 17533 gene locus_tag LOCUS_74200 17913 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74200 18474 19613 gene locus_tag LOCUS_74210 18474 19613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74210 19761 20141 gene locus_tag LOCUS_74220 19761 20141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 20414 22402 gene locus_tag LOCUS_74230 20414 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74230 22399 23337 gene locus_tag LOCUS_74240 22399 23337 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_74240 23519 23262 gene locus_tag LOCUS_74250 23519 23262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 23494 23880 gene locus_tag LOCUS_74260 23494 23880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74260 23942 25471 gene locus_tag LOCUS_74270 23942 25471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74270 26507 25788 gene locus_tag LOCUS_74280 26507 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74280 26653 26946 gene locus_tag LOCUS_74290 26653 26946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74290 26955 27707 gene locus_tag LOCUS_74300 26955 27707 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_74300 29295 28393 gene locus_tag LOCUS_74310 29295 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74310 29504 30028 gene locus_tag LOCUS_74320 29504 30028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74320 30354 30049 gene locus_tag LOCUS_74330 30354 30049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74330 30643 30422 gene locus_tag LOCUS_74340 30643 30422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74340 31118 30930 gene locus_tag LOCUS_74350 31118 30930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 31894 31097 gene locus_tag LOCUS_74360 31894 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74360 34764 35105 gene locus_tag LOCUS_74370 34764 35105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74370 >Feature sequence34 38 469 gene locus_tag LOCUS_74380 38 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74380 469 2058 gene locus_tag LOCUS_74390 469 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74390 2210 3352 gene locus_tag LOCUS_74400 2210 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74400 3345 4130 gene locus_tag LOCUS_74410 3345 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74410 4134 5576 gene locus_tag LOCUS_74420 4134 5576 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935349.1 protein_id gnl|my_center|LOCUS_74420 5615 5872 gene locus_tag LOCUS_74430 5615 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74430 5879 6760 gene locus_tag LOCUS_74440 5879 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74440 6757 7257 gene locus_tag LOCUS_74450 6757 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74450 7272 7442 gene locus_tag LOCUS_74460 7272 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74460 7442 8389 gene locus_tag LOCUS_74470 7442 8389 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939436.1 protein_id gnl|my_center|LOCUS_74470 8386 8592 gene locus_tag LOCUS_74480 8386 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74480 8585 9004 gene locus_tag LOCUS_74490 8585 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74490 9008 10885 gene locus_tag LOCUS_74500 9008 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74500 10882 12825 gene locus_tag LOCUS_74510 10882 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74510 12825 13919 gene locus_tag LOCUS_74520 12825 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74520 13916 14167 gene locus_tag LOCUS_74530 13916 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74530 14282 15193 gene locus_tag LOCUS_74540 14282 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74540 15193 15594 gene locus_tag LOCUS_74550 15193 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74550 15591 15809 gene locus_tag LOCUS_74560 15591 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74560 15813 16163 gene locus_tag LOCUS_74570 15813 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74570 16160 16618 gene locus_tag LOCUS_74580 16160 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74580 16633 17133 gene locus_tag LOCUS_74590 16633 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74590 17133 17750 gene locus_tag LOCUS_74600 17133 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74600 17750 18160 gene locus_tag LOCUS_74610 17750 18160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74610 18157 18408 gene locus_tag LOCUS_74620 18157 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74620 19537 18779 gene locus_tag LOCUS_74630 19537 18779 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_74630 20100 19762 gene locus_tag LOCUS_74640 20100 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74640 20318 20100 gene locus_tag LOCUS_74650 20318 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74650 21134 20382 gene locus_tag LOCUS_74660 21134 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74660 21188 22252 gene locus_tag LOCUS_74670 21188 22252 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_74670 22591 22890 gene locus_tag LOCUS_74680 22591 22890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74680 22890 23162 gene locus_tag LOCUS_74690 22890 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74690 23159 23764 gene locus_tag LOCUS_74700 23159 23764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74700 24237 24467 gene locus_tag LOCUS_74710 24237 24467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74710 24464 25384 gene locus_tag LOCUS_74720 24464 25384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74720 25381 25560 gene locus_tag LOCUS_74730 25381 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74730 25557 25724 gene locus_tag LOCUS_74740 25557 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74740 25941 26336 gene locus_tag LOCUS_74750 25941 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74750 26455 27309 gene locus_tag LOCUS_74760 26455 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74760 27513 28427 gene locus_tag LOCUS_74770 27513 28427 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_74770 28424 29290 gene locus_tag LOCUS_74780 28424 29290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 29287 29460 gene locus_tag LOCUS_74790 29287 29460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74790 29457 29597 gene locus_tag LOCUS_74800 29457 29597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74800 29594 29815 gene locus_tag LOCUS_74810 29594 29815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74810 29812 30138 gene locus_tag LOCUS_74820 29812 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74820 30135 30962 gene locus_tag LOCUS_74830 30135 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74830 30884 31159 gene locus_tag LOCUS_74840 30884 31159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74840 31156 31323 gene locus_tag LOCUS_74850 31156 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74850 31360 31572 gene locus_tag LOCUS_74860 31360 31572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74860 31660 31911 gene locus_tag LOCUS_74870 31660 31911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74870 31911 32522 gene locus_tag LOCUS_74880 31911 32522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74880 33608 33964 gene locus_tag LOCUS_74890 33608 33964 CDS product DUF4326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076534005.1 protein_id gnl|my_center|LOCUS_74890 >Feature sequence35 183 608 gene locus_tag LOCUS_74900 183 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_74900 2180 1428 gene locus_tag LOCUS_74910 2180 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74910 3016 2432 gene locus_tag LOCUS_74920 3016 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 3465 2929 gene locus_tag LOCUS_74930 3465 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74930 3891 3676 gene locus_tag LOCUS_74940 3891 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74940 5273 4281 gene locus_tag LOCUS_74950 5273 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74950 5603 5277 gene locus_tag LOCUS_74960 5603 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74960 7144 5642 gene locus_tag LOCUS_74970 7144 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74970 8290 7721 gene locus_tag LOCUS_74980 8290 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74980 8183 8440 gene locus_tag LOCUS_74990 8183 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74990 8774 8418 gene locus_tag LOCUS_75000 8774 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75000 9457 8771 gene locus_tag LOCUS_75010 9457 8771 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_75010 10091 9543 gene locus_tag LOCUS_75020 10091 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75020 9991 10701 gene locus_tag LOCUS_75030 9991 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75030 10969 11370 gene locus_tag LOCUS_75040 10969 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75040 12204 11842 gene locus_tag LOCUS_75050 12204 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75050 13196 14335 gene locus_tag LOCUS_75060 13196 14335 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_75060 15175 14366 gene locus_tag LOCUS_75070 15175 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75070 15183 15470 gene locus_tag LOCUS_75080 15183 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75080 15635 16531 gene locus_tag LOCUS_75090 15635 16531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75090 19304 16581 gene locus_tag LOCUS_75100 19304 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75100 19705 21168 gene locus_tag LOCUS_75110 19705 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75110 22695 21235 gene locus_tag LOCUS_75120 22695 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75120 24445 22736 gene locus_tag LOCUS_75130 24445 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75130 25688 24471 gene locus_tag LOCUS_75140 25688 24471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75140 26700 25711 gene locus_tag LOCUS_75150 26700 25711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75150 26871 27605 gene locus_tag LOCUS_75160 26871 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75160 27651 28619 gene locus_tag LOCUS_75170 27651 28619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75170 28781 29173 gene locus_tag LOCUS_75180 28781 29173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75180 29866 29231 gene locus_tag LOCUS_75190 29866 29231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75190 29909 30721 gene locus_tag LOCUS_75200 29909 30721 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_75200 30834 31103 gene locus_tag LOCUS_75210 30834 31103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75210 31208 31777 gene locus_tag LOCUS_75220 31208 31777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75220 32204 31821 gene locus_tag LOCUS_75230 32204 31821 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922498.1 protein_id gnl|my_center|LOCUS_75230 >Feature sequence36 1063 737 gene locus_tag LOCUS_75240 1063 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75240 1208 1438 gene locus_tag LOCUS_75250 1208 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75250 1476 1664 gene locus_tag LOCUS_75260 1476 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75260 1740 2819 gene locus_tag LOCUS_75270 1740 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75270 2869 3063 gene locus_tag LOCUS_75280 2869 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75280 3262 4830 gene locus_tag LOCUS_75290 3262 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75290 4998 6353 gene locus_tag LOCUS_75300 4998 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75300 6350 8539 gene locus_tag LOCUS_75310 6350 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75310 8526 11456 gene locus_tag LOCUS_75320 8526 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75320 11673 11515 gene locus_tag LOCUS_75330 11673 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75330 11822 13846 gene locus_tag LOCUS_75340 11822 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75340 13908 14594 gene locus_tag LOCUS_75350 13908 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75350 15442 15233 gene locus_tag LOCUS_75360 15442 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75360 15613 15801 gene locus_tag LOCUS_75370 15613 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75370 16318 16689 gene locus_tag LOCUS_75380 16318 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75380 18587 16926 gene locus_tag LOCUS_75390 18587 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75390 20914 18584 gene locus_tag LOCUS_75400 20914 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75400 21822 20911 gene locus_tag LOCUS_75410 21822 20911 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257056.1 protein_id gnl|my_center|LOCUS_75410 22704 22018 gene locus_tag LOCUS_75420 22704 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75420 23452 22742 gene locus_tag LOCUS_75430 23452 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75430 24069 23449 gene locus_tag LOCUS_75440 24069 23449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75440 24979 24092 gene locus_tag LOCUS_75450 24979 24092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75450 25791 24982 gene locus_tag LOCUS_75460 25791 24982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75460 27676 25748 gene locus_tag LOCUS_75470 27676 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75470 27998 27633 gene locus_tag LOCUS_75480 27998 27633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75480 28227 27991 gene locus_tag LOCUS_75490 28227 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75490 28357 28692 gene locus_tag LOCUS_75500 28357 28692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75500 29022 29522 gene locus_tag LOCUS_75510 29022 29522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75510 30482 30910 gene locus_tag LOCUS_75520 30482 30910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75520 >Feature sequence37 1219 638 gene locus_tag LOCUS_75530 1219 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75530 2292 1246 gene locus_tag LOCUS_75540 2292 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75540 2920 2315 gene locus_tag LOCUS_75550 2920 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75550 3213 2917 gene locus_tag LOCUS_75560 3213 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75560 3428 3216 gene locus_tag LOCUS_75570 3428 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75570 4108 3425 gene locus_tag LOCUS_75580 4108 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75580 4751 4119 gene locus_tag LOCUS_75590 4751 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75590 5640 4744 gene locus_tag LOCUS_75600 5640 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75600 5989 5642 gene locus_tag LOCUS_75610 5989 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75610 10929 5986 gene locus_tag LOCUS_75620 10929 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75620 14789 11526 gene locus_tag LOCUS_75630 14789 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75630 15477 14812 gene locus_tag LOCUS_75640 15477 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75640 15658 15467 gene locus_tag LOCUS_75650 15658 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75650 15806 15648 gene locus_tag LOCUS_75660 15806 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75660 16138 15806 gene locus_tag LOCUS_75670 16138 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75670 18526 16862 gene locus_tag LOCUS_75680 18526 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75680 19160 18798 gene locus_tag LOCUS_75690 19160 18798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75690 20157 19150 gene locus_tag LOCUS_75700 20157 19150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75700 20306 20154 gene locus_tag LOCUS_75710 20306 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75710 21003 20311 gene locus_tag LOCUS_75720 21003 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75720 22628 21000 gene locus_tag LOCUS_75730 22628 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75730 >Feature sequence38 849 685 gene locus_tag LOCUS_75740 849 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75740 1105 908 gene locus_tag LOCUS_75750 1105 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75750 1693 1193 gene locus_tag LOCUS_75760 1693 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75760 3149 2286 gene locus_tag LOCUS_75770 3149 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75770 3221 3589 gene locus_tag LOCUS_75780 3221 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75780 3893 4264 gene locus_tag LOCUS_75790 3893 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75790 4252 4452 gene locus_tag LOCUS_75800 4252 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75800 5602 4514 gene locus_tag LOCUS_75810 5602 4514 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_75810 6560 5982 gene locus_tag LOCUS_75820 6560 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75820 7389 6682 gene locus_tag LOCUS_75830 7389 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75830 8033 7383 gene locus_tag LOCUS_75840 8033 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75840 8908 8060 gene locus_tag LOCUS_75850 8908 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75850 10385 8901 gene locus_tag LOCUS_75860 10385 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75860 10704 10396 gene locus_tag LOCUS_75870 10704 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75870 11745 10843 gene locus_tag LOCUS_75880 11745 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75880 12461 11748 gene locus_tag LOCUS_75890 12461 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75890 16544 12642 gene locus_tag LOCUS_75900 16544 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75900 17085 16525 gene locus_tag LOCUS_75910 17085 16525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75910 17923 17138 gene locus_tag LOCUS_75920 17923 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75920 18345 17842 gene locus_tag LOCUS_75930 18345 17842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75930 19535 18342 gene locus_tag LOCUS_75940 19535 18342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 20560 19532 gene locus_tag LOCUS_75950 20560 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75950 21569 20814 gene locus_tag LOCUS_75960 21569 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75960 >Feature sequence39 76 345 gene locus_tag LOCUS_75970 76 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75970 857 1213 gene locus_tag LOCUS_75980 857 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75980 1887 2210 gene locus_tag LOCUS_75990 1887 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75990 2348 2941 gene locus_tag LOCUS_76000 2348 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76000 4862 4413 gene locus_tag LOCUS_76010 4862 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76010 5621 5962 gene locus_tag LOCUS_76020 5621 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76020 6075 6974 gene locus_tag LOCUS_76030 6075 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76030 6974 9598 gene locus_tag LOCUS_76040 6974 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76040 9982 9800 gene locus_tag LOCUS_76050 9982 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76050 13200 12982 gene locus_tag LOCUS_76060 13200 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76060 13472 13242 gene locus_tag LOCUS_76070 13472 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76070 13774 13520 gene locus_tag LOCUS_76080 13774 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76080 14352 13801 gene locus_tag LOCUS_76090 14352 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76090 17134 16394 gene locus_tag LOCUS_76100 gene istB 17134 16394 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_76100 18697 17150 gene locus_tag LOCUS_76110 gene istA 18697 17150 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_76110 19282 19479 gene locus_tag LOCUS_76120 19282 19479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76120 >Feature sequence40 2602 3423 gene locus_tag LOCUS_76130 2602 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76130 3309 4379 gene locus_tag LOCUS_76140 3309 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76140 4638 5192 gene locus_tag LOCUS_76150 4638 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76150 5642 6256 gene locus_tag LOCUS_76160 5642 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_76160 6484 6783 gene locus_tag LOCUS_76170 6484 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76170 6883 7221 gene locus_tag LOCUS_76180 6883 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76180 7516 8400 gene locus_tag LOCUS_76190 7516 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76190 8516 8806 gene locus_tag LOCUS_76200 8516 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76200 >Feature sequence41 1227 106 gene locus_tag LOCUS_76210 1227 106 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_76210 2474 1245 gene locus_tag LOCUS_76220 gene nqrF 2474 1245 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816933.1 protein_id gnl|my_center|LOCUS_76220 2829 2542 gene locus_tag LOCUS_76230 2829 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76230 3744 3121 gene locus_tag LOCUS_76240 3744 3121 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 protein_id gnl|my_center|LOCUS_76240 4189 3749 gene locus_tag LOCUS_76250 4189 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76250 4783 4517 gene locus_tag LOCUS_76260 4783 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76260 4949 4821 gene locus_tag LOCUS_76270 4949 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76270 5577 5173 gene locus_tag LOCUS_76280 5577 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76280 5965 5750 gene locus_tag LOCUS_76290 5965 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76290 6714 6238 gene locus_tag LOCUS_76300 6714 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76300 >Feature sequence42 194 445 gene locus_tag LOCUS_76310 194 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76310 445 819 gene locus_tag LOCUS_76320 445 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76320 822 1196 gene locus_tag LOCUS_76330 822 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76330 1159 1824 gene locus_tag LOCUS_76340 1159 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76340 1821 2114 gene locus_tag LOCUS_76350 1821 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76350 2111 2341 gene locus_tag LOCUS_76360 2111 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76360 2338 3111 gene locus_tag LOCUS_76370 2338 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76370 3256 3435 gene locus_tag LOCUS_76380 3256 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76380 3432 3599 gene locus_tag LOCUS_76390 3432 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76390 3596 4111 gene locus_tag LOCUS_76400 3596 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76400 4108 4419 gene locus_tag LOCUS_76410 4108 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76410 4482 5348 gene locus_tag LOCUS_76420 4482 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76420 5345 5695 gene locus_tag LOCUS_76430 5345 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76430