>Feature sequence01 1434 937 gene locus_tag LOCUS_00010 1434 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00010 2388 1945 gene locus_tag LOCUS_00020 gene gcvH 2388 1945 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_00020 3799 2471 gene locus_tag LOCUS_00030 3799 2471 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_00030 4722 3976 gene locus_tag LOCUS_00040 4722 3976 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839368.1 protein_id gnl|my_center|LOCUS_00040 5545 4961 gene locus_tag LOCUS_00050 5545 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6122 5634 gene locus_tag LOCUS_00060 6122 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7111 6194 gene locus_tag LOCUS_00070 7111 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8217 7360 gene locus_tag LOCUS_00080 8217 7360 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 8755 9480 gene locus_tag LOCUS_00090 gene truA 8755 9480 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_00090 13265 9477 gene locus_tag LOCUS_00100 13265 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14854 13280 gene locus_tag LOCUS_00110 14854 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15428 14838 gene locus_tag LOCUS_00120 15428 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16120 15425 gene locus_tag LOCUS_00130 16120 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16524 16015 gene locus_tag LOCUS_00140 16524 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17179 16727 gene locus_tag LOCUS_00150 17179 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17336 17752 gene locus_tag LOCUS_00160 17336 17752 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_00160 17976 18311 gene locus_tag LOCUS_00170 17976 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18305 19414 gene locus_tag LOCUS_00180 18305 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19673 19840 gene locus_tag LOCUS_00190 19673 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19868 21331 gene locus_tag LOCUS_00200 19868 21331 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689235.1 protein_id gnl|my_center|LOCUS_00200 21338 23155 gene locus_tag LOCUS_00210 21338 23155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23092 23334 gene locus_tag LOCUS_00220 23092 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24672 23386 gene locus_tag LOCUS_00230 24672 23386 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_00230 24901 25809 gene locus_tag LOCUS_00240 gene rimK 24901 25809 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 protein_id gnl|my_center|LOCUS_00240 26509 25796 gene locus_tag LOCUS_00250 26509 25796 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_00250 26760 26551 gene locus_tag LOCUS_00260 26760 26551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00260 27877 26750 gene locus_tag LOCUS_00270 27877 26750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00270 28432 27980 gene locus_tag LOCUS_00280 28432 27980 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142427.1 protein_id gnl|my_center|LOCUS_00280 28722 28435 gene locus_tag LOCUS_00290 28722 28435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28950 29591 gene locus_tag LOCUS_00300 28950 29591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29738 30631 gene locus_tag LOCUS_00310 29738 30631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31235 33448 gene locus_tag LOCUS_00320 31235 33448 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108188.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00320 33776 34096 gene locus_tag LOCUS_00330 33776 34096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 34093 34794 gene locus_tag LOCUS_00340 34093 34794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00340 36411 35227 gene locus_tag LOCUS_00350 36411 35227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38275 36398 gene locus_tag LOCUS_00360 38275 36398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00360 39362 38298 gene locus_tag LOCUS_00370 39362 38298 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640668.1 protein_id gnl|my_center|LOCUS_00370 40801 39452 gene locus_tag LOCUS_00380 40801 39452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41493 40879 gene locus_tag LOCUS_00390 41493 40879 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_00390 43800 41797 gene locus_tag LOCUS_00400 gene recG 43800 41797 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_00400 44183 44563 gene locus_tag LOCUS_00410 gene rbfA 44183 44563 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527893.1 protein_id gnl|my_center|LOCUS_00410 48288 44638 gene locus_tag LOCUS_00420 48288 44638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51388 48713 gene locus_tag LOCUS_00430 51388 48713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 54043 51881 gene locus_tag LOCUS_00440 54043 51881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 54591 54040 gene locus_tag LOCUS_00450 54591 54040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 54961 54530 gene locus_tag LOCUS_00460 54961 54530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00460 55831 56457 gene locus_tag LOCUS_00470 55831 56457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 56887 56597 gene locus_tag LOCUS_00480 56887 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56949 58151 gene locus_tag LOCUS_00490 56949 58151 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00490 58145 58438 gene locus_tag LOCUS_00500 58145 58438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 58569 59273 gene locus_tag LOCUS_00510 58569 59273 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_00510 59517 59765 gene locus_tag LOCUS_00520 59517 59765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59982 60461 gene locus_tag LOCUS_00530 59982 60461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 61271 60558 gene locus_tag LOCUS_00540 61271 60558 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_00540 61423 61809 gene locus_tag LOCUS_00550 61423 61809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 63457 61880 gene locus_tag LOCUS_00560 63457 61880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64359 63634 gene locus_tag LOCUS_00570 64359 63634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 64841 64419 gene locus_tag LOCUS_00580 64841 64419 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198664.1 protein_id gnl|my_center|LOCUS_00580 66566 65004 gene locus_tag LOCUS_00590 66566 65004 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_00590 67490 66648 gene locus_tag LOCUS_00600 67490 66648 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_00600 67874 67545 gene locus_tag LOCUS_00610 67874 67545 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_00610 68850 68002 gene locus_tag LOCUS_00620 68850 68002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 protein_id gnl|my_center|LOCUS_00620 69022 71292 gene locus_tag LOCUS_00630 69022 71292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 71353 71559 gene locus_tag LOCUS_00640 71353 71559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 71549 71815 gene locus_tag LOCUS_00650 71549 71815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 71788 72240 gene locus_tag LOCUS_00660 71788 72240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72932 72339 gene locus_tag LOCUS_00670 72932 72339 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764211.1 protein_id gnl|my_center|LOCUS_00670 73879 72980 gene locus_tag LOCUS_00680 73879 72980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 74317 73904 gene locus_tag LOCUS_00690 74317 73904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75123 74512 gene locus_tag LOCUS_00700 75123 74512 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_00700 75418 75188 gene locus_tag LOCUS_00710 75418 75188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00710 76456 75632 gene locus_tag LOCUS_00720 76456 75632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00720 78045 76594 gene locus_tag LOCUS_00730 78045 76594 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_00730 79380 78079 gene locus_tag LOCUS_00740 79380 78079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 80069 79551 gene locus_tag LOCUS_00750 80069 79551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00750 81079 80627 gene locus_tag LOCUS_00760 81079 80627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 81862 81083 gene locus_tag LOCUS_00770 81862 81083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00770 82396 81932 gene locus_tag LOCUS_00780 82396 81932 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_00780 83198 82503 gene locus_tag LOCUS_00790 gene cybH 83198 82503 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 protein_id gnl|my_center|LOCUS_00790 85034 83313 gene locus_tag LOCUS_00800 85034 83313 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_00800 86254 85130 gene locus_tag LOCUS_00810 86254 85130 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_00810 86447 86677 gene locus_tag LOCUS_00820 86447 86677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 86689 87030 gene locus_tag LOCUS_00830 gene hypA 86689 87030 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_00830 87047 87868 gene locus_tag LOCUS_00840 gene hypB 87047 87868 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_00840 87870 89156 gene locus_tag LOCUS_00850 87870 89156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00850 89153 90211 gene locus_tag LOCUS_00860 89153 90211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00860 90189 90470 gene locus_tag LOCUS_00870 90189 90470 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_00870 90473 90751 gene locus_tag LOCUS_00880 90473 90751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 90762 91526 gene locus_tag LOCUS_00890 90762 91526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 91777 93408 gene locus_tag LOCUS_00900 91777 93408 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00900 93321 93782 gene locus_tag LOCUS_00910 93321 93782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00910 93797 93937 gene locus_tag LOCUS_00920 93797 93937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 93986 95116 gene locus_tag LOCUS_00930 93986 95116 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_00930 95203 95628 gene locus_tag LOCUS_00940 95203 95628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00940 95657 95989 gene locus_tag LOCUS_00950 95657 95989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 95989 96399 gene locus_tag LOCUS_00960 95989 96399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 96604 97191 gene locus_tag LOCUS_00970 96604 97191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 97264 97785 gene locus_tag LOCUS_00980 97264 97785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 98313 97840 gene locus_tag LOCUS_00990 98313 97840 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_00990 99136 100068 gene locus_tag LOCUS_01000 99136 100068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 100212 100559 gene locus_tag LOCUS_01010 100212 100559 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_01010 100684 101322 gene locus_tag LOCUS_01020 100684 101322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 101377 102666 gene locus_tag LOCUS_01030 101377 102666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01030 102570 102956 gene locus_tag LOCUS_01040 102570 102956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 103800 103111 gene locus_tag LOCUS_01050 103800 103111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 104789 103824 gene locus_tag LOCUS_01060 104789 103824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 106141 105329 gene locus_tag LOCUS_01070 106141 105329 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202571.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01070 107269 106559 gene locus_tag LOCUS_01080 107269 106559 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_01080 108290 107166 gene locus_tag LOCUS_01090 108290 107166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 110163 109945 gene locus_tag LOCUS_01100 110163 109945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 111149 110244 gene locus_tag LOCUS_01110 111149 110244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 111811 111146 gene locus_tag LOCUS_01120 111811 111146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 112177 113514 gene locus_tag LOCUS_01130 112177 113514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113690 114928 gene locus_tag LOCUS_01140 113690 114928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 115004 115288 gene locus_tag LOCUS_01150 115004 115288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 115195 115533 gene locus_tag LOCUS_01160 115195 115533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 115729 115926 gene locus_tag LOCUS_01170 115729 115926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 116205 116002 gene locus_tag LOCUS_01180 116205 116002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 116763 116290 gene locus_tag LOCUS_01190 116763 116290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 117454 116750 gene locus_tag LOCUS_01200 117454 116750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 117677 117429 gene locus_tag LOCUS_01210 117677 117429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 118197 117721 gene locus_tag LOCUS_01220 118197 117721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 118901 118170 gene locus_tag LOCUS_01230 118901 118170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 120262 119489 gene locus_tag LOCUS_01240 120262 119489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 121326 120364 gene locus_tag LOCUS_01250 121326 120364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 122000 121341 gene locus_tag LOCUS_01260 122000 121341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 122209 123846 gene locus_tag LOCUS_01270 122209 123846 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_01270 124759 123965 gene locus_tag LOCUS_01280 124759 123965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 125607 125056 gene locus_tag LOCUS_01290 125607 125056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 126454 125645 gene locus_tag LOCUS_01300 126454 125645 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_01300 127457 126462 gene locus_tag LOCUS_01310 127457 126462 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_01310 127563 128645 gene locus_tag LOCUS_01320 127563 128645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 128738 129094 gene locus_tag LOCUS_01330 128738 129094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 130425 129322 gene locus_tag LOCUS_01340 130425 129322 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_01340 131038 130433 gene locus_tag LOCUS_01350 131038 130433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 134220 131446 gene locus_tag LOCUS_01360 134220 131446 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_01360 134841 134431 gene locus_tag LOCUS_01370 134841 134431 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_01370 136676 135303 gene locus_tag LOCUS_01380 136676 135303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 139243 136646 gene locus_tag LOCUS_01390 139243 136646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 141377 140460 gene locus_tag LOCUS_01400 141377 140460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 147396 141472 gene locus_tag LOCUS_01410 147396 141472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 148227 147436 gene locus_tag LOCUS_01420 148227 147436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 149199 148471 gene locus_tag LOCUS_01430 149199 148471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 150185 149190 gene locus_tag LOCUS_01440 150185 149190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 150889 150341 gene locus_tag LOCUS_01450 150889 150341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 152871 150880 gene locus_tag LOCUS_01460 152871 150880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 153113 152811 gene locus_tag LOCUS_01470 153113 152811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 156406 153137 gene locus_tag LOCUS_01480 156406 153137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 157895 157206 gene locus_tag LOCUS_01490 157895 157206 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_01490 158128 159363 gene locus_tag LOCUS_01500 158128 159363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 159327 161018 gene locus_tag LOCUS_01510 159327 161018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 162636 161185 gene locus_tag LOCUS_01520 162636 161185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 163801 162848 gene locus_tag LOCUS_01530 163801 162848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 164273 163683 gene locus_tag LOCUS_01540 164273 163683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 164992 164357 gene locus_tag LOCUS_01550 164992 164357 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_01550 165218 166321 gene locus_tag LOCUS_01560 165218 166321 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_01560 166312 166950 gene locus_tag LOCUS_01570 166312 166950 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209040.1 protein_id gnl|my_center|LOCUS_01570 167670 167026 gene locus_tag LOCUS_01580 167670 167026 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_01580 167748 171245 gene locus_tag LOCUS_01590 167748 171245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 171392 172795 gene locus_tag LOCUS_01600 171392 172795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 172732 173079 gene locus_tag LOCUS_01610 172732 173079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 174029 173085 gene locus_tag LOCUS_01620 174029 173085 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337458.1 protein_id gnl|my_center|LOCUS_01620 174969 174172 gene locus_tag LOCUS_01630 174969 174172 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489429.1 protein_id gnl|my_center|LOCUS_01630 175555 175076 gene locus_tag LOCUS_01640 175555 175076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 175985 175572 gene locus_tag LOCUS_01650 175985 175572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01650 176474 176010 gene locus_tag LOCUS_01660 176474 176010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01660 176791 177108 gene locus_tag LOCUS_01670 176791 177108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 177108 177587 gene locus_tag LOCUS_01680 177108 177587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 177784 178824 gene locus_tag LOCUS_01690 177784 178824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 179701 178991 gene locus_tag LOCUS_01700 179701 178991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 180469 181116 gene locus_tag LOCUS_01710 180469 181116 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_01710 181526 183454 gene locus_tag LOCUS_01720 181526 183454 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_01720 183605 183676 gene locus_tag LOCUS_t00010 183605 183676 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 184261 185001 gene locus_tag LOCUS_01730 184261 185001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 185498 185100 gene locus_tag LOCUS_01740 185498 185100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 185632 186228 gene locus_tag LOCUS_01750 185632 186228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 186239 186946 gene locus_tag LOCUS_01760 186239 186946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 187056 187337 gene locus_tag LOCUS_01770 187056 187337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 187391 189031 gene locus_tag LOCUS_01780 187391 189031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 189028 191079 gene locus_tag LOCUS_01790 189028 191079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 191503 191901 gene locus_tag LOCUS_01800 191503 191901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 191792 192403 gene locus_tag LOCUS_01810 191792 192403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 192324 193778 gene locus_tag LOCUS_01820 192324 193778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01820 193801 197880 gene locus_tag LOCUS_01830 193801 197880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 197903 201925 gene locus_tag LOCUS_01840 197903 201925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 201979 203043 gene locus_tag LOCUS_01850 201979 203043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 203699 203217 gene locus_tag LOCUS_01860 203699 203217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01860 204135 203716 gene locus_tag LOCUS_01870 204135 203716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01870 204762 204148 gene locus_tag LOCUS_01880 204762 204148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 206137 204797 gene locus_tag LOCUS_01890 206137 204797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 206634 207971 gene locus_tag LOCUS_01900 206634 207971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 208305 209489 gene locus_tag LOCUS_01910 208305 209489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 210807 209530 gene locus_tag LOCUS_01920 gene proS 210807 209530 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_01920 211252 212679 gene locus_tag LOCUS_01930 211252 212679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 212798 214264 gene locus_tag LOCUS_01940 212798 214264 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405255.1 protein_id gnl|my_center|LOCUS_01940 214405 215619 gene locus_tag LOCUS_01950 214405 215619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 216684 215686 gene locus_tag LOCUS_01960 216684 215686 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_01960 219521 216825 gene locus_tag LOCUS_01970 219521 216825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 219705 221141 gene locus_tag LOCUS_01980 gene hpaE 219705 221141 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110130.1 protein_id gnl|my_center|LOCUS_01980 221564 221863 gene locus_tag LOCUS_01990 221564 221863 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_01990 221870 222004 gene locus_tag LOCUS_02000 221870 222004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 222022 222570 gene locus_tag LOCUS_02010 222022 222570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 222645 223439 gene locus_tag LOCUS_02020 222645 223439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 224183 223503 gene locus_tag LOCUS_02030 224183 223503 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_02030 224490 226064 gene locus_tag LOCUS_02040 224490 226064 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_02040 226497 226141 gene locus_tag LOCUS_02050 226497 226141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 226849 226388 gene locus_tag LOCUS_02060 226849 226388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 227648 228034 gene locus_tag LOCUS_02070 227648 228034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02070 228264 229694 gene locus_tag LOCUS_02080 228264 229694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 229807 231372 gene locus_tag LOCUS_02090 229807 231372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 231369 232610 gene locus_tag LOCUS_02100 231369 232610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 233535 232732 gene locus_tag LOCUS_02110 233535 232732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 234508 233591 gene locus_tag LOCUS_02120 234508 233591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 235919 234843 gene locus_tag LOCUS_02130 235919 234843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 236220 237989 gene locus_tag LOCUS_02140 gene sulP 236220 237989 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_02140 238272 239747 gene locus_tag LOCUS_02150 gene nrfD 238272 239747 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_02150 239880 241082 gene locus_tag LOCUS_02160 239880 241082 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_02160 241572 241132 gene locus_tag LOCUS_02170 241572 241132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 241664 244423 gene locus_tag LOCUS_02180 241664 244423 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_02180 245930 244590 gene locus_tag LOCUS_02190 245930 244590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 246537 245965 gene locus_tag LOCUS_02200 246537 245965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 247429 246566 gene locus_tag LOCUS_02210 247429 246566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 247788 248333 gene locus_tag LOCUS_02220 247788 248333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02220 248363 249115 gene locus_tag LOCUS_02230 248363 249115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 250279 249233 gene locus_tag LOCUS_02240 250279 249233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 250647 251468 gene locus_tag LOCUS_02250 250647 251468 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_02250 251465 252256 gene locus_tag LOCUS_02260 251465 252256 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_02260 253410 252772 gene locus_tag LOCUS_02270 253410 252772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 254674 253394 gene locus_tag LOCUS_02280 254674 253394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 254952 256301 gene locus_tag LOCUS_02290 gene hisS 254952 256301 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_02290 258139 256580 gene locus_tag LOCUS_02300 258139 256580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 258940 258479 gene locus_tag LOCUS_02310 258940 258479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 260372 258921 gene locus_tag LOCUS_02320 260372 258921 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_02320 261646 260375 gene locus_tag LOCUS_02330 261646 260375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 262835 261669 gene locus_tag LOCUS_02340 262835 261669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 263415 262747 gene locus_tag LOCUS_02350 263415 262747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 263843 263998 gene locus_tag LOCUS_02360 263843 263998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 264039 264593 gene locus_tag LOCUS_02370 264039 264593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 264599 264943 gene locus_tag LOCUS_02380 264599 264943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 265045 265455 gene locus_tag LOCUS_02390 265045 265455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 265457 265651 gene locus_tag LOCUS_02400 265457 265651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02400 266094 265798 gene locus_tag LOCUS_02410 266094 265798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 266096 266437 gene locus_tag LOCUS_02420 266096 266437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02420 266734 267003 gene locus_tag LOCUS_02430 266734 267003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 267289 267477 gene locus_tag LOCUS_02440 267289 267477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 268598 267546 gene locus_tag LOCUS_02450 268598 267546 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_02450 269549 268602 gene locus_tag LOCUS_02460 269549 268602 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_02460 270388 269600 gene locus_tag LOCUS_02470 270388 269600 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_02470 272380 270539 gene locus_tag LOCUS_02480 gene mutL 272380 270539 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_02480 272707 272393 gene locus_tag LOCUS_02490 272707 272393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 273657 272863 gene locus_tag LOCUS_02500 273657 272863 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986634.1 protein_id gnl|my_center|LOCUS_02500 275378 273765 gene locus_tag LOCUS_02510 275378 273765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 276638 275976 gene locus_tag LOCUS_02520 276638 275976 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_02520 277513 276635 gene locus_tag LOCUS_02530 277513 276635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 278692 277634 gene locus_tag LOCUS_02540 278692 277634 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_02540 278809 280116 gene locus_tag LOCUS_02550 278809 280116 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_02550 280299 281315 gene locus_tag LOCUS_02560 280299 281315 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733041.1 protein_id gnl|my_center|LOCUS_02560 281401 282318 gene locus_tag LOCUS_02570 281401 282318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 282803 282390 gene locus_tag LOCUS_02580 gene aroQ 282803 282390 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_02580 283816 282821 gene locus_tag LOCUS_02590 283816 282821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02590 285029 283836 gene locus_tag LOCUS_02600 285029 283836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02600 285315 286283 gene locus_tag LOCUS_02610 285315 286283 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_02610 286452 287144 gene locus_tag LOCUS_02620 286452 287144 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_02620 287168 288190 gene locus_tag LOCUS_02630 287168 288190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 288187 289449 gene locus_tag LOCUS_02640 288187 289449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 290326 289595 gene locus_tag LOCUS_02650 290326 289595 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_02650 290906 290340 gene locus_tag LOCUS_02660 290906 290340 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_02660 291058 291879 gene locus_tag LOCUS_02670 291058 291879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 292124 291933 gene locus_tag LOCUS_02680 292124 291933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 293150 292293 gene locus_tag LOCUS_02690 293150 292293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 293796 293125 gene locus_tag LOCUS_02700 293796 293125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 294122 293871 gene locus_tag LOCUS_02710 294122 293871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 295463 295206 gene locus_tag LOCUS_02720 295463 295206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 296853 295444 gene locus_tag LOCUS_02730 296853 295444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 298029 297328 gene locus_tag LOCUS_02740 298029 297328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 298804 298220 gene locus_tag LOCUS_02750 298804 298220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 301108 298928 gene locus_tag LOCUS_02760 301108 298928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 301875 301108 gene locus_tag LOCUS_02770 301875 301108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 302069 303214 gene locus_tag LOCUS_02780 302069 303214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 303216 303482 gene locus_tag LOCUS_02790 303216 303482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 303888 303454 gene locus_tag LOCUS_02800 303888 303454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 303992 305086 gene locus_tag LOCUS_02810 303992 305086 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_02810 305229 307463 gene locus_tag LOCUS_02820 305229 307463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 307488 308906 gene locus_tag LOCUS_02830 307488 308906 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_02830 309305 308994 gene locus_tag LOCUS_02840 309305 308994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 309586 309377 gene locus_tag LOCUS_02850 309586 309377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 309722 310912 gene locus_tag LOCUS_02860 309722 310912 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_02860 310882 311028 gene locus_tag LOCUS_02870 310882 311028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 312272 311136 gene locus_tag LOCUS_02880 gene asnA 312272 311136 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_02880 312399 313733 gene locus_tag LOCUS_02890 312399 313733 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_02890 313785 314984 gene locus_tag LOCUS_02900 313785 314984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02900 314994 315413 gene locus_tag LOCUS_02910 314994 315413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02910 317407 315515 gene locus_tag LOCUS_02920 317407 315515 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_02920 318537 317488 gene locus_tag LOCUS_02930 gene desE 318537 317488 CDS product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 protein_id gnl|my_center|LOCUS_02930 318906 318697 gene locus_tag LOCUS_02940 318906 318697 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930433.1 protein_id gnl|my_center|LOCUS_02940 321606 319003 gene locus_tag LOCUS_02950 321606 319003 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_02950 321956 321606 gene locus_tag LOCUS_02960 321956 321606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 322050 322622 gene locus_tag LOCUS_02970 322050 322622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 322936 323145 gene locus_tag LOCUS_02980 322936 323145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 323040 323606 gene locus_tag LOCUS_02990 323040 323606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 325939 323822 gene locus_tag LOCUS_03000 325939 323822 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_03000 326102 329773 gene locus_tag LOCUS_03010 326102 329773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 329784 331052 gene locus_tag LOCUS_03020 329784 331052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 331231 331413 gene locus_tag LOCUS_03030 331231 331413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 331410 332066 gene locus_tag LOCUS_03040 331410 332066 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_03040 332380 332790 gene locus_tag LOCUS_03050 332380 332790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 332913 333683 gene locus_tag LOCUS_03060 332913 333683 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_03060 335082 333667 gene locus_tag LOCUS_03070 335082 333667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03070 336748 335075 gene locus_tag LOCUS_03080 336748 335075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 337179 338369 gene locus_tag LOCUS_03090 gene clsB 337179 338369 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649638.1 protein_id gnl|my_center|LOCUS_03090 339001 338504 gene locus_tag LOCUS_03100 339001 338504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 339241 340839 gene locus_tag LOCUS_03110 339241 340839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 340743 340961 gene locus_tag LOCUS_03120 340743 340961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 341010 341813 gene locus_tag LOCUS_03130 341010 341813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 342658 341894 gene locus_tag LOCUS_03140 342658 341894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 343288 342668 gene locus_tag LOCUS_03150 343288 342668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 344037 343285 gene locus_tag LOCUS_03160 344037 343285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 344743 344075 gene locus_tag LOCUS_03170 344743 344075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 344969 345481 gene locus_tag LOCUS_03180 344969 345481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 345510 346304 gene locus_tag LOCUS_03190 345510 346304 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_03190 347553 346237 gene locus_tag LOCUS_03200 347553 346237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 348620 347556 gene locus_tag LOCUS_03210 gene lpxK 348620 347556 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_03210 348748 349236 gene locus_tag LOCUS_03220 348748 349236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 349301 349669 gene locus_tag LOCUS_03230 349301 349669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 350492 349716 gene locus_tag LOCUS_03240 350492 349716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 350746 350456 gene locus_tag LOCUS_03250 350746 350456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 351248 350751 gene locus_tag LOCUS_03260 351248 350751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 351478 351245 gene locus_tag LOCUS_03270 351478 351245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 352804 351617 gene locus_tag LOCUS_03280 352804 351617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 353792 352824 gene locus_tag LOCUS_03290 353792 352824 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_03290 354529 353798 gene locus_tag LOCUS_03300 354529 353798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 357744 354442 gene locus_tag LOCUS_03310 357744 354442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 360773 357729 gene locus_tag LOCUS_03320 360773 357729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 361824 361258 gene locus_tag LOCUS_03330 361824 361258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 362783 361797 gene locus_tag LOCUS_03340 362783 361797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 362987 363640 gene locus_tag LOCUS_03350 362987 363640 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_03350 363734 364537 gene locus_tag LOCUS_03360 363734 364537 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_03360 364534 365208 gene locus_tag LOCUS_03370 gene prsW 364534 365208 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_03370 365393 365938 gene locus_tag LOCUS_03380 365393 365938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 366019 366714 gene locus_tag LOCUS_03390 366019 366714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 366741 368132 gene locus_tag LOCUS_03400 366741 368132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03400 368162 368431 gene locus_tag LOCUS_03410 368162 368431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 368491 370185 gene locus_tag LOCUS_03420 368491 370185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 370942 371640 gene locus_tag LOCUS_03430 370942 371640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 372349 371630 gene locus_tag LOCUS_03440 gene pgeF 372349 371630 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_03440 374080 374940 gene locus_tag LOCUS_03450 374080 374940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 375382 375041 gene locus_tag LOCUS_03460 375382 375041 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 protein_id gnl|my_center|LOCUS_03460 376467 375658 gene locus_tag LOCUS_03470 376467 375658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 376934 376464 gene locus_tag LOCUS_03480 376934 376464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 377373 376999 gene locus_tag LOCUS_03490 377373 376999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 378157 377567 gene locus_tag LOCUS_03500 378157 377567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 378481 378981 gene locus_tag LOCUS_03510 378481 378981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 378978 381212 gene locus_tag LOCUS_03520 378978 381212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03520 381188 383284 gene locus_tag LOCUS_03530 381188 383284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03530 383800 383342 gene locus_tag LOCUS_03540 383800 383342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 383982 383797 gene locus_tag LOCUS_03550 383982 383797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 384589 384098 gene locus_tag LOCUS_03560 384589 384098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 384807 384607 gene locus_tag LOCUS_03570 384807 384607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 386192 385821 gene locus_tag LOCUS_03580 386192 385821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 386351 386620 gene locus_tag LOCUS_03590 386351 386620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 387432 386974 gene locus_tag LOCUS_03600 387432 386974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 387753 387499 gene locus_tag LOCUS_03610 387753 387499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 388595 388125 gene locus_tag LOCUS_03620 388595 388125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 389004 388723 gene locus_tag LOCUS_03630 389004 388723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 389472 389278 gene locus_tag LOCUS_03640 389472 389278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 390489 389515 gene locus_tag LOCUS_03650 390489 389515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 391234 390503 gene locus_tag LOCUS_03660 391234 390503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 393439 391904 gene locus_tag LOCUS_03670 393439 391904 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770826.1 protein_id gnl|my_center|LOCUS_03670 394036 393581 gene locus_tag LOCUS_03680 394036 393581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03680 395919 394021 gene locus_tag LOCUS_03690 395919 394021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03690 395894 396064 gene locus_tag LOCUS_03700 395894 396064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 396393 396974 gene locus_tag LOCUS_03710 396393 396974 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_03710 397167 398039 gene locus_tag LOCUS_03720 397167 398039 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_03720 398042 398287 gene locus_tag LOCUS_03730 398042 398287 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_03730 399383 398307 gene locus_tag LOCUS_03740 399383 398307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 399577 400701 gene locus_tag LOCUS_03750 399577 400701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 400722 401426 gene locus_tag LOCUS_03760 400722 401426 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_03760 401408 401638 gene locus_tag LOCUS_03770 401408 401638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 401684 403369 gene locus_tag LOCUS_03780 401684 403369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 404053 403460 gene locus_tag LOCUS_03790 404053 403460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 405220 404156 gene locus_tag LOCUS_03800 405220 404156 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_03800 406473 405358 gene locus_tag LOCUS_03810 406473 405358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 407002 406457 gene locus_tag LOCUS_03820 407002 406457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 407619 407068 gene locus_tag LOCUS_03830 407619 407068 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_03830 408805 407783 gene locus_tag LOCUS_03840 408805 407783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 409036 410367 gene locus_tag LOCUS_03850 409036 410367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 410534 411253 gene locus_tag LOCUS_03860 410534 411253 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_03860 411735 411250 gene locus_tag LOCUS_03870 411735 411250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 412121 411738 gene locus_tag LOCUS_03880 412121 411738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 412292 412128 gene locus_tag LOCUS_03890 412292 412128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 412797 412345 gene locus_tag LOCUS_03900 412797 412345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 413982 412930 gene locus_tag LOCUS_03910 413982 412930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 414358 414891 gene locus_tag LOCUS_03920 414358 414891 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_03920 414941 416686 gene locus_tag LOCUS_03930 414941 416686 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_03930 416715 418085 gene locus_tag LOCUS_03940 416715 418085 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_03940 418145 419551 gene locus_tag LOCUS_03950 418145 419551 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_03950 420957 419572 gene locus_tag LOCUS_03960 gene glgA 420957 419572 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836716.1 protein_id gnl|my_center|LOCUS_03960 421913 421101 gene locus_tag LOCUS_03970 421913 421101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 422642 422046 gene locus_tag LOCUS_03980 422642 422046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 425730 422704 gene locus_tag LOCUS_03990 425730 422704 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_03990 426081 425809 gene locus_tag LOCUS_04000 426081 425809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 426908 426084 gene locus_tag LOCUS_04010 426908 426084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04010 427497 426943 gene locus_tag LOCUS_04020 427497 426943 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_04020 428210 427575 gene locus_tag LOCUS_04030 428210 427575 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_04030 429908 428487 gene locus_tag LOCUS_04040 429908 428487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_04040 430014 430511 gene locus_tag LOCUS_04050 430014 430511 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769725.1 protein_id gnl|my_center|LOCUS_04050 430653 432848 gene locus_tag LOCUS_04060 430653 432848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 432980 433138 gene locus_tag LOCUS_04070 432980 433138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 433135 433647 gene locus_tag LOCUS_04080 433135 433647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 433652 433912 gene locus_tag LOCUS_04090 433652 433912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 433891 434946 gene locus_tag LOCUS_04100 433891 434946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04100 435087 435626 gene locus_tag LOCUS_04110 435087 435626 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_04110 435630 436763 gene locus_tag LOCUS_04120 435630 436763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 437031 437777 gene locus_tag LOCUS_04130 437031 437777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 438799 437825 gene locus_tag LOCUS_04140 438799 437825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 439882 439289 gene locus_tag LOCUS_04150 gene hisIE 439882 439289 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_04150 440717 439965 gene locus_tag LOCUS_04160 gene hisF 440717 439965 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_04160 441646 440732 gene locus_tag LOCUS_04170 441646 440732 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_04170 441847 442203 gene locus_tag LOCUS_04180 441847 442203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04180 442243 442548 gene locus_tag LOCUS_04190 442243 442548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 442552 443226 gene locus_tag LOCUS_04200 gene aat 442552 443226 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_04200 443432 443358 gene locus_tag LOCUS_t00020 443432 443358 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 443513 444427 gene locus_tag LOCUS_04210 443513 444427 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_04210 444619 445353 gene locus_tag LOCUS_04220 444619 445353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 445350 445712 gene locus_tag LOCUS_04230 445350 445712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04230 445661 447001 gene locus_tag LOCUS_04240 445661 447001 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404351.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04240 447001 448122 gene locus_tag LOCUS_04250 447001 448122 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_04250 448552 449037 gene locus_tag LOCUS_04260 448552 449037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 449055 452687 gene locus_tag LOCUS_04270 449055 452687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 452939 453550 gene locus_tag LOCUS_04280 452939 453550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 454389 453601 gene locus_tag LOCUS_04290 454389 453601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 455822 454668 gene locus_tag LOCUS_04300 gene hemW 455822 454668 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_04300 457056 455962 gene locus_tag LOCUS_04310 457056 455962 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_04310 457478 457113 gene locus_tag LOCUS_04320 457478 457113 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_04320 457626 460832 gene locus_tag LOCUS_04330 457626 460832 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_04330 460857 460997 gene locus_tag LOCUS_04340 460857 460997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04340 461073 461561 gene locus_tag LOCUS_04350 461073 461561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04350 461566 462267 gene locus_tag LOCUS_04360 461566 462267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 463777 462287 gene locus_tag LOCUS_04370 463777 462287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 465481 463853 gene locus_tag LOCUS_04380 465481 463853 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_04380 466520 465585 gene locus_tag LOCUS_04390 466520 465585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 468022 466433 gene locus_tag LOCUS_04400 468022 466433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 468271 469452 gene locus_tag LOCUS_04410 gene mtaB 468271 469452 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_04410 469472 470362 gene locus_tag LOCUS_04420 469472 470362 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_04420 470406 471230 gene locus_tag LOCUS_04430 470406 471230 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_04430 471233 471607 gene locus_tag LOCUS_04440 471233 471607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04440 473169 471511 gene locus_tag LOCUS_04450 473169 471511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 473756 473169 gene locus_tag LOCUS_04460 473756 473169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04460 474791 473958 gene locus_tag LOCUS_04470 gene trxA 474791 473958 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932886.1 protein_id gnl|my_center|LOCUS_04470 474867 475499 gene locus_tag LOCUS_04480 474867 475499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402939.1 protein_id gnl|my_center|LOCUS_04480 476194 475505 gene locus_tag LOCUS_04490 476194 475505 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_04490 477278 476304 gene locus_tag LOCUS_04500 477278 476304 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_04500 477391 477879 gene locus_tag LOCUS_04510 477391 477879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 478618 477911 gene locus_tag LOCUS_04520 478618 477911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 478768 479700 gene locus_tag LOCUS_04530 478768 479700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 479851 479991 gene locus_tag LOCUS_04540 479851 479991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04540 479981 480406 gene locus_tag LOCUS_04550 479981 480406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 480472 482499 gene locus_tag LOCUS_04560 gene uvrB 480472 482499 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_04560 482731 483726 gene locus_tag LOCUS_04570 482731 483726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 483753 484982 gene locus_tag LOCUS_04580 483753 484982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 485049 485912 gene locus_tag LOCUS_04590 485049 485912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 486456 485965 gene locus_tag LOCUS_04600 486456 485965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 487205 486417 gene locus_tag LOCUS_04610 487205 486417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 487664 487293 gene locus_tag LOCUS_04620 487664 487293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 488779 487646 gene locus_tag LOCUS_04630 488779 487646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04630 489356 489078 gene locus_tag LOCUS_04640 489356 489078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 489674 489363 gene locus_tag LOCUS_04650 489674 489363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 491608 489776 gene locus_tag LOCUS_04660 491608 489776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04660 492155 491526 gene locus_tag LOCUS_04670 492155 491526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 492334 492642 gene locus_tag LOCUS_04680 492334 492642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 492721 493305 gene locus_tag LOCUS_04690 gene hisH 492721 493305 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_04690 493451 494248 gene locus_tag LOCUS_04700 493451 494248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 494252 494596 gene locus_tag LOCUS_04710 494252 494596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 494700 495257 gene locus_tag LOCUS_04720 494700 495257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 496619 495645 gene locus_tag LOCUS_04730 496619 495645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 497195 496662 gene locus_tag LOCUS_04740 497195 496662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 498031 497114 gene locus_tag LOCUS_04750 498031 497114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 501044 498585 gene locus_tag LOCUS_04760 501044 498585 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_04760 501269 504127 gene locus_tag LOCUS_04770 501269 504127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 504884 504180 gene locus_tag LOCUS_04780 504884 504180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 505563 505237 gene locus_tag LOCUS_04790 505563 505237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 506015 505560 gene locus_tag LOCUS_04800 506015 505560 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_04800 506327 506133 gene locus_tag LOCUS_04810 506327 506133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 507830 506493 gene locus_tag LOCUS_04820 507830 506493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 508154 508240 gene locus_tag LOCUS_t00030 508154 508240 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 508408 508701 gene locus_tag LOCUS_04830 508408 508701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 508846 508613 gene locus_tag LOCUS_04840 508846 508613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04840 510150 508852 gene locus_tag LOCUS_04850 510150 508852 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04850 510635 510967 gene locus_tag LOCUS_04860 510635 510967 CDS product killer suppression protein HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387766.1 protein_id gnl|my_center|LOCUS_04860 510982 512082 gene locus_tag LOCUS_04870 510982 512082 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_04870 512569 512925 gene locus_tag LOCUS_04880 512569 512925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 513676 513182 gene locus_tag LOCUS_04890 513676 513182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 514296 513601 gene locus_tag LOCUS_04900 514296 513601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 514606 514418 gene locus_tag LOCUS_04910 514606 514418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 514811 514638 gene locus_tag LOCUS_04920 514811 514638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 515131 514910 gene locus_tag LOCUS_04930 515131 514910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 515505 515134 gene locus_tag LOCUS_04940 515505 515134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 516105 515821 gene locus_tag LOCUS_04950 516105 515821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 516725 518983 gene locus_tag LOCUS_04960 516725 518983 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_04960 521398 519152 gene locus_tag LOCUS_04970 521398 519152 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_04970 521915 521469 gene locus_tag LOCUS_04980 521915 521469 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_04980 522199 522480 gene locus_tag LOCUS_04990 522199 522480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04990 522556 523275 gene locus_tag LOCUS_05000 522556 523275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 523772 524086 gene locus_tag LOCUS_05010 523772 524086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 524083 524424 gene locus_tag LOCUS_05020 524083 524424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05020 524412 525596 gene locus_tag LOCUS_05030 524412 525596 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_05030 527039 525828 gene locus_tag LOCUS_05040 527039 525828 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_05040 528116 527118 gene locus_tag LOCUS_05050 528116 527118 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_05050 529848 528169 gene locus_tag LOCUS_05060 529848 528169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 529941 530774 gene locus_tag LOCUS_05070 529941 530774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 530925 531197 gene locus_tag LOCUS_05080 530925 531197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 531274 532029 gene locus_tag LOCUS_05090 531274 532029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05090 532185 533375 gene locus_tag LOCUS_05100 532185 533375 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_05100 533400 533840 gene locus_tag LOCUS_05110 533400 533840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 534231 534743 gene locus_tag LOCUS_05120 534231 534743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 535389 536333 gene locus_tag LOCUS_05130 535389 536333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 536466 537479 gene locus_tag LOCUS_05140 536466 537479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 537571 537894 gene locus_tag LOCUS_05150 537571 537894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 538012 540087 gene locus_tag LOCUS_05160 538012 540087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05160 540102 542315 gene locus_tag LOCUS_05170 540102 542315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05170 542448 542783 gene locus_tag LOCUS_05180 542448 542783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 542822 543490 gene locus_tag LOCUS_05190 542822 543490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 544587 543709 gene locus_tag LOCUS_05200 544587 543709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 544666 545271 gene locus_tag LOCUS_05210 gene caiE 544666 545271 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122881.1 protein_id gnl|my_center|LOCUS_05210 545406 545642 gene locus_tag LOCUS_05220 545406 545642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 545753 546271 gene locus_tag LOCUS_05230 545753 546271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05230 546341 546754 gene locus_tag LOCUS_05240 546341 546754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_05240 546911 547579 gene locus_tag LOCUS_05250 546911 547579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05250 547468 548991 gene locus_tag LOCUS_05260 547468 548991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05260 549000 550055 gene locus_tag LOCUS_05270 549000 550055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 550147 552195 gene locus_tag LOCUS_05280 gene paaZ 550147 552195 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399720.1 protein_id gnl|my_center|LOCUS_05280 554442 552160 gene locus_tag LOCUS_05290 554442 552160 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_05290 554564 555565 gene locus_tag LOCUS_05300 554564 555565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 555517 557664 gene locus_tag LOCUS_05310 555517 557664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 558511 557720 gene locus_tag LOCUS_05320 558511 557720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 559747 558569 gene locus_tag LOCUS_05330 559747 558569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05330 560334 559765 gene locus_tag LOCUS_05340 560334 559765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05340 560426 562279 gene locus_tag LOCUS_05350 560426 562279 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_05350 562391 562714 gene locus_tag LOCUS_05360 562391 562714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 562773 563528 gene locus_tag LOCUS_05370 562773 563528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05370 564535 563591 gene locus_tag LOCUS_05380 564535 563591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 565790 564720 gene locus_tag LOCUS_05390 565790 564720 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_05390 565909 566838 gene locus_tag LOCUS_05400 565909 566838 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_05400 567062 567376 gene locus_tag LOCUS_05410 567062 567376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 567403 567933 gene locus_tag LOCUS_05420 567403 567933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 567933 568340 gene locus_tag LOCUS_05430 567933 568340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 569948 568350 gene locus_tag LOCUS_05440 569948 568350 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_05440 570280 571557 gene locus_tag LOCUS_05450 gene kynU 570280 571557 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_05450 571554 573326 gene locus_tag LOCUS_05460 571554 573326 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05460 573352 573687 gene locus_tag LOCUS_05470 573352 573687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05470 575872 573950 gene locus_tag LOCUS_05480 575872 573950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 577409 576324 gene locus_tag LOCUS_05490 577409 576324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05490 580020 577387 gene locus_tag LOCUS_05500 580020 577387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 580247 582436 gene locus_tag LOCUS_05510 580247 582436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 582745 583494 gene locus_tag LOCUS_05520 582745 583494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_05520 584228 583569 gene locus_tag LOCUS_05530 584228 583569 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_05530 584560 584273 gene locus_tag LOCUS_05540 584560 584273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 585108 584533 gene locus_tag LOCUS_05550 585108 584533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 585665 585222 gene locus_tag LOCUS_05560 585665 585222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 585944 585774 gene locus_tag LOCUS_05570 585944 585774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 586222 585956 gene locus_tag LOCUS_05580 586222 585956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 586623 588824 gene locus_tag LOCUS_05590 586623 588824 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_05590 589857 589051 gene locus_tag LOCUS_05600 589857 589051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 589969 590445 gene locus_tag LOCUS_05610 589969 590445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 590457 591377 gene locus_tag LOCUS_05620 590457 591377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 593439 591397 gene locus_tag LOCUS_05630 593439 591397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 594258 593653 gene locus_tag LOCUS_05640 594258 593653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 596780 594300 gene locus_tag LOCUS_05650 596780 594300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 598920 596968 gene locus_tag LOCUS_05660 598920 596968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 599020 601929 gene locus_tag LOCUS_05670 599020 601929 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_05670 603507 602044 gene locus_tag LOCUS_05680 603507 602044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 604343 603537 gene locus_tag LOCUS_05690 604343 603537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 604908 604351 gene locus_tag LOCUS_05700 604908 604351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 605437 604964 gene locus_tag LOCUS_05710 605437 604964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 606887 605562 gene locus_tag LOCUS_05720 606887 605562 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_05720 607871 606906 gene locus_tag LOCUS_05730 607871 606906 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_05730 609131 607875 gene locus_tag LOCUS_05740 609131 607875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 609867 609121 gene locus_tag LOCUS_05750 609867 609121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 610495 609857 gene locus_tag LOCUS_05760 610495 609857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 611796 610477 gene locus_tag LOCUS_05770 611796 610477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 611996 612583 gene locus_tag LOCUS_05780 611996 612583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 612474 613586 gene locus_tag LOCUS_05790 612474 613586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 613833 614564 gene locus_tag LOCUS_05800 613833 614564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 614561 615118 gene locus_tag LOCUS_05810 614561 615118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05810 615150 615344 gene locus_tag LOCUS_05820 615150 615344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 615428 615949 gene locus_tag LOCUS_05830 gene atpF 615428 615949 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_05830 615955 616524 gene locus_tag LOCUS_05840 gene atpH 615955 616524 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_05840 616588 618192 gene locus_tag LOCUS_05850 gene atpA 616588 618192 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_05850 618217 619110 gene locus_tag LOCUS_05860 gene atpG 618217 619110 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_05860 619291 619896 gene locus_tag LOCUS_05870 619291 619896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05870 619814 620005 gene locus_tag LOCUS_05880 619814 620005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 620235 620432 gene locus_tag LOCUS_05890 620235 620432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05890 620470 621000 gene locus_tag LOCUS_05900 620470 621000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05900 621004 621447 gene locus_tag LOCUS_05910 621004 621447 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122034607.1 protein_id gnl|my_center|LOCUS_05910 622018 622833 gene locus_tag LOCUS_05920 622018 622833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05920 622837 623397 gene locus_tag LOCUS_05930 622837 623397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05930 623402 624547 gene locus_tag LOCUS_05940 623402 624547 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_05940 625817 624534 gene locus_tag LOCUS_05950 625817 624534 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_05950 625885 626196 gene locus_tag LOCUS_05960 625885 626196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05960 626193 627326 gene locus_tag LOCUS_05970 626193 627326 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130286390.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05970 627530 628924 gene locus_tag LOCUS_05980 627530 628924 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_05980 629998 629249 gene locus_tag LOCUS_05990 629998 629249 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839117.1 protein_id gnl|my_center|LOCUS_05990 630081 632144 gene locus_tag LOCUS_06000 630081 632144 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_06000 632429 632851 gene locus_tag LOCUS_06010 632429 632851 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_06010 632983 634662 gene locus_tag LOCUS_06020 632983 634662 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_06020 634717 635469 gene locus_tag LOCUS_06030 634717 635469 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_06030 638504 635823 gene locus_tag LOCUS_06040 638504 635823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 639170 638607 gene locus_tag LOCUS_06050 639170 638607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06050 640475 639462 gene locus_tag LOCUS_06060 640475 639462 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_06060 641617 640571 gene locus_tag LOCUS_06070 gene thiL 641617 640571 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_06070 642136 641639 gene locus_tag LOCUS_06080 642136 641639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06080 642555 642145 gene locus_tag LOCUS_06090 642555 642145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06090 643084 642536 gene locus_tag LOCUS_06100 643084 642536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 643319 643089 gene locus_tag LOCUS_06110 643319 643089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 644070 643234 gene locus_tag LOCUS_06120 644070 643234 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06120 645856 644954 gene locus_tag LOCUS_06130 645856 644954 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_06130 647385 645853 gene locus_tag LOCUS_06140 647385 645853 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_06140 648169 647375 gene locus_tag LOCUS_06150 648169 647375 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_06150 648451 648182 gene locus_tag LOCUS_06160 648451 648182 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_06160 649146 648475 gene locus_tag LOCUS_06170 649146 648475 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_06170 649443 649156 gene locus_tag LOCUS_06180 649443 649156 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_06180 649759 649433 gene locus_tag LOCUS_06190 649759 649433 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_06190 650165 649749 gene locus_tag LOCUS_06200 650165 649749 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_06200 651562 650171 gene locus_tag LOCUS_06210 gene atpD 651562 650171 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_06210 651617 651871 gene locus_tag LOCUS_06220 651617 651871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 653352 652114 gene locus_tag LOCUS_06230 653352 652114 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_06230 654607 653549 gene locus_tag LOCUS_06240 gene porQ 654607 653549 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_06240 655238 654612 gene locus_tag LOCUS_06250 655238 654612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 656817 655501 gene locus_tag LOCUS_06260 656817 655501 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_06260 656869 657036 gene locus_tag LOCUS_06270 656869 657036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 660186 657196 gene locus_tag LOCUS_06280 660186 657196 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_06280 661853 660363 gene locus_tag LOCUS_06290 661853 660363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 662391 661807 gene locus_tag LOCUS_06300 662391 661807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 662506 663051 gene locus_tag LOCUS_06310 662506 663051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 663039 664676 gene locus_tag LOCUS_06320 663039 664676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 665485 664784 gene locus_tag LOCUS_06330 665485 664784 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_06330 666672 665617 gene locus_tag LOCUS_06340 666672 665617 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_06340 666754 666978 gene locus_tag LOCUS_06350 666754 666978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 667056 668864 gene locus_tag LOCUS_06360 667056 668864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 670188 668962 gene locus_tag LOCUS_06370 670188 668962 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_06370 673307 670311 gene locus_tag LOCUS_06380 673307 670311 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_06380 673722 674561 gene locus_tag LOCUS_06390 673722 674561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 674600 675118 gene locus_tag LOCUS_06400 674600 675118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 675334 675726 gene locus_tag LOCUS_06410 675334 675726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 675723 676127 gene locus_tag LOCUS_06420 675723 676127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 676142 676633 gene locus_tag LOCUS_06430 676142 676633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 677590 676934 gene locus_tag LOCUS_06440 677590 676934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 678298 677702 gene locus_tag LOCUS_06450 678298 677702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 678653 678234 gene locus_tag LOCUS_06460 678653 678234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 679371 679634 gene locus_tag LOCUS_06470 679371 679634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06470 679631 679810 gene locus_tag LOCUS_06480 679631 679810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 679836 680087 gene locus_tag LOCUS_06490 679836 680087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 681055 680522 gene locus_tag LOCUS_06500 681055 680522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 681577 681233 gene locus_tag LOCUS_06510 681577 681233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 681840 681580 gene locus_tag LOCUS_06520 681840 681580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 682229 681945 gene locus_tag LOCUS_06530 682229 681945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 682818 682555 gene locus_tag LOCUS_06540 682818 682555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 683867 682860 gene locus_tag LOCUS_06550 683867 682860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 684038 683877 gene locus_tag LOCUS_06560 684038 683877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence02 610 732 gene locus_tag LOCUS_06570 610 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1194 2426 gene locus_tag LOCUS_06580 1194 2426 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203509.1 protein_id gnl|my_center|LOCUS_06580 2579 3187 gene locus_tag LOCUS_06590 2579 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880985.1 protein_id gnl|my_center|LOCUS_06590 3444 4253 gene locus_tag LOCUS_06600 3444 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4412 5629 gene locus_tag LOCUS_06610 4412 5629 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_06610 5796 6326 gene locus_tag LOCUS_06620 5796 6326 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_06620 6440 7060 gene locus_tag LOCUS_06630 6440 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 7285 8202 gene locus_tag LOCUS_06640 7285 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9588 8344 gene locus_tag LOCUS_06650 9588 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_06650 9894 10331 gene locus_tag LOCUS_06660 9894 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 10818 10408 gene locus_tag LOCUS_06670 10818 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12995 11559 gene locus_tag LOCUS_06680 12995 11559 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_06680 13226 13005 gene locus_tag LOCUS_06690 13226 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 14431 13346 gene locus_tag LOCUS_06700 14431 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 16214 14400 gene locus_tag LOCUS_06710 16214 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06710 17090 17017 gene locus_tag LOCUS_t00040 17090 17017 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18233 17205 gene locus_tag LOCUS_06720 18233 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06720 18733 18230 gene locus_tag LOCUS_06730 18733 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 19533 18835 gene locus_tag LOCUS_06740 19533 18835 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_06740 20051 20584 gene locus_tag LOCUS_06750 20051 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06750 20590 21189 gene locus_tag LOCUS_06760 20590 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 21340 21702 gene locus_tag LOCUS_06770 21340 21702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 21951 22613 gene locus_tag LOCUS_06780 21951 22613 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_06780 22629 22847 gene locus_tag LOCUS_06790 22629 22847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 22918 23499 gene locus_tag LOCUS_06800 22918 23499 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_06800 24581 23565 gene locus_tag LOCUS_06810 24581 23565 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_06810 24767 25480 gene locus_tag LOCUS_06820 24767 25480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 25782 25698 gene locus_tag LOCUS_t00050 25782 25698 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25886 25800 gene locus_tag LOCUS_t00060 25886 25800 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26444 25920 gene locus_tag LOCUS_06830 gene hscB 26444 25920 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384418.1 protein_id gnl|my_center|LOCUS_06830 27039 26446 gene locus_tag LOCUS_06840 27039 26446 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_06840 27623 27210 gene locus_tag LOCUS_06850 27623 27210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 28223 27702 gene locus_tag LOCUS_06860 28223 27702 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_06860 28363 28491 gene locus_tag LOCUS_06870 28363 28491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 28578 29618 gene locus_tag LOCUS_06880 gene lysA 28578 29618 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06880 29886 32567 gene locus_tag LOCUS_06890 29886 32567 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_06890 33108 32707 gene locus_tag LOCUS_06900 33108 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 33544 33176 gene locus_tag LOCUS_06910 33544 33176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 33687 34142 gene locus_tag LOCUS_06920 33687 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 34201 34962 gene locus_tag LOCUS_06930 34201 34962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 35005 37989 gene locus_tag LOCUS_06940 35005 37989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 38105 38587 gene locus_tag LOCUS_06950 38105 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 38831 39349 gene locus_tag LOCUS_06960 38831 39349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 39346 44811 gene locus_tag LOCUS_06970 39346 44811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 46783 44801 gene locus_tag LOCUS_06980 46783 44801 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_06980 50003 46920 gene locus_tag LOCUS_06990 gene secDF 50003 46920 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_06990 51126 50161 gene locus_tag LOCUS_07000 51126 50161 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_07000 51161 51385 gene locus_tag LOCUS_07010 51161 51385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 51708 51382 gene locus_tag LOCUS_07020 51708 51382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 51989 52729 gene locus_tag LOCUS_07030 51989 52729 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_07030 52868 53827 gene locus_tag LOCUS_07040 52868 53827 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_07040 53980 54669 gene locus_tag LOCUS_07050 53980 54669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 55082 54735 gene locus_tag LOCUS_07060 55082 54735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 55223 56089 gene locus_tag LOCUS_07070 55223 56089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 57512 56013 gene locus_tag LOCUS_07080 57512 56013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_07080 57604 58521 gene locus_tag LOCUS_07090 57604 58521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 58584 59726 gene locus_tag LOCUS_07100 gene wcaL 58584 59726 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097867.1 protein_id gnl|my_center|LOCUS_07100 60616 59978 gene locus_tag LOCUS_07110 60616 59978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07110 61603 60833 gene locus_tag LOCUS_07120 61603 60833 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_07120 62718 61600 gene locus_tag LOCUS_07130 62718 61600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 65331 62824 gene locus_tag LOCUS_07140 65331 62824 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_07140 66896 65454 gene locus_tag LOCUS_07150 66896 65454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 67065 67520 gene locus_tag LOCUS_07160 67065 67520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 67445 69556 gene locus_tag LOCUS_07170 67445 69556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 69448 70905 gene locus_tag LOCUS_07180 69448 70905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 71097 71351 gene locus_tag LOCUS_07190 71097 71351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 71341 71769 gene locus_tag LOCUS_07200 71341 71769 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_07200 71775 73013 gene locus_tag LOCUS_07210 71775 73013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 73051 73353 gene locus_tag LOCUS_07220 73051 73353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 73662 74375 gene locus_tag LOCUS_07230 73662 74375 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_07230 74535 74891 gene locus_tag LOCUS_07240 gene gldC 74535 74891 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_07240 74984 76210 gene locus_tag LOCUS_07250 74984 76210 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_07250 76375 77616 gene locus_tag LOCUS_07260 76375 77616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 82420 77765 gene locus_tag LOCUS_07270 82420 77765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 83049 82747 gene locus_tag LOCUS_07280 83049 82747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 83563 83264 gene locus_tag LOCUS_07290 83563 83264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07290 84639 83497 gene locus_tag LOCUS_07300 84639 83497 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 84936 86294 gene locus_tag LOCUS_07310 84936 86294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 86785 86555 gene locus_tag LOCUS_07320 86785 86555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07320 88825 87227 gene locus_tag LOCUS_07330 88825 87227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 89417 88818 gene locus_tag LOCUS_07340 gene yihA 89417 88818 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_07340 89529 90185 gene locus_tag LOCUS_07350 89529 90185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 91043 90834 gene locus_tag LOCUS_07360 91043 90834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 91099 91686 gene locus_tag LOCUS_07370 91099 91686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07370 91754 93025 gene locus_tag LOCUS_07380 91754 93025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 93401 94888 gene locus_tag LOCUS_07390 93401 94888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_07390 95456 94944 gene locus_tag LOCUS_07400 95456 94944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 96439 95537 gene locus_tag LOCUS_07410 96439 95537 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_07410 96768 97004 gene locus_tag LOCUS_07420 96768 97004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07420 97010 97351 gene locus_tag LOCUS_07430 97010 97351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 98540 97443 gene locus_tag LOCUS_07440 98540 97443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 98938 98537 gene locus_tag LOCUS_07450 98938 98537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07450 101963 98967 gene locus_tag LOCUS_07460 101963 98967 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_07460 104232 101983 gene locus_tag LOCUS_07470 gene bglX 104232 101983 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_07470 105727 104411 gene locus_tag LOCUS_07480 105727 104411 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_07480 107451 105919 gene locus_tag LOCUS_07490 107451 105919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 108612 107563 gene locus_tag LOCUS_07500 108612 107563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 109042 108644 gene locus_tag LOCUS_07510 109042 108644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 110463 109039 gene locus_tag LOCUS_07520 110463 109039 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07520 111349 111996 gene locus_tag LOCUS_07530 gene pdxH 111349 111996 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_07530 114425 112059 gene locus_tag LOCUS_07540 114425 112059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 115327 114650 gene locus_tag LOCUS_07550 115327 114650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07550 115810 115574 gene locus_tag LOCUS_07560 115810 115574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 116025 115843 gene locus_tag LOCUS_07570 116025 115843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 118532 115986 gene locus_tag LOCUS_07580 118532 115986 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 120492 118639 gene locus_tag LOCUS_07590 120492 118639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 122530 120599 gene locus_tag LOCUS_07600 122530 120599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 123909 122449 gene locus_tag LOCUS_07610 123909 122449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 124470 123925 gene locus_tag LOCUS_07620 124470 123925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 127949 124590 gene locus_tag LOCUS_07630 127949 124590 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067544393.1 protein_id gnl|my_center|LOCUS_07630 129632 128064 gene locus_tag LOCUS_07640 129632 128064 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_07640 132692 129693 gene locus_tag LOCUS_07650 132692 129693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_07650 133098 134243 gene locus_tag LOCUS_07660 133098 134243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 134462 135244 gene locus_tag LOCUS_07670 134462 135244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 135154 136452 gene locus_tag LOCUS_07680 135154 136452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07680 138423 138659 gene locus_tag LOCUS_07690 138423 138659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 138773 139168 gene locus_tag LOCUS_07700 138773 139168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 139242 139430 gene locus_tag LOCUS_07710 139242 139430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 140629 139673 gene locus_tag LOCUS_07720 140629 139673 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_07720 141079 140852 gene locus_tag LOCUS_07730 141079 140852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 141924 141373 gene locus_tag LOCUS_07740 141924 141373 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303165.1 protein_id gnl|my_center|LOCUS_07740 141996 142913 gene locus_tag LOCUS_07750 141996 142913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 142951 143487 gene locus_tag LOCUS_07760 gene dcd 142951 143487 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_07760 143497 146154 gene locus_tag LOCUS_07770 143497 146154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 146244 146744 gene locus_tag LOCUS_07780 146244 146744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 147916 146876 gene locus_tag LOCUS_07790 147916 146876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 148923 148105 gene locus_tag LOCUS_07800 148923 148105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 149105 149926 gene locus_tag LOCUS_07810 149105 149926 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_07810 150070 150645 gene locus_tag LOCUS_07820 150070 150645 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_07820 150683 152152 gene locus_tag LOCUS_07830 150683 152152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 152946 152350 gene locus_tag LOCUS_07840 152946 152350 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_07840 153387 152950 gene locus_tag LOCUS_07850 153387 152950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 155064 153688 gene locus_tag LOCUS_07860 155064 153688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 155838 155317 gene locus_tag LOCUS_07870 155838 155317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07870 156421 155831 gene locus_tag LOCUS_07880 156421 155831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 157224 156538 gene locus_tag LOCUS_07890 157224 156538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 158265 159650 gene locus_tag LOCUS_07900 158265 159650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 159560 159754 gene locus_tag LOCUS_07910 159560 159754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 160269 159829 gene locus_tag LOCUS_07920 160269 159829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 161793 160396 gene locus_tag LOCUS_07930 161793 160396 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_07930 161994 162464 gene locus_tag LOCUS_07940 161994 162464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 162840 162517 gene locus_tag LOCUS_07950 162840 162517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 164001 162970 gene locus_tag LOCUS_07960 164001 162970 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_07960 166061 164175 gene locus_tag LOCUS_07970 166061 164175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 166192 166722 gene locus_tag LOCUS_07980 166192 166722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 166701 166892 gene locus_tag LOCUS_07990 166701 166892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 167653 167195 gene locus_tag LOCUS_08000 167653 167195 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_08000 167925 167656 gene locus_tag LOCUS_08010 167925 167656 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_08010 168057 169565 gene locus_tag LOCUS_08020 168057 169565 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 169562 169771 gene locus_tag LOCUS_08030 169562 169771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08030 170703 170047 gene locus_tag LOCUS_08040 170703 170047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 171473 170700 gene locus_tag LOCUS_08050 171473 170700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 172057 171563 gene locus_tag LOCUS_08060 172057 171563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 172745 172332 gene locus_tag LOCUS_08070 172745 172332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 173824 172706 gene locus_tag LOCUS_08080 173824 172706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08080 173886 174131 gene locus_tag LOCUS_08090 173886 174131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 174850 174191 gene locus_tag LOCUS_08100 174850 174191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 176012 177235 gene locus_tag LOCUS_08110 176012 177235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 177339 178922 gene locus_tag LOCUS_08120 177339 178922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 178976 181435 gene locus_tag LOCUS_08130 178976 181435 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_08130 181440 181625 gene locus_tag LOCUS_08140 181440 181625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 182883 181693 gene locus_tag LOCUS_08150 182883 181693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 184265 182814 gene locus_tag LOCUS_08160 184265 182814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 184497 185135 gene locus_tag LOCUS_08170 184497 185135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 185301 186704 gene locus_tag LOCUS_08180 185301 186704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 187675 186701 gene locus_tag LOCUS_08190 187675 186701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 189009 187759 gene locus_tag LOCUS_08200 189009 187759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 189132 190436 gene locus_tag LOCUS_08210 gene hemL 189132 190436 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071513.1 protein_id gnl|my_center|LOCUS_08210 190997 190500 gene locus_tag LOCUS_08220 190997 190500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 191191 191000 gene locus_tag LOCUS_08230 191191 191000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 191809 192180 gene locus_tag LOCUS_08240 gene rplS 191809 192180 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_08240 193068 192328 gene locus_tag LOCUS_08250 gene bshB1 193068 192328 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_08250 193447 193070 gene locus_tag LOCUS_08260 193447 193070 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_08260 194709 193450 gene locus_tag LOCUS_08270 194709 193450 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 protein_id gnl|my_center|LOCUS_08270 195122 195733 gene locus_tag LOCUS_08280 gene recR 195122 195733 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_08280 195739 197706 gene locus_tag LOCUS_08290 195739 197706 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_08290 199366 197918 gene locus_tag LOCUS_08300 199366 197918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 199863 199372 gene locus_tag LOCUS_08310 199863 199372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 201013 199964 gene locus_tag LOCUS_08320 201013 199964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 201846 201208 gene locus_tag LOCUS_08330 201846 201208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 202343 201924 gene locus_tag LOCUS_08340 202343 201924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 203022 202453 gene locus_tag LOCUS_08350 203022 202453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 203373 203035 gene locus_tag LOCUS_08360 203373 203035 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_08360 203881 203441 gene locus_tag LOCUS_08370 203881 203441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 204235 203894 gene locus_tag LOCUS_08380 204235 203894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 204622 204341 gene locus_tag LOCUS_08390 204622 204341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 204848 205522 gene locus_tag LOCUS_08400 204848 205522 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_08400 205557 206219 gene locus_tag LOCUS_08410 205557 206219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 206484 206314 gene locus_tag LOCUS_08420 206484 206314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 206704 206537 gene locus_tag LOCUS_08430 206704 206537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 207188 206742 gene locus_tag LOCUS_08440 207188 206742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 207413 207228 gene locus_tag LOCUS_08450 207413 207228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 207783 207562 gene locus_tag LOCUS_08460 207783 207562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 208672 208109 gene locus_tag LOCUS_08470 208672 208109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 210783 209026 gene locus_tag LOCUS_08480 210783 209026 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_08480 210983 210780 gene locus_tag LOCUS_08490 210983 210780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 211605 210934 gene locus_tag LOCUS_08500 211605 210934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 212407 211664 gene locus_tag LOCUS_08510 212407 211664 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_08510 213560 212559 gene locus_tag LOCUS_08520 213560 212559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 214182 214994 gene locus_tag LOCUS_08530 214182 214994 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_08530 215271 215609 gene locus_tag LOCUS_08540 215271 215609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 215582 216004 gene locus_tag LOCUS_08550 215582 216004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 219652 216038 gene locus_tag LOCUS_08560 219652 216038 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921394.1 protein_id gnl|my_center|LOCUS_08560 220521 219649 gene locus_tag LOCUS_08570 220521 219649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_08570 221999 220704 gene locus_tag LOCUS_08580 221999 220704 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_08580 222249 223520 gene locus_tag LOCUS_08590 gene tyrS 222249 223520 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_08590 223955 223539 gene locus_tag LOCUS_08600 223955 223539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 225207 224164 gene locus_tag LOCUS_08610 gene dinB 225207 224164 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513996.1 protein_id gnl|my_center|LOCUS_08610 225935 225282 gene locus_tag LOCUS_08620 225935 225282 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_08620 226779 225949 gene locus_tag LOCUS_08630 226779 225949 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_08630 227733 226786 gene locus_tag LOCUS_08640 227733 226786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 229064 227769 gene locus_tag LOCUS_08650 229064 227769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 230331 229072 gene locus_tag LOCUS_08660 230331 229072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 230870 230412 gene locus_tag LOCUS_08670 230870 230412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 232282 231128 gene locus_tag LOCUS_08680 232282 231128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 233684 232818 gene locus_tag LOCUS_08690 233684 232818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 233619 234284 gene locus_tag LOCUS_08700 233619 234284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 234290 234568 gene locus_tag LOCUS_08710 234290 234568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 234561 235607 gene locus_tag LOCUS_08720 234561 235607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494135.1 protein_id gnl|my_center|LOCUS_08720 236203 235745 gene locus_tag LOCUS_08730 236203 235745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 236360 237109 gene locus_tag LOCUS_08740 236360 237109 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_08740 237121 238917 gene locus_tag LOCUS_08750 237121 238917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 238990 239166 gene locus_tag LOCUS_08760 238990 239166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 239614 241167 gene locus_tag LOCUS_08770 239614 241167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 241435 242289 gene locus_tag LOCUS_08780 241435 242289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 242286 242777 gene locus_tag LOCUS_08790 242286 242777 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029031045.1 protein_id gnl|my_center|LOCUS_08790 244706 243597 gene locus_tag LOCUS_08800 244706 243597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 245536 244640 gene locus_tag LOCUS_08810 245536 244640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 246255 247499 gene locus_tag LOCUS_08820 246255 247499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 247432 249219 gene locus_tag LOCUS_08830 247432 249219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 249291 249527 gene locus_tag LOCUS_08840 249291 249527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 249511 249702 gene locus_tag LOCUS_08850 249511 249702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 249741 250274 gene locus_tag LOCUS_08860 249741 250274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 250337 250948 gene locus_tag LOCUS_08870 250337 250948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 250950 251537 gene locus_tag LOCUS_08880 250950 251537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 251706 252179 gene locus_tag LOCUS_08890 251706 252179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 252863 253018 gene locus_tag LOCUS_08900 252863 253018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08900 253434 253739 gene locus_tag LOCUS_08910 253434 253739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 253712 254269 gene locus_tag LOCUS_08920 253712 254269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 254338 255042 gene locus_tag LOCUS_08930 254338 255042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 255103 256341 gene locus_tag LOCUS_08940 255103 256341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 256307 257251 gene locus_tag LOCUS_08950 256307 257251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 257251 259536 gene locus_tag LOCUS_08960 257251 259536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 259563 260459 gene locus_tag LOCUS_08970 259563 260459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 260469 261161 gene locus_tag LOCUS_08980 260469 261161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08980 261242 262645 gene locus_tag LOCUS_08990 261242 262645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 262664 264490 gene locus_tag LOCUS_09000 262664 264490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 265442 264663 gene locus_tag LOCUS_09010 265442 264663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_09010 265917 265585 gene locus_tag LOCUS_09020 265917 265585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 266871 266041 gene locus_tag LOCUS_09030 266871 266041 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_09030 267827 266976 gene locus_tag LOCUS_09040 267827 266976 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_09040 268703 267948 gene locus_tag LOCUS_09050 268703 267948 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255254.1 protein_id gnl|my_center|LOCUS_09050 270095 268785 gene locus_tag LOCUS_09060 270095 268785 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_09060 270321 270629 gene locus_tag LOCUS_09070 270321 270629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 270524 270952 gene locus_tag LOCUS_09080 270524 270952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 271063 271314 gene locus_tag LOCUS_09090 271063 271314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 271829 272860 gene locus_tag LOCUS_09100 271829 272860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09100 274012 273287 gene locus_tag LOCUS_09110 274012 273287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 274272 275114 gene locus_tag LOCUS_09120 274272 275114 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262210.1 protein_id gnl|my_center|LOCUS_09120 276030 276368 gene locus_tag LOCUS_09130 276030 276368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 276352 276741 gene locus_tag LOCUS_09140 276352 276741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 276984 276697 gene locus_tag LOCUS_09150 276984 276697 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680083.1 protein_id gnl|my_center|LOCUS_09150 277433 278785 gene locus_tag LOCUS_09160 277433 278785 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_09160 279388 279765 gene locus_tag LOCUS_09170 279388 279765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09170 279729 280289 gene locus_tag LOCUS_09180 279729 280289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 280318 280665 gene locus_tag LOCUS_09190 280318 280665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 281012 281476 gene locus_tag LOCUS_09200 281012 281476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 281515 282669 gene locus_tag LOCUS_09210 281515 282669 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_09210 282666 282995 gene locus_tag LOCUS_09220 282666 282995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 283176 284129 gene locus_tag LOCUS_09230 283176 284129 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_09230 285647 284295 gene locus_tag LOCUS_09240 gene rseP 285647 284295 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_09240 286074 286502 gene locus_tag LOCUS_09250 286074 286502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 286794 286579 gene locus_tag LOCUS_09260 286794 286579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 286856 287761 gene locus_tag LOCUS_09270 286856 287761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 287823 288320 gene locus_tag LOCUS_09280 287823 288320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 288919 288365 gene locus_tag LOCUS_09290 288919 288365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 289012 289590 gene locus_tag LOCUS_09300 289012 289590 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_09300 289872 292766 gene locus_tag LOCUS_09310 289872 292766 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_09310 292787 294091 gene locus_tag LOCUS_09320 292787 294091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 294304 296427 gene locus_tag LOCUS_09330 294304 296427 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_09330 297575 296487 gene locus_tag LOCUS_09340 297575 296487 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_09340 298129 297590 gene locus_tag LOCUS_09350 298129 297590 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395060.1 protein_id gnl|my_center|LOCUS_09350 299213 298278 gene locus_tag LOCUS_09360 gene mdh 299213 298278 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_09360 299401 300942 gene locus_tag LOCUS_09370 299401 300942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 301092 302561 gene locus_tag LOCUS_09380 301092 302561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 302568 304124 gene locus_tag LOCUS_09390 302568 304124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 304518 305378 gene locus_tag LOCUS_09400 304518 305378 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703309.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 305375 308653 gene locus_tag LOCUS_09410 305375 308653 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_09410 308701 310347 gene locus_tag LOCUS_09420 308701 310347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 310548 310796 gene locus_tag LOCUS_09430 310548 310796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_09430 311584 310871 gene locus_tag LOCUS_09440 311584 310871 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_09440 313702 311660 gene locus_tag LOCUS_09450 313702 311660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 316553 313710 gene locus_tag LOCUS_09460 316553 313710 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_09460 316811 316656 gene locus_tag LOCUS_09470 316811 316656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 317963 317112 gene locus_tag LOCUS_09480 317963 317112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 319312 318026 gene locus_tag LOCUS_09490 319312 318026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 319557 319850 gene locus_tag LOCUS_09500 319557 319850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 319805 320641 gene locus_tag LOCUS_09510 319805 320641 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09510 320822 322117 gene locus_tag LOCUS_09520 320822 322117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 322257 323684 gene locus_tag LOCUS_09530 322257 323684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 324029 323730 gene locus_tag LOCUS_09540 324029 323730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 324083 324784 gene locus_tag LOCUS_09550 324083 324784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 325014 325598 gene locus_tag LOCUS_09560 325014 325598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 325798 326244 gene locus_tag LOCUS_09570 325798 326244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 327743 326241 gene locus_tag LOCUS_09580 gene asnS 327743 326241 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_09580 327908 328528 gene locus_tag LOCUS_09590 327908 328528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 328416 331031 gene locus_tag LOCUS_09600 328416 331031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 330977 331657 gene locus_tag LOCUS_09610 330977 331657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 331654 331962 gene locus_tag LOCUS_09620 331654 331962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 331907 332635 gene locus_tag LOCUS_09630 331907 332635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 335117 332745 gene locus_tag LOCUS_09640 335117 332745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 335472 335194 gene locus_tag LOCUS_09650 335472 335194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 335483 335788 gene locus_tag LOCUS_09660 335483 335788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 335963 337921 gene locus_tag LOCUS_09670 gene glgB 335963 337921 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_09670 339225 338065 gene locus_tag LOCUS_09680 339225 338065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 339759 339532 gene locus_tag LOCUS_09690 339759 339532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 339858 342263 gene locus_tag LOCUS_09700 339858 342263 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_09700 342268 342909 gene locus_tag LOCUS_09710 gene queE 342268 342909 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_09710 342933 343970 gene locus_tag LOCUS_09720 342933 343970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 344968 344447 gene locus_tag LOCUS_09730 344968 344447 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_09730 345411 347270 gene locus_tag LOCUS_09740 345411 347270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 347458 348930 gene locus_tag LOCUS_09750 347458 348930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 348958 350808 gene locus_tag LOCUS_09760 348958 350808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 351730 350891 gene locus_tag LOCUS_09770 gene tesB 351730 350891 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_09770 352584 351802 gene locus_tag LOCUS_09780 352584 351802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 353435 352884 gene locus_tag LOCUS_09790 353435 352884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09790 354180 353521 gene locus_tag LOCUS_09800 354180 353521 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839368.1 protein_id gnl|my_center|LOCUS_09800 354337 355455 gene locus_tag LOCUS_09810 354337 355455 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_09810 355554 355907 gene locus_tag LOCUS_09820 355554 355907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 356703 356149 gene locus_tag LOCUS_09830 356703 356149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 357413 359773 gene locus_tag LOCUS_09840 357413 359773 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_09840 359784 360947 gene locus_tag LOCUS_09850 359784 360947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 361214 362614 gene locus_tag LOCUS_09860 361214 362614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 364460 362817 gene locus_tag LOCUS_09870 364460 362817 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_09870 364665 365996 gene locus_tag LOCUS_09880 364665 365996 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_09880 366235 366963 gene locus_tag LOCUS_09890 gene fabG 366235 366963 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_09890 367060 368280 gene locus_tag LOCUS_09900 367060 368280 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_09900 368304 368549 gene locus_tag LOCUS_09910 368304 368549 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_09910 368562 369065 gene locus_tag LOCUS_09920 368562 369065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09920 369106 369489 gene locus_tag LOCUS_09930 369106 369489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09930 369527 369898 gene locus_tag LOCUS_09940 369527 369898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 369962 370444 gene locus_tag LOCUS_09950 369962 370444 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_09950 370441 371004 gene locus_tag LOCUS_09960 370441 371004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09960 371164 370925 gene locus_tag LOCUS_09970 371164 370925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 371232 371606 gene locus_tag LOCUS_09980 371232 371606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 371584 372219 gene locus_tag LOCUS_09990 371584 372219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_09990 372246 372512 gene locus_tag LOCUS_10000 372246 372512 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_10000 372896 373705 gene locus_tag LOCUS_10010 372896 373705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10010 373708 373926 gene locus_tag LOCUS_10020 373708 373926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 373947 374774 gene locus_tag LOCUS_10030 373947 374774 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 374767 375537 gene locus_tag LOCUS_10040 374767 375537 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_10040 375676 376845 gene locus_tag LOCUS_10050 375676 376845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 377090 377830 gene locus_tag LOCUS_10060 377090 377830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 378166 379317 gene locus_tag LOCUS_10070 378166 379317 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_10070 379568 380689 gene locus_tag LOCUS_10080 379568 380689 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_10080 380670 381191 gene locus_tag LOCUS_10090 380670 381191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 381360 381731 gene locus_tag LOCUS_10100 381360 381731 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_10100 381718 382938 gene locus_tag LOCUS_10110 381718 382938 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_10110 382935 383306 gene locus_tag LOCUS_10120 gene acpS 382935 383306 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_10120 383530 383790 gene locus_tag LOCUS_10130 383530 383790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 383787 385082 gene locus_tag LOCUS_10140 383787 385082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 385079 385828 gene locus_tag LOCUS_10150 385079 385828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 385906 386361 gene locus_tag LOCUS_10160 385906 386361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 386363 387844 gene locus_tag LOCUS_10170 386363 387844 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_10170 389110 387884 gene locus_tag LOCUS_10180 389110 387884 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766270.1 protein_id gnl|my_center|LOCUS_10180 389182 389841 gene locus_tag LOCUS_10190 389182 389841 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956994.1 protein_id gnl|my_center|LOCUS_10190 389926 391005 gene locus_tag LOCUS_10200 389926 391005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 391563 391054 gene locus_tag LOCUS_10210 391563 391054 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_10210 392525 391560 gene locus_tag LOCUS_10220 392525 391560 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_10220 393883 392726 gene locus_tag LOCUS_10230 393883 392726 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_10230 395322 393910 gene locus_tag LOCUS_10240 gene glmM 395322 393910 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_10240 395372 395617 gene locus_tag LOCUS_10250 395372 395617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 395614 395970 gene locus_tag LOCUS_10260 395614 395970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 396246 399032 gene locus_tag LOCUS_10270 396246 399032 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_10270 399058 400545 gene locus_tag LOCUS_10280 399058 400545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 400490 400657 gene locus_tag LOCUS_10290 400490 400657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 401480 400746 gene locus_tag LOCUS_10300 401480 400746 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_10300 401815 405282 gene locus_tag LOCUS_10310 401815 405282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 405296 405595 gene locus_tag LOCUS_10320 405296 405595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 405919 408813 gene locus_tag LOCUS_10330 405919 408813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 408833 409573 gene locus_tag LOCUS_10340 408833 409573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 409606 409947 gene locus_tag LOCUS_10350 409606 409947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 409991 412246 gene locus_tag LOCUS_10360 409991 412246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 412651 413592 gene locus_tag LOCUS_10370 412651 413592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 413586 414086 gene locus_tag LOCUS_10380 413586 414086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 414507 414064 gene locus_tag LOCUS_10390 414507 414064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 414700 414473 gene locus_tag LOCUS_10400 414700 414473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 414684 415538 gene locus_tag LOCUS_10410 414684 415538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 415723 416094 gene locus_tag LOCUS_10420 415723 416094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 416183 416590 gene locus_tag LOCUS_10430 416183 416590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 416889 417176 gene locus_tag LOCUS_10440 416889 417176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 417177 417803 gene locus_tag LOCUS_10450 417177 417803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 418114 418260 gene locus_tag LOCUS_10460 418114 418260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 418260 418838 gene locus_tag LOCUS_10470 418260 418838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 418951 419442 gene locus_tag LOCUS_10480 418951 419442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 419527 422907 gene locus_tag LOCUS_10490 419527 422907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 422877 423662 gene locus_tag LOCUS_10500 422877 423662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 423774 424088 gene locus_tag LOCUS_10510 423774 424088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 424061 424303 gene locus_tag LOCUS_10520 424061 424303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 424903 426108 gene locus_tag LOCUS_10530 424903 426108 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_10530 426227 427198 gene locus_tag LOCUS_10540 426227 427198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 427542 427772 gene locus_tag LOCUS_10550 427542 427772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 427829 429190 gene locus_tag LOCUS_10560 427829 429190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 429288 429935 gene locus_tag LOCUS_10570 429288 429935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 429977 431050 gene locus_tag LOCUS_10580 429977 431050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 431131 433650 gene locus_tag LOCUS_10590 431131 433650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 433781 434368 gene locus_tag LOCUS_10600 433781 434368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 434274 435011 gene locus_tag LOCUS_10610 434274 435011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 436083 436478 gene locus_tag LOCUS_10620 436083 436478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 436441 436767 gene locus_tag LOCUS_10630 436441 436767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence03 40 240 gene locus_tag LOCUS_10640 40 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 255 617 gene locus_tag LOCUS_10650 255 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10650 577 1029 gene locus_tag LOCUS_10660 577 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10660 1384 2391 gene locus_tag LOCUS_10670 1384 2391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_10670 3616 4974 gene locus_tag LOCUS_10680 3616 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5473 5051 gene locus_tag LOCUS_10690 5473 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6030 5569 gene locus_tag LOCUS_10700 6030 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6602 7192 gene locus_tag LOCUS_10710 gene can 6602 7192 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_10710 7315 7974 gene locus_tag LOCUS_10720 7315 7974 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_10720 8390 9403 gene locus_tag LOCUS_10730 8390 9403 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_10730 9605 10078 gene locus_tag LOCUS_10740 9605 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 10170 11495 gene locus_tag LOCUS_10750 10170 11495 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_10750 12004 14994 gene locus_tag LOCUS_10760 12004 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15635 15093 gene locus_tag LOCUS_10770 15635 15093 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064639.1 protein_id gnl|my_center|LOCUS_10770 15807 16130 gene locus_tag LOCUS_10780 15807 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10780 16237 17199 gene locus_tag LOCUS_10790 16237 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 18824 17226 gene locus_tag LOCUS_10800 gene muiA 18824 17226 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_10800 19340 19552 gene locus_tag LOCUS_10810 19340 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 19877 20326 gene locus_tag LOCUS_10820 19877 20326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 20349 21536 gene locus_tag LOCUS_10830 20349 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 22058 21636 gene locus_tag LOCUS_10840 22058 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 22179 22754 gene locus_tag LOCUS_10850 22179 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23703 22762 gene locus_tag LOCUS_10860 23703 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 25875 23725 gene locus_tag LOCUS_10870 gene scpA 25875 23725 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_10870 27268 25949 gene locus_tag LOCUS_10880 27268 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 28535 27273 gene locus_tag LOCUS_10890 28535 27273 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_10890 28963 28703 gene locus_tag LOCUS_10900 28963 28703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 29754 28972 gene locus_tag LOCUS_10910 29754 28972 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_10910 30572 29781 gene locus_tag LOCUS_10920 30572 29781 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_10920 30945 30574 gene locus_tag LOCUS_10930 30945 30574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 31741 31190 gene locus_tag LOCUS_10940 31741 31190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 32400 31960 gene locus_tag LOCUS_10950 32400 31960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 33672 32455 gene locus_tag LOCUS_10960 33672 32455 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_10960 34400 33816 gene locus_tag LOCUS_10970 34400 33816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 36669 34441 gene locus_tag LOCUS_10980 gene uvrA 36669 34441 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 37543 36806 gene locus_tag LOCUS_10990 37543 36806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10990 37807 37616 gene locus_tag LOCUS_11000 37807 37616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11000 38382 37819 gene locus_tag LOCUS_11010 gene pth 38382 37819 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_11010 38974 38405 gene locus_tag LOCUS_11020 38974 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 39394 39936 gene locus_tag LOCUS_11030 39394 39936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 39843 40289 gene locus_tag LOCUS_11040 39843 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 40225 43074 gene locus_tag LOCUS_11050 40225 43074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 43101 47144 gene locus_tag LOCUS_11060 43101 47144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 47301 48353 gene locus_tag LOCUS_11070 47301 48353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 48494 48970 gene locus_tag LOCUS_11080 gene greA 48494 48970 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_11080 48963 49370 gene locus_tag LOCUS_11090 48963 49370 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_11090 50029 49367 gene locus_tag LOCUS_11100 gene ruvC 50029 49367 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_11100 49982 50944 gene locus_tag LOCUS_11110 49982 50944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 51067 51849 gene locus_tag LOCUS_11120 51067 51849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 51857 52492 gene locus_tag LOCUS_11130 51857 52492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 52632 54002 gene locus_tag LOCUS_11140 52632 54002 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957619.1 protein_id gnl|my_center|LOCUS_11140 54374 54853 gene locus_tag LOCUS_11150 54374 54853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 56253 54850 gene locus_tag LOCUS_11160 56253 54850 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_11160 57101 56250 gene locus_tag LOCUS_11170 57101 56250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 59227 57230 gene locus_tag LOCUS_11180 59227 57230 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_11180 59478 60860 gene locus_tag LOCUS_11190 59478 60860 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_11190 61377 60919 gene locus_tag LOCUS_11200 gene mscL 61377 60919 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_11200 61535 62269 gene locus_tag LOCUS_11210 61535 62269 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_11210 62276 62887 gene locus_tag LOCUS_11220 62276 62887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11220 62921 63706 gene locus_tag LOCUS_11230 62921 63706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11230 63703 64047 gene locus_tag LOCUS_11240 63703 64047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 64122 66068 gene locus_tag LOCUS_11250 64122 66068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 66065 66421 gene locus_tag LOCUS_11260 66065 66421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 66495 66827 gene locus_tag LOCUS_11270 66495 66827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 66812 67321 gene locus_tag LOCUS_11280 66812 67321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11280 67963 67535 gene locus_tag LOCUS_11290 67963 67535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 68107 68841 gene locus_tag LOCUS_11300 68107 68841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 69103 68852 gene locus_tag LOCUS_11310 69103 68852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 69560 69405 gene locus_tag LOCUS_11320 69560 69405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11320 70720 69662 gene locus_tag LOCUS_11330 70720 69662 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11330 71465 70884 gene locus_tag LOCUS_11340 71465 70884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 71668 71420 gene locus_tag LOCUS_11350 71668 71420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11350 72036 71644 gene locus_tag LOCUS_11360 72036 71644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 73009 72050 gene locus_tag LOCUS_11370 73009 72050 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_11370 73980 73120 gene locus_tag LOCUS_11380 73980 73120 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_11380 74335 74063 gene locus_tag LOCUS_11390 74335 74063 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_11390 74863 75561 gene locus_tag LOCUS_11400 74863 75561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 75627 76457 gene locus_tag LOCUS_11410 75627 76457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11410 76475 77083 gene locus_tag LOCUS_11420 76475 77083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 77449 77195 gene locus_tag LOCUS_11430 77449 77195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 77993 78409 gene locus_tag LOCUS_11440 77993 78409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 78406 78549 gene locus_tag LOCUS_11450 78406 78549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 79574 78993 gene locus_tag LOCUS_11460 79574 78993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 79966 79583 gene locus_tag LOCUS_11470 79966 79583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 80222 80521 gene locus_tag LOCUS_11480 80222 80521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 80849 81493 gene locus_tag LOCUS_11490 80849 81493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 82157 81645 gene locus_tag LOCUS_11500 82157 81645 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_11500 82530 82285 gene locus_tag LOCUS_11510 82530 82285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 83327 82644 gene locus_tag LOCUS_11520 83327 82644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 84212 83472 gene locus_tag LOCUS_11530 84212 83472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 84379 84696 gene locus_tag LOCUS_11540 84379 84696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 86199 84811 gene locus_tag LOCUS_11550 86199 84811 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_11550 86487 86305 gene locus_tag LOCUS_11560 86487 86305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 87065 86484 gene locus_tag LOCUS_11570 87065 86484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11570 88127 87336 gene locus_tag LOCUS_11580 88127 87336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 89642 89334 gene locus_tag LOCUS_11590 89642 89334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 90452 90096 gene locus_tag LOCUS_11600 90452 90096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11600 90905 90468 gene locus_tag LOCUS_11610 90905 90468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 91813 91343 gene locus_tag LOCUS_11620 91813 91343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 92086 91904 gene locus_tag LOCUS_11630 92086 91904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 93891 93457 gene locus_tag LOCUS_11640 93891 93457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 95219 94146 gene locus_tag LOCUS_11650 95219 94146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 95662 95354 gene locus_tag LOCUS_11660 95662 95354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 96020 95667 gene locus_tag LOCUS_11670 96020 95667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 96235 96023 gene locus_tag LOCUS_11680 96235 96023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 97015 96656 gene locus_tag LOCUS_11690 97015 96656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 98004 97531 gene locus_tag LOCUS_11700 98004 97531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 98903 98355 gene locus_tag LOCUS_11710 98903 98355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 99281 99069 gene locus_tag LOCUS_11720 99281 99069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 99772 99209 gene locus_tag LOCUS_11730 99772 99209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 100518 99823 gene locus_tag LOCUS_11740 100518 99823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 101167 100733 gene locus_tag LOCUS_11750 101167 100733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 101745 101164 gene locus_tag LOCUS_11760 101745 101164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 102718 101735 gene locus_tag LOCUS_11770 102718 101735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 103226 102801 gene locus_tag LOCUS_11780 103226 102801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 104027 103233 gene locus_tag LOCUS_11790 104027 103233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 104842 104012 gene locus_tag LOCUS_11800 104842 104012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 104863 105138 gene locus_tag LOCUS_11810 104863 105138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 106554 105883 gene locus_tag LOCUS_11820 106554 105883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 107027 106647 gene locus_tag LOCUS_11830 107027 106647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 107290 107024 gene locus_tag LOCUS_11840 107290 107024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 107478 107257 gene locus_tag LOCUS_11850 107478 107257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 108266 107481 gene locus_tag LOCUS_11860 108266 107481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 109246 108614 gene locus_tag LOCUS_11870 109246 108614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 111050 109722 gene locus_tag LOCUS_11880 111050 109722 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_11880 112547 111450 gene locus_tag LOCUS_11890 112547 111450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 113010 112861 gene locus_tag LOCUS_11900 113010 112861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 113458 114735 gene locus_tag LOCUS_11910 113458 114735 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_11910 115130 115816 gene locus_tag LOCUS_11920 115130 115816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_11920 115840 118299 gene locus_tag LOCUS_11930 115840 118299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_11930 118856 118398 gene locus_tag LOCUS_11940 118856 118398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 119405 119896 gene locus_tag LOCUS_11950 119405 119896 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_11950 121745 120207 gene locus_tag LOCUS_11960 121745 120207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 122408 121869 gene locus_tag LOCUS_11970 gene hpt 122408 121869 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_11970 123817 122492 gene locus_tag LOCUS_11980 123817 122492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11980 125305 124679 gene locus_tag LOCUS_11990 125305 124679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 125749 125354 gene locus_tag LOCUS_12000 125749 125354 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_12000 125961 125746 gene locus_tag LOCUS_12010 125961 125746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 127463 126066 gene locus_tag LOCUS_12020 gene gpmI 127463 126066 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_12020 127582 127797 gene locus_tag LOCUS_12030 127582 127797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 127871 128251 gene locus_tag LOCUS_12040 127871 128251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 128781 128290 gene locus_tag LOCUS_12050 128781 128290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12050 129249 128806 gene locus_tag LOCUS_12060 129249 128806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 130040 129288 gene locus_tag LOCUS_12070 130040 129288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 131282 130182 gene locus_tag LOCUS_12080 131282 130182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 131543 132757 gene locus_tag LOCUS_12090 131543 132757 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921785.1 protein_id gnl|my_center|LOCUS_12090 132917 133198 gene locus_tag LOCUS_12100 132917 133198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12100 133195 133959 gene locus_tag LOCUS_12110 133195 133959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 135197 134022 gene locus_tag LOCUS_12120 135197 134022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12120 136057 135329 gene locus_tag LOCUS_12130 136057 135329 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966816.1 protein_id gnl|my_center|LOCUS_12130 136215 136736 gene locus_tag LOCUS_12140 136215 136736 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203275.1 protein_id gnl|my_center|LOCUS_12140 136746 137363 gene locus_tag LOCUS_12150 136746 137363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 137375 137587 gene locus_tag LOCUS_12160 137375 137587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 137551 138513 gene locus_tag LOCUS_12170 137551 138513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 138578 139183 gene locus_tag LOCUS_12180 138578 139183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 139196 140341 gene locus_tag LOCUS_12190 139196 140341 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_12190 140542 141150 gene locus_tag LOCUS_12200 140542 141150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12200 141252 141635 gene locus_tag LOCUS_12210 141252 141635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 142115 141654 gene locus_tag LOCUS_12220 142115 141654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_12220 142760 142224 gene locus_tag LOCUS_12230 142760 142224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 143339 142812 gene locus_tag LOCUS_12240 143339 142812 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_12240 144582 143401 gene locus_tag LOCUS_12250 144582 143401 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_12250 144951 145910 gene locus_tag LOCUS_12260 144951 145910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 146217 148787 gene locus_tag LOCUS_12270 146217 148787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 148872 149519 gene locus_tag LOCUS_12280 148872 149519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 149489 149926 gene locus_tag LOCUS_12290 149489 149926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 151580 150213 gene locus_tag LOCUS_12300 151580 150213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12300 154834 151481 gene locus_tag LOCUS_12310 154834 151481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12310 155097 155900 gene locus_tag LOCUS_12320 155097 155900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 156008 157138 gene locus_tag LOCUS_12330 156008 157138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 157609 158712 gene locus_tag LOCUS_12340 157609 158712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12340 158612 159208 gene locus_tag LOCUS_12350 158612 159208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12350 159240 159953 gene locus_tag LOCUS_12360 159240 159953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 161344 160034 gene locus_tag LOCUS_12370 161344 160034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 162163 161384 gene locus_tag LOCUS_12380 162163 161384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12380 162606 162397 gene locus_tag LOCUS_12390 162606 162397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 162824 163786 gene locus_tag LOCUS_12400 162824 163786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 164066 164782 gene locus_tag LOCUS_12410 164066 164782 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_12410 164763 165119 gene locus_tag LOCUS_12420 164763 165119 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_12420 165133 166329 gene locus_tag LOCUS_12430 gene coaBC 165133 166329 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_12430 166348 167262 gene locus_tag LOCUS_12440 166348 167262 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_12440 167873 167346 gene locus_tag LOCUS_12450 167873 167346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 168225 167833 gene locus_tag LOCUS_12460 168225 167833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 168731 168345 gene locus_tag LOCUS_12470 168731 168345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 169523 170410 gene locus_tag LOCUS_12480 169523 170410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 171008 170565 gene locus_tag LOCUS_12490 171008 170565 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_12490 171218 172456 gene locus_tag LOCUS_12500 gene guaB 171218 172456 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12500 172466 172825 gene locus_tag LOCUS_12510 172466 172825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 173693 174259 gene locus_tag LOCUS_12520 173693 174259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 174919 174281 gene locus_tag LOCUS_12530 174919 174281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12530 175198 175377 gene locus_tag LOCUS_12540 175198 175377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 175748 175323 gene locus_tag LOCUS_12550 175748 175323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 176749 176186 gene locus_tag LOCUS_12560 176749 176186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 178994 176667 gene locus_tag LOCUS_12570 178994 176667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 179702 179103 gene locus_tag LOCUS_12580 179702 179103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 179821 179681 gene locus_tag LOCUS_12590 179821 179681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 181025 179943 gene locus_tag LOCUS_12600 181025 179943 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_12600 181065 181745 gene locus_tag LOCUS_12610 181065 181745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 181942 184149 gene locus_tag LOCUS_12620 gene carB 181942 184149 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 184244 184753 gene locus_tag LOCUS_12630 184244 184753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 184896 186674 gene locus_tag LOCUS_12640 184896 186674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 186797 188257 gene locus_tag LOCUS_12650 186797 188257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 188384 188602 gene locus_tag LOCUS_12660 188384 188602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 189618 188581 gene locus_tag LOCUS_12670 189618 188581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 189924 189631 gene locus_tag LOCUS_12680 189924 189631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 190600 189905 gene locus_tag LOCUS_12690 190600 189905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 191130 190792 gene locus_tag LOCUS_12700 191130 190792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 191694 191524 gene locus_tag LOCUS_12710 191694 191524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 192004 193335 gene locus_tag LOCUS_12720 192004 193335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 193363 195237 gene locus_tag LOCUS_12730 193363 195237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 195427 195756 gene locus_tag LOCUS_12740 195427 195756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 195753 196811 gene locus_tag LOCUS_12750 195753 196811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 196844 197071 gene locus_tag LOCUS_12760 196844 197071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 197068 197352 gene locus_tag LOCUS_12770 197068 197352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 197415 197618 gene locus_tag LOCUS_12780 197415 197618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 198020 198919 gene locus_tag LOCUS_12790 198020 198919 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_12790 199395 199736 gene locus_tag LOCUS_12800 199395 199736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12800 202020 202703 gene locus_tag LOCUS_12810 202020 202703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 203754 203419 gene locus_tag LOCUS_12820 203754 203419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 204400 205557 gene locus_tag LOCUS_12830 204400 205557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 205455 206189 gene locus_tag LOCUS_12840 205455 206189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12840 206147 206332 gene locus_tag LOCUS_12850 206147 206332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 206374 207198 gene locus_tag LOCUS_12860 206374 207198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 209628 207358 gene locus_tag LOCUS_12870 209628 207358 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_12870 210186 209686 gene locus_tag LOCUS_12880 210186 209686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 210440 211078 gene locus_tag LOCUS_12890 210440 211078 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_12890 211114 212034 gene locus_tag LOCUS_12900 211114 212034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12900 212128 213126 gene locus_tag LOCUS_12910 212128 213126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12910 213150 213905 gene locus_tag LOCUS_12920 213150 213905 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_12920 214864 214073 gene locus_tag LOCUS_12930 214864 214073 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_12930 214978 216183 gene locus_tag LOCUS_12940 214978 216183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 218260 216263 gene locus_tag LOCUS_12950 218260 216263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 219057 218515 gene locus_tag LOCUS_12960 219057 218515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 221459 218991 gene locus_tag LOCUS_12970 221459 218991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12970 221667 222572 gene locus_tag LOCUS_12980 221667 222572 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_12980 222624 223061 gene locus_tag LOCUS_12990 222624 223061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_12990 224007 223096 gene locus_tag LOCUS_13000 224007 223096 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 protein_id gnl|my_center|LOCUS_13000 224699 224106 gene locus_tag LOCUS_13010 224699 224106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 225149 226381 gene locus_tag LOCUS_13020 225149 226381 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_13020 226405 227178 gene locus_tag LOCUS_13030 226405 227178 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_13030 227263 227925 gene locus_tag LOCUS_13040 227263 227925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 228012 229397 gene locus_tag LOCUS_13050 228012 229397 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_13050 230072 229416 gene locus_tag LOCUS_13060 230072 229416 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_13060 230830 230189 gene locus_tag LOCUS_13070 230830 230189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 231629 231216 gene locus_tag LOCUS_13080 231629 231216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 232259 231687 gene locus_tag LOCUS_13090 232259 231687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 232409 232714 gene locus_tag LOCUS_13100 232409 232714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 232948 233032 gene locus_tag LOCUS_t00070 232948 233032 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 236947 236363 gene locus_tag LOCUS_13110 236947 236363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 237162 236950 gene locus_tag LOCUS_13120 237162 236950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 237484 237651 gene locus_tag LOCUS_13130 237484 237651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 239093 238137 gene locus_tag LOCUS_13140 239093 238137 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_13140 240106 239195 gene locus_tag LOCUS_13150 240106 239195 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_13150 241484 240510 gene locus_tag LOCUS_13160 241484 240510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220886.1 protein_id gnl|my_center|LOCUS_13160 242614 241607 gene locus_tag LOCUS_13170 242614 241607 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_13170 242940 242611 gene locus_tag LOCUS_13180 242940 242611 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_13180 243169 242960 gene locus_tag LOCUS_13190 243169 242960 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784908.1 protein_id gnl|my_center|LOCUS_13190 244292 243336 gene locus_tag LOCUS_13200 244292 243336 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224940.1 protein_id gnl|my_center|LOCUS_13200 245929 244673 gene locus_tag LOCUS_13210 245929 244673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 246245 245937 gene locus_tag LOCUS_13220 gene kaiB 246245 245937 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_13220 246546 246256 gene locus_tag LOCUS_13230 246546 246256 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_13230 247208 246552 gene locus_tag LOCUS_13240 247208 246552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13240 247983 247093 gene locus_tag LOCUS_13250 247983 247093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 248347 249249 gene locus_tag LOCUS_13260 248347 249249 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_13260 249510 249322 gene locus_tag LOCUS_13270 249510 249322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 250289 249507 gene locus_tag LOCUS_13280 250289 249507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13280 250429 252153 gene locus_tag LOCUS_13290 250429 252153 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_13290 252308 252901 gene locus_tag LOCUS_13300 gene lacC 252308 252901 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_13300 253042 253845 gene locus_tag LOCUS_13310 253042 253845 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_13310 254045 255280 gene locus_tag LOCUS_13320 254045 255280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 255240 255437 gene locus_tag LOCUS_13330 255240 255437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 255451 256539 gene locus_tag LOCUS_13340 255451 256539 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839729.1 protein_id gnl|my_center|LOCUS_13340 256829 258307 gene locus_tag LOCUS_13350 256829 258307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 259873 258317 gene locus_tag LOCUS_13360 259873 258317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 260829 259765 gene locus_tag LOCUS_13370 260829 259765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13370 261094 263193 gene locus_tag LOCUS_13380 261094 263193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_13380 263283 265193 gene locus_tag LOCUS_13390 263283 265193 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_13390 265247 266083 gene locus_tag LOCUS_13400 265247 266083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 266089 266334 gene locus_tag LOCUS_13410 266089 266334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 267502 266528 gene locus_tag LOCUS_13420 267502 266528 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_13420 267708 269306 gene locus_tag LOCUS_13430 267708 269306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13430 269192 269914 gene locus_tag LOCUS_13440 269192 269914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13440 269890 270726 gene locus_tag LOCUS_13450 269890 270726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13450 270875 272008 gene locus_tag LOCUS_13460 270875 272008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13460 272088 272303 gene locus_tag LOCUS_13470 272088 272303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13470 272424 273116 gene locus_tag LOCUS_13480 272424 273116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 273217 273798 gene locus_tag LOCUS_13490 273217 273798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 273951 275438 gene locus_tag LOCUS_13500 273951 275438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 275521 279564 gene locus_tag LOCUS_13510 275521 279564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 279655 280704 gene locus_tag LOCUS_13520 279655 280704 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 protein_id gnl|my_center|LOCUS_13520 281811 280711 gene locus_tag LOCUS_13530 gene ugpC 281811 280711 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228630.1 protein_id gnl|my_center|LOCUS_13530 283150 281885 gene locus_tag LOCUS_13540 283150 281885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210193.1 protein_id gnl|my_center|LOCUS_13540 284070 283147 gene locus_tag LOCUS_13550 284070 283147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 284402 283959 gene locus_tag LOCUS_13560 284402 283959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 285242 284418 gene locus_tag LOCUS_13570 285242 284418 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_13570 286133 285282 gene locus_tag LOCUS_13580 286133 285282 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_13580 287502 286171 gene locus_tag LOCUS_13590 287502 286171 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804138.1 protein_id gnl|my_center|LOCUS_13590 288717 287518 gene locus_tag LOCUS_13600 288717 287518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 289455 288775 gene locus_tag LOCUS_13610 289455 288775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 289490 289906 gene locus_tag LOCUS_13620 289490 289906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 289970 290893 gene locus_tag LOCUS_13630 gene xerD 289970 290893 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_13630 291920 290970 gene locus_tag LOCUS_13640 gene prfA 291920 290970 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103430.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13640 293100 292261 gene locus_tag LOCUS_13650 293100 292261 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_13650 293352 296501 gene locus_tag LOCUS_13660 293352 296501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_13660 296452 296607 gene locus_tag LOCUS_13670 296452 296607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 296698 298332 gene locus_tag LOCUS_13680 296698 298332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 298329 299174 gene locus_tag LOCUS_13690 298329 299174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13690 299334 300104 gene locus_tag LOCUS_13700 299334 300104 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_13700 300207 300449 gene locus_tag LOCUS_13710 300207 300449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 300824 301855 gene locus_tag LOCUS_13720 300824 301855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 301893 302120 gene locus_tag LOCUS_13730 301893 302120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 302551 302904 gene locus_tag LOCUS_13740 302551 302904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 303021 303686 gene locus_tag LOCUS_13750 303021 303686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13750 303662 304162 gene locus_tag LOCUS_13760 303662 304162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 306104 306295 gene locus_tag LOCUS_13770 306104 306295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 308213 306366 gene locus_tag LOCUS_13780 308213 306366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 314982 308296 gene locus_tag LOCUS_13790 314982 308296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 315981 316712 gene locus_tag LOCUS_13800 315981 316712 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_13800 317791 316760 gene locus_tag LOCUS_13810 317791 316760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 319086 317749 gene locus_tag LOCUS_13820 319086 317749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 319868 319101 gene locus_tag LOCUS_13830 319868 319101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 320547 319888 gene locus_tag LOCUS_13840 320547 319888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 320730 323870 gene locus_tag LOCUS_13850 320730 323870 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120701253.1 protein_id gnl|my_center|LOCUS_13850 325404 323962 gene locus_tag LOCUS_13860 325404 323962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 325621 328731 gene locus_tag LOCUS_13870 325621 328731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 328771 329385 gene locus_tag LOCUS_13880 328771 329385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 329582 331036 gene locus_tag LOCUS_13890 329582 331036 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_13890 331093 331587 gene locus_tag LOCUS_13900 331093 331587 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_13900 332119 331706 gene locus_tag LOCUS_13910 332119 331706 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_13910 332739 332143 gene locus_tag LOCUS_13920 332739 332143 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_13920 332927 333835 gene locus_tag LOCUS_13930 332927 333835 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13930 333807 334064 gene locus_tag LOCUS_13940 333807 334064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 335773 334067 gene locus_tag LOCUS_13950 gene recJ 335773 334067 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence04 <1 596 gene locus_tag LOCUS_13960 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:S41 family peptidase 1284 796 gene locus_tag LOCUS_13970 1284 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5336 1647 gene locus_tag LOCUS_13980 5336 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5610 6299 gene locus_tag LOCUS_13990 5610 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13990 6702 9071 gene locus_tag LOCUS_14000 6702 9071 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_14000 9276 9022 gene locus_tag LOCUS_14010 9276 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 9743 9336 gene locus_tag LOCUS_14020 gene mce 9743 9336 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_14020 10746 10024 gene locus_tag LOCUS_14030 10746 10024 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_14030 11124 10786 gene locus_tag LOCUS_14040 11124 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14040 12098 11136 gene locus_tag LOCUS_14050 12098 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 12298 12095 gene locus_tag LOCUS_14060 12298 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 13429 12515 gene locus_tag LOCUS_14070 13429 12515 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_14070 13729 13466 gene locus_tag LOCUS_14080 13729 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 14110 13823 gene locus_tag LOCUS_14090 14110 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 14342 14623 gene locus_tag LOCUS_14100 14342 14623 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_14100 14638 16287 gene locus_tag LOCUS_14110 gene groL 14638 16287 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_14110 17211 16330 gene locus_tag LOCUS_14120 17211 16330 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_14120 18002 17367 gene locus_tag LOCUS_14130 18002 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 18513 18064 gene locus_tag LOCUS_14140 18513 18064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 18855 18778 gene locus_tag LOCUS_t00080 18855 18778 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19167 20642 gene locus_tag LOCUS_14150 19167 20642 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_14150 20762 22006 gene locus_tag LOCUS_14160 20762 22006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 21982 22521 gene locus_tag LOCUS_14170 21982 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 22525 23676 gene locus_tag LOCUS_14180 22525 23676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 24430 23783 gene locus_tag LOCUS_14190 24430 23783 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_14190 25261 24482 gene locus_tag LOCUS_14200 25261 24482 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_14200 26145 25288 gene locus_tag LOCUS_14210 26145 25288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 26314 26898 gene locus_tag LOCUS_14220 26314 26898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 26951 27616 gene locus_tag LOCUS_14230 26951 27616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14230 27642 28328 gene locus_tag LOCUS_14240 27642 28328 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_14240 28404 29012 gene locus_tag LOCUS_14250 28404 29012 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_14250 29552 29028 gene locus_tag LOCUS_14260 29552 29028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 29817 30788 gene locus_tag LOCUS_14270 29817 30788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 31296 30856 gene locus_tag LOCUS_14280 31296 30856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 32489 31293 gene locus_tag LOCUS_14290 32489 31293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 33709 32726 gene locus_tag LOCUS_14300 33709 32726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 36414 33754 gene locus_tag LOCUS_14310 gene fdhF 36414 33754 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_14310 37461 36505 gene locus_tag LOCUS_14320 37461 36505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14320 38198 37461 gene locus_tag LOCUS_14330 38198 37461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14330 38502 39620 gene locus_tag LOCUS_14340 38502 39620 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_14340 39623 39901 gene locus_tag LOCUS_14350 39623 39901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 39814 40548 gene locus_tag LOCUS_14360 39814 40548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 40735 41691 gene locus_tag LOCUS_14370 40735 41691 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 protein_id gnl|my_center|LOCUS_14370 41779 42246 gene locus_tag LOCUS_14380 41779 42246 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_14380 43536 42319 gene locus_tag LOCUS_14390 43536 42319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_14390 44107 44514 gene locus_tag LOCUS_14400 44107 44514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 44536 46404 gene locus_tag LOCUS_14410 gene cysN 44536 46404 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403357.1 protein_id gnl|my_center|LOCUS_14410 46560 47330 gene locus_tag LOCUS_14420 46560 47330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 47504 47968 gene locus_tag LOCUS_14430 47504 47968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 48006 48428 gene locus_tag LOCUS_14440 48006 48428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 48541 50610 gene locus_tag LOCUS_14450 48541 50610 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14450 50559 51176 gene locus_tag LOCUS_14460 50559 51176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14460 51173 52591 gene locus_tag LOCUS_14470 51173 52591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14470 52476 52739 gene locus_tag LOCUS_14480 52476 52739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 52715 53362 gene locus_tag LOCUS_14490 52715 53362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 53466 54941 gene locus_tag LOCUS_14500 gene crtI 53466 54941 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_14500 54963 55799 gene locus_tag LOCUS_14510 54963 55799 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_14510 55799 56644 gene locus_tag LOCUS_14520 55799 56644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 57456 56641 gene locus_tag LOCUS_14530 57456 56641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 58649 57486 gene locus_tag LOCUS_14540 58649 57486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14540 59111 58881 gene locus_tag LOCUS_14550 59111 58881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14550 59445 59191 gene locus_tag LOCUS_14560 59445 59191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 59893 59462 gene locus_tag LOCUS_14570 gene arr 59893 59462 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_14570 60214 59996 gene locus_tag LOCUS_14580 60214 59996 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_14580 60745 60218 gene locus_tag LOCUS_14590 60745 60218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 61466 62985 gene locus_tag LOCUS_r00010 61466 62985 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 63104 63179 gene locus_tag LOCUS_t00090 63104 63179 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 63224 63298 gene locus_tag LOCUS_t00100 63224 63298 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 63476 66358 gene locus_tag LOCUS_r00020 63476 66358 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 66480 66588 gene locus_tag LOCUS_r00030 66480 66588 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 66734 67033 gene locus_tag LOCUS_14600 66734 67033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 67815 67204 gene locus_tag LOCUS_14610 67815 67204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 69275 67824 gene locus_tag LOCUS_14620 69275 67824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14620 69417 70805 gene locus_tag LOCUS_14630 69417 70805 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975424.1 protein_id gnl|my_center|LOCUS_14630 70853 71548 gene locus_tag LOCUS_14640 70853 71548 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_14640 71545 72201 gene locus_tag LOCUS_14650 71545 72201 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_14650 72271 73971 gene locus_tag LOCUS_14660 72271 73971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 73884 75083 gene locus_tag LOCUS_14670 73884 75083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14670 75188 76714 gene locus_tag LOCUS_14680 75188 76714 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_14680 76796 77797 gene locus_tag LOCUS_14690 76796 77797 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_14690 77923 78312 gene locus_tag LOCUS_14700 77923 78312 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_14700 78348 79655 gene locus_tag LOCUS_14710 78348 79655 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_14710 80659 79724 gene locus_tag LOCUS_14720 80659 79724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 80854 81039 gene locus_tag LOCUS_14730 80854 81039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 81937 81470 gene locus_tag LOCUS_14740 81937 81470 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925817.1 protein_id gnl|my_center|LOCUS_14740 83266 81980 gene locus_tag LOCUS_14750 83266 81980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 84960 83482 gene locus_tag LOCUS_14760 84960 83482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 85462 85106 gene locus_tag LOCUS_14770 85462 85106 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460856.1 protein_id gnl|my_center|LOCUS_14770 85728 87128 gene locus_tag LOCUS_14780 85728 87128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 87115 87636 gene locus_tag LOCUS_14790 87115 87636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 87708 88364 gene locus_tag LOCUS_14800 87708 88364 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963146.1 protein_id gnl|my_center|LOCUS_14800 88396 88911 gene locus_tag LOCUS_14810 88396 88911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 88922 89443 gene locus_tag LOCUS_14820 88922 89443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14820 89517 90632 gene locus_tag LOCUS_14830 89517 90632 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_14830 91306 90710 gene locus_tag LOCUS_14840 91306 90710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 93006 91432 gene locus_tag LOCUS_14850 93006 91432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 93377 93003 gene locus_tag LOCUS_14860 93377 93003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 94999 93374 gene locus_tag LOCUS_14870 94999 93374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 95168 95668 gene locus_tag LOCUS_14880 95168 95668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 96222 96800 gene locus_tag LOCUS_14890 96222 96800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14890 96823 98838 gene locus_tag LOCUS_14900 96823 98838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 98844 99548 gene locus_tag LOCUS_14910 98844 99548 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_14910 99631 100284 gene locus_tag LOCUS_14920 99631 100284 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_14920 103005 100324 gene locus_tag LOCUS_14930 103005 100324 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530065.1 protein_id gnl|my_center|LOCUS_14930 105770 103224 gene locus_tag LOCUS_14940 105770 103224 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_14940 106590 105829 gene locus_tag LOCUS_14950 106590 105829 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_14950 106742 108700 gene locus_tag LOCUS_14960 106742 108700 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_14960 108836 110398 gene locus_tag LOCUS_14970 108836 110398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 111384 110407 gene locus_tag LOCUS_14980 111384 110407 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836428.1 protein_id gnl|my_center|LOCUS_14980 111548 112816 gene locus_tag LOCUS_14990 111548 112816 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_14990 114813 112834 gene locus_tag LOCUS_15000 114813 112834 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_15000 114976 114892 gene locus_tag LOCUS_t00110 114976 114892 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 116241 115216 gene locus_tag LOCUS_15010 116241 115216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 116765 116238 gene locus_tag LOCUS_15020 116765 116238 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_15020 119399 116772 gene locus_tag LOCUS_15030 119399 116772 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166522727.1 protein_id gnl|my_center|LOCUS_15030 120797 119487 gene locus_tag LOCUS_15040 120797 119487 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_15040 121113 120868 gene locus_tag LOCUS_15050 121113 120868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 121727 121092 gene locus_tag LOCUS_15060 121727 121092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 122238 121729 gene locus_tag LOCUS_15070 122238 121729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15070 122567 122259 gene locus_tag LOCUS_15080 122567 122259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 122926 124107 gene locus_tag LOCUS_15090 122926 124107 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213326.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15090 124440 124655 gene locus_tag LOCUS_15100 124440 124655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 124981 124652 gene locus_tag LOCUS_15110 124981 124652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 125739 124972 gene locus_tag LOCUS_15120 125739 124972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 125884 126654 gene locus_tag LOCUS_15130 125884 126654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_15130 126717 128240 gene locus_tag LOCUS_15140 126717 128240 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15140 128227 128397 gene locus_tag LOCUS_15150 128227 128397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 128428 129861 gene locus_tag LOCUS_15160 128428 129861 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_15160 129911 130207 gene locus_tag LOCUS_15170 129911 130207 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_15170 130286 131296 gene locus_tag LOCUS_15180 130286 131296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 131296 131616 gene locus_tag LOCUS_15190 131296 131616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 132712 131594 gene locus_tag LOCUS_15200 132712 131594 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_15200 133300 133980 gene locus_tag LOCUS_15210 133300 133980 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_15210 133992 134444 gene locus_tag LOCUS_15220 gene dtd 133992 134444 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_15220 134441 134782 gene locus_tag LOCUS_15230 134441 134782 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_15230 134785 135285 gene locus_tag LOCUS_15240 134785 135285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 136571 135330 gene locus_tag LOCUS_15250 136571 135330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15250 138490 137030 gene locus_tag LOCUS_15260 138490 137030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 138738 141323 gene locus_tag LOCUS_15270 138738 141323 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_15270 141386 142684 gene locus_tag LOCUS_15280 141386 142684 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_15280 143448 142756 gene locus_tag LOCUS_15290 143448 142756 CDS product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_15290 143651 146992 gene locus_tag LOCUS_15300 143651 146992 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_15300 147122 147532 gene locus_tag LOCUS_15310 147122 147532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 147536 147964 gene locus_tag LOCUS_15320 gene ybeY 147536 147964 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_15320 148035 148949 gene locus_tag LOCUS_15330 148035 148949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 148946 150490 gene locus_tag LOCUS_15340 148946 150490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 150497 150964 gene locus_tag LOCUS_15350 150497 150964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 150958 151434 gene locus_tag LOCUS_15360 150958 151434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15360 151437 152759 gene locus_tag LOCUS_15370 gene thrC 151437 152759 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_15370 152803 153891 gene locus_tag LOCUS_15380 gene mvaD 152803 153891 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_15380 153981 155228 gene locus_tag LOCUS_15390 153981 155228 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_15390 155376 156536 gene locus_tag LOCUS_15400 155376 156536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 157104 158132 gene locus_tag LOCUS_15410 157104 158132 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986871.1 protein_id gnl|my_center|LOCUS_15410 158474 159283 gene locus_tag LOCUS_15420 158474 159283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 159387 159977 gene locus_tag LOCUS_15430 gene deoC 159387 159977 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15430 160046 160447 gene locus_tag LOCUS_15440 160046 160447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 160465 161868 gene locus_tag LOCUS_15450 gene rodA 160465 161868 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_15450 161888 162937 gene locus_tag LOCUS_15460 gene tgt 161888 162937 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_15460 163018 163893 gene locus_tag LOCUS_15470 163018 163893 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_15470 164165 164713 gene locus_tag LOCUS_15480 164165 164713 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_15480 164771 165901 gene locus_tag LOCUS_15490 gene mutY 164771 165901 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_15490 165926 166354 gene locus_tag LOCUS_15500 gene ssb 165926 166354 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137264126.1 protein_id gnl|my_center|LOCUS_15500 166351 167385 gene locus_tag LOCUS_15510 166351 167385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15510 167386 167826 gene locus_tag LOCUS_15520 167386 167826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15520 167836 168462 gene locus_tag LOCUS_15530 gene gldD 167836 168462 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_15530 168487 168744 gene locus_tag LOCUS_15540 168487 168744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 169200 169484 gene locus_tag LOCUS_15550 169200 169484 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_15550 169563 169856 gene locus_tag LOCUS_15560 169563 169856 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870728.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 170125 170940 gene locus_tag LOCUS_15570 170125 170940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 172005 170995 gene locus_tag LOCUS_15580 172005 170995 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_15580 173209 172133 gene locus_tag LOCUS_15590 gene recA 173209 172133 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_15590 173592 175046 gene locus_tag LOCUS_15600 173592 175046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 175188 179159 gene locus_tag LOCUS_15610 175188 179159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 179087 181315 gene locus_tag LOCUS_15620 179087 181315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15620 181629 181393 gene locus_tag LOCUS_15630 181629 181393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 182177 181743 gene locus_tag LOCUS_15640 182177 181743 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_15640 182611 182210 gene locus_tag LOCUS_15650 182611 182210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 182611 183207 gene locus_tag LOCUS_15660 182611 183207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 183278 184870 gene locus_tag LOCUS_15670 183278 184870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 186025 184883 gene locus_tag LOCUS_15680 186025 184883 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_15680 186610 186041 gene locus_tag LOCUS_15690 186610 186041 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_15690 187185 186676 gene locus_tag LOCUS_15700 187185 186676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 188438 187404 gene locus_tag LOCUS_15710 188438 187404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 188725 188519 gene locus_tag LOCUS_15720 188725 188519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 188927 189682 gene locus_tag LOCUS_15730 188927 189682 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_15730 190953 189796 gene locus_tag LOCUS_15740 190953 189796 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_15740 191329 192066 gene locus_tag LOCUS_15750 191329 192066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 192111 192638 gene locus_tag LOCUS_15760 192111 192638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 192640 193803 gene locus_tag LOCUS_15770 192640 193803 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_15770 194593 193760 gene locus_tag LOCUS_15780 194593 193760 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_15780 195249 194608 gene locus_tag LOCUS_15790 195249 194608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 195453 196979 gene locus_tag LOCUS_15800 gene cysS 195453 196979 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_15800 198090 196987 gene locus_tag LOCUS_15810 198090 196987 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_15810 198233 199504 gene locus_tag LOCUS_15820 gene purD 198233 199504 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_15820 199672 200178 gene locus_tag LOCUS_15830 199672 200178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15830 200186 200998 gene locus_tag LOCUS_15840 200186 200998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15840 201034 201972 gene locus_tag LOCUS_15850 201034 201972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15850 202568 201993 gene locus_tag LOCUS_15860 202568 201993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 202798 203466 gene locus_tag LOCUS_15870 202798 203466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 203630 204658 gene locus_tag LOCUS_15880 203630 204658 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_15880 205928 206923 gene locus_tag LOCUS_15890 205928 206923 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_15890 206938 207810 gene locus_tag LOCUS_15900 206938 207810 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_15900 207807 208757 gene locus_tag LOCUS_15910 207807 208757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_15910 208754 209764 gene locus_tag LOCUS_15920 208754 209764 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_15920 209791 210807 gene locus_tag LOCUS_15930 209791 210807 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_15930 211268 210774 gene locus_tag LOCUS_15940 gene folA 211268 210774 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_15940 212113 211280 gene locus_tag LOCUS_15950 212113 211280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15950 213161 212061 gene locus_tag LOCUS_15960 213161 212061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15960 213703 213179 gene locus_tag LOCUS_15970 gene mreD 213703 213179 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_15970 214523 213693 gene locus_tag LOCUS_15980 214523 213693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 215571 214540 gene locus_tag LOCUS_15990 215571 214540 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_15990 217004 215739 gene locus_tag LOCUS_16000 217004 215739 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_16000 217117 218232 gene locus_tag LOCUS_16010 gene dnaN 217117 218232 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_16010 218316 218765 gene locus_tag LOCUS_16020 218316 218765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 218770 219360 gene locus_tag LOCUS_16030 gene nadD 218770 219360 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_16030 220813 219389 gene locus_tag LOCUS_16040 220813 219389 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_16040 221789 220905 gene locus_tag LOCUS_16050 221789 220905 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_16050 222336 221896 gene locus_tag LOCUS_16060 222336 221896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 222962 222504 gene locus_tag LOCUS_16070 222962 222504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 223559 224665 gene locus_tag LOCUS_16080 223559 224665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16080 225388 224669 gene locus_tag LOCUS_16090 225388 224669 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_16090 226628 225672 gene locus_tag LOCUS_16100 226628 225672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 227115 226870 gene locus_tag LOCUS_16110 227115 226870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 227337 227843 gene locus_tag LOCUS_16120 227337 227843 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_16120 227869 229179 gene locus_tag LOCUS_16130 227869 229179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 229320 230882 gene locus_tag LOCUS_16140 229320 230882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 231226 231657 gene locus_tag LOCUS_16150 231226 231657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16150 231892 232392 gene locus_tag LOCUS_16160 231892 232392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 232441 233103 gene locus_tag LOCUS_16170 232441 233103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 233466 233164 gene locus_tag LOCUS_16180 233466 233164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 235824 233644 gene locus_tag LOCUS_16190 235824 233644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 237108 236143 gene locus_tag LOCUS_16200 237108 236143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 239947 237128 gene locus_tag LOCUS_16210 239947 237128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 240306 240028 gene locus_tag LOCUS_16220 240306 240028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 243316 240311 gene locus_tag LOCUS_16230 243316 240311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 244584 243433 gene locus_tag LOCUS_16240 244584 243433 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 protein_id gnl|my_center|LOCUS_16240 245997 244609 gene locus_tag LOCUS_16250 245997 244609 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_16250 247350 246079 gene locus_tag LOCUS_16260 247350 246079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 247231 247473 gene locus_tag LOCUS_16270 247231 247473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 247605 254123 gene locus_tag LOCUS_16280 247605 254123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 254777 254127 gene locus_tag LOCUS_16290 254777 254127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 255383 254805 gene locus_tag LOCUS_16300 255383 254805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 256323 255772 gene locus_tag LOCUS_16310 256323 255772 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_16310 256920 256381 gene locus_tag LOCUS_16320 256920 256381 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_16320 257763 256996 gene locus_tag LOCUS_16330 257763 256996 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_16330 257874 258344 gene locus_tag LOCUS_16340 257874 258344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 258317 259456 gene locus_tag LOCUS_16350 258317 259456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16350 259380 259736 gene locus_tag LOCUS_16360 259380 259736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 259786 260430 gene locus_tag LOCUS_16370 259786 260430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16370 260450 260704 gene locus_tag LOCUS_16380 260450 260704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 261531 260701 gene locus_tag LOCUS_16390 261531 260701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 261716 262246 gene locus_tag LOCUS_16400 261716 262246 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926824.1 protein_id gnl|my_center|LOCUS_16400 263388 262243 gene locus_tag LOCUS_16410 263388 262243 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_16410 263940 263392 gene locus_tag LOCUS_16420 263940 263392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 264575 263925 gene locus_tag LOCUS_16430 264575 263925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16430 265256 264705 gene locus_tag LOCUS_16440 265256 264705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 265649 265347 gene locus_tag LOCUS_16450 265649 265347 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_16450 266968 265658 gene locus_tag LOCUS_16460 gene murA 266968 265658 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_16460 267782 267063 gene locus_tag LOCUS_16470 267782 267063 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_16470 268330 267803 gene locus_tag LOCUS_16480 268330 267803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 269408 268233 gene locus_tag LOCUS_16490 269408 268233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 270744 269431 gene locus_tag LOCUS_16500 270744 269431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 271666 270845 gene locus_tag LOCUS_16510 271666 270845 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_16510 272128 272736 gene locus_tag LOCUS_16520 272128 272736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16520 272797 273150 gene locus_tag LOCUS_16530 272797 273150 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_16530 273177 274247 gene locus_tag LOCUS_16540 273177 274247 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_16540 274251 274742 gene locus_tag LOCUS_16550 gene rfaE2 274251 274742 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_16550 274739 275560 gene locus_tag LOCUS_16560 274739 275560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 275593 276378 gene locus_tag LOCUS_16570 275593 276378 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_16570 276448 277494 gene locus_tag LOCUS_16580 276448 277494 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816072.1 protein_id gnl|my_center|LOCUS_16580 277508 277894 gene locus_tag LOCUS_16590 277508 277894 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_16590 280097 277908 gene locus_tag LOCUS_16600 280097 277908 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_16600 280491 279991 gene locus_tag LOCUS_16610 280491 279991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 280974 280525 gene locus_tag LOCUS_16620 280974 280525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 281739 281080 gene locus_tag LOCUS_16630 gene purQ 281739 281080 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_16630 282832 281846 gene locus_tag LOCUS_16640 282832 281846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 283087 283440 gene locus_tag LOCUS_16650 283087 283440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 284852 283437 gene locus_tag LOCUS_16660 284852 283437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 285012 284794 gene locus_tag LOCUS_16670 285012 284794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 285419 285664 gene locus_tag LOCUS_16680 285419 285664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 285963 286268 gene locus_tag LOCUS_16690 285963 286268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 286283 286507 gene locus_tag LOCUS_16700 286283 286507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16700 286504 287271 gene locus_tag LOCUS_16710 286504 287271 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_16710 289931 287268 gene locus_tag LOCUS_16720 289931 287268 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_16720 291258 290032 gene locus_tag LOCUS_16730 291258 290032 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_16730 291799 291275 gene locus_tag LOCUS_16740 291799 291275 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16740 292020 291796 gene locus_tag LOCUS_16750 292020 291796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 292075 293577 gene locus_tag LOCUS_16760 292075 293577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 293973 293614 gene locus_tag LOCUS_16770 293973 293614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 294826 294143 gene locus_tag LOCUS_16780 294826 294143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506001.1 protein_id gnl|my_center|LOCUS_16780 296852 294951 gene locus_tag LOCUS_16790 296852 294951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 297187 296870 gene locus_tag LOCUS_16800 297187 296870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 297437 297237 gene locus_tag LOCUS_16810 297437 297237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 298119 297460 gene locus_tag LOCUS_16820 298119 297460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 298609 298028 gene locus_tag LOCUS_16830 298609 298028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16830 298932 298612 gene locus_tag LOCUS_16840 298932 298612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16840 300013 299435 gene locus_tag LOCUS_16850 300013 299435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16850 300446 300057 gene locus_tag LOCUS_16860 300446 300057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 301884 302273 gene locus_tag LOCUS_16870 301884 302273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16870 302508 302726 gene locus_tag LOCUS_16880 302508 302726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence05 222 1109 gene locus_tag LOCUS_16890 222 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16890 1153 1353 gene locus_tag LOCUS_16900 1153 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16900 1993 2529 gene locus_tag LOCUS_16910 1993 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2541 3011 gene locus_tag LOCUS_16920 2541 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2989 3294 gene locus_tag LOCUS_16930 2989 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3320 3661 gene locus_tag LOCUS_16940 3320 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4096 3785 gene locus_tag LOCUS_16950 4096 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4229 4110 gene locus_tag LOCUS_16960 4229 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4581 4216 gene locus_tag LOCUS_16970 4581 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4928 4578 gene locus_tag LOCUS_16980 4928 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 5156 4941 gene locus_tag LOCUS_16990 5156 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5243 5860 gene locus_tag LOCUS_17000 5243 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 5945 6202 gene locus_tag LOCUS_17010 5945 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6209 6442 gene locus_tag LOCUS_17020 6209 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 7738 6560 gene locus_tag LOCUS_17030 7738 6560 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_17030 7782 8729 gene locus_tag LOCUS_17040 7782 8729 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_17040 9971 8955 gene locus_tag LOCUS_17050 9971 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 10447 9968 gene locus_tag LOCUS_17060 10447 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 10589 12562 gene locus_tag LOCUS_17070 10589 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 13562 12633 gene locus_tag LOCUS_17080 gene porV 13562 12633 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_17080 15216 13720 gene locus_tag LOCUS_17090 15216 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 15793 16104 gene locus_tag LOCUS_17100 15793 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 16372 16169 gene locus_tag LOCUS_17110 16372 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 17686 16637 gene locus_tag LOCUS_17120 17686 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 18326 17862 gene locus_tag LOCUS_17130 18326 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 20423 18663 gene locus_tag LOCUS_17140 20423 18663 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922256.1 protein_id gnl|my_center|LOCUS_17140 20931 20752 gene locus_tag LOCUS_17150 20931 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 21759 21139 gene locus_tag LOCUS_17160 21759 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 22949 22032 gene locus_tag LOCUS_17170 22949 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 23662 23519 gene locus_tag LOCUS_17180 23662 23519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 23880 23722 gene locus_tag LOCUS_17190 23880 23722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 24419 24117 gene locus_tag LOCUS_17200 24419 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 24974 24495 gene locus_tag LOCUS_17210 24974 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17210 25522 25148 gene locus_tag LOCUS_17220 25522 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 26007 25513 gene locus_tag LOCUS_17230 26007 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 26643 26311 gene locus_tag LOCUS_17240 26643 26311 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_17240 27446 26958 gene locus_tag LOCUS_17250 27446 26958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 28383 28093 gene locus_tag LOCUS_17260 28383 28093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 28658 28404 gene locus_tag LOCUS_17270 28658 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 29862 28807 gene locus_tag LOCUS_17280 29862 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 30948 30418 gene locus_tag LOCUS_17290 30948 30418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 31920 31342 gene locus_tag LOCUS_17300 31920 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 32660 31977 gene locus_tag LOCUS_17310 32660 31977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 33455 32844 gene locus_tag LOCUS_17320 33455 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 33862 33473 gene locus_tag LOCUS_17330 33862 33473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 34574 33879 gene locus_tag LOCUS_17340 34574 33879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 34789 34568 gene locus_tag LOCUS_17350 34789 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 36261 34843 gene locus_tag LOCUS_17360 36261 34843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 36646 36467 gene locus_tag LOCUS_17370 36646 36467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 37350 36631 gene locus_tag LOCUS_17380 37350 36631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 38185 37970 gene locus_tag LOCUS_17390 38185 37970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 38914 38432 gene locus_tag LOCUS_17400 38914 38432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 39453 38962 gene locus_tag LOCUS_17410 39453 38962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 39904 39446 gene locus_tag LOCUS_17420 39904 39446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17420 40829 39924 gene locus_tag LOCUS_17430 40829 39924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17430 41065 40856 gene locus_tag LOCUS_17440 41065 40856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 42687 41266 gene locus_tag LOCUS_17450 42687 41266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17450 44138 42750 gene locus_tag LOCUS_17460 44138 42750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17460 45099 44383 gene locus_tag LOCUS_17470 45099 44383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 45642 45439 gene locus_tag LOCUS_17480 45642 45439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 46004 45639 gene locus_tag LOCUS_17490 46004 45639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 47204 46521 gene locus_tag LOCUS_17500 47204 46521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 47506 47201 gene locus_tag LOCUS_17510 47506 47201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 48310 47642 gene locus_tag LOCUS_17520 48310 47642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 48691 48542 gene locus_tag LOCUS_17530 48691 48542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 50037 48904 gene locus_tag LOCUS_17540 50037 48904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17540 51447 50095 gene locus_tag LOCUS_17550 51447 50095 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259200.1 protein_id gnl|my_center|LOCUS_17550 51889 51488 gene locus_tag LOCUS_17560 51889 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 52839 51874 gene locus_tag LOCUS_17570 52839 51874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 54114 52843 gene locus_tag LOCUS_17580 54114 52843 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_17580 54847 54203 gene locus_tag LOCUS_17590 54847 54203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 55829 54924 gene locus_tag LOCUS_17600 55829 54924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17600 56290 55781 gene locus_tag LOCUS_17610 56290 55781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17610 57813 56287 gene locus_tag LOCUS_17620 57813 56287 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 protein_id gnl|my_center|LOCUS_17620 59130 57817 gene locus_tag LOCUS_17630 gene gabT 59130 57817 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_17630 59557 60405 gene locus_tag LOCUS_17640 59557 60405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 60541 61389 gene locus_tag LOCUS_17650 60541 61389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 61560 62846 gene locus_tag LOCUS_17660 61560 62846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 63113 63973 gene locus_tag LOCUS_17670 63113 63973 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_17670 64030 64404 gene locus_tag LOCUS_17680 64030 64404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 65520 64654 gene locus_tag LOCUS_17690 65520 64654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 65856 66800 gene locus_tag LOCUS_17700 65856 66800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_17700 67009 67833 gene locus_tag LOCUS_17710 67009 67833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 67855 68355 gene locus_tag LOCUS_17720 67855 68355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 68321 69064 gene locus_tag LOCUS_17730 68321 69064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 69614 69045 gene locus_tag LOCUS_17740 69614 69045 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_17740 70259 69759 gene locus_tag LOCUS_17750 70259 69759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_17750 71056 70289 gene locus_tag LOCUS_17760 71056 70289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 71962 71159 gene locus_tag LOCUS_17770 71962 71159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 72533 71850 gene locus_tag LOCUS_17780 72533 71850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 73207 72530 gene locus_tag LOCUS_17790 73207 72530 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_17790 73368 74228 gene locus_tag LOCUS_17800 gene hisG 73368 74228 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_17800 74239 75531 gene locus_tag LOCUS_17810 gene hisD 74239 75531 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_17810 75532 76569 gene locus_tag LOCUS_17820 gene hisC 75532 76569 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_17820 76678 77808 gene locus_tag LOCUS_17830 gene hisB 76678 77808 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_17830 77839 78450 gene locus_tag LOCUS_17840 gene scpB 77839 78450 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_17840 78466 78987 gene locus_tag LOCUS_17850 78466 78987 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_17850 79066 79515 gene locus_tag LOCUS_17860 79066 79515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 80780 79566 gene locus_tag LOCUS_17870 80780 79566 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_17870 81484 80870 gene locus_tag LOCUS_17880 81484 80870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 81638 81565 gene locus_tag LOCUS_t00120 81638 81565 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 81781 82401 gene locus_tag LOCUS_17890 81781 82401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 82405 83238 gene locus_tag LOCUS_17900 82405 83238 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_17900 84780 83341 gene locus_tag LOCUS_17910 84780 83341 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_17910 86214 84838 gene locus_tag LOCUS_17920 86214 84838 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_17920 87125 86235 gene locus_tag LOCUS_17930 87125 86235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 89263 87122 gene locus_tag LOCUS_17940 89263 87122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17940 89550 91097 gene locus_tag LOCUS_17950 89550 91097 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17950 91091 91288 gene locus_tag LOCUS_17960 91091 91288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17960 91492 92046 gene locus_tag LOCUS_17970 91492 92046 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_17970 92437 92072 gene locus_tag LOCUS_17980 92437 92072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 92664 92434 gene locus_tag LOCUS_17990 92664 92434 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_17990 92828 95629 gene locus_tag LOCUS_18000 gene clpB 92828 95629 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_18000 95844 96854 gene locus_tag LOCUS_18010 95844 96854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 97973 97248 gene locus_tag LOCUS_18020 97973 97248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 98805 98500 gene locus_tag LOCUS_18030 98805 98500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 99143 101893 gene locus_tag LOCUS_18040 99143 101893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 102406 103050 gene locus_tag LOCUS_18050 102406 103050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 103520 103176 gene locus_tag LOCUS_18060 103520 103176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 103819 103577 gene locus_tag LOCUS_18070 103819 103577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 105560 104025 gene locus_tag LOCUS_18080 105560 104025 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_18080 106657 105686 gene locus_tag LOCUS_18090 106657 105686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18090 107103 106657 gene locus_tag LOCUS_18100 107103 106657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18100 107725 107159 gene locus_tag LOCUS_18110 107725 107159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18110 108435 107722 gene locus_tag LOCUS_18120 108435 107722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18120 109082 108438 gene locus_tag LOCUS_18130 109082 108438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 109249 109410 gene locus_tag LOCUS_18140 109249 109410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 109559 109747 gene locus_tag LOCUS_18150 109559 109747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 109790 110623 gene locus_tag LOCUS_18160 109790 110623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18160 110709 111653 gene locus_tag LOCUS_18170 110709 111653 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_18170 112558 111650 gene locus_tag LOCUS_18180 112558 111650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 113136 112552 gene locus_tag LOCUS_18190 113136 112552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 114208 113102 gene locus_tag LOCUS_18200 114208 113102 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_18200 115736 114423 gene locus_tag LOCUS_18210 115736 114423 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_18210 116977 115736 gene locus_tag LOCUS_18220 116977 115736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_18220 117667 117041 gene locus_tag LOCUS_18230 117667 117041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 118780 117668 gene locus_tag LOCUS_18240 gene mtnA 118780 117668 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529406.1 protein_id gnl|my_center|LOCUS_18240 119895 118843 gene locus_tag LOCUS_18250 119895 118843 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 protein_id gnl|my_center|LOCUS_18250 119967 121067 gene locus_tag LOCUS_18260 gene paaK 119967 121067 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 protein_id gnl|my_center|LOCUS_18260 122370 121243 gene locus_tag LOCUS_18270 122370 121243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 123178 122588 gene locus_tag LOCUS_18280 123178 122588 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656972.1 protein_id gnl|my_center|LOCUS_18280 124250 123549 gene locus_tag LOCUS_18290 124250 123549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 125178 124264 gene locus_tag LOCUS_18300 125178 124264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_18300 125234 125428 gene locus_tag LOCUS_18310 125234 125428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 126095 125487 gene locus_tag LOCUS_18320 126095 125487 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098397.1 protein_id gnl|my_center|LOCUS_18320 126870 126205 gene locus_tag LOCUS_18330 126870 126205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 127817 126966 gene locus_tag LOCUS_18340 127817 126966 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_18340 130509 128242 gene locus_tag LOCUS_18350 130509 128242 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112075.1 protein_id gnl|my_center|LOCUS_18350 130772 130548 gene locus_tag LOCUS_18360 130772 130548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18360 131558 130872 gene locus_tag LOCUS_18370 131558 130872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18370 131785 132009 gene locus_tag LOCUS_18380 131785 132009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 132006 134018 gene locus_tag LOCUS_18390 132006 134018 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_18390 134228 135547 gene locus_tag LOCUS_18400 134228 135547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 136382 135501 gene locus_tag LOCUS_18410 gene cysM 136382 135501 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_18410 137185 136382 gene locus_tag LOCUS_18420 137185 136382 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783689.1 protein_id gnl|my_center|LOCUS_18420 137711 138937 gene locus_tag LOCUS_18430 137711 138937 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18430 139085 140122 gene locus_tag LOCUS_18440 139085 140122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 140119 141495 gene locus_tag LOCUS_18450 140119 141495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18450 141419 142633 gene locus_tag LOCUS_18460 141419 142633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 143830 142685 gene locus_tag LOCUS_18470 143830 142685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 144110 145471 gene locus_tag LOCUS_18480 144110 145471 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_18480 145716 145982 gene locus_tag LOCUS_18490 145716 145982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 145906 146469 gene locus_tag LOCUS_18500 145906 146469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 146482 147876 gene locus_tag LOCUS_18510 gene mnmE 146482 147876 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_18510 148252 148923 gene locus_tag LOCUS_18520 148252 148923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 148914 149612 gene locus_tag LOCUS_18530 148914 149612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 149596 150249 gene locus_tag LOCUS_18540 149596 150249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 150855 150289 gene locus_tag LOCUS_18550 150855 150289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 152216 150870 gene locus_tag LOCUS_18560 152216 150870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18560 153243 152503 gene locus_tag LOCUS_18570 153243 152503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18570 153695 153249 gene locus_tag LOCUS_18580 153695 153249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18580 154124 154549 gene locus_tag LOCUS_18590 154124 154549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 154719 155735 gene locus_tag LOCUS_18600 154719 155735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 156268 155915 gene locus_tag LOCUS_18610 156268 155915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 157116 156217 gene locus_tag LOCUS_18620 157116 156217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18620 157945 158295 gene locus_tag LOCUS_18630 157945 158295 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_18630 158300 159496 gene locus_tag LOCUS_18640 158300 159496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143789.1 protein_id gnl|my_center|LOCUS_18640 159524 159889 gene locus_tag LOCUS_18650 159524 159889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 160090 160629 gene locus_tag LOCUS_18660 160090 160629 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_18660 160806 161378 gene locus_tag LOCUS_18670 160806 161378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 161335 162420 gene locus_tag LOCUS_18680 161335 162420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 162498 163439 gene locus_tag LOCUS_18690 162498 163439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 163456 164577 gene locus_tag LOCUS_18700 163456 164577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 165152 164637 gene locus_tag LOCUS_18710 165152 164637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 165726 165283 gene locus_tag LOCUS_18720 165726 165283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18720 166239 167111 gene locus_tag LOCUS_18730 166239 167111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 167115 168443 gene locus_tag LOCUS_18740 167115 168443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 168574 169197 gene locus_tag LOCUS_18750 168574 169197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18750 169384 169872 gene locus_tag LOCUS_18760 169384 169872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 169902 170270 gene locus_tag LOCUS_18770 169902 170270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 170392 171087 gene locus_tag LOCUS_18780 170392 171087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 171122 174718 gene locus_tag LOCUS_18790 171122 174718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 174649 175989 gene locus_tag LOCUS_18800 174649 175989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 176086 176403 gene locus_tag LOCUS_18810 176086 176403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 176393 177931 gene locus_tag LOCUS_18820 176393 177931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 178200 178874 gene locus_tag LOCUS_18830 178200 178874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_18830 179681 178893 gene locus_tag LOCUS_18840 179681 178893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18840 179623 179922 gene locus_tag LOCUS_18850 179623 179922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 180563 180210 gene locus_tag LOCUS_18860 180563 180210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18860 181714 180653 gene locus_tag LOCUS_18870 181714 180653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 182432 181815 gene locus_tag LOCUS_18880 182432 181815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 183084 182548 gene locus_tag LOCUS_18890 183084 182548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18890 184071 183853 gene locus_tag LOCUS_18900 184071 183853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18900 184655 184041 gene locus_tag LOCUS_18910 184655 184041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18910 184802 185872 gene locus_tag LOCUS_18920 184802 185872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 185876 187531 gene locus_tag LOCUS_18930 185876 187531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 187534 190146 gene locus_tag LOCUS_18940 187534 190146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 191448 190228 gene locus_tag LOCUS_18950 gene manA 191448 190228 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210579.1 protein_id gnl|my_center|LOCUS_18950 193278 191584 gene locus_tag LOCUS_18960 193278 191584 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_18960 193497 194408 gene locus_tag LOCUS_18970 193497 194408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 194311 195450 gene locus_tag LOCUS_18980 194311 195450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 196168 195425 gene locus_tag LOCUS_18990 196168 195425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 197070 196189 gene locus_tag LOCUS_19000 197070 196189 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_19000 197650 197072 gene locus_tag LOCUS_19010 197650 197072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 198321 197671 gene locus_tag LOCUS_19020 198321 197671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 199518 198358 gene locus_tag LOCUS_19030 199518 198358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 200062 199508 gene locus_tag LOCUS_19040 200062 199508 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_19040 200259 200684 gene locus_tag LOCUS_19050 200259 200684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19050 200603 201598 gene locus_tag LOCUS_19060 200603 201598 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 201611 202963 gene locus_tag LOCUS_19070 201611 202963 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_19070 202971 204287 gene locus_tag LOCUS_19080 202971 204287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 205192 204254 gene locus_tag LOCUS_19090 205192 204254 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_19090 206760 205198 gene locus_tag LOCUS_19100 206760 205198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 206846 207553 gene locus_tag LOCUS_19110 206846 207553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 207667 208035 gene locus_tag LOCUS_19120 207667 208035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19120 208193 208531 gene locus_tag LOCUS_19130 208193 208531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 209007 208723 gene locus_tag LOCUS_19140 209007 208723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 210169 208994 gene locus_tag LOCUS_19150 210169 208994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 210848 210384 gene locus_tag LOCUS_19160 210848 210384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 211223 211011 gene locus_tag LOCUS_19170 211223 211011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 212018 211296 gene locus_tag LOCUS_19180 212018 211296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19180 212581 212009 gene locus_tag LOCUS_19190 212581 212009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 214181 212733 gene locus_tag LOCUS_19200 214181 212733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 214846 214190 gene locus_tag LOCUS_19210 214846 214190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 215075 216046 gene locus_tag LOCUS_19220 215075 216046 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_19220 216212 217288 gene locus_tag LOCUS_19230 216212 217288 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_19230 217343 217963 gene locus_tag LOCUS_19240 217343 217963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 217960 218670 gene locus_tag LOCUS_19250 217960 218670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 220169 218667 gene locus_tag LOCUS_19260 220169 218667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19260 221348 220749 gene locus_tag LOCUS_19270 221348 220749 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_19270 222085 221345 gene locus_tag LOCUS_19280 gene ygiD 222085 221345 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_19280 223017 222448 gene locus_tag LOCUS_19290 223017 222448 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_19290 223510 223064 gene locus_tag LOCUS_19300 223510 223064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 226894 223523 gene locus_tag LOCUS_19310 226894 223523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 227534 227055 gene locus_tag LOCUS_19320 227534 227055 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_19320 228432 228052 gene locus_tag LOCUS_19330 228432 228052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19330 229652 228435 gene locus_tag LOCUS_19340 229652 228435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19340 230108 229668 gene locus_tag LOCUS_19350 gene rpiB 230108 229668 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_19350 231339 230206 gene locus_tag LOCUS_19360 231339 230206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19360 232096 231287 gene locus_tag LOCUS_19370 232096 231287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19370 233280 232171 gene locus_tag LOCUS_19380 233280 232171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19380 233900 233352 gene locus_tag LOCUS_19390 233900 233352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 235057 233969 gene locus_tag LOCUS_19400 235057 233969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 235632 235009 gene locus_tag LOCUS_19410 235632 235009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 236261 235974 gene locus_tag LOCUS_19420 236261 235974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 237254 236451 gene locus_tag LOCUS_19430 gene mscS 237254 236451 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_19430 237346 238620 gene locus_tag LOCUS_19440 237346 238620 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_19440 239233 238643 gene locus_tag LOCUS_19450 239233 238643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 242211 239359 gene locus_tag LOCUS_19460 242211 239359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 242376 245312 gene locus_tag LOCUS_19470 242376 245312 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_19470 245386 245589 gene locus_tag LOCUS_19480 245386 245589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 245591 245980 gene locus_tag LOCUS_19490 245591 245980 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_19490 246426 248123 gene locus_tag LOCUS_19500 246426 248123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 248139 248903 gene locus_tag LOCUS_19510 248139 248903 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_19510 249036 249491 gene locus_tag LOCUS_19520 249036 249491 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_19520 249499 250206 gene locus_tag LOCUS_19530 249499 250206 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_19530 250203 250712 gene locus_tag LOCUS_19540 250203 250712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19540 252073 251006 gene locus_tag LOCUS_19550 252073 251006 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_19550 255528 252268 gene locus_tag LOCUS_19560 255528 252268 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107757.1 protein_id gnl|my_center|LOCUS_19560 256050 255580 gene locus_tag LOCUS_19570 256050 255580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 257721 256102 gene locus_tag LOCUS_19580 257721 256102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 258378 257923 gene locus_tag LOCUS_19590 258378 257923 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_19590 260190 258379 gene locus_tag LOCUS_19600 260190 258379 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_19600 260795 260187 gene locus_tag LOCUS_19610 260795 260187 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_19610 262124 260802 gene locus_tag LOCUS_19620 262124 260802 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762991.1 protein_id gnl|my_center|LOCUS_19620 263896 262124 gene locus_tag LOCUS_19630 263896 262124 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_19630 264729 263893 gene locus_tag LOCUS_19640 264729 263893 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_19640 265176 264754 gene locus_tag LOCUS_19650 265176 264754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 265691 266422 gene locus_tag LOCUS_19660 265691 266422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 267009 266386 gene locus_tag LOCUS_19670 267009 266386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 267953 267360 gene locus_tag LOCUS_19680 267953 267360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 269421 268018 gene locus_tag LOCUS_19690 269421 268018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 270125 269568 gene locus_tag LOCUS_19700 270125 269568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 270883 270122 gene locus_tag LOCUS_19710 270883 270122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 271313 270981 gene locus_tag LOCUS_19720 271313 270981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 272311 271382 gene locus_tag LOCUS_19730 272311 271382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 273060 272317 gene locus_tag LOCUS_19740 273060 272317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 274282 274055 gene locus_tag LOCUS_19750 274282 274055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 275849 275010 gene locus_tag LOCUS_19760 275849 275010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 276870 275953 gene locus_tag LOCUS_19770 276870 275953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 278190 276886 gene locus_tag LOCUS_19780 278190 276886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 279097 278132 gene locus_tag LOCUS_19790 279097 278132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 279405 279629 gene locus_tag LOCUS_19800 279405 279629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 279607 281742 gene locus_tag LOCUS_19810 279607 281742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 281860 284706 gene locus_tag LOCUS_19820 281860 284706 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_19820 284651 285049 gene locus_tag LOCUS_19830 284651 285049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 285055 286596 gene locus_tag LOCUS_19840 285055 286596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 286613 287443 gene locus_tag LOCUS_19850 286613 287443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 290398 287444 gene locus_tag LOCUS_19860 290398 287444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 290886 290338 gene locus_tag LOCUS_19870 290886 290338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 291521 290883 gene locus_tag LOCUS_19880 291521 290883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 291951 291667 gene locus_tag LOCUS_19890 291951 291667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 292432 292857 gene locus_tag LOCUS_19900 292432 292857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 293926 293048 gene locus_tag LOCUS_19910 293926 293048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 294461 293913 gene locus_tag LOCUS_19920 294461 293913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 295160 294630 gene locus_tag LOCUS_19930 295160 294630 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_19930 295657 295217 gene locus_tag LOCUS_19940 295657 295217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19940 296086 295850 gene locus_tag LOCUS_19950 296086 295850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence06 461 1783 gene locus_tag LOCUS_19960 461 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1923 7475 gene locus_tag LOCUS_19970 1923 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 8293 7568 gene locus_tag LOCUS_19980 8293 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 8493 8290 gene locus_tag LOCUS_19990 8493 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 9133 8765 gene locus_tag LOCUS_20000 9133 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 10472 9036 gene locus_tag LOCUS_20010 10472 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 11096 10533 gene locus_tag LOCUS_20020 11096 10533 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814921.1 protein_id gnl|my_center|LOCUS_20020 11380 13809 gene locus_tag LOCUS_20030 11380 13809 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_20030 15223 14087 gene locus_tag LOCUS_20040 15223 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 15983 15441 gene locus_tag LOCUS_20050 15983 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 16428 17174 gene locus_tag LOCUS_20060 16428 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 17250 17657 gene locus_tag LOCUS_20070 17250 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 17665 18960 gene locus_tag LOCUS_20080 17665 18960 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_20080 19121 20053 gene locus_tag LOCUS_20090 19121 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 20050 21102 gene locus_tag LOCUS_20100 20050 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 21168 21719 gene locus_tag LOCUS_20110 21168 21719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 22546 25113 gene locus_tag LOCUS_20120 22546 25113 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_20120 25259 26473 gene locus_tag LOCUS_20130 25259 26473 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_20130 27686 26586 gene locus_tag LOCUS_20140 27686 26586 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_20140 28124 27693 gene locus_tag LOCUS_20150 28124 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 28810 28148 gene locus_tag LOCUS_20160 28810 28148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 29198 29689 gene locus_tag LOCUS_20170 29198 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 29782 30309 gene locus_tag LOCUS_20180 29782 30309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 30349 31995 gene locus_tag LOCUS_20190 30349 31995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 32288 32812 gene locus_tag LOCUS_20200 32288 32812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 36174 32881 gene locus_tag LOCUS_20210 36174 32881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 38880 36550 gene locus_tag LOCUS_20220 38880 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20220 41051 38850 gene locus_tag LOCUS_20230 41051 38850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 42403 40973 gene locus_tag LOCUS_20240 42403 40973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 43410 42442 gene locus_tag LOCUS_20250 43410 42442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 44554 43847 gene locus_tag LOCUS_20260 44554 43847 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761475.1 protein_id gnl|my_center|LOCUS_20260 46086 44635 gene locus_tag LOCUS_20270 46086 44635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 46654 46055 gene locus_tag LOCUS_20280 46654 46055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 46970 50170 gene locus_tag LOCUS_20290 46970 50170 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_20290 50657 50262 gene locus_tag LOCUS_20300 50657 50262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20300 51034 50627 gene locus_tag LOCUS_20310 51034 50627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 52755 51082 gene locus_tag LOCUS_20320 52755 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 53761 52805 gene locus_tag LOCUS_20330 53761 52805 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_20330 54575 53772 gene locus_tag LOCUS_20340 54575 53772 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_20340 54723 56573 gene locus_tag LOCUS_20350 gene hscA 54723 56573 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693792.1 protein_id gnl|my_center|LOCUS_20350 56654 57007 gene locus_tag LOCUS_20360 56654 57007 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_20360 57363 57043 gene locus_tag LOCUS_20370 gene cutA 57363 57043 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868105.1 protein_id gnl|my_center|LOCUS_20370 57526 58473 gene locus_tag LOCUS_20380 57526 58473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 59498 58404 gene locus_tag LOCUS_20390 59498 58404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 60832 59459 gene locus_tag LOCUS_20400 60832 59459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20400 62278 61007 gene locus_tag LOCUS_20410 62278 61007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 62790 62371 gene locus_tag LOCUS_20420 62790 62371 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531833.1 protein_id gnl|my_center|LOCUS_20420 62998 62801 gene locus_tag LOCUS_20430 62998 62801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 63794 64030 gene locus_tag LOCUS_20440 63794 64030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20440 64157 65122 gene locus_tag LOCUS_20450 64157 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20450 65241 66323 gene locus_tag LOCUS_20460 gene metX 65241 66323 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_20460 66471 67106 gene locus_tag LOCUS_20470 66471 67106 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397208.1 protein_id gnl|my_center|LOCUS_20470 67338 68576 gene locus_tag LOCUS_20480 67338 68576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 69877 68960 gene locus_tag LOCUS_20490 69877 68960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20490 70440 69913 gene locus_tag LOCUS_20500 70440 69913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 70784 70557 gene locus_tag LOCUS_20510 70784 70557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20510 71944 70781 gene locus_tag LOCUS_20520 71944 70781 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20520 72115 72696 gene locus_tag LOCUS_20530 72115 72696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 72804 73106 gene locus_tag LOCUS_20540 72804 73106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20540 74318 73212 gene locus_tag LOCUS_20550 gene lpxB 74318 73212 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_20550 74624 74322 gene locus_tag LOCUS_20560 74624 74322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 75651 75043 gene locus_tag LOCUS_20570 gene surE 75651 75043 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20570 75949 76779 gene locus_tag LOCUS_20580 75949 76779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20580 77141 81838 gene locus_tag LOCUS_20590 77141 81838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 81879 82910 gene locus_tag LOCUS_20600 81879 82910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20600 82957 83670 gene locus_tag LOCUS_20610 82957 83670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 83912 83763 gene locus_tag LOCUS_20620 83912 83763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 86454 84061 gene locus_tag LOCUS_20630 86454 84061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 86949 86524 gene locus_tag LOCUS_20640 86949 86524 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_20640 87941 87225 gene locus_tag LOCUS_20650 87941 87225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20650 88113 89297 gene locus_tag LOCUS_20660 88113 89297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 89400 90350 gene locus_tag LOCUS_20670 89400 90350 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_20670 90844 90413 gene locus_tag LOCUS_20680 90844 90413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 92333 90972 gene locus_tag LOCUS_20690 92333 90972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 93901 92579 gene locus_tag LOCUS_20700 93901 92579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 95520 93814 gene locus_tag LOCUS_20710 95520 93814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 95630 96820 gene locus_tag LOCUS_20720 gene kbl 95630 96820 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_20720 98466 96907 gene locus_tag LOCUS_20730 98466 96907 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_20730 99784 98495 gene locus_tag LOCUS_20740 99784 98495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 100158 99796 gene locus_tag LOCUS_20750 100158 99796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 100810 106563 gene locus_tag LOCUS_20760 100810 106563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 106885 107814 gene locus_tag LOCUS_20770 106885 107814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 108076 108729 gene locus_tag LOCUS_20780 108076 108729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20780 108711 110402 gene locus_tag LOCUS_20790 108711 110402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20790 110321 110875 gene locus_tag LOCUS_20800 110321 110875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 110989 113280 gene locus_tag LOCUS_20810 110989 113280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20810 113258 113464 gene locus_tag LOCUS_20820 113258 113464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 113409 114374 gene locus_tag LOCUS_20830 113409 114374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 114811 114530 gene locus_tag LOCUS_20840 114811 114530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20840 115308 114811 gene locus_tag LOCUS_20850 115308 114811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20850 115411 115484 gene locus_tag LOCUS_t00130 115411 115484 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 116135 115725 gene locus_tag LOCUS_20860 116135 115725 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_20860 116628 116239 gene locus_tag LOCUS_20870 116628 116239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 116941 116633 gene locus_tag LOCUS_20880 116941 116633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20880 117459 118037 gene locus_tag LOCUS_20890 117459 118037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 118051 120219 gene locus_tag LOCUS_20900 118051 120219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 121521 120304 gene locus_tag LOCUS_20910 121521 120304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20910 122221 121523 gene locus_tag LOCUS_20920 122221 121523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 122370 122218 gene locus_tag LOCUS_20930 122370 122218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 122785 122336 gene locus_tag LOCUS_20940 122785 122336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 122966 122787 gene locus_tag LOCUS_20950 122966 122787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 123758 123237 gene locus_tag LOCUS_20960 123758 123237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 124810 123833 gene locus_tag LOCUS_20970 124810 123833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 125644 124991 gene locus_tag LOCUS_20980 125644 124991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 126779 125628 gene locus_tag LOCUS_20990 126779 125628 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_20990 127633 126782 gene locus_tag LOCUS_21000 127633 126782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 128248 127853 gene locus_tag LOCUS_21010 128248 127853 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583738.1 protein_id gnl|my_center|LOCUS_21010 129189 128482 gene locus_tag LOCUS_21020 129189 128482 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_21020 131072 129468 gene locus_tag LOCUS_21030 131072 129468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 131903 131370 gene locus_tag LOCUS_21040 131903 131370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 132271 134577 gene locus_tag LOCUS_21050 132271 134577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 136411 134687 gene locus_tag LOCUS_21060 136411 134687 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_21060 136692 137582 gene locus_tag LOCUS_21070 136692 137582 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_21070 137599 138273 gene locus_tag LOCUS_21080 137599 138273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 138264 139082 gene locus_tag LOCUS_21090 138264 139082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21090 139048 139791 gene locus_tag LOCUS_21100 139048 139791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 140010 140798 gene locus_tag LOCUS_21110 140010 140798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 140823 142367 gene locus_tag LOCUS_21120 140823 142367 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_21120 142855 142556 gene locus_tag LOCUS_21130 142855 142556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 143493 142837 gene locus_tag LOCUS_21140 143493 142837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21140 143638 144975 gene locus_tag LOCUS_21150 143638 144975 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_21150 145799 145056 gene locus_tag LOCUS_21160 145799 145056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 146042 146326 gene locus_tag LOCUS_21170 146042 146326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 146332 147069 gene locus_tag LOCUS_21180 146332 147069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 147062 147778 gene locus_tag LOCUS_21190 147062 147778 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_21190 147833 148498 gene locus_tag LOCUS_21200 147833 148498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21200 148489 149502 gene locus_tag LOCUS_21210 148489 149502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 149402 149830 gene locus_tag LOCUS_21220 149402 149830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21220 151336 150074 gene locus_tag LOCUS_21230 151336 150074 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_21230 151448 152713 gene locus_tag LOCUS_21240 151448 152713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 152733 153551 gene locus_tag LOCUS_21250 152733 153551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 153701 154261 gene locus_tag LOCUS_21260 153701 154261 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_21260 154251 155519 gene locus_tag LOCUS_21270 154251 155519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 157246 155576 gene locus_tag LOCUS_21280 157246 155576 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_21280 157647 157414 gene locus_tag LOCUS_21290 157647 157414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21290 158168 157545 gene locus_tag LOCUS_21300 158168 157545 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 158564 158217 gene locus_tag LOCUS_21310 158564 158217 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_21310 158726 159979 gene locus_tag LOCUS_21320 158726 159979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21320 159942 160580 gene locus_tag LOCUS_21330 159942 160580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21330 160532 161359 gene locus_tag LOCUS_21340 160532 161359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21340 162666 161431 gene locus_tag LOCUS_21350 162666 161431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21350 165437 162687 gene locus_tag LOCUS_21360 165437 162687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21360 166828 166046 gene locus_tag LOCUS_21370 166828 166046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21370 167807 167061 gene locus_tag LOCUS_21380 167807 167061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 168565 167984 gene locus_tag LOCUS_21390 168565 167984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 168870 168565 gene locus_tag LOCUS_21400 168870 168565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 169594 168935 gene locus_tag LOCUS_21410 169594 168935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21410 170238 169633 gene locus_tag LOCUS_21420 170238 169633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 170668 170363 gene locus_tag LOCUS_21430 170668 170363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 172373 170958 gene locus_tag LOCUS_21440 172373 170958 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_21440 173012 172392 gene locus_tag LOCUS_21450 173012 172392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21450 175528 172928 gene locus_tag LOCUS_21460 175528 172928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21460 176579 175560 gene locus_tag LOCUS_21470 176579 175560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 177044 177871 gene locus_tag LOCUS_21480 gene dapB 177044 177871 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_21480 177868 178965 gene locus_tag LOCUS_21490 177868 178965 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_21490 179931 179080 gene locus_tag LOCUS_21500 179931 179080 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_21500 182226 179974 gene locus_tag LOCUS_21510 182226 179974 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_21510 182692 182961 gene locus_tag LOCUS_21520 182692 182961 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_21520 182965 183384 gene locus_tag LOCUS_21530 182965 183384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 183583 184476 gene locus_tag LOCUS_21540 183583 184476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 184565 185485 gene locus_tag LOCUS_21550 184565 185485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 185482 186996 gene locus_tag LOCUS_21560 185482 186996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 187091 187459 gene locus_tag LOCUS_21570 187091 187459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 188519 187572 gene locus_tag LOCUS_21580 188519 187572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 189249 188671 gene locus_tag LOCUS_21590 189249 188671 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_21590 189927 189490 gene locus_tag LOCUS_21600 189927 189490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 190144 191124 gene locus_tag LOCUS_21610 190144 191124 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_21610 191420 192310 gene locus_tag LOCUS_21620 191420 192310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21620 192371 192595 gene locus_tag LOCUS_21630 192371 192595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 192550 193773 gene locus_tag LOCUS_21640 192550 193773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 193912 194142 gene locus_tag LOCUS_21650 193912 194142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 194316 194618 gene locus_tag LOCUS_21660 194316 194618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 194609 196600 gene locus_tag LOCUS_21670 194609 196600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 198855 196714 gene locus_tag LOCUS_21680 198855 196714 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_21680 199581 198901 gene locus_tag LOCUS_21690 199581 198901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 200809 199613 gene locus_tag LOCUS_21700 200809 199613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 201748 201026 gene locus_tag LOCUS_21710 201748 201026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 202762 201974 gene locus_tag LOCUS_21720 202762 201974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 202872 204308 gene locus_tag LOCUS_21730 202872 204308 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108446.1 protein_id gnl|my_center|LOCUS_21730 204315 205811 gene locus_tag LOCUS_21740 204315 205811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 205795 207021 gene locus_tag LOCUS_21750 205795 207021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 207008 207463 gene locus_tag LOCUS_21760 207008 207463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 208029 207667 gene locus_tag LOCUS_21770 208029 207667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 208136 209080 gene locus_tag LOCUS_21780 208136 209080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21780 209108 209413 gene locus_tag LOCUS_21790 209108 209413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 209358 209714 gene locus_tag LOCUS_21800 209358 209714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 210206 211087 gene locus_tag LOCUS_21810 210206 211087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 211326 211676 gene locus_tag LOCUS_21820 211326 211676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 213440 212196 gene locus_tag LOCUS_21830 213440 212196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 216871 213509 gene locus_tag LOCUS_21840 216871 213509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 217459 217157 gene locus_tag LOCUS_21850 217459 217157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 218204 217461 gene locus_tag LOCUS_21860 218204 217461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 219877 218234 gene locus_tag LOCUS_21870 219877 218234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 220678 220016 gene locus_tag LOCUS_21880 220678 220016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 224277 222250 gene locus_tag LOCUS_21890 gene ppk1 224277 222250 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 protein_id gnl|my_center|LOCUS_21890 225316 224504 gene locus_tag LOCUS_21900 225316 224504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 225547 225981 gene locus_tag LOCUS_21910 225547 225981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 225873 227348 gene locus_tag LOCUS_21920 225873 227348 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21920 227367 227753 gene locus_tag LOCUS_21930 227367 227753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 227654 227938 gene locus_tag LOCUS_21940 227654 227938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 228150 228533 gene locus_tag LOCUS_21950 228150 228533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 228581 229444 gene locus_tag LOCUS_21960 228581 229444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21960 229574 230950 gene locus_tag LOCUS_21970 229574 230950 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_21970 232195 231197 gene locus_tag LOCUS_21980 232195 231197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21980 232398 232192 gene locus_tag LOCUS_21990 232398 232192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 232913 232545 gene locus_tag LOCUS_22000 232913 232545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 234094 233039 gene locus_tag LOCUS_22010 234094 233039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 234282 234091 gene locus_tag LOCUS_22020 234282 234091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 234545 234261 gene locus_tag LOCUS_22030 234545 234261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 235523 234609 gene locus_tag LOCUS_22040 235523 234609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 236128 235628 gene locus_tag LOCUS_22050 236128 235628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 237450 236248 gene locus_tag LOCUS_22060 237450 236248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_22060 237656 238852 gene locus_tag LOCUS_22070 237656 238852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22070 238828 239631 gene locus_tag LOCUS_22080 238828 239631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 239606 240001 gene locus_tag LOCUS_22090 239606 240001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 239950 241062 gene locus_tag LOCUS_22100 239950 241062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 241403 241942 gene locus_tag LOCUS_22110 241403 241942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 241961 242989 gene locus_tag LOCUS_22120 241961 242989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 243661 243065 gene locus_tag LOCUS_22130 243661 243065 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_22130 244726 243686 gene locus_tag LOCUS_22140 244726 243686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 244927 244727 gene locus_tag LOCUS_22150 244927 244727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 244994 245872 gene locus_tag LOCUS_22160 gene folP 244994 245872 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_22160 245890 246828 gene locus_tag LOCUS_22170 245890 246828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 247008 247322 gene locus_tag LOCUS_22180 247008 247322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 247338 247871 gene locus_tag LOCUS_22190 247338 247871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 247841 248329 gene locus_tag LOCUS_22200 247841 248329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22200 248427 248624 gene locus_tag LOCUS_22210 248427 248624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 248663 249673 gene locus_tag LOCUS_22220 248663 249673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 249592 250425 gene locus_tag LOCUS_22230 249592 250425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 250552 251658 gene locus_tag LOCUS_22240 250552 251658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 251580 252086 gene locus_tag LOCUS_22250 251580 252086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 252011 253327 gene locus_tag LOCUS_22260 252011 253327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 253330 253995 gene locus_tag LOCUS_22270 253330 253995 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_22270 254608 253988 gene locus_tag LOCUS_22280 254608 253988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 254831 254598 gene locus_tag LOCUS_22290 254831 254598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22290 255421 254765 gene locus_tag LOCUS_22300 gene lpxA 255421 254765 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22300 256451 255423 gene locus_tag LOCUS_22310 256451 255423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22310 256810 256421 gene locus_tag LOCUS_22320 256810 256421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22320 257867 256917 gene locus_tag LOCUS_22330 gene lpxD 257867 256917 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_22330 258060 258965 gene locus_tag LOCUS_22340 gene hemC 258060 258965 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392763.1 protein_id gnl|my_center|LOCUS_22340 260466 258973 gene locus_tag LOCUS_22350 260466 258973 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_22350 261192 260476 gene locus_tag LOCUS_22360 261192 260476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_22360 262018 261227 gene locus_tag LOCUS_22370 262018 261227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 262289 262906 gene locus_tag LOCUS_22380 262289 262906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 262946 266692 gene locus_tag LOCUS_22390 262946 266692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 267197 266895 gene locus_tag LOCUS_22400 267197 266895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22400 267257 267979 gene locus_tag LOCUS_22410 267257 267979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 268005 270668 gene locus_tag LOCUS_22420 268005 270668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 270647 271825 gene locus_tag LOCUS_22430 270647 271825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 272503 271907 gene locus_tag LOCUS_22440 272503 271907 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_22440 273059 272607 gene locus_tag LOCUS_22450 273059 272607 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_22450 273195 273386 gene locus_tag LOCUS_22460 273195 273386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 273365 273520 gene locus_tag LOCUS_22470 273365 273520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 273517 273999 gene locus_tag LOCUS_22480 273517 273999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 274154 274837 gene locus_tag LOCUS_22490 274154 274837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 274992 275744 gene locus_tag LOCUS_22500 274992 275744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 276051 276890 gene locus_tag LOCUS_22510 276051 276890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22510 276868 277311 gene locus_tag LOCUS_22520 276868 277311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22520 278711 277290 gene locus_tag LOCUS_22530 278711 277290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22530 279195 278728 gene locus_tag LOCUS_22540 279195 278728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22540 280573 279260 gene locus_tag LOCUS_22550 280573 279260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 280764 280555 gene locus_tag LOCUS_22560 280764 280555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence07 941 315 gene locus_tag LOCUS_22570 941 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2161 893 gene locus_tag LOCUS_22580 2161 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2562 3890 gene locus_tag LOCUS_22590 2562 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5782 4061 gene locus_tag LOCUS_22600 5782 4061 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_22600 6200 9682 gene locus_tag LOCUS_22610 6200 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 9716 11116 gene locus_tag LOCUS_22620 9716 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 11135 12082 gene locus_tag LOCUS_22630 11135 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 12294 13241 gene locus_tag LOCUS_22640 12294 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 13681 13902 gene locus_tag LOCUS_22650 13681 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 14037 14696 gene locus_tag LOCUS_22660 14037 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 14830 15168 gene locus_tag LOCUS_22670 14830 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 15424 16776 gene locus_tag LOCUS_22680 gene hemN 15424 16776 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_22680 16788 17093 gene locus_tag LOCUS_22690 16788 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 17590 17330 gene locus_tag LOCUS_22700 17590 17330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 18227 17481 gene locus_tag LOCUS_22710 18227 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22710 19753 19163 gene locus_tag LOCUS_22720 19753 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 20439 19750 gene locus_tag LOCUS_22730 20439 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 20840 20457 gene locus_tag LOCUS_22740 20840 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 21290 20961 gene locus_tag LOCUS_22750 21290 20961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 23649 21394 gene locus_tag LOCUS_22760 23649 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 23761 24465 gene locus_tag LOCUS_22770 23761 24465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 25318 24449 gene locus_tag LOCUS_22780 25318 24449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22780 25728 25351 gene locus_tag LOCUS_22790 25728 25351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22790 26252 25902 gene locus_tag LOCUS_22800 26252 25902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 26747 26256 gene locus_tag LOCUS_22810 26747 26256 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_22810 29105 26757 gene locus_tag LOCUS_22820 29105 26757 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_22820 29247 29329 gene locus_tag LOCUS_t00140 29247 29329 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29440 30879 gene locus_tag LOCUS_22830 29440 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 30970 31677 gene locus_tag LOCUS_22840 gene clpP 30970 31677 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_22840 31692 32402 gene locus_tag LOCUS_22850 31692 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22850 32488 32937 gene locus_tag LOCUS_22860 32488 32937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22860 34106 33384 gene locus_tag LOCUS_22870 34106 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 35619 34108 gene locus_tag LOCUS_22880 gene lysS 35619 34108 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_22880 35877 36473 gene locus_tag LOCUS_22890 35877 36473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22890 36473 36874 gene locus_tag LOCUS_22900 36473 36874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22900 38154 36871 gene locus_tag LOCUS_22910 38154 36871 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_22910 39508 38246 gene locus_tag LOCUS_22920 39508 38246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 39741 40538 gene locus_tag LOCUS_22930 39741 40538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 40421 41497 gene locus_tag LOCUS_22940 40421 41497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22940 42004 41570 gene locus_tag LOCUS_22950 42004 41570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 42348 43409 gene locus_tag LOCUS_22960 42348 43409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 43589 44752 gene locus_tag LOCUS_22970 43589 44752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22970 44925 45599 gene locus_tag LOCUS_22980 44925 45599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22980 45599 45868 gene locus_tag LOCUS_22990 45599 45868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22990 46176 46421 gene locus_tag LOCUS_23000 46176 46421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 46424 46945 gene locus_tag LOCUS_23010 46424 46945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 47200 47589 gene locus_tag LOCUS_23020 47200 47589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 48722 47961 gene locus_tag LOCUS_23030 48722 47961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 54105 48865 gene locus_tag LOCUS_23040 54105 48865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 55023 56117 gene locus_tag LOCUS_23050 gene paaK 55023 56117 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965787.1 protein_id gnl|my_center|LOCUS_23050 56874 56143 gene locus_tag LOCUS_23060 56874 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 57454 56777 gene locus_tag LOCUS_23070 57454 56777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 57729 58103 gene locus_tag LOCUS_23080 57729 58103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 58175 58486 gene locus_tag LOCUS_23090 58175 58486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 58588 58806 gene locus_tag LOCUS_23100 58588 58806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 59263 58916 gene locus_tag LOCUS_23110 59263 58916 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_23110 59464 61326 gene locus_tag LOCUS_23120 59464 61326 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_23120 61371 61988 gene locus_tag LOCUS_23130 61371 61988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23130 61931 62377 gene locus_tag LOCUS_23140 61931 62377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23140 62383 62733 gene locus_tag LOCUS_23150 62383 62733 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_23150 62724 63290 gene locus_tag LOCUS_23160 62724 63290 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_23160 63306 63764 gene locus_tag LOCUS_23170 63306 63764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 63761 64249 gene locus_tag LOCUS_23180 63761 64249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23180 64246 64893 gene locus_tag LOCUS_23190 64246 64893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23190 64906 65982 gene locus_tag LOCUS_23200 gene nuoH 64906 65982 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_23200 66228 66500 gene locus_tag LOCUS_23210 66228 66500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23210 66508 67041 gene locus_tag LOCUS_23220 66508 67041 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_23220 67038 67355 gene locus_tag LOCUS_23230 gene nuoK 67038 67355 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_23230 67360 68790 gene locus_tag LOCUS_23240 67360 68790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23240 68801 69280 gene locus_tag LOCUS_23250 68801 69280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23250 69291 70787 gene locus_tag LOCUS_23260 69291 70787 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_23260 70854 72278 gene locus_tag LOCUS_23270 70854 72278 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_23270 72263 72634 gene locus_tag LOCUS_23280 72263 72634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 72806 72955 gene locus_tag LOCUS_23290 72806 72955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 73682 73080 gene locus_tag LOCUS_23300 73682 73080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 74647 73724 gene locus_tag LOCUS_23310 74647 73724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23310 74640 75008 gene locus_tag LOCUS_23320 74640 75008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 75973 75251 gene locus_tag LOCUS_23330 75973 75251 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_23330 76716 76399 gene locus_tag LOCUS_23340 76716 76399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23340 78181 76886 gene locus_tag LOCUS_23350 78181 76886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 79196 78228 gene locus_tag LOCUS_23360 79196 78228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 81499 80093 gene locus_tag LOCUS_23370 81499 80093 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202983.1 protein_id gnl|my_center|LOCUS_23370 81696 82244 gene locus_tag LOCUS_23380 81696 82244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23380 82177 83880 gene locus_tag LOCUS_23390 82177 83880 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 85813 84008 gene locus_tag LOCUS_23400 gene aceK 85813 84008 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 protein_id gnl|my_center|LOCUS_23400 87152 85956 gene locus_tag LOCUS_23410 87152 85956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_23410 87797 87201 gene locus_tag LOCUS_23420 87797 87201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 88828 87794 gene locus_tag LOCUS_23430 88828 87794 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_23430 89690 88785 gene locus_tag LOCUS_23440 89690 88785 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947156.1 protein_id gnl|my_center|LOCUS_23440 90181 90843 gene locus_tag LOCUS_23450 90181 90843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 90758 90958 gene locus_tag LOCUS_23460 90758 90958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23460 94120 91022 gene locus_tag LOCUS_23470 94120 91022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 94293 96227 gene locus_tag LOCUS_23480 gene pqqU 94293 96227 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_23480 96498 96920 gene locus_tag LOCUS_23490 96498 96920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 96920 97435 gene locus_tag LOCUS_23500 96920 97435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 97552 97818 gene locus_tag LOCUS_23510 97552 97818 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_23510 98483 97833 gene locus_tag LOCUS_23520 98483 97833 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_23520 98764 98492 gene locus_tag LOCUS_23530 98764 98492 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_23530 99475 98777 gene locus_tag LOCUS_23540 99475 98777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_23540 99585 100178 gene locus_tag LOCUS_23550 99585 100178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 100812 100183 gene locus_tag LOCUS_23560 100812 100183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 101082 102086 gene locus_tag LOCUS_23570 101082 102086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 102223 103554 gene locus_tag LOCUS_23580 102223 103554 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_23580 103539 103739 gene locus_tag LOCUS_23590 103539 103739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23590 103870 104859 gene locus_tag LOCUS_23600 103870 104859 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_23600 104913 105479 gene locus_tag LOCUS_23610 gene efp 104913 105479 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_23610 105484 105948 gene locus_tag LOCUS_23620 105484 105948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23620 106110 107453 gene locus_tag LOCUS_23630 gene accC 106110 107453 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_23630 107705 109174 gene locus_tag LOCUS_23640 107705 109174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23640 109138 111042 gene locus_tag LOCUS_23650 109138 111042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23650 111569 111039 gene locus_tag LOCUS_23660 111569 111039 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_23660 111981 112532 gene locus_tag LOCUS_23670 111981 112532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 112804 113559 gene locus_tag LOCUS_23680 112804 113559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 113947 114552 gene locus_tag LOCUS_23690 113947 114552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23690 114549 116837 gene locus_tag LOCUS_23700 114549 116837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23700 116786 117247 gene locus_tag LOCUS_23710 116786 117247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23710 117298 117855 gene locus_tag LOCUS_23720 117298 117855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 117852 118985 gene locus_tag LOCUS_23730 117852 118985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23730 119056 120084 gene locus_tag LOCUS_23740 119056 120084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 120374 120790 gene locus_tag LOCUS_23750 120374 120790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23750 120842 121834 gene locus_tag LOCUS_23760 120842 121834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23760 121867 122103 gene locus_tag LOCUS_23770 121867 122103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 122115 122867 gene locus_tag LOCUS_23780 122115 122867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 123336 122896 gene locus_tag LOCUS_23790 123336 122896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 123736 123551 gene locus_tag LOCUS_23800 123736 123551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 123906 124484 gene locus_tag LOCUS_23810 123906 124484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 124536 124841 gene locus_tag LOCUS_23820 gene raiA 124536 124841 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_23820 125120 125195 gene locus_tag LOCUS_t00150 125120 125195 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 125295 125378 gene locus_tag LOCUS_t00160 125295 125378 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 125410 125482 gene locus_tag LOCUS_t00170 125410 125482 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 125610 125682 gene locus_tag LOCUS_t00180 125610 125682 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 125737 126933 gene locus_tag LOCUS_23830 gene tuf 125737 126933 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963319.1 protein_id gnl|my_center|LOCUS_23830 127025 127098 gene locus_tag LOCUS_t00190 127025 127098 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 127146 127334 gene locus_tag LOCUS_23840 127146 127334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 127348 127896 gene locus_tag LOCUS_23850 gene nusG 127348 127896 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_23850 127986 128438 gene locus_tag LOCUS_23860 gene rplK 127986 128438 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762027.1 protein_id gnl|my_center|LOCUS_23860 128516 128851 gene locus_tag LOCUS_23870 128516 128851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23870 128854 129210 gene locus_tag LOCUS_23880 128854 129210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 129235 129765 gene locus_tag LOCUS_23890 gene rplJ 129235 129765 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963314.1 protein_id gnl|my_center|LOCUS_23890 129837 130220 gene locus_tag LOCUS_23900 gene rplL 129837 130220 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_23900 130406 132355 gene locus_tag LOCUS_23910 130406 132355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23910 132345 134222 gene locus_tag LOCUS_23920 132345 134222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23920 134260 134688 gene locus_tag LOCUS_23930 134260 134688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23930 134664 135098 gene locus_tag LOCUS_23940 134664 135098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23940 134990 135523 gene locus_tag LOCUS_23950 134990 135523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23950 135520 136101 gene locus_tag LOCUS_23960 135520 136101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23960 136175 138250 gene locus_tag LOCUS_23970 136175 138250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23970 138247 138561 gene locus_tag LOCUS_23980 138247 138561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 138644 139201 gene locus_tag LOCUS_23990 138644 139201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 140248 139265 gene locus_tag LOCUS_24000 140248 139265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 140430 141179 gene locus_tag LOCUS_24010 140430 141179 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_24010 141325 143688 gene locus_tag LOCUS_24020 141325 143688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 145019 143907 gene locus_tag LOCUS_24030 gene ald 145019 143907 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_24030 145082 145894 gene locus_tag LOCUS_24040 145082 145894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 146698 146060 gene locus_tag LOCUS_24050 146698 146060 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 protein_id gnl|my_center|LOCUS_24050 148125 146698 gene locus_tag LOCUS_24060 148125 146698 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_24060 149670 148327 gene locus_tag LOCUS_24070 149670 148327 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_24070 151025 149898 gene locus_tag LOCUS_24080 151025 149898 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_24080 152144 151047 gene locus_tag LOCUS_24090 152144 151047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_24090 152898 152158 gene locus_tag LOCUS_24100 152898 152158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 153815 152910 gene locus_tag LOCUS_24110 153815 152910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 154693 153812 gene locus_tag LOCUS_24120 154693 153812 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_24120 156124 154850 gene locus_tag LOCUS_24130 156124 154850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 156851 156285 gene locus_tag LOCUS_24140 156851 156285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 157483 157010 gene locus_tag LOCUS_24150 157483 157010 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_24150 158694 157534 gene locus_tag LOCUS_24160 gene dnaJ 158694 157534 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962830.1 protein_id gnl|my_center|LOCUS_24160 159074 158760 gene locus_tag LOCUS_24170 159074 158760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 159360 159208 gene locus_tag LOCUS_24180 159360 159208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 159934 159329 gene locus_tag LOCUS_24190 159934 159329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 160006 160647 gene locus_tag LOCUS_24200 160006 160647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 160751 161275 gene locus_tag LOCUS_24210 160751 161275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 161836 161594 gene locus_tag LOCUS_24220 161836 161594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 161729 163000 gene locus_tag LOCUS_24230 161729 163000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 163067 165070 gene locus_tag LOCUS_24240 163067 165070 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_24240 165154 165228 gene locus_tag LOCUS_t00200 165154 165228 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 166376 165651 gene locus_tag LOCUS_24250 166376 165651 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_24250 167484 166450 gene locus_tag LOCUS_24260 167484 166450 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_24260 167862 170477 gene locus_tag LOCUS_24270 167862 170477 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_24270 171860 170799 gene locus_tag LOCUS_24280 gene rimO 171860 170799 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24280 172162 171851 gene locus_tag LOCUS_24290 172162 171851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24290 172468 173232 gene locus_tag LOCUS_24300 172468 173232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24300 173180 174034 gene locus_tag LOCUS_24310 173180 174034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24310 174037 174687 gene locus_tag LOCUS_24320 gene can 174037 174687 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651595.1 protein_id gnl|my_center|LOCUS_24320 174748 175479 gene locus_tag LOCUS_24330 174748 175479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 176701 175550 gene locus_tag LOCUS_24340 176701 175550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 176871 177863 gene locus_tag LOCUS_24350 176871 177863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 177877 178992 gene locus_tag LOCUS_24360 177877 178992 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_24360 180891 179185 gene locus_tag LOCUS_24370 180891 179185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 182139 181069 gene locus_tag LOCUS_24380 182139 181069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24380 182826 182263 gene locus_tag LOCUS_24390 182826 182263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24390 184631 182955 gene locus_tag LOCUS_24400 gene ilvD 184631 182955 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_24400 185495 185193 gene locus_tag LOCUS_24410 185495 185193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 185618 186280 gene locus_tag LOCUS_24420 185618 186280 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920521.1 protein_id gnl|my_center|LOCUS_24420 187963 186308 gene locus_tag LOCUS_24430 gene recN 187963 186308 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_24430 189001 188048 gene locus_tag LOCUS_24440 189001 188048 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122317.1 protein_id gnl|my_center|LOCUS_24440 189135 192308 gene locus_tag LOCUS_24450 189135 192308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 194025 192370 gene locus_tag LOCUS_24460 194025 192370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 194738 194022 gene locus_tag LOCUS_24470 194738 194022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 197248 195230 gene locus_tag LOCUS_24480 197248 195230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 198989 197349 gene locus_tag LOCUS_24490 198989 197349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 199084 200055 gene locus_tag LOCUS_24500 199084 200055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 200664 200113 gene locus_tag LOCUS_24510 200664 200113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 200804 201382 gene locus_tag LOCUS_24520 200804 201382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 201385 202104 gene locus_tag LOCUS_24530 201385 202104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 203797 202106 gene locus_tag LOCUS_24540 203797 202106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 205038 203740 gene locus_tag LOCUS_24550 205038 203740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 205162 206697 gene locus_tag LOCUS_24560 205162 206697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 206837 207148 gene locus_tag LOCUS_24570 206837 207148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 208059 207229 gene locus_tag LOCUS_24580 208059 207229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 208108 208608 gene locus_tag LOCUS_24590 208108 208608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 208890 208729 gene locus_tag LOCUS_24600 208890 208729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 208950 210527 gene locus_tag LOCUS_24610 208950 210527 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817440.1 protein_id gnl|my_center|LOCUS_24610 211637 210600 gene locus_tag LOCUS_24620 211637 210600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 214390 211661 gene locus_tag LOCUS_24630 214390 211661 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_24630 214497 214649 gene locus_tag LOCUS_24640 214497 214649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24640 214792 216402 gene locus_tag LOCUS_24650 gene acs 214792 216402 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24650 216404 217054 gene locus_tag LOCUS_24660 216404 217054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 217066 217332 gene locus_tag LOCUS_24670 217066 217332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 217500 219152 gene locus_tag LOCUS_24680 gene ettA 217500 219152 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763451.1 protein_id gnl|my_center|LOCUS_24680 219251 219808 gene locus_tag LOCUS_24690 219251 219808 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24690 220003 221109 gene locus_tag LOCUS_24700 220003 221109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 221106 223610 gene locus_tag LOCUS_24710 221106 223610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24710 223646 223864 gene locus_tag LOCUS_24720 223646 223864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24720 225541 224723 gene locus_tag LOCUS_24730 225541 224723 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_24730 225787 226116 gene locus_tag LOCUS_24740 225787 226116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 226113 227216 gene locus_tag LOCUS_24750 226113 227216 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_24750 227245 227811 gene locus_tag LOCUS_24760 227245 227811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24760 227814 228278 gene locus_tag LOCUS_24770 227814 228278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24770 229198 228281 gene locus_tag LOCUS_24780 229198 228281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24780 230316 229192 gene locus_tag LOCUS_24790 230316 229192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24790 230445 231962 gene locus_tag LOCUS_24800 230445 231962 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_24800 233109 232015 gene locus_tag LOCUS_24810 233109 232015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 234107 233277 gene locus_tag LOCUS_24820 234107 233277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 234325 235260 gene locus_tag LOCUS_24830 234325 235260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24830 235143 236378 gene locus_tag LOCUS_24840 235143 236378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 236375 237340 gene locus_tag LOCUS_24850 236375 237340 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_24850 237538 238782 gene locus_tag LOCUS_24860 gene gldK 237538 238782 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_24860 239019 239630 gene locus_tag LOCUS_24870 gene gldL 239019 239630 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_24870 239932 241236 gene locus_tag LOCUS_24880 gene gldM 239932 241236 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24880 241496 242371 gene locus_tag LOCUS_24890 241496 242371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 244360 242465 gene locus_tag LOCUS_24900 244360 242465 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_24900 244536 246353 gene locus_tag LOCUS_24910 244536 246353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_24910 246748 246374 gene locus_tag LOCUS_24920 246748 246374 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_24920 246963 246745 gene locus_tag LOCUS_24930 246963 246745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 247034 247159 gene locus_tag LOCUS_24940 247034 247159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 248137 247346 gene locus_tag LOCUS_24950 248137 247346 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_24950 249083 248316 gene locus_tag LOCUS_24960 249083 248316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 250078 249077 gene locus_tag LOCUS_24970 250078 249077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24970 252365 250152 gene locus_tag LOCUS_24980 252365 250152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24980 254190 252607 gene locus_tag LOCUS_24990 254190 252607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24990 254711 254199 gene locus_tag LOCUS_25000 254711 254199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25000 258741 254779 gene locus_tag LOCUS_25010 258741 254779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 259927 258641 gene locus_tag LOCUS_25020 259927 258641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 260708 259920 gene locus_tag LOCUS_25030 260708 259920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 261383 260814 gene locus_tag LOCUS_25040 261383 260814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 262330 261488 gene locus_tag LOCUS_25050 262330 261488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_25050 263389 262604 gene locus_tag LOCUS_25060 263389 262604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence08 341 75 gene locus_tag LOCUS_25070 341 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 1803 2264 gene locus_tag LOCUS_25080 1803 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25080 2287 2571 gene locus_tag LOCUS_25090 2287 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25090 2678 3718 gene locus_tag LOCUS_25100 2678 3718 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_25100 3932 4837 gene locus_tag LOCUS_25110 gene thyA 3932 4837 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679609.1 protein_id gnl|my_center|LOCUS_25110 5036 6433 gene locus_tag LOCUS_25120 5036 6433 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_25120 6473 7561 gene locus_tag LOCUS_25130 6473 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25130 7561 8595 gene locus_tag LOCUS_25140 7561 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25140 8616 9776 gene locus_tag LOCUS_25150 8616 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 9834 11246 gene locus_tag LOCUS_25160 gene nrfD 9834 11246 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_25160 11246 11806 gene locus_tag LOCUS_25170 11246 11806 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_25170 11790 12716 gene locus_tag LOCUS_25180 11790 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 12760 13803 gene locus_tag LOCUS_25190 12760 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25190 13715 14011 gene locus_tag LOCUS_25200 13715 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 14125 15606 gene locus_tag LOCUS_25210 14125 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 15663 15908 gene locus_tag LOCUS_25220 15663 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25220 16038 16790 gene locus_tag LOCUS_25230 16038 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25230 16787 17518 gene locus_tag LOCUS_25240 16787 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25240 17612 18511 gene locus_tag LOCUS_25250 gene cyoE 17612 18511 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_25250 18607 19101 gene locus_tag LOCUS_25260 18607 19101 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_25260 19136 20011 gene locus_tag LOCUS_25270 19136 20011 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_25270 20044 20475 gene locus_tag LOCUS_25280 20044 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 20648 21340 gene locus_tag LOCUS_25290 20648 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 21337 21915 gene locus_tag LOCUS_25300 21337 21915 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_25300 28364 22107 gene locus_tag LOCUS_25310 28364 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 29049 28294 gene locus_tag LOCUS_25320 29049 28294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 31461 29263 gene locus_tag LOCUS_25330 31461 29263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 33692 31401 gene locus_tag LOCUS_25340 33692 31401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 34756 33671 gene locus_tag LOCUS_25350 34756 33671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 35534 34650 gene locus_tag LOCUS_25360 35534 34650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 36903 35914 gene locus_tag LOCUS_25370 36903 35914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 38233 36875 gene locus_tag LOCUS_25380 38233 36875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 40043 40483 gene locus_tag LOCUS_25390 40043 40483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 40398 41423 gene locus_tag LOCUS_25400 40398 41423 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_25400 41430 41939 gene locus_tag LOCUS_25410 41430 41939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 41933 42178 gene locus_tag LOCUS_25420 41933 42178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 42144 42590 gene locus_tag LOCUS_25430 42144 42590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 42593 43420 gene locus_tag LOCUS_25440 42593 43420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 43634 43957 gene locus_tag LOCUS_25450 43634 43957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 43893 44186 gene locus_tag LOCUS_25460 43893 44186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 44448 44744 gene locus_tag LOCUS_25470 44448 44744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 44732 45163 gene locus_tag LOCUS_25480 44732 45163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25480 45079 45558 gene locus_tag LOCUS_25490 45079 45558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 46663 46097 gene locus_tag LOCUS_25500 46663 46097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25500 47152 46694 gene locus_tag LOCUS_25510 47152 46694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25510 47402 47800 gene locus_tag LOCUS_25520 47402 47800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 48033 48446 gene locus_tag LOCUS_25530 48033 48446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 48451 51618 gene locus_tag LOCUS_25540 48451 51618 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_25540 51723 52976 gene locus_tag LOCUS_25550 51723 52976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 53101 53661 gene locus_tag LOCUS_25560 53101 53661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 53716 54213 gene locus_tag LOCUS_25570 53716 54213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25570 54210 55400 gene locus_tag LOCUS_25580 54210 55400 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_25580 55581 56153 gene locus_tag LOCUS_25590 55581 56153 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506656.1 protein_id gnl|my_center|LOCUS_25590 57762 58115 gene locus_tag LOCUS_25600 57762 58115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 58129 58983 gene locus_tag LOCUS_25610 58129 58983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 59096 59305 gene locus_tag LOCUS_25620 59096 59305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 59613 62252 gene locus_tag LOCUS_25630 59613 62252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25630 62240 63040 gene locus_tag LOCUS_25640 62240 63040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25640 63037 64176 gene locus_tag LOCUS_25650 63037 64176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25650 64151 64396 gene locus_tag LOCUS_25660 64151 64396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 64387 64719 gene locus_tag LOCUS_25670 64387 64719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25670 64780 65049 gene locus_tag LOCUS_25680 64780 65049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25680 66244 66816 gene locus_tag LOCUS_25690 66244 66816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25690 67007 66729 gene locus_tag LOCUS_25700 67007 66729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 66964 67155 gene locus_tag LOCUS_25710 66964 67155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 67152 67406 gene locus_tag LOCUS_25720 67152 67406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 67492 69552 gene locus_tag LOCUS_25730 67492 69552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25730 69470 69787 gene locus_tag LOCUS_25740 69470 69787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 70922 71440 gene locus_tag LOCUS_25750 70922 71440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25750 71525 72598 gene locus_tag LOCUS_25760 71525 72598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 72595 73140 gene locus_tag LOCUS_25770 72595 73140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 73332 75029 gene locus_tag LOCUS_25780 73332 75029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 75047 75265 gene locus_tag LOCUS_25790 75047 75265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 75648 76946 gene locus_tag LOCUS_25800 75648 76946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 76996 78858 gene locus_tag LOCUS_25810 76996 78858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 78863 79219 gene locus_tag LOCUS_25820 78863 79219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 79281 80045 gene locus_tag LOCUS_25830 79281 80045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 80151 80465 gene locus_tag LOCUS_25840 80151 80465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 80507 80935 gene locus_tag LOCUS_25850 80507 80935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 80953 81312 gene locus_tag LOCUS_25860 80953 81312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 81341 81712 gene locus_tag LOCUS_25870 81341 81712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 81709 82488 gene locus_tag LOCUS_25880 81709 82488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 82431 82889 gene locus_tag LOCUS_25890 82431 82889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 83205 83441 gene locus_tag LOCUS_25900 83205 83441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 85272 84592 gene locus_tag LOCUS_25910 85272 84592 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_25910 85438 85803 gene locus_tag LOCUS_25920 85438 85803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 85963 85793 gene locus_tag LOCUS_25930 85963 85793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 86083 88587 gene locus_tag LOCUS_25940 gene topA 86083 88587 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_25940 88687 89004 gene locus_tag LOCUS_25950 88687 89004 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_25950 89574 89035 gene locus_tag LOCUS_25960 89574 89035 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921584.1 protein_id gnl|my_center|LOCUS_25960 91490 89586 gene locus_tag LOCUS_25970 gene typA 91490 89586 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_25970 91916 93454 gene locus_tag LOCUS_25980 91916 93454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 93445 95019 gene locus_tag LOCUS_25990 93445 95019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 95078 96532 gene locus_tag LOCUS_26000 95078 96532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 96529 96936 gene locus_tag LOCUS_26010 96529 96936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 96946 97563 gene locus_tag LOCUS_26020 96946 97563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26020 97817 98482 gene locus_tag LOCUS_26030 97817 98482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 98519 99724 gene locus_tag LOCUS_26040 98519 99724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 99690 101228 gene locus_tag LOCUS_26050 99690 101228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 101225 102628 gene locus_tag LOCUS_26060 101225 102628 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26060 102746 103774 gene locus_tag LOCUS_26070 102746 103774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 103782 104174 gene locus_tag LOCUS_26080 103782 104174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 104282 105202 gene locus_tag LOCUS_26090 104282 105202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 105189 106118 gene locus_tag LOCUS_26100 105189 106118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 106196 108010 gene locus_tag LOCUS_26110 106196 108010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 108168 110840 gene locus_tag LOCUS_26120 108168 110840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_26120 114061 111080 gene locus_tag LOCUS_26130 114061 111080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 114906 115370 gene locus_tag LOCUS_26140 114906 115370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 116637 116188 gene locus_tag LOCUS_26150 116637 116188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 118132 117632 gene locus_tag LOCUS_26160 118132 117632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26160 121062 118705 gene locus_tag LOCUS_26170 121062 118705 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_26170 121488 121258 gene locus_tag LOCUS_26180 121488 121258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26180 121487 121762 gene locus_tag LOCUS_26190 121487 121762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 123190 122528 gene locus_tag LOCUS_26200 gene truB 123190 122528 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_26200 123568 123251 gene locus_tag LOCUS_26210 123568 123251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 124475 123600 gene locus_tag LOCUS_26220 124475 123600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 125009 124518 gene locus_tag LOCUS_26230 125009 124518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26230 125532 125014 gene locus_tag LOCUS_26240 125532 125014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26240 126130 125549 gene locus_tag LOCUS_26250 126130 125549 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_26250 126343 127074 gene locus_tag LOCUS_26260 126343 127074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 127129 127548 gene locus_tag LOCUS_26270 127129 127548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 127503 127856 gene locus_tag LOCUS_26280 127503 127856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 127858 128052 gene locus_tag LOCUS_26290 127858 128052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26290 128058 128333 gene locus_tag LOCUS_26300 128058 128333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26300 128609 130246 gene locus_tag LOCUS_26310 128609 130246 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26310 130234 130539 gene locus_tag LOCUS_26320 130234 130539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26320 131027 130698 gene locus_tag LOCUS_26330 131027 130698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 133249 131024 gene locus_tag LOCUS_26340 133249 131024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26340 136420 133322 gene locus_tag LOCUS_26350 136420 133322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 136800 136363 gene locus_tag LOCUS_26360 136800 136363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 137179 136820 gene locus_tag LOCUS_26370 137179 136820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 137996 137160 gene locus_tag LOCUS_26380 137996 137160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 138868 138020 gene locus_tag LOCUS_26390 138868 138020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 139110 138778 gene locus_tag LOCUS_26400 139110 138778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 139330 143712 gene locus_tag LOCUS_26410 139330 143712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26410 143739 144155 gene locus_tag LOCUS_26420 143739 144155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26420 144180 145007 gene locus_tag LOCUS_26430 144180 145007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26430 145361 145717 gene locus_tag LOCUS_26440 145361 145717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 145665 145982 gene locus_tag LOCUS_26450 145665 145982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 145933 151242 gene locus_tag LOCUS_26460 145933 151242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26460 151359 152273 gene locus_tag LOCUS_26470 151359 152273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 152392 152637 gene locus_tag LOCUS_26480 152392 152637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 152661 152993 gene locus_tag LOCUS_26490 152661 152993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 154733 153015 gene locus_tag LOCUS_26500 154733 153015 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480202.1 protein_id gnl|my_center|LOCUS_26500 155432 156046 gene locus_tag LOCUS_26510 155432 156046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 155962 156390 gene locus_tag LOCUS_26520 155962 156390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 157016 156396 gene locus_tag LOCUS_26530 157016 156396 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_26530 157216 158271 gene locus_tag LOCUS_26540 157216 158271 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_26540 159138 158353 gene locus_tag LOCUS_26550 159138 158353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 protein_id gnl|my_center|LOCUS_26550 159911 159132 gene locus_tag LOCUS_26560 159911 159132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 161136 159970 gene locus_tag LOCUS_26570 161136 159970 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26570 161485 161147 gene locus_tag LOCUS_26580 161485 161147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 162213 161632 gene locus_tag LOCUS_26590 162213 161632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_26590 164274 162295 gene locus_tag LOCUS_26600 gene nosZ 164274 162295 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_26600 164545 164982 gene locus_tag LOCUS_26610 164545 164982 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_26610 165095 165577 gene locus_tag LOCUS_26620 165095 165577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 165579 166817 gene locus_tag LOCUS_26630 165579 166817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 166840 167214 gene locus_tag LOCUS_26640 166840 167214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26640 167192 167557 gene locus_tag LOCUS_26650 167192 167557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26650 168542 167685 gene locus_tag LOCUS_26660 168542 167685 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26660 169650 168796 gene locus_tag LOCUS_26670 169650 168796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 170576 169674 gene locus_tag LOCUS_26680 170576 169674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_26680 171191 171877 gene locus_tag LOCUS_26690 171191 171877 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_26690 171949 173061 gene locus_tag LOCUS_26700 171949 173061 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942324.1 protein_id gnl|my_center|LOCUS_26700 173531 173752 gene locus_tag LOCUS_26710 173531 173752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26710 174586 174095 gene locus_tag LOCUS_26720 174586 174095 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 protein_id gnl|my_center|LOCUS_26720 174676 177456 gene locus_tag LOCUS_26730 174676 177456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 178816 177365 gene locus_tag LOCUS_26740 178816 177365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26740 179469 178813 gene locus_tag LOCUS_26750 179469 178813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 181251 179488 gene locus_tag LOCUS_26760 181251 179488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 182282 181356 gene locus_tag LOCUS_26770 gene rfbD 182282 181356 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_26770 182359 183669 gene locus_tag LOCUS_26780 182359 183669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 184609 183764 gene locus_tag LOCUS_26790 184609 183764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 185399 184623 gene locus_tag LOCUS_26800 gene tauC 185399 184623 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706737.1 protein_id gnl|my_center|LOCUS_26800 186383 185493 gene locus_tag LOCUS_26810 186383 185493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 187288 186428 gene locus_tag LOCUS_26820 187288 186428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 187965 187543 gene locus_tag LOCUS_26830 187965 187543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26830 188567 188091 gene locus_tag LOCUS_26840 188567 188091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26840 189643 188549 gene locus_tag LOCUS_26850 189643 188549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26850 190764 189859 gene locus_tag LOCUS_26860 190764 189859 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 protein_id gnl|my_center|LOCUS_26860 190871 191431 gene locus_tag LOCUS_26870 190871 191431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 191813 192088 gene locus_tag LOCUS_26880 gene rpsO 191813 192088 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057119.1 protein_id gnl|my_center|LOCUS_26880 192329 194251 gene locus_tag LOCUS_26890 gene pnp 192329 194251 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 194146 194613 gene locus_tag LOCUS_26900 194146 194613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26900 194858 195706 gene locus_tag LOCUS_26910 194858 195706 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_26910 196674 195802 gene locus_tag LOCUS_26920 196674 195802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 protein_id gnl|my_center|LOCUS_26920 197142 197417 gene locus_tag LOCUS_26930 197142 197417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26930 197339 198400 gene locus_tag LOCUS_26940 197339 198400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26940 198516 199613 gene locus_tag LOCUS_26950 198516 199613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26950 199565 201964 gene locus_tag LOCUS_26960 199565 201964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26960 202207 202560 gene locus_tag LOCUS_26970 202207 202560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26970 202506 203198 gene locus_tag LOCUS_26980 202506 203198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26980 204049 203345 gene locus_tag LOCUS_26990 204049 203345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 204869 204126 gene locus_tag LOCUS_27000 204869 204126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 205225 204950 gene locus_tag LOCUS_27010 205225 204950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27010 206675 205188 gene locus_tag LOCUS_27020 206675 205188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27020 207887 206676 gene locus_tag LOCUS_27030 207887 206676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27030 208054 208977 gene locus_tag LOCUS_27040 208054 208977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 209098 210744 gene locus_tag LOCUS_27050 209098 210744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 211270 212586 gene locus_tag LOCUS_27060 211270 212586 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055843.1 protein_id gnl|my_center|LOCUS_27060 212919 213371 gene locus_tag LOCUS_27070 212919 213371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 215212 213626 gene locus_tag LOCUS_27080 215212 213626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 215922 215131 gene locus_tag LOCUS_27090 215922 215131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 216250 218634 gene locus_tag LOCUS_27100 216250 218634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 219374 219147 gene locus_tag LOCUS_27110 219374 219147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 221704 219440 gene locus_tag LOCUS_27120 221704 219440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 222651 221776 gene locus_tag LOCUS_27130 222651 221776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 222922 223140 gene locus_tag LOCUS_27140 222922 223140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 223321 223821 gene locus_tag LOCUS_27150 223321 223821 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259362.1 protein_id gnl|my_center|LOCUS_27150 223985 224170 gene locus_tag LOCUS_27160 223985 224170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 224125 224583 gene locus_tag LOCUS_27170 224125 224583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27170 225431 224634 gene locus_tag LOCUS_27180 gene cdaA 225431 224634 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_27180 227620 225428 gene locus_tag LOCUS_27190 227620 225428 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_27190 227691 228902 gene locus_tag LOCUS_27200 227691 228902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 228907 229485 gene locus_tag LOCUS_27210 228907 229485 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_27210 230266 229595 gene locus_tag LOCUS_27220 230266 229595 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_27220 230897 230253 gene locus_tag LOCUS_27230 230897 230253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 231193 230867 gene locus_tag LOCUS_27240 231193 230867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 231336 232046 gene locus_tag LOCUS_27250 231336 232046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27250 231983 232579 gene locus_tag LOCUS_27260 231983 232579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27260 232576 233175 gene locus_tag LOCUS_27270 232576 233175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 233423 233716 gene locus_tag LOCUS_27280 233423 233716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 234249 233737 gene locus_tag LOCUS_27290 234249 233737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27290 235213 234272 gene locus_tag LOCUS_27300 235213 234272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27300 235270 235449 gene locus_tag LOCUS_27310 235270 235449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 235519 236688 gene locus_tag LOCUS_27320 235519 236688 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093179.1 protein_id gnl|my_center|LOCUS_27320 236715 237509 gene locus_tag LOCUS_27330 gene murQ 236715 237509 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_27330 237729 238382 gene locus_tag LOCUS_27340 237729 238382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27340 239770 239183 gene locus_tag LOCUS_27350 239770 239183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 240558 239662 gene locus_tag LOCUS_27360 240558 239662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 241090 240536 gene locus_tag LOCUS_27370 241090 240536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 241110 241421 gene locus_tag LOCUS_27380 241110 241421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence09 306 974 gene locus_tag LOCUS_27390 306 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 971 1330 gene locus_tag LOCUS_27400 971 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1373 2683 gene locus_tag LOCUS_27410 1373 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2572 2994 gene locus_tag LOCUS_27420 2572 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3011 3625 gene locus_tag LOCUS_27430 3011 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3916 4254 gene locus_tag LOCUS_27440 3916 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 4480 4794 gene locus_tag LOCUS_27450 4480 4794 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817201.1 protein_id gnl|my_center|LOCUS_27450 5560 4805 gene locus_tag LOCUS_27460 5560 4805 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_27460 6700 5600 gene locus_tag LOCUS_27470 gene pdxA 6700 5600 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_27470 6821 7597 gene locus_tag LOCUS_27480 gene rsmA 6821 7597 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_27480 7722 8168 gene locus_tag LOCUS_27490 7722 8168 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_27490 8270 9436 gene locus_tag LOCUS_27500 8270 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27500 9443 9796 gene locus_tag LOCUS_27510 9443 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27510 10479 9892 gene locus_tag LOCUS_27520 10479 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27520 10741 10463 gene locus_tag LOCUS_27530 10741 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27530 11781 10984 gene locus_tag LOCUS_27540 11781 10984 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_27540 11934 12671 gene locus_tag LOCUS_27550 11934 12671 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_27550 12930 12727 gene locus_tag LOCUS_27560 12930 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 13255 12917 gene locus_tag LOCUS_27570 13255 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 14637 14203 gene locus_tag LOCUS_27580 14637 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 16292 15225 gene locus_tag LOCUS_27590 16292 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 16709 18949 gene locus_tag LOCUS_27600 gene katG 16709 18949 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963840.1 protein_id gnl|my_center|LOCUS_27600 19784 19038 gene locus_tag LOCUS_27610 19784 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 20762 19803 gene locus_tag LOCUS_27620 20762 19803 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_27620 22145 20799 gene locus_tag LOCUS_27630 22145 20799 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_27630 23256 22162 gene locus_tag LOCUS_27640 gene fni 23256 22162 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_27640 23389 23922 gene locus_tag LOCUS_27650 gene rplM 23389 23922 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902658.1 protein_id gnl|my_center|LOCUS_27650 23952 24338 gene locus_tag LOCUS_27660 gene rpsI 23952 24338 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109004.1 protein_id gnl|my_center|LOCUS_27660 24375 25106 gene locus_tag LOCUS_27670 gene rpsB 24375 25106 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_27670 25144 25986 gene locus_tag LOCUS_27680 gene tsf 25144 25986 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_27680 26086 26766 gene locus_tag LOCUS_27690 gene pyrH 26086 26766 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_27690 27770 26775 gene locus_tag LOCUS_27700 27770 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27700 27984 27778 gene locus_tag LOCUS_27710 27984 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27710 29225 28026 gene locus_tag LOCUS_27720 29225 28026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27720 30503 29511 gene locus_tag LOCUS_27730 30503 29511 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_27730 31552 30746 gene locus_tag LOCUS_27740 31552 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 31995 31561 gene locus_tag LOCUS_27750 31995 31561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 33652 32744 gene locus_tag LOCUS_27760 33652 32744 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_27760 33781 34188 gene locus_tag LOCUS_27770 33781 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 34185 34889 gene locus_tag LOCUS_27780 34185 34889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27780 34963 36465 gene locus_tag LOCUS_27790 34963 36465 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932852.1 protein_id gnl|my_center|LOCUS_27790 36569 37015 gene locus_tag LOCUS_27800 36569 37015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 37050 37583 gene locus_tag LOCUS_27810 37050 37583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 37596 38831 gene locus_tag LOCUS_27820 gene nusA 37596 38831 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_27820 39087 40136 gene locus_tag LOCUS_27830 39087 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 40180 41952 gene locus_tag LOCUS_27840 40180 41952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27840 41983 43224 gene locus_tag LOCUS_27850 41983 43224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 43231 44445 gene locus_tag LOCUS_27860 43231 44445 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_27860 44464 45531 gene locus_tag LOCUS_27870 44464 45531 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_27870 46400 45699 gene locus_tag LOCUS_27880 gene radC 46400 45699 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_27880 46816 46568 gene locus_tag LOCUS_27890 46816 46568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 46924 47340 gene locus_tag LOCUS_27900 gene rnpA 46924 47340 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_27900 47351 47857 gene locus_tag LOCUS_27910 47351 47857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 48800 47850 gene locus_tag LOCUS_27920 48800 47850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27920 49100 48813 gene locus_tag LOCUS_27930 49100 48813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27930 49966 49190 gene locus_tag LOCUS_27940 49966 49190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 50682 50029 gene locus_tag LOCUS_27950 50682 50029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 51229 50795 gene locus_tag LOCUS_27960 51229 50795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 54020 51201 gene locus_tag LOCUS_27970 54020 51201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 55034 54072 gene locus_tag LOCUS_27980 55034 54072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 55323 55694 gene locus_tag LOCUS_27990 55323 55694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 55852 56604 gene locus_tag LOCUS_28000 55852 56604 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_28000 56646 57794 gene locus_tag LOCUS_28010 56646 57794 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 protein_id gnl|my_center|LOCUS_28010 58759 57896 gene locus_tag LOCUS_28020 gene ubiA 58759 57896 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_28020 59452 58913 gene locus_tag LOCUS_28030 59452 58913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 61291 59633 gene locus_tag LOCUS_28040 61291 59633 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_28040 61758 61372 gene locus_tag LOCUS_28050 gene apaG 61758 61372 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383338.1 protein_id gnl|my_center|LOCUS_28050 62325 61762 gene locus_tag LOCUS_28060 gene gmk 62325 61762 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_28060 63290 62415 gene locus_tag LOCUS_28070 63290 62415 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_28070 63477 63791 gene locus_tag LOCUS_28080 63477 63791 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_28080 63825 64607 gene locus_tag LOCUS_28090 63825 64607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 64877 66424 gene locus_tag LOCUS_28100 64877 66424 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_28100 67029 66589 gene locus_tag LOCUS_28110 67029 66589 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_28110 67526 68638 gene locus_tag LOCUS_28120 67526 68638 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_28120 68638 69273 gene locus_tag LOCUS_28130 68638 69273 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_28130 69286 69588 gene locus_tag LOCUS_28140 69286 69588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 69814 70689 gene locus_tag LOCUS_28150 69814 70689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 70730 71446 gene locus_tag LOCUS_28160 70730 71446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 71479 72747 gene locus_tag LOCUS_28170 71479 72747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 72665 74263 gene locus_tag LOCUS_28180 72665 74263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 74472 74260 gene locus_tag LOCUS_28190 74472 74260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 75505 74456 gene locus_tag LOCUS_28200 75505 74456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 76929 75586 gene locus_tag LOCUS_28210 76929 75586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 77622 76957 gene locus_tag LOCUS_28220 77622 76957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 78485 77640 gene locus_tag LOCUS_28230 78485 77640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28230 78723 78463 gene locus_tag LOCUS_28240 78723 78463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28240 79009 79434 gene locus_tag LOCUS_28250 79009 79434 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537794.1 protein_id gnl|my_center|LOCUS_28250 79944 79489 gene locus_tag LOCUS_28260 79944 79489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 80961 80155 gene locus_tag LOCUS_28270 80961 80155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28270 82041 80998 gene locus_tag LOCUS_28280 82041 80998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28280 82300 82076 gene locus_tag LOCUS_28290 82300 82076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28290 83054 82446 gene locus_tag LOCUS_28300 83054 82446 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_28300 83229 83065 gene locus_tag LOCUS_28310 83229 83065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 84221 83175 gene locus_tag LOCUS_28320 84221 83175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 85304 84282 gene locus_tag LOCUS_28330 85304 84282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 85542 85318 gene locus_tag LOCUS_28340 85542 85318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 85996 85520 gene locus_tag LOCUS_28350 85996 85520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28350 86374 86006 gene locus_tag LOCUS_28360 86374 86006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 86438 87253 gene locus_tag LOCUS_28370 86438 87253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771186.1 protein_id gnl|my_center|LOCUS_28370 88293 87394 gene locus_tag LOCUS_28380 88293 87394 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_28380 88420 89505 gene locus_tag LOCUS_28390 88420 89505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 89436 91202 gene locus_tag LOCUS_28400 89436 91202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 91241 91507 gene locus_tag LOCUS_28410 91241 91507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 91519 91830 gene locus_tag LOCUS_28420 91519 91830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 92009 92689 gene locus_tag LOCUS_28430 92009 92689 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797352.1 protein_id gnl|my_center|LOCUS_28430 92824 93318 gene locus_tag LOCUS_28440 92824 93318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 93922 93419 gene locus_tag LOCUS_28450 93922 93419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 94545 93835 gene locus_tag LOCUS_28460 94545 93835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28460 94647 95939 gene locus_tag LOCUS_28470 94647 95939 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_28470 96025 97689 gene locus_tag LOCUS_28480 gene sulP 96025 97689 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_28480 97962 98411 gene locus_tag LOCUS_28490 97962 98411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28490 98369 98587 gene locus_tag LOCUS_28500 98369 98587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 98763 99215 gene locus_tag LOCUS_28510 98763 99215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 99252 99731 gene locus_tag LOCUS_28520 99252 99731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 100375 99737 gene locus_tag LOCUS_28530 100375 99737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 102675 100393 gene locus_tag LOCUS_28540 102675 100393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28540 103250 102702 gene locus_tag LOCUS_28550 103250 102702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28550 103782 103360 gene locus_tag LOCUS_28560 103782 103360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 104453 105490 gene locus_tag LOCUS_28570 104453 105490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090662474.1 protein_id gnl|my_center|LOCUS_28570 105601 107346 gene locus_tag LOCUS_28580 105601 107346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 107415 107894 gene locus_tag LOCUS_28590 107415 107894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 107991 108551 gene locus_tag LOCUS_28600 107991 108551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28600 108762 109532 gene locus_tag LOCUS_28610 108762 109532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 109438 109677 gene locus_tag LOCUS_28620 109438 109677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 109695 111071 gene locus_tag LOCUS_28630 109695 111071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 111621 112061 gene locus_tag LOCUS_28640 111621 112061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 112558 113286 gene locus_tag LOCUS_28650 112558 113286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 113300 117061 gene locus_tag LOCUS_28660 113300 117061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 117339 117097 gene locus_tag LOCUS_28670 117339 117097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 117280 119040 gene locus_tag LOCUS_28680 117280 119040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 120386 119151 gene locus_tag LOCUS_28690 120386 119151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 120787 120383 gene locus_tag LOCUS_28700 120787 120383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 121605 120790 gene locus_tag LOCUS_28710 121605 120790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 121971 121615 gene locus_tag LOCUS_28720 121971 121615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 123639 122365 gene locus_tag LOCUS_28730 gene nqrF 123639 122365 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_28730 124304 123690 gene locus_tag LOCUS_28740 gene nqrE 124304 123690 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418136.1 protein_id gnl|my_center|LOCUS_28740 124937 124326 gene locus_tag LOCUS_28750 124937 124326 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 protein_id gnl|my_center|LOCUS_28750 125516 125112 gene locus_tag LOCUS_28760 125516 125112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28760 125838 125530 gene locus_tag LOCUS_28770 125838 125530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 126534 125878 gene locus_tag LOCUS_28780 126534 125878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28780 127088 126531 gene locus_tag LOCUS_28790 127088 126531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28790 128832 127186 gene locus_tag LOCUS_28800 128832 127186 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_28800 129494 129033 gene locus_tag LOCUS_28810 129494 129033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 131562 129424 gene locus_tag LOCUS_28820 131562 129424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 133357 131993 gene locus_tag LOCUS_28830 133357 131993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 133944 134786 gene locus_tag LOCUS_28840 133944 134786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 135519 134890 gene locus_tag LOCUS_28850 135519 134890 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_28850 135611 136414 gene locus_tag LOCUS_28860 135611 136414 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_28860 136567 136655 gene locus_tag LOCUS_t00210 136567 136655 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 136710 137516 gene locus_tag LOCUS_28870 136710 137516 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_28870 137531 138001 gene locus_tag LOCUS_28880 137531 138001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 138009 138611 gene locus_tag LOCUS_28890 138009 138611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 138595 139074 gene locus_tag LOCUS_28900 138595 139074 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_28900 139581 139150 gene locus_tag LOCUS_28910 139581 139150 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_28910 139752 141617 gene locus_tag LOCUS_28920 139752 141617 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_28920 142259 141621 gene locus_tag LOCUS_28930 142259 141621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 144855 142333 gene locus_tag LOCUS_28940 144855 142333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 144999 145967 gene locus_tag LOCUS_28950 144999 145967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 147091 145970 gene locus_tag LOCUS_28960 147091 145970 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_28960 147311 147799 gene locus_tag LOCUS_28970 147311 147799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 147760 148251 gene locus_tag LOCUS_28980 147760 148251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 149468 148257 gene locus_tag LOCUS_28990 149468 148257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28990 150034 149432 gene locus_tag LOCUS_29000 150034 149432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 150998 150054 gene locus_tag LOCUS_29010 150998 150054 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_29010 151549 151986 gene locus_tag LOCUS_29020 151549 151986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29020 152616 152002 gene locus_tag LOCUS_29030 152616 152002 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29030 152821 152588 gene locus_tag LOCUS_29040 152821 152588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29040 153840 152941 gene locus_tag LOCUS_29050 153840 152941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 154430 153768 gene locus_tag LOCUS_29060 154430 153768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 154468 155193 gene locus_tag LOCUS_29070 gene trmB 154468 155193 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_29070 156621 155200 gene locus_tag LOCUS_29080 156621 155200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 157443 156646 gene locus_tag LOCUS_29090 gene murI 157443 156646 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_29090 157964 157452 gene locus_tag LOCUS_29100 157964 157452 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_29100 158568 158038 gene locus_tag LOCUS_29110 158568 158038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 159402 158974 gene locus_tag LOCUS_29120 159402 158974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29120 160156 159359 gene locus_tag LOCUS_29130 160156 159359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 160319 161539 gene locus_tag LOCUS_29140 160319 161539 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_29140 161582 161995 gene locus_tag LOCUS_29150 gene iscU 161582 161995 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092829.1 protein_id gnl|my_center|LOCUS_29150 162025 162363 gene locus_tag LOCUS_29160 162025 162363 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_29160 162616 163155 gene locus_tag LOCUS_29170 162616 163155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29170 163152 163793 gene locus_tag LOCUS_29180 163152 163793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29180 164384 163773 gene locus_tag LOCUS_29190 gene pnuC 164384 163773 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_29190 165298 164465 gene locus_tag LOCUS_29200 165298 164465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 166992 165295 gene locus_tag LOCUS_29210 166992 165295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 168090 167125 gene locus_tag LOCUS_29220 168090 167125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 170790 169000 gene locus_tag LOCUS_29230 gene lepA 170790 169000 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_29230 171440 170850 gene locus_tag LOCUS_29240 171440 170850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 171901 171437 gene locus_tag LOCUS_29250 171901 171437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 172261 173655 gene locus_tag LOCUS_29260 172261 173655 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258651.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29260 175088 174468 gene locus_tag LOCUS_29270 175088 174468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29270 176854 175079 gene locus_tag LOCUS_29280 176854 175079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29280 177584 176841 gene locus_tag LOCUS_29290 177584 176841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29290 177804 178550 gene locus_tag LOCUS_29300 177804 178550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 178555 180288 gene locus_tag LOCUS_29310 178555 180288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 180766 180383 gene locus_tag LOCUS_29320 180766 180383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 181113 180763 gene locus_tag LOCUS_29330 181113 180763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 181256 182728 gene locus_tag LOCUS_29340 181256 182728 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803428.1 protein_id gnl|my_center|LOCUS_29340 182712 183413 gene locus_tag LOCUS_29350 182712 183413 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_29350 183516 183845 gene locus_tag LOCUS_29360 183516 183845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 183832 184038 gene locus_tag LOCUS_29370 183832 184038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 184125 185411 gene locus_tag LOCUS_29380 184125 185411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 185473 185664 gene locus_tag LOCUS_29390 185473 185664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 185667 186017 gene locus_tag LOCUS_29400 185667 186017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 186053 186574 gene locus_tag LOCUS_29410 186053 186574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 186571 187794 gene locus_tag LOCUS_29420 186571 187794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29420 187839 188156 gene locus_tag LOCUS_29430 187839 188156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 188277 189425 gene locus_tag LOCUS_29440 gene mqnC 188277 189425 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_29440 190183 189536 gene locus_tag LOCUS_29450 gene lptB 190183 189536 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29450 190929 190195 gene locus_tag LOCUS_29460 190929 190195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 192437 191031 gene locus_tag LOCUS_29470 192437 191031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 192852 192538 gene locus_tag LOCUS_29480 192852 192538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29480 193198 192806 gene locus_tag LOCUS_29490 193198 192806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 194432 193086 gene locus_tag LOCUS_29500 194432 193086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29500 194562 195113 gene locus_tag LOCUS_29510 194562 195113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 195221 195712 gene locus_tag LOCUS_29520 195221 195712 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888078.1 protein_id gnl|my_center|LOCUS_29520 196496 195792 gene locus_tag LOCUS_29530 196496 195792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_29530 197176 196604 gene locus_tag LOCUS_29540 197176 196604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29540 197757 197173 gene locus_tag LOCUS_29550 197757 197173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 198016 198345 gene locus_tag LOCUS_29560 198016 198345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 198670 198452 gene locus_tag LOCUS_29570 198670 198452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 199580 198639 gene locus_tag LOCUS_29580 199580 198639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29580 200039 199587 gene locus_tag LOCUS_29590 200039 199587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 201858 199930 gene locus_tag LOCUS_29600 201858 199930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29600 202265 201762 gene locus_tag LOCUS_29610 202265 201762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29610 202453 202698 gene locus_tag LOCUS_29620 202453 202698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29620 202755 203300 gene locus_tag LOCUS_29630 202755 203300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29630 203364 203747 gene locus_tag LOCUS_29640 203364 203747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 203964 204566 gene locus_tag LOCUS_29650 203964 204566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 204533 206698 gene locus_tag LOCUS_29660 204533 206698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29660 206836 207459 gene locus_tag LOCUS_29670 206836 207459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 207976 208773 gene locus_tag LOCUS_29680 207976 208773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 209203 208868 gene locus_tag LOCUS_29690 gene vapC 209203 208868 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 protein_id gnl|my_center|LOCUS_29690 209460 209212 gene locus_tag LOCUS_29700 209460 209212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 209918 210238 gene locus_tag LOCUS_29710 209918 210238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 210528 211286 gene locus_tag LOCUS_29720 210528 211286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 211502 211939 gene locus_tag LOCUS_29730 211502 211939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 212207 212593 gene locus_tag LOCUS_29740 212207 212593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 215253 212755 gene locus_tag LOCUS_29750 215253 212755 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_29750 215459 216313 gene locus_tag LOCUS_29760 215459 216313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 216335 217513 gene locus_tag LOCUS_29770 216335 217513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 219104 217572 gene locus_tag LOCUS_29780 219104 217572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 219439 219074 gene locus_tag LOCUS_29790 219439 219074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 219573 220031 gene locus_tag LOCUS_29800 219573 220031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 220219 221454 gene locus_tag LOCUS_29810 220219 221454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_29810 221583 221822 gene locus_tag LOCUS_29820 221583 221822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 221804 222919 gene locus_tag LOCUS_29830 221804 222919 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29830 222943 224637 gene locus_tag LOCUS_29840 222943 224637 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942144.1 protein_id gnl|my_center|LOCUS_29840 225293 224889 gene locus_tag LOCUS_29850 225293 224889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 225529 225290 gene locus_tag LOCUS_29860 225529 225290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 225778 227160 gene locus_tag LOCUS_29870 225778 227160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 227157 228449 gene locus_tag LOCUS_29880 227157 228449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 228513 228899 gene locus_tag LOCUS_29890 228513 228899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 229207 230454 gene locus_tag LOCUS_29900 229207 230454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 230460 231128 gene locus_tag LOCUS_29910 230460 231128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29910 231170 231484 gene locus_tag LOCUS_29920 231170 231484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29920 231506 232231 gene locus_tag LOCUS_29930 231506 232231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29930 236157 232513 gene locus_tag LOCUS_29940 236157 232513 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_29940 236320 237390 gene locus_tag LOCUS_29950 236320 237390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29950 237299 237670 gene locus_tag LOCUS_29960 237299 237670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29960 >Feature sequence10 1485 151 gene locus_tag LOCUS_29970 1485 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 2234 1374 gene locus_tag LOCUS_29980 2234 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29980 2597 3505 gene locus_tag LOCUS_29990 2597 3505 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_29990 3654 3827 gene locus_tag LOCUS_30000 3654 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3827 4132 gene locus_tag LOCUS_30010 3827 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30010 4142 5068 gene locus_tag LOCUS_30020 4142 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30020 4972 5520 gene locus_tag LOCUS_30030 4972 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30030 5611 5982 gene locus_tag LOCUS_30040 5611 5982 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_30040 6787 6068 gene locus_tag LOCUS_30050 6787 6068 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_30050 8221 6797 gene locus_tag LOCUS_30060 8221 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 8429 9862 gene locus_tag LOCUS_30070 8429 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 10820 10074 gene locus_tag LOCUS_30080 10820 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 11171 10863 gene locus_tag LOCUS_30090 gene rplU 11171 10863 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_30090 11487 12653 gene locus_tag LOCUS_30100 11487 12653 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_30100 12928 13980 gene locus_tag LOCUS_30110 12928 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 14183 16951 gene locus_tag LOCUS_30120 14183 16951 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055271316.1 protein_id gnl|my_center|LOCUS_30120 17372 19417 gene locus_tag LOCUS_30130 17372 19417 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_30130 19792 19565 gene locus_tag LOCUS_30140 19792 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 20949 19786 gene locus_tag LOCUS_30150 20949 19786 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30150 21073 21348 gene locus_tag LOCUS_30160 21073 21348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30160 21329 21991 gene locus_tag LOCUS_30170 21329 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30170 22160 23092 gene locus_tag LOCUS_30180 22160 23092 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_30180 23661 23338 gene locus_tag LOCUS_30190 23661 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30190 23919 24248 gene locus_tag LOCUS_30200 23919 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30200 24482 26275 gene locus_tag LOCUS_30210 24482 26275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30210 26403 27404 gene locus_tag LOCUS_30220 26403 27404 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_30220 27769 27527 gene locus_tag LOCUS_30230 27769 27527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 28295 27780 gene locus_tag LOCUS_30240 28295 27780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30240 28477 28298 gene locus_tag LOCUS_30250 28477 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 30181 28634 gene locus_tag LOCUS_30260 30181 28634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 30810 30184 gene locus_tag LOCUS_30270 30810 30184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 32158 30827 gene locus_tag LOCUS_30280 32158 30827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 32437 32363 gene locus_tag LOCUS_t00220 32437 32363 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32805 32575 gene locus_tag LOCUS_30290 32805 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 37075 33461 gene locus_tag LOCUS_30300 37075 33461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30300 39153 37591 gene locus_tag LOCUS_30310 39153 37591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30310 42040 39296 gene locus_tag LOCUS_30320 42040 39296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 43334 42261 gene locus_tag LOCUS_30330 43334 42261 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_30330 44364 43402 gene locus_tag LOCUS_30340 gene yedA 44364 43402 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_30340 44646 45455 gene locus_tag LOCUS_30350 44646 45455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30350 45353 46459 gene locus_tag LOCUS_30360 45353 46459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30360 46459 47055 gene locus_tag LOCUS_30370 46459 47055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 47182 48333 gene locus_tag LOCUS_30380 gene aruH 47182 48333 CDS product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 protein_id gnl|my_center|LOCUS_30380 48859 48470 gene locus_tag LOCUS_30390 48859 48470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 49300 49644 gene locus_tag LOCUS_30400 49300 49644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 49966 49805 gene locus_tag LOCUS_30410 49966 49805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 51639 50854 gene locus_tag LOCUS_30420 51639 50854 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_30420 53766 51760 gene locus_tag LOCUS_30430 53766 51760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 53940 54878 gene locus_tag LOCUS_30440 53940 54878 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_30440 55466 55281 gene locus_tag LOCUS_30450 55466 55281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30450 55692 55510 gene locus_tag LOCUS_30460 55692 55510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 55901 55692 gene locus_tag LOCUS_30470 55901 55692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 56305 55832 gene locus_tag LOCUS_30480 56305 55832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 58015 56528 gene locus_tag LOCUS_30490 58015 56528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 59251 58145 gene locus_tag LOCUS_30500 59251 58145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 60498 59434 gene locus_tag LOCUS_30510 60498 59434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 60874 61224 gene locus_tag LOCUS_30520 60874 61224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 63585 61435 gene locus_tag LOCUS_30530 63585 61435 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832365.1 protein_id gnl|my_center|LOCUS_30530 63792 64526 gene locus_tag LOCUS_30540 gene sodA 63792 64526 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_30540 65781 64603 gene locus_tag LOCUS_30550 65781 64603 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_30550 66093 65848 gene locus_tag LOCUS_30560 66093 65848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 66169 66336 gene locus_tag LOCUS_30570 66169 66336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 67073 66399 gene locus_tag LOCUS_30580 67073 66399 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_30580 67603 67169 gene locus_tag LOCUS_30590 67603 67169 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_30590 69050 67620 gene locus_tag LOCUS_30600 gene ccoG 69050 67620 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_30600 70102 69140 gene locus_tag LOCUS_30610 70102 69140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 70282 70106 gene locus_tag LOCUS_30620 70282 70106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 72435 70363 gene locus_tag LOCUS_30630 gene ccoN 72435 70363 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_30630 72602 72435 gene locus_tag LOCUS_30640 72602 72435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 72863 73285 gene locus_tag LOCUS_30650 72863 73285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 73608 73826 gene locus_tag LOCUS_30660 73608 73826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 73829 75193 gene locus_tag LOCUS_30670 73829 75193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 75233 75838 gene locus_tag LOCUS_30680 75233 75838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 75835 76767 gene locus_tag LOCUS_30690 75835 76767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 76929 78215 gene locus_tag LOCUS_30700 76929 78215 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_30700 79077 78325 gene locus_tag LOCUS_30710 79077 78325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 80477 79083 gene locus_tag LOCUS_30720 80477 79083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 80753 82243 gene locus_tag LOCUS_30730 80753 82243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 83177 82740 gene locus_tag LOCUS_30740 83177 82740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 86320 83456 gene locus_tag LOCUS_30750 86320 83456 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_30750 86552 86695 gene locus_tag LOCUS_30760 86552 86695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 87212 88153 gene locus_tag LOCUS_30770 87212 88153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 89057 88284 gene locus_tag LOCUS_30780 89057 88284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 90133 89069 gene locus_tag LOCUS_30790 90133 89069 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_30790 91254 90268 gene locus_tag LOCUS_30800 91254 90268 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_30800 91357 91776 gene locus_tag LOCUS_30810 91357 91776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 91907 92494 gene locus_tag LOCUS_30820 91907 92494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 92501 94372 gene locus_tag LOCUS_30830 92501 94372 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_30830 95071 94562 gene locus_tag LOCUS_30840 95071 94562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 96783 95398 gene locus_tag LOCUS_30850 96783 95398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 97431 96847 gene locus_tag LOCUS_30860 97431 96847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 98236 97679 gene locus_tag LOCUS_30870 98236 97679 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_30870 98862 98263 gene locus_tag LOCUS_30880 98862 98263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 99205 98921 gene locus_tag LOCUS_30890 99205 98921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 99788 100927 gene locus_tag LOCUS_30900 99788 100927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 100876 101235 gene locus_tag LOCUS_30910 100876 101235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 101289 102893 gene locus_tag LOCUS_30920 101289 102893 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_30920 103045 104421 gene locus_tag LOCUS_30930 103045 104421 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30930 104318 104593 gene locus_tag LOCUS_30940 104318 104593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 104805 105395 gene locus_tag LOCUS_30950 104805 105395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 105413 105931 gene locus_tag LOCUS_30960 105413 105931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30960 105928 106722 gene locus_tag LOCUS_30970 105928 106722 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_30970 107369 108043 gene locus_tag LOCUS_30980 107369 108043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30980 108108 109037 gene locus_tag LOCUS_30990 108108 109037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30990 109163 110356 gene locus_tag LOCUS_31000 109163 110356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_31000 111182 110349 gene locus_tag LOCUS_31010 111182 110349 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973550.1 protein_id gnl|my_center|LOCUS_31010 111464 111234 gene locus_tag LOCUS_31020 111464 111234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31020 112780 111521 gene locus_tag LOCUS_31030 112780 111521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31030 112945 114378 gene locus_tag LOCUS_31040 gene pyk 112945 114378 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_31040 115879 114470 gene locus_tag LOCUS_31050 115879 114470 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_31050 116032 116253 gene locus_tag LOCUS_31060 116032 116253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 116254 116637 gene locus_tag LOCUS_31070 116254 116637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31070 116634 117065 gene locus_tag LOCUS_31080 116634 117065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31080 117856 117275 gene locus_tag LOCUS_31090 117856 117275 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_31090 118295 119944 gene locus_tag LOCUS_31100 118295 119944 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_31100 120708 120139 gene locus_tag LOCUS_31110 120708 120139 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_31110 121471 120752 gene locus_tag LOCUS_31120 121471 120752 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962995.1 protein_id gnl|my_center|LOCUS_31120 122039 121584 gene locus_tag LOCUS_31130 122039 121584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 122546 122346 gene locus_tag LOCUS_31140 122546 122346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 123125 122901 gene locus_tag LOCUS_31150 123125 122901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 123536 123688 gene locus_tag LOCUS_31160 123536 123688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 123670 124002 gene locus_tag LOCUS_31170 123670 124002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31170 124025 125062 gene locus_tag LOCUS_31180 124025 125062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31180 125601 125155 gene locus_tag LOCUS_31190 125601 125155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 125685 126938 gene locus_tag LOCUS_31200 gene xseA 125685 126938 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_31200 126979 127176 gene locus_tag LOCUS_31210 126979 127176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 127222 127461 gene locus_tag LOCUS_31220 127222 127461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31220 127376 128065 gene locus_tag LOCUS_31230 127376 128065 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31230 128075 129169 gene locus_tag LOCUS_31240 128075 129169 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_31240 129214 130242 gene locus_tag LOCUS_31250 129214 130242 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_31250 130255 131076 gene locus_tag LOCUS_31260 130255 131076 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_31260 131054 131938 gene locus_tag LOCUS_31270 131054 131938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 131965 132726 gene locus_tag LOCUS_31280 131965 132726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 132885 133844 gene locus_tag LOCUS_31290 132885 133844 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_31290 133858 134577 gene locus_tag LOCUS_31300 133858 134577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 134732 134971 gene locus_tag LOCUS_31310 134732 134971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31310 136648 135509 gene locus_tag LOCUS_31320 136648 135509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31320 138353 136596 gene locus_tag LOCUS_31330 138353 136596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 138678 139361 gene locus_tag LOCUS_31340 138678 139361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546133.1 protein_id gnl|my_center|LOCUS_31340 140361 139348 gene locus_tag LOCUS_31350 gene murB 140361 139348 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_31350 141502 140393 gene locus_tag LOCUS_31360 gene mnmA 141502 140393 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_31360 141660 142640 gene locus_tag LOCUS_31370 141660 142640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 142940 142746 gene locus_tag LOCUS_31380 142940 142746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31380 143758 142898 gene locus_tag LOCUS_31390 143758 142898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31390 144090 145622 gene locus_tag LOCUS_31400 144090 145622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 145766 146437 gene locus_tag LOCUS_31410 145766 146437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31410 146386 147801 gene locus_tag LOCUS_31420 146386 147801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 148701 147838 gene locus_tag LOCUS_31430 148701 147838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 148930 148706 gene locus_tag LOCUS_31440 148930 148706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 150093 148927 gene locus_tag LOCUS_31450 150093 148927 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861789.1 protein_id gnl|my_center|LOCUS_31450 150280 151557 gene locus_tag LOCUS_31460 150280 151557 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404924.1 protein_id gnl|my_center|LOCUS_31460 151658 152239 gene locus_tag LOCUS_31470 151658 152239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 152239 152445 gene locus_tag LOCUS_31480 152239 152445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 152463 152669 gene locus_tag LOCUS_31490 152463 152669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 152685 153617 gene locus_tag LOCUS_31500 152685 153617 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_31500 154612 153677 gene locus_tag LOCUS_31510 154612 153677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 156186 154510 gene locus_tag LOCUS_31520 156186 154510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 157227 156220 gene locus_tag LOCUS_31530 157227 156220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 157453 157301 gene locus_tag LOCUS_31540 157453 157301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 157886 157581 gene locus_tag LOCUS_31550 157886 157581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 157954 158259 gene locus_tag LOCUS_31560 157954 158259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31560 158256 158660 gene locus_tag LOCUS_31570 158256 158660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31570 158719 159309 gene locus_tag LOCUS_31580 158719 159309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 159309 160061 gene locus_tag LOCUS_31590 159309 160061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 160901 160200 gene locus_tag LOCUS_31600 160901 160200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 168154 160907 gene locus_tag LOCUS_31610 168154 160907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 169248 168142 gene locus_tag LOCUS_31620 169248 168142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 169656 170198 gene locus_tag LOCUS_31630 169656 170198 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_31630 170224 170415 gene locus_tag LOCUS_31640 gene rpmF 170224 170415 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_31640 170530 170913 gene locus_tag LOCUS_31650 170530 170913 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_31650 171032 172042 gene locus_tag LOCUS_31660 gene trpS 171032 172042 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_31660 172161 172781 gene locus_tag LOCUS_31670 172161 172781 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_31670 175231 172916 gene locus_tag LOCUS_31680 175231 172916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 175399 176004 gene locus_tag LOCUS_31690 175399 176004 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_31690 176093 176659 gene locus_tag LOCUS_31700 176093 176659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31700 176680 178068 gene locus_tag LOCUS_31710 176680 178068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31710 178240 181230 gene locus_tag LOCUS_31720 178240 181230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 181984 181307 gene locus_tag LOCUS_31730 gene can 181984 181307 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_31730 183636 181981 gene locus_tag LOCUS_31740 183636 181981 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_31740 188320 184199 gene locus_tag LOCUS_31750 188320 184199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 189436 188396 gene locus_tag LOCUS_31760 189436 188396 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_31760 190507 189551 gene locus_tag LOCUS_31770 190507 189551 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_31770 190674 191879 gene locus_tag LOCUS_31780 190674 191879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 192958 192374 gene locus_tag LOCUS_31790 192958 192374 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_31790 193059 193475 gene locus_tag LOCUS_31800 193059 193475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 193509 194618 gene locus_tag LOCUS_31810 193509 194618 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_31810 194781 195914 gene locus_tag LOCUS_31820 194781 195914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31820 195844 198078 gene locus_tag LOCUS_31830 195844 198078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31830 199918 198167 gene locus_tag LOCUS_31840 199918 198167 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090974988.1 protein_id gnl|my_center|LOCUS_31840 200086 200931 gene locus_tag LOCUS_31850 200086 200931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31850 200946 201269 gene locus_tag LOCUS_31860 200946 201269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31860 201453 203459 gene locus_tag LOCUS_31870 201453 203459 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_31870 204627 203677 gene locus_tag LOCUS_31880 204627 203677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 205039 204632 gene locus_tag LOCUS_31890 205039 204632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31890 205540 205046 gene locus_tag LOCUS_31900 205540 205046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 207155 205650 gene locus_tag LOCUS_31910 207155 205650 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31910 207418 207134 gene locus_tag LOCUS_31920 207418 207134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 207817 207482 gene locus_tag LOCUS_31930 207817 207482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 208190 207795 gene locus_tag LOCUS_31940 208190 207795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 208398 210251 gene locus_tag LOCUS_31950 208398 210251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31950 210248 210904 gene locus_tag LOCUS_31960 210248 210904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31960 211064 211405 gene locus_tag LOCUS_31970 211064 211405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31970 211402 211776 gene locus_tag LOCUS_31980 211402 211776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31980 212576 211884 gene locus_tag LOCUS_31990 212576 211884 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_31990 212754 212891 gene locus_tag LOCUS_32000 212754 212891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 213096 214085 gene locus_tag LOCUS_32010 213096 214085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 214096 214593 gene locus_tag LOCUS_32020 gene paaJ 214096 214593 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_32020 214756 215388 gene locus_tag LOCUS_32030 214756 215388 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_32030 215869 215465 gene locus_tag LOCUS_32040 215869 215465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 217052 215877 gene locus_tag LOCUS_32050 217052 215877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 217663 217202 gene locus_tag LOCUS_32060 217663 217202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 218386 217664 gene locus_tag LOCUS_32070 218386 217664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 219490 218411 gene locus_tag LOCUS_32080 219490 218411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 220034 219615 gene locus_tag LOCUS_32090 220034 219615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 220379 220050 gene locus_tag LOCUS_32100 220379 220050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 221007 221360 gene locus_tag LOCUS_32110 221007 221360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 221384 222601 gene locus_tag LOCUS_32120 221384 222601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 223327 222632 gene locus_tag LOCUS_32130 223327 222632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 223677 223555 gene locus_tag LOCUS_32140 223677 223555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32140 225025 223667 gene locus_tag LOCUS_32150 225025 223667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32150 226623 227285 gene locus_tag LOCUS_32160 226623 227285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 227544 229460 gene locus_tag LOCUS_32170 227544 229460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 229551 229769 gene locus_tag LOCUS_32180 229551 229769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 230218 230514 gene locus_tag LOCUS_32190 230218 230514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence11 2000 837 gene locus_tag LOCUS_32200 2000 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3498 6350 gene locus_tag LOCUS_32210 gene uvrA 3498 6350 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_32210 6742 8106 gene locus_tag LOCUS_32220 6742 8106 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_32220 8143 9216 gene locus_tag LOCUS_32230 8143 9216 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_32230 9408 12194 gene locus_tag LOCUS_32240 9408 12194 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32240 12109 12537 gene locus_tag LOCUS_32250 12109 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32250 12608 13969 gene locus_tag LOCUS_32260 12608 13969 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538117.1 protein_id gnl|my_center|LOCUS_32260 14882 14046 gene locus_tag LOCUS_32270 14882 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 15627 14797 gene locus_tag LOCUS_32280 15627 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 15757 15620 gene locus_tag LOCUS_32290 15757 15620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 16011 15778 gene locus_tag LOCUS_32300 16011 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 16492 16109 gene locus_tag LOCUS_32310 16492 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 16758 16543 gene locus_tag LOCUS_32320 16758 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 23567 17055 gene locus_tag LOCUS_32330 23567 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 24075 23509 gene locus_tag LOCUS_32340 24075 23509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 28121 24156 gene locus_tag LOCUS_32350 28121 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 28293 28078 gene locus_tag LOCUS_32360 28293 28078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 29775 28645 gene locus_tag LOCUS_32370 29775 28645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 30125 29790 gene locus_tag LOCUS_32380 30125 29790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 31127 30144 gene locus_tag LOCUS_32390 31127 30144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 31652 31203 gene locus_tag LOCUS_32400 31652 31203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32400 32153 31800 gene locus_tag LOCUS_32410 32153 31800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32410 33049 32102 gene locus_tag LOCUS_32420 33049 32102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32420 33339 33121 gene locus_tag LOCUS_32430 33339 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32430 33903 33520 gene locus_tag LOCUS_32440 33903 33520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32440 34223 33933 gene locus_tag LOCUS_32450 34223 33933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32450 34571 34383 gene locus_tag LOCUS_32460 34571 34383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32460 35234 34983 gene locus_tag LOCUS_32470 35234 34983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32470 35920 35654 gene locus_tag LOCUS_32480 35920 35654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32480 36304 35945 gene locus_tag LOCUS_32490 36304 35945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32490 37538 36735 gene locus_tag LOCUS_32500 37538 36735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32500 39976 37619 gene locus_tag LOCUS_32510 39976 37619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32510 41996 39897 gene locus_tag LOCUS_32520 41996 39897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32520 42370 42149 gene locus_tag LOCUS_32530 42370 42149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 43793 42345 gene locus_tag LOCUS_32540 43793 42345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 44242 43946 gene locus_tag LOCUS_32550 44242 43946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 49338 44176 gene locus_tag LOCUS_32560 49338 44176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 51580 49262 gene locus_tag LOCUS_32570 51580 49262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 56526 51655 gene locus_tag LOCUS_32580 56526 51655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32580 62701 57248 gene locus_tag LOCUS_32590 62701 57248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 64451 62910 gene locus_tag LOCUS_32600 64451 62910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 67025 65280 gene locus_tag LOCUS_32610 67025 65280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 67396 66959 gene locus_tag LOCUS_32620 67396 66959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 67795 67409 gene locus_tag LOCUS_32630 67795 67409 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_32630 68029 68988 gene locus_tag LOCUS_32640 68029 68988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 69172 70998 gene locus_tag LOCUS_32650 gene uvrC 69172 70998 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_32650 71860 71132 gene locus_tag LOCUS_32660 71860 71132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 72503 72042 gene locus_tag LOCUS_32670 72503 72042 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_32670 72804 74108 gene locus_tag LOCUS_32680 72804 74108 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_32680 74852 74190 gene locus_tag LOCUS_32690 74852 74190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 75892 75011 gene locus_tag LOCUS_32700 75892 75011 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_32700 76177 77148 gene locus_tag LOCUS_32710 gene pfkA 76177 77148 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_32710 77161 78045 gene locus_tag LOCUS_32720 gene kdsA 77161 78045 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785350.1 protein_id gnl|my_center|LOCUS_32720 78215 78439 gene locus_tag LOCUS_32730 78215 78439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 79147 78473 gene locus_tag LOCUS_32740 79147 78473 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_32740 79758 79267 gene locus_tag LOCUS_32750 79758 79267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 81431 80061 gene locus_tag LOCUS_32760 81431 80061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 82066 81428 gene locus_tag LOCUS_32770 82066 81428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 82687 82103 gene locus_tag LOCUS_32780 gene purN 82687 82103 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_32780 83170 84519 gene locus_tag LOCUS_32790 83170 84519 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32790 84845 85219 gene locus_tag LOCUS_32800 84845 85219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32800 85408 85788 gene locus_tag LOCUS_32810 85408 85788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 86901 85966 gene locus_tag LOCUS_32820 86901 85966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 87780 86998 gene locus_tag LOCUS_32830 87780 86998 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_32830 88648 87935 gene locus_tag LOCUS_32840 88648 87935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32840 89382 88603 gene locus_tag LOCUS_32850 89382 88603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32850 89860 89321 gene locus_tag LOCUS_32860 89860 89321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32860 90351 89947 gene locus_tag LOCUS_32870 90351 89947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32870 90893 90561 gene locus_tag LOCUS_32880 90893 90561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32880 92385 91000 gene locus_tag LOCUS_32890 92385 91000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 93036 92512 gene locus_tag LOCUS_32900 93036 92512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32900 93432 93100 gene locus_tag LOCUS_32910 93432 93100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32910 93464 94267 gene locus_tag LOCUS_32920 93464 94267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32920 94252 94548 gene locus_tag LOCUS_32930 94252 94548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32930 94706 95803 gene locus_tag LOCUS_32940 94706 95803 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922549.1 protein_id gnl|my_center|LOCUS_32940 95814 96884 gene locus_tag LOCUS_32950 95814 96884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 97210 96950 gene locus_tag LOCUS_32960 97210 96950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 97311 97171 gene locus_tag LOCUS_32970 97311 97171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 97448 98608 gene locus_tag LOCUS_32980 gene aroB 97448 98608 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_32980 98775 100046 gene locus_tag LOCUS_32990 98775 100046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32990 100043 101047 gene locus_tag LOCUS_33000 100043 101047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33000 101004 101312 gene locus_tag LOCUS_33010 101004 101312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 102135 101407 gene locus_tag LOCUS_33020 102135 101407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 102637 102341 gene locus_tag LOCUS_33030 102637 102341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33030 102880 102677 gene locus_tag LOCUS_33040 102880 102677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33040 103433 102867 gene locus_tag LOCUS_33050 103433 102867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 106242 103525 gene locus_tag LOCUS_33060 106242 103525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 106538 106248 gene locus_tag LOCUS_33070 106538 106248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 107014 106634 gene locus_tag LOCUS_33080 107014 106634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 107854 107066 gene locus_tag LOCUS_33090 107854 107066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 107962 108645 gene locus_tag LOCUS_33100 107962 108645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 108847 109404 gene locus_tag LOCUS_33110 108847 109404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 109764 109390 gene locus_tag LOCUS_33120 109764 109390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 111476 109917 gene locus_tag LOCUS_33130 111476 109917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 113051 111618 gene locus_tag LOCUS_33140 113051 111618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 114687 113119 gene locus_tag LOCUS_33150 114687 113119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33150 114785 114859 gene locus_tag LOCUS_t00230 114785 114859 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 115543 118641 gene locus_tag LOCUS_33160 115543 118641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33160 118730 119221 gene locus_tag LOCUS_33170 118730 119221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33170 119466 119257 gene locus_tag LOCUS_33180 119466 119257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 119697 119876 gene locus_tag LOCUS_33190 119697 119876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 119931 121202 gene locus_tag LOCUS_33200 119931 121202 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_33200 121269 123284 gene locus_tag LOCUS_33210 121269 123284 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_33210 124551 123250 gene locus_tag LOCUS_33220 124551 123250 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_33220 124997 124548 gene locus_tag LOCUS_33230 gene umuD 124997 124548 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_33230 125183 125617 gene locus_tag LOCUS_33240 125183 125617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 125792 126901 gene locus_tag LOCUS_33250 125792 126901 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_33250 127178 126969 gene locus_tag LOCUS_33260 127178 126969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 128176 127232 gene locus_tag LOCUS_33270 128176 127232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 135883 128396 gene locus_tag LOCUS_33280 135883 128396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 137604 135880 gene locus_tag LOCUS_33290 137604 135880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 138104 137601 gene locus_tag LOCUS_33300 138104 137601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 138498 138268 gene locus_tag LOCUS_33310 138498 138268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 141145 138593 gene locus_tag LOCUS_33320 141145 138593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 144000 141121 gene locus_tag LOCUS_33330 144000 141121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 144653 143997 gene locus_tag LOCUS_33340 144653 143997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 145292 145483 gene locus_tag LOCUS_33350 145292 145483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 147054 147239 gene locus_tag LOCUS_33360 147054 147239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 148549 148785 gene locus_tag LOCUS_33370 148549 148785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 149659 150486 gene locus_tag LOCUS_33380 149659 150486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33380 151722 150469 gene locus_tag LOCUS_33390 151722 150469 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_33390 152196 151738 gene locus_tag LOCUS_33400 152196 151738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33400 152513 152217 gene locus_tag LOCUS_33410 152513 152217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33410 153664 152609 gene locus_tag LOCUS_33420 153664 152609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 154130 154675 gene locus_tag LOCUS_33430 154130 154675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 154811 155155 gene locus_tag LOCUS_33440 154811 155155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 155182 155943 gene locus_tag LOCUS_33450 155182 155943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33450 155981 157444 gene locus_tag LOCUS_33460 gene malL 155981 157444 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33460 157438 157788 gene locus_tag LOCUS_33470 157438 157788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33470 159232 157742 gene locus_tag LOCUS_33480 159232 157742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 159575 159276 gene locus_tag LOCUS_33490 159575 159276 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_33490 160252 159572 gene locus_tag LOCUS_33500 160252 159572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 160633 161865 gene locus_tag LOCUS_33510 160633 161865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33510 161913 163577 gene locus_tag LOCUS_33520 161913 163577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33520 163638 165212 gene locus_tag LOCUS_33530 163638 165212 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_33530 165236 167092 gene locus_tag LOCUS_33540 165236 167092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 168631 167177 gene locus_tag LOCUS_33550 gene gabD 168631 167177 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_33550 168725 168651 gene locus_tag LOCUS_t00240 168725 168651 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 168858 169715 gene locus_tag LOCUS_33560 168858 169715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 169778 170011 gene locus_tag LOCUS_33570 169778 170011 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_33570 170668 170024 gene locus_tag LOCUS_33580 170668 170024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 172305 170872 gene locus_tag LOCUS_33590 172305 170872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33590 173149 172316 gene locus_tag LOCUS_33600 173149 172316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33600 173713 173462 gene locus_tag LOCUS_33610 173713 173462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 175597 173753 gene locus_tag LOCUS_33620 175597 173753 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33620 177591 175708 gene locus_tag LOCUS_33630 177591 175708 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_33630 177856 178314 gene locus_tag LOCUS_33640 177856 178314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33640 178333 179238 gene locus_tag LOCUS_33650 178333 179238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33650 179686 179907 gene locus_tag LOCUS_33660 179686 179907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 180036 180338 gene locus_tag LOCUS_33670 180036 180338 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_33670 180319 180738 gene locus_tag LOCUS_33680 180319 180738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 180991 181626 gene locus_tag LOCUS_33690 180991 181626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33690 181617 182135 gene locus_tag LOCUS_33700 181617 182135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33700 182324 182629 gene locus_tag LOCUS_33710 182324 182629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 182638 183201 gene locus_tag LOCUS_33720 182638 183201 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_33720 183483 184583 gene locus_tag LOCUS_33730 183483 184583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 185390 185884 gene locus_tag LOCUS_33740 185390 185884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 186120 186665 gene locus_tag LOCUS_33750 186120 186665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 188250 186619 gene locus_tag LOCUS_33760 188250 186619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 188975 188247 gene locus_tag LOCUS_33770 188975 188247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 189208 188987 gene locus_tag LOCUS_33780 189208 188987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 189519 189235 gene locus_tag LOCUS_33790 189519 189235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 190253 189684 gene locus_tag LOCUS_33800 190253 189684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 190820 190446 gene locus_tag LOCUS_33810 190820 190446 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263478.1 protein_id gnl|my_center|LOCUS_33810 190949 191800 gene locus_tag LOCUS_33820 190949 191800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33820 191850 192317 gene locus_tag LOCUS_33830 191850 192317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 192620 194368 gene locus_tag LOCUS_33840 192620 194368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 195654 194533 gene locus_tag LOCUS_33850 195654 194533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 195807 196535 gene locus_tag LOCUS_33860 195807 196535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 196661 197515 gene locus_tag LOCUS_33870 gene speB 196661 197515 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_33870 198311 197538 gene locus_tag LOCUS_33880 198311 197538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 199128 198328 gene locus_tag LOCUS_33890 199128 198328 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_33890 199648 199130 gene locus_tag LOCUS_33900 199648 199130 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_33900 199794 200987 gene locus_tag LOCUS_33910 199794 200987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 201597 201136 gene locus_tag LOCUS_33920 201597 201136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33920 203031 202114 gene locus_tag LOCUS_33930 203031 202114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33930 203912 203028 gene locus_tag LOCUS_33940 203912 203028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 204729 203899 gene locus_tag LOCUS_33950 204729 203899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 205292 205747 gene locus_tag LOCUS_33960 205292 205747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 205767 206942 gene locus_tag LOCUS_33970 205767 206942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 206947 208023 gene locus_tag LOCUS_33980 206947 208023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 208404 207997 gene locus_tag LOCUS_33990 208404 207997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 208604 208401 gene locus_tag LOCUS_34000 208604 208401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 210379 208508 gene locus_tag LOCUS_34010 210379 208508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 210652 210852 gene locus_tag LOCUS_34020 210652 210852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 211527 212075 gene locus_tag LOCUS_34030 211527 212075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence12 840 562 gene locus_tag LOCUS_34040 840 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34040 1943 819 gene locus_tag LOCUS_34050 gene leuC 1943 819 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34050 3138 1975 gene locus_tag LOCUS_34060 3138 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3334 3522 gene locus_tag LOCUS_34070 3334 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 3531 4868 gene locus_tag LOCUS_34080 3531 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 5766 4870 gene locus_tag LOCUS_34090 gene ychF 5766 4870 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34090 5966 5778 gene locus_tag LOCUS_34100 5966 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34100 6053 6619 gene locus_tag LOCUS_34110 6053 6619 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_34110 7450 6644 gene locus_tag LOCUS_34120 7450 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 9268 7736 gene locus_tag LOCUS_34130 9268 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 9498 9965 gene locus_tag LOCUS_34140 gene ybaK 9498 9965 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815307.1 protein_id gnl|my_center|LOCUS_34140 10237 9962 gene locus_tag LOCUS_34150 10237 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34150 10644 10204 gene locus_tag LOCUS_34160 10644 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34160 10728 11084 gene locus_tag LOCUS_34170 10728 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 11240 12247 gene locus_tag LOCUS_34180 11240 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34180 12253 12570 gene locus_tag LOCUS_34190 12253 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34190 13142 12651 gene locus_tag LOCUS_34200 13142 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 13733 13164 gene locus_tag LOCUS_34210 13733 13164 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_34210 13855 14205 gene locus_tag LOCUS_34220 13855 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 14261 14866 gene locus_tag LOCUS_34230 14261 14866 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920958.1 protein_id gnl|my_center|LOCUS_34230 15104 15826 gene locus_tag LOCUS_34240 15104 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 15898 16236 gene locus_tag LOCUS_34250 15898 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 16262 17890 gene locus_tag LOCUS_34260 16262 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 17794 18330 gene locus_tag LOCUS_34270 17794 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34270 18378 19211 gene locus_tag LOCUS_34280 18378 19211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 19535 20005 gene locus_tag LOCUS_34290 19535 20005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 20107 22164 gene locus_tag LOCUS_34300 20107 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 22226 22591 gene locus_tag LOCUS_34310 22226 22591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34310 22822 23052 gene locus_tag LOCUS_34320 22822 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 22950 24377 gene locus_tag LOCUS_34330 22950 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 24469 25296 gene locus_tag LOCUS_34340 24469 25296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34340 25275 26117 gene locus_tag LOCUS_34350 25275 26117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 26123 27049 gene locus_tag LOCUS_34360 26123 27049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 27102 27347 gene locus_tag LOCUS_34370 27102 27347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 27736 27344 gene locus_tag LOCUS_34380 27736 27344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34380 29517 27805 gene locus_tag LOCUS_34390 29517 27805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 29922 29686 gene locus_tag LOCUS_34400 29922 29686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 29870 31402 gene locus_tag LOCUS_34410 29870 31402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34410 31399 33417 gene locus_tag LOCUS_34420 31399 33417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34420 34100 33414 gene locus_tag LOCUS_34430 34100 33414 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_34430 35738 34122 gene locus_tag LOCUS_34440 35738 34122 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_34440 38874 36043 gene locus_tag LOCUS_34450 38874 36043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 39009 40199 gene locus_tag LOCUS_34460 gene rnd 39009 40199 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_34460 40206 41936 gene locus_tag LOCUS_34470 40206 41936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_34470 43814 42126 gene locus_tag LOCUS_34480 43814 42126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 44093 44341 gene locus_tag LOCUS_34490 44093 44341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 45240 44338 gene locus_tag LOCUS_34500 45240 44338 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_34500 45593 45237 gene locus_tag LOCUS_34510 45593 45237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 47035 45590 gene locus_tag LOCUS_34520 47035 45590 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34520 47739 47116 gene locus_tag LOCUS_34530 47739 47116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34530 48029 47649 gene locus_tag LOCUS_34540 48029 47649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34540 49020 48034 gene locus_tag LOCUS_34550 49020 48034 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994177.1 protein_id gnl|my_center|LOCUS_34550 49124 51313 gene locus_tag LOCUS_34560 49124 51313 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_34560 51324 52658 gene locus_tag LOCUS_34570 51324 52658 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_34570 53533 52655 gene locus_tag LOCUS_34580 53533 52655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34580 53978 53451 gene locus_tag LOCUS_34590 53978 53451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34590 57712 54458 gene locus_tag LOCUS_34600 57712 54458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 57973 57746 gene locus_tag LOCUS_34610 57973 57746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 58244 57957 gene locus_tag LOCUS_34620 58244 57957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34620 58356 58850 gene locus_tag LOCUS_34630 58356 58850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 58947 59312 gene locus_tag LOCUS_34640 58947 59312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 59245 60225 gene locus_tag LOCUS_34650 59245 60225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 60259 62196 gene locus_tag LOCUS_34660 gene dnaG 60259 62196 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_34660 65423 62214 gene locus_tag LOCUS_34670 65423 62214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 65681 66400 gene locus_tag LOCUS_34680 65681 66400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 66436 68334 gene locus_tag LOCUS_34690 66436 68334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 68521 68348 gene locus_tag LOCUS_34700 68521 68348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 69930 68650 gene locus_tag LOCUS_34710 69930 68650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34710 70828 70103 gene locus_tag LOCUS_34720 70828 70103 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_34720 71735 70836 gene locus_tag LOCUS_34730 71735 70836 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_34730 72836 71883 gene locus_tag LOCUS_34740 72836 71883 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_34740 72967 74061 gene locus_tag LOCUS_34750 72967 74061 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_34750 74085 75170 gene locus_tag LOCUS_34760 74085 75170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 76171 75152 gene locus_tag LOCUS_34770 76171 75152 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_34770 77373 76192 gene locus_tag LOCUS_34780 77373 76192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34780 78746 77370 gene locus_tag LOCUS_34790 78746 77370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34790 79350 79640 gene locus_tag LOCUS_34800 79350 79640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34800 79656 80048 gene locus_tag LOCUS_34810 79656 80048 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_34810 80050 80265 gene locus_tag LOCUS_34820 80050 80265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 80262 80456 gene locus_tag LOCUS_34830 80262 80456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 80705 81559 gene locus_tag LOCUS_34840 80705 81559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 81565 82869 gene locus_tag LOCUS_34850 81565 82869 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_34850 83895 82864 gene locus_tag LOCUS_34860 83895 82864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 85507 84095 gene locus_tag LOCUS_34870 85507 84095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 86331 85612 gene locus_tag LOCUS_34880 86331 85612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 86890 86429 gene locus_tag LOCUS_34890 86890 86429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 88323 86887 gene locus_tag LOCUS_34900 88323 86887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34900 89339 88284 gene locus_tag LOCUS_34910 89339 88284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34910 90025 89336 gene locus_tag LOCUS_34920 90025 89336 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_34920 90533 90700 gene locus_tag LOCUS_34930 90533 90700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 91503 90853 gene locus_tag LOCUS_34940 91503 90853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34940 92072 91527 gene locus_tag LOCUS_34950 92072 91527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34950 92722 92087 gene locus_tag LOCUS_34960 gene pncA 92722 92087 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_34960 93263 92742 gene locus_tag LOCUS_34970 93263 92742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34970 93482 94063 gene locus_tag LOCUS_34980 93482 94063 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_34980 94177 95142 gene locus_tag LOCUS_34990 94177 95142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 95449 95270 gene locus_tag LOCUS_35000 95449 95270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 95646 96995 gene locus_tag LOCUS_35010 95646 96995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35010 96959 97930 gene locus_tag LOCUS_35020 96959 97930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 97944 98726 gene locus_tag LOCUS_35030 97944 98726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 98627 98854 gene locus_tag LOCUS_35040 98627 98854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 99036 99740 gene locus_tag LOCUS_35050 99036 99740 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_35050 100254 99751 gene locus_tag LOCUS_35060 100254 99751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35060 100916 100266 gene locus_tag LOCUS_35070 100916 100266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 101407 102201 gene locus_tag LOCUS_35080 101407 102201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 102230 102460 gene locus_tag LOCUS_35090 102230 102460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35090 102444 103103 gene locus_tag LOCUS_35100 102444 103103 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_35100 105601 103229 gene locus_tag LOCUS_35110 105601 103229 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_35110 105797 106468 gene locus_tag LOCUS_35120 105797 106468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 107636 106527 gene locus_tag LOCUS_35130 107636 106527 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_35130 109962 107674 gene locus_tag LOCUS_35140 gene purL 109962 107674 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_35140 110628 109993 gene locus_tag LOCUS_35150 110628 109993 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_35150 110852 111682 gene locus_tag LOCUS_35160 110852 111682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 111779 113998 gene locus_tag LOCUS_35170 111779 113998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 114533 114009 gene locus_tag LOCUS_35180 114533 114009 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35180 114752 114937 gene locus_tag LOCUS_35190 114752 114937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 115273 115100 gene locus_tag LOCUS_35200 115273 115100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35200 115740 115312 gene locus_tag LOCUS_35210 115740 115312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35210 115888 116214 gene locus_tag LOCUS_35220 gene gatC 115888 116214 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_35220 116252 116968 gene locus_tag LOCUS_35230 116252 116968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_35230 116975 117535 gene locus_tag LOCUS_35240 116975 117535 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_35240 117546 118802 gene locus_tag LOCUS_35250 117546 118802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_35250 119048 118881 gene locus_tag LOCUS_35260 119048 118881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 119374 119006 gene locus_tag LOCUS_35270 119374 119006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 119434 120744 gene locus_tag LOCUS_35280 119434 120744 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_35280 120982 121545 gene locus_tag LOCUS_35290 120982 121545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35290 121553 121738 gene locus_tag LOCUS_35300 121553 121738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 121735 122040 gene locus_tag LOCUS_35310 121735 122040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 122112 122576 gene locus_tag LOCUS_35320 122112 122576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 123354 122647 gene locus_tag LOCUS_35330 123354 122647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 124921 123491 gene locus_tag LOCUS_35340 124921 123491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 125379 124924 gene locus_tag LOCUS_35350 125379 124924 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_35350 127831 125633 gene locus_tag LOCUS_35360 127831 125633 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_35360 128342 127878 gene locus_tag LOCUS_35370 128342 127878 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_35370 129743 128394 gene locus_tag LOCUS_35380 129743 128394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 129928 130815 gene locus_tag LOCUS_35390 129928 130815 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_35390 131322 130921 gene locus_tag LOCUS_35400 131322 130921 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 protein_id gnl|my_center|LOCUS_35400 131614 131327 gene locus_tag LOCUS_35410 131614 131327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35410 132062 131688 gene locus_tag LOCUS_35420 132062 131688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35420 133022 132090 gene locus_tag LOCUS_35430 133022 132090 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_35430 133429 133112 gene locus_tag LOCUS_35440 gene trxA 133429 133112 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_35440 133588 134673 gene locus_tag LOCUS_35450 133588 134673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 134759 135622 gene locus_tag LOCUS_35460 134759 135622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 135711 136124 gene locus_tag LOCUS_35470 135711 136124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35470 136124 136747 gene locus_tag LOCUS_35480 136124 136747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35480 137089 137640 gene locus_tag LOCUS_35490 137089 137640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35490 137733 138089 gene locus_tag LOCUS_35500 137733 138089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35500 138028 138495 gene locus_tag LOCUS_35510 138028 138495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35510 138974 138501 gene locus_tag LOCUS_35520 138974 138501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 139444 138974 gene locus_tag LOCUS_35530 139444 138974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 140598 139669 gene locus_tag LOCUS_35540 140598 139669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 141377 140814 gene locus_tag LOCUS_35550 141377 140814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 142533 141520 gene locus_tag LOCUS_35560 142533 141520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 142906 145167 gene locus_tag LOCUS_35570 gene gyrA 142906 145167 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35570 145404 146684 gene locus_tag LOCUS_35580 145404 146684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 146753 147400 gene locus_tag LOCUS_35590 146753 147400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35590 147575 148117 gene locus_tag LOCUS_35600 147575 148117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35600 148683 148093 gene locus_tag LOCUS_35610 gene coaE 148683 148093 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_35610 148870 149895 gene locus_tag LOCUS_35620 148870 149895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 150063 151556 gene locus_tag LOCUS_35630 150063 151556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 151646 152029 gene locus_tag LOCUS_35640 151646 152029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 152693 152301 gene locus_tag LOCUS_35650 152693 152301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 154083 152662 gene locus_tag LOCUS_35660 154083 152662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35660 154274 154122 gene locus_tag LOCUS_35670 154274 154122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 154450 154962 gene locus_tag LOCUS_35680 154450 154962 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_35680 155227 155427 gene locus_tag LOCUS_35690 155227 155427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 155475 155975 gene locus_tag LOCUS_35700 155475 155975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 155990 156517 gene locus_tag LOCUS_35710 155990 156517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 157674 156589 gene locus_tag LOCUS_35720 157674 156589 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35720 158012 157671 gene locus_tag LOCUS_35730 158012 157671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35730 158574 158002 gene locus_tag LOCUS_35740 158574 158002 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_35740 158793 161978 gene locus_tag LOCUS_35750 158793 161978 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_35750 162037 163242 gene locus_tag LOCUS_35760 162037 163242 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764762.1 protein_id gnl|my_center|LOCUS_35760 163321 163641 gene locus_tag LOCUS_35770 163321 163641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35770 163545 164264 gene locus_tag LOCUS_35780 163545 164264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35780 164261 164461 gene locus_tag LOCUS_35790 164261 164461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35790 164468 165310 gene locus_tag LOCUS_35800 gene prmC 164468 165310 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_35800 165968 165288 gene locus_tag LOCUS_35810 gene mqnB 165968 165288 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_35810 166786 165965 gene locus_tag LOCUS_35820 166786 165965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 167984 166803 gene locus_tag LOCUS_35830 167984 166803 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_35830 168232 168062 gene locus_tag LOCUS_35840 168232 168062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 168894 168220 gene locus_tag LOCUS_35850 168894 168220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35850 169691 169236 gene locus_tag LOCUS_35860 169691 169236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 170110 169736 gene locus_tag LOCUS_35870 170110 169736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 170374 171087 gene locus_tag LOCUS_35880 gene lipB 170374 171087 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_35880 171172 171522 gene locus_tag LOCUS_35890 171172 171522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 171582 172121 gene locus_tag LOCUS_35900 171582 172121 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_35900 172118 174709 gene locus_tag LOCUS_35910 172118 174709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 175539 174721 gene locus_tag LOCUS_35920 175539 174721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 176850 175543 gene locus_tag LOCUS_35930 176850 175543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 178209 176857 gene locus_tag LOCUS_35940 gene ffh 178209 176857 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_35940 178466 179266 gene locus_tag LOCUS_35950 178466 179266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 179291 180247 gene locus_tag LOCUS_35960 179291 180247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 180463 181368 gene locus_tag LOCUS_35970 180463 181368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35970 181419 182327 gene locus_tag LOCUS_35980 181419 182327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 182331 183119 gene locus_tag LOCUS_35990 182331 183119 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35990 183254 184495 gene locus_tag LOCUS_36000 183254 184495 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36000 185445 184828 gene locus_tag LOCUS_36010 185445 184828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 186654 185617 gene locus_tag LOCUS_36020 gene ribD 186654 185617 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_36020 186847 187377 gene locus_tag LOCUS_36030 186847 187377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 187820 187383 gene locus_tag LOCUS_36040 187820 187383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36040 188052 187774 gene locus_tag LOCUS_36050 188052 187774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36050 188379 189365 gene locus_tag LOCUS_36060 188379 189365 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_36060 190794 190066 gene locus_tag LOCUS_36070 190794 190066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 191119 191559 gene locus_tag LOCUS_36080 191119 191559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 191756 192739 gene locus_tag LOCUS_36090 gene pfkA 191756 192739 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_36090 193392 192754 gene locus_tag LOCUS_36100 gene trmH 193392 192754 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_36100 193842 193444 gene locus_tag LOCUS_36110 193842 193444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 194840 193851 gene locus_tag LOCUS_36120 194840 193851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 196431 194890 gene locus_tag LOCUS_36130 gene guaA 196431 194890 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_36130 198247 196448 gene locus_tag LOCUS_36140 198247 196448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 198755 198312 gene locus_tag LOCUS_36150 198755 198312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36150 >Feature sequence13 577 230 gene locus_tag LOCUS_36160 577 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 2011 1010 gene locus_tag LOCUS_36170 2011 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 5991 2005 gene locus_tag LOCUS_36180 5991 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 6645 7808 gene locus_tag LOCUS_36190 6645 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_36190 8116 7874 gene locus_tag LOCUS_36200 8116 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 10692 8113 gene locus_tag LOCUS_36210 10692 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 11196 10822 gene locus_tag LOCUS_36220 11196 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 11871 11353 gene locus_tag LOCUS_36230 11871 11353 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_36230 13098 12667 gene locus_tag LOCUS_36240 13098 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36240 13595 13023 gene locus_tag LOCUS_36250 13595 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36250 13775 15868 gene locus_tag LOCUS_36260 13775 15868 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_36260 15892 16722 gene locus_tag LOCUS_36270 15892 16722 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36270 16748 16984 gene locus_tag LOCUS_36280 16748 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 17461 17703 gene locus_tag LOCUS_36290 17461 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 17716 18426 gene locus_tag LOCUS_36300 17716 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 19626 18454 gene locus_tag LOCUS_36310 19626 18454 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_36310 20722 19634 gene locus_tag LOCUS_36320 20722 19634 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_36320 20838 21641 gene locus_tag LOCUS_36330 20838 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 21783 22703 gene locus_tag LOCUS_36340 21783 22703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36340 22748 23176 gene locus_tag LOCUS_36350 22748 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36350 23184 24404 gene locus_tag LOCUS_36360 23184 24404 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_36360 24653 25738 gene locus_tag LOCUS_36370 24653 25738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36370 25647 25880 gene locus_tag LOCUS_36380 25647 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 25942 26562 gene locus_tag LOCUS_36390 25942 26562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 26672 27622 gene locus_tag LOCUS_36400 gene corA 26672 27622 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_36400 27802 28920 gene locus_tag LOCUS_36410 27802 28920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_36410 29011 29670 gene locus_tag LOCUS_36420 29011 29670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 29791 30699 gene locus_tag LOCUS_36430 29791 30699 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_36430 30711 31388 gene locus_tag LOCUS_36440 30711 31388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_36440 31455 32372 gene locus_tag LOCUS_36450 31455 32372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 32379 33281 gene locus_tag LOCUS_36460 32379 33281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36460 33296 33499 gene locus_tag LOCUS_36470 33296 33499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 33520 34866 gene locus_tag LOCUS_36480 33520 34866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 36854 34875 gene locus_tag LOCUS_36490 36854 34875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 38376 36994 gene locus_tag LOCUS_36500 38376 36994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 38556 39143 gene locus_tag LOCUS_36510 38556 39143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 39205 39798 gene locus_tag LOCUS_36520 39205 39798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 40541 40996 gene locus_tag LOCUS_36530 40541 40996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 41066 42049 gene locus_tag LOCUS_36540 41066 42049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 42278 43009 gene locus_tag LOCUS_36550 42278 43009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 43133 43801 gene locus_tag LOCUS_36560 43133 43801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 44391 43798 gene locus_tag LOCUS_36570 44391 43798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141799.1 protein_id gnl|my_center|LOCUS_36570 44592 45761 gene locus_tag LOCUS_36580 44592 45761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 46603 45758 gene locus_tag LOCUS_36590 46603 45758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 47613 46825 gene locus_tag LOCUS_36600 47613 46825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36600 47612 47908 gene locus_tag LOCUS_36610 47612 47908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 47947 49056 gene locus_tag LOCUS_36620 47947 49056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 49486 49007 gene locus_tag LOCUS_36630 49486 49007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 52039 49628 gene locus_tag LOCUS_36640 52039 49628 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_36640 52913 52116 gene locus_tag LOCUS_36650 52913 52116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 55472 53013 gene locus_tag LOCUS_36660 55472 53013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 55773 56573 gene locus_tag LOCUS_36670 55773 56573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 56611 57411 gene locus_tag LOCUS_36680 56611 57411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 58009 57413 gene locus_tag LOCUS_36690 58009 57413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 58619 58248 gene locus_tag LOCUS_36700 58619 58248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 59503 58598 gene locus_tag LOCUS_36710 59503 58598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 59737 62904 gene locus_tag LOCUS_36720 59737 62904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 65166 63013 gene locus_tag LOCUS_36730 65166 63013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 68101 65357 gene locus_tag LOCUS_36740 68101 65357 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_36740 68450 68704 gene locus_tag LOCUS_36750 gene rpsT 68450 68704 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_36750 68873 69223 gene locus_tag LOCUS_36760 68873 69223 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_36760 69264 71093 gene locus_tag LOCUS_36770 69264 71093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 71110 71490 gene locus_tag LOCUS_36780 71110 71490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 71865 71626 gene locus_tag LOCUS_36790 71865 71626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 72479 71949 gene locus_tag LOCUS_36800 72479 71949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 72606 73223 gene locus_tag LOCUS_36810 72606 73223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 73347 73940 gene locus_tag LOCUS_36820 73347 73940 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_36820 74241 74504 gene locus_tag LOCUS_36830 74241 74504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 77281 74633 gene locus_tag LOCUS_36840 77281 74633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 78858 77293 gene locus_tag LOCUS_36850 78858 77293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 78989 78855 gene locus_tag LOCUS_36860 78989 78855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 80034 79000 gene locus_tag LOCUS_36870 80034 79000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 80317 81057 gene locus_tag LOCUS_36880 80317 81057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 81064 82422 gene locus_tag LOCUS_36890 81064 82422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 82564 83520 gene locus_tag LOCUS_36900 82564 83520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 83493 83675 gene locus_tag LOCUS_36910 83493 83675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 83716 85245 gene locus_tag LOCUS_36920 83716 85245 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_36920 85292 85774 gene locus_tag LOCUS_36930 85292 85774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36930 85830 87572 gene locus_tag LOCUS_36940 85830 87572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 87569 89527 gene locus_tag LOCUS_36950 87569 89527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 90090 90365 gene locus_tag LOCUS_36960 90090 90365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 90359 91417 gene locus_tag LOCUS_36970 90359 91417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 91525 92655 gene locus_tag LOCUS_36980 91525 92655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 92643 93494 gene locus_tag LOCUS_36990 92643 93494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 93705 94319 gene locus_tag LOCUS_37000 93705 94319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 95094 95411 gene locus_tag LOCUS_37010 95094 95411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 95537 95758 gene locus_tag LOCUS_37020 95537 95758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 96357 98633 gene locus_tag LOCUS_37030 96357 98633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37030 98650 98973 gene locus_tag LOCUS_37040 98650 98973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 99017 100315 gene locus_tag LOCUS_37050 99017 100315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 100391 101065 gene locus_tag LOCUS_37060 100391 101065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 101363 102991 gene locus_tag LOCUS_37070 101363 102991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 104029 103022 gene locus_tag LOCUS_37080 104029 103022 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_37080 104486 104229 gene locus_tag LOCUS_37090 104486 104229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 104614 104919 gene locus_tag LOCUS_37100 104614 104919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 104897 106777 gene locus_tag LOCUS_37110 104897 106777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 106861 107250 gene locus_tag LOCUS_37120 106861 107250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 107219 107425 gene locus_tag LOCUS_37130 107219 107425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 107538 108365 gene locus_tag LOCUS_37140 107538 108365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 108368 108799 gene locus_tag LOCUS_37150 108368 108799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 109213 108956 gene locus_tag LOCUS_37160 109213 108956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 110330 109107 gene locus_tag LOCUS_37170 110330 109107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 110890 110249 gene locus_tag LOCUS_37180 110890 110249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 111458 111874 gene locus_tag LOCUS_37190 111458 111874 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_37190 112435 112235 gene locus_tag LOCUS_37200 112435 112235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 112619 115036 gene locus_tag LOCUS_37210 112619 115036 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_37210 115623 115147 gene locus_tag LOCUS_37220 115623 115147 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_37220 117294 115846 gene locus_tag LOCUS_37230 117294 115846 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_37230 118742 117402 gene locus_tag LOCUS_37240 118742 117402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_37240 120146 118755 gene locus_tag LOCUS_37250 120146 118755 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_37250 120820 120200 gene locus_tag LOCUS_37260 120820 120200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 123316 120887 gene locus_tag LOCUS_37270 123316 120887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 124656 123244 gene locus_tag LOCUS_37280 124656 123244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 125471 124803 gene locus_tag LOCUS_37290 gene cmk 125471 124803 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_37290 126892 125501 gene locus_tag LOCUS_37300 126892 125501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 127537 127316 gene locus_tag LOCUS_37310 127537 127316 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_37310 128246 127836 gene locus_tag LOCUS_37320 128246 127836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 128902 128243 gene locus_tag LOCUS_37330 128902 128243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 129507 128956 gene locus_tag LOCUS_37340 129507 128956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37340 130019 129525 gene locus_tag LOCUS_37350 130019 129525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37350 130128 131738 gene locus_tag LOCUS_37360 gene purB 130128 131738 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_37360 131644 132687 gene locus_tag LOCUS_37370 131644 132687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37370 132651 132989 gene locus_tag LOCUS_37380 132651 132989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 134031 133321 gene locus_tag LOCUS_37390 gene mazG 134031 133321 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_37390 134088 134312 gene locus_tag LOCUS_37400 134088 134312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 134345 134692 gene locus_tag LOCUS_37410 134345 134692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 134718 135404 gene locus_tag LOCUS_37420 134718 135404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 135415 136191 gene locus_tag LOCUS_37430 135415 136191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 136229 136798 gene locus_tag LOCUS_37440 136229 136798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 136920 137819 gene locus_tag LOCUS_37450 136920 137819 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_37450 137920 139398 gene locus_tag LOCUS_37460 137920 139398 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_37460 139546 140355 gene locus_tag LOCUS_37470 139546 140355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37470 140325 140549 gene locus_tag LOCUS_37480 140325 140549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37480 140689 141939 gene locus_tag LOCUS_37490 140689 141939 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_37490 142249 142821 gene locus_tag LOCUS_37500 142249 142821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 142893 144500 gene locus_tag LOCUS_37510 gene argS 142893 144500 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_37510 144865 146541 gene locus_tag LOCUS_37520 144865 146541 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_37520 147452 146622 gene locus_tag LOCUS_37530 147452 146622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 147669 147986 gene locus_tag LOCUS_37540 147669 147986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37540 147997 148263 gene locus_tag LOCUS_37550 147997 148263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37550 148267 148788 gene locus_tag LOCUS_37560 148267 148788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37560 148752 149198 gene locus_tag LOCUS_37570 148752 149198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37570 149668 149195 gene locus_tag LOCUS_37580 149668 149195 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_37580 150584 149637 gene locus_tag LOCUS_37590 150584 149637 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_37590 150867 150986 gene locus_tag LOCUS_37600 150867 150986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 153677 150993 gene locus_tag LOCUS_37610 153677 150993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 161994 154018 gene locus_tag LOCUS_37620 161994 154018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 163337 162531 gene locus_tag LOCUS_37630 163337 162531 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_37630 164452 163352 gene locus_tag LOCUS_37640 164452 163352 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_37640 165325 164486 gene locus_tag LOCUS_37650 165325 164486 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_37650 165923 165384 gene locus_tag LOCUS_37660 165923 165384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37660 166531 165860 gene locus_tag LOCUS_37670 166531 165860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37670 167422 166613 gene locus_tag LOCUS_37680 167422 166613 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37680 >Feature sequence14 974 426 gene locus_tag LOCUS_37690 974 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37690 1366 1539 gene locus_tag LOCUS_37700 1366 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 1788 3080 gene locus_tag LOCUS_37710 1788 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 4084 3143 gene locus_tag LOCUS_37720 4084 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 4896 4123 gene locus_tag LOCUS_37730 4896 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 5316 4957 gene locus_tag LOCUS_37740 5316 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 8049 5572 gene locus_tag LOCUS_37750 8049 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 8625 10370 gene locus_tag LOCUS_37760 8625 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 10568 12268 gene locus_tag LOCUS_37770 10568 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_37770 13050 12328 gene locus_tag LOCUS_37780 13050 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37780 13393 12959 gene locus_tag LOCUS_37790 13393 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37790 13732 13397 gene locus_tag LOCUS_37800 13732 13397 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_37800 14023 14670 gene locus_tag LOCUS_37810 14023 14670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226991426.1 protein_id gnl|my_center|LOCUS_37810 14667 15902 gene locus_tag LOCUS_37820 14667 15902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_37820 15974 16423 gene locus_tag LOCUS_37830 15974 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 16607 16987 gene locus_tag LOCUS_37840 16607 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 18637 17381 gene locus_tag LOCUS_37850 gene odhB 18637 17381 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_37850 19325 18798 gene locus_tag LOCUS_37860 19325 18798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 20093 19392 gene locus_tag LOCUS_37870 20093 19392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 21526 20120 gene locus_tag LOCUS_37880 21526 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 23377 21656 gene locus_tag LOCUS_37890 23377 21656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 23587 24345 gene locus_tag LOCUS_37900 gene rlmB 23587 24345 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_37900 24461 25711 gene locus_tag LOCUS_37910 24461 25711 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_37910 27705 26269 gene locus_tag LOCUS_37920 27705 26269 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_37920 29929 28007 gene locus_tag LOCUS_37930 29929 28007 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_37930 30473 30021 gene locus_tag LOCUS_37940 30473 30021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 31007 30546 gene locus_tag LOCUS_37950 31007 30546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 31107 33332 gene locus_tag LOCUS_37960 31107 33332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 33691 34752 gene locus_tag LOCUS_37970 33691 34752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37970 34801 35310 gene locus_tag LOCUS_37980 34801 35310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 38560 35468 gene locus_tag LOCUS_37990 38560 35468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_37990 39836 39093 gene locus_tag LOCUS_38000 39836 39093 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_38000 40769 39840 gene locus_tag LOCUS_38010 gene queG 40769 39840 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_38010 40888 41283 gene locus_tag LOCUS_38020 40888 41283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 41317 42048 gene locus_tag LOCUS_38030 41317 42048 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_38030 42545 42120 gene locus_tag LOCUS_38040 42545 42120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 43369 42572 gene locus_tag LOCUS_38050 43369 42572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38050 44126 43272 gene locus_tag LOCUS_38060 44126 43272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38060 44190 44396 gene locus_tag LOCUS_38070 44190 44396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38070 44396 45412 gene locus_tag LOCUS_38080 44396 45412 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38080 45409 46329 gene locus_tag LOCUS_38090 45409 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 46248 46463 gene locus_tag LOCUS_38100 46248 46463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 46445 47161 gene locus_tag LOCUS_38110 46445 47161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 47158 47754 gene locus_tag LOCUS_38120 47158 47754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38120 47765 49594 gene locus_tag LOCUS_38130 47765 49594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38130 49527 49970 gene locus_tag LOCUS_38140 49527 49970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 51655 50048 gene locus_tag LOCUS_38150 51655 50048 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_38150 52702 51707 gene locus_tag LOCUS_38160 52702 51707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 53531 52926 gene locus_tag LOCUS_38170 53531 52926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38170 53805 53620 gene locus_tag LOCUS_38180 53805 53620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 53987 54535 gene locus_tag LOCUS_38190 53987 54535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38190 54746 55135 gene locus_tag LOCUS_38200 54746 55135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38200 55190 57637 gene locus_tag LOCUS_38210 55190 57637 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_38210 58279 57779 gene locus_tag LOCUS_38220 58279 57779 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971635.1 protein_id gnl|my_center|LOCUS_38220 59634 58357 gene locus_tag LOCUS_38230 59634 58357 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_38230 59731 60555 gene locus_tag LOCUS_38240 59731 60555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 60571 60828 gene locus_tag LOCUS_38250 60571 60828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 60992 61669 gene locus_tag LOCUS_38260 60992 61669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 63188 61779 gene locus_tag LOCUS_38270 63188 61779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 63474 64319 gene locus_tag LOCUS_38280 63474 64319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 64297 66363 gene locus_tag LOCUS_38290 64297 66363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 68046 66637 gene locus_tag LOCUS_38300 68046 66637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 68205 71108 gene locus_tag LOCUS_38310 68205 71108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 71364 71750 gene locus_tag LOCUS_38320 71364 71750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 71876 73084 gene locus_tag LOCUS_38330 71876 73084 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_38330 73961 73086 gene locus_tag LOCUS_38340 73961 73086 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_38340 74981 74061 gene locus_tag LOCUS_38350 74981 74061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 75668 75201 gene locus_tag LOCUS_38360 gene smpB 75668 75201 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_38360 76324 75758 gene locus_tag LOCUS_38370 76324 75758 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228535.1 protein_id gnl|my_center|LOCUS_38370 76407 78095 gene locus_tag LOCUS_38380 76407 78095 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_38380 79507 78266 gene locus_tag LOCUS_38390 79507 78266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38390 80696 79449 gene locus_tag LOCUS_38400 80696 79449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38400 81011 81490 gene locus_tag LOCUS_38410 81011 81490 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_38410 81822 84137 gene locus_tag LOCUS_38420 81822 84137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 84238 84537 gene locus_tag LOCUS_38430 84238 84537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 84609 85604 gene locus_tag LOCUS_38440 84609 85604 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_38440 85601 86482 gene locus_tag LOCUS_38450 85601 86482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 86887 86513 gene locus_tag LOCUS_38460 86887 86513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 87129 87935 gene locus_tag LOCUS_38470 87129 87935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38470 88071 89225 gene locus_tag LOCUS_38480 88071 89225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 90635 89460 gene locus_tag LOCUS_38490 90635 89460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 91294 90785 gene locus_tag LOCUS_38500 91294 90785 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_38500 91484 91876 gene locus_tag LOCUS_38510 91484 91876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 92809 91988 gene locus_tag LOCUS_38520 92809 91988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38520 93585 92785 gene locus_tag LOCUS_38530 93585 92785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38530 93879 94493 gene locus_tag LOCUS_38540 93879 94493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 95101 94466 gene locus_tag LOCUS_38550 95101 94466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 95162 96214 gene locus_tag LOCUS_38560 95162 96214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 96367 97440 gene locus_tag LOCUS_38570 96367 97440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 98669 97545 gene locus_tag LOCUS_38580 gene hppD 98669 97545 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_38580 99956 98802 gene locus_tag LOCUS_38590 99956 98802 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_38590 100116 99979 gene locus_tag LOCUS_38600 100116 99979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 100388 100089 gene locus_tag LOCUS_38610 100388 100089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 101175 101762 gene locus_tag LOCUS_38620 101175 101762 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_38620 104464 101849 gene locus_tag LOCUS_38630 gene clpB 104464 101849 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_38630 107367 104674 gene locus_tag LOCUS_38640 107367 104674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 107615 107289 gene locus_tag LOCUS_38650 107615 107289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 108264 111797 gene locus_tag LOCUS_38660 gene dnaE 108264 111797 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_38660 111902 112318 gene locus_tag LOCUS_38670 gene tsaE 111902 112318 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_38670 112356 113579 gene locus_tag LOCUS_38680 112356 113579 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_38680 113789 114883 gene locus_tag LOCUS_38690 113789 114883 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_38690 114899 116014 gene locus_tag LOCUS_38700 114899 116014 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_38700 116016 116807 gene locus_tag LOCUS_38710 116016 116807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38710 117013 117369 gene locus_tag LOCUS_38720 117013 117369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38720 117781 118383 gene locus_tag LOCUS_38730 117781 118383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38730 118289 119926 gene locus_tag LOCUS_38740 118289 119926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38740 120563 120093 gene locus_tag LOCUS_38750 120563 120093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38750 121311 120469 gene locus_tag LOCUS_38760 121311 120469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38760 121907 121569 gene locus_tag LOCUS_38770 121907 121569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 122760 121975 gene locus_tag LOCUS_38780 122760 121975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 123544 122762 gene locus_tag LOCUS_38790 123544 122762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 125238 123541 gene locus_tag LOCUS_38800 125238 123541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_38800 126173 125268 gene locus_tag LOCUS_38810 126173 125268 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_38810 126663 127517 gene locus_tag LOCUS_38820 gene rsgA 126663 127517 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38820 128814 128032 gene locus_tag LOCUS_38830 128814 128032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 129599 131491 gene locus_tag LOCUS_38840 129599 131491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 132838 131762 gene locus_tag LOCUS_38850 132838 131762 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_38850 133042 133926 gene locus_tag LOCUS_38860 133042 133926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38860 133947 134642 gene locus_tag LOCUS_38870 133947 134642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38870 134849 135673 gene locus_tag LOCUS_38880 134849 135673 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_38880 136692 136279 gene locus_tag LOCUS_38890 136692 136279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 139581 136729 gene locus_tag LOCUS_38900 139581 136729 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_38900 139821 139585 gene locus_tag LOCUS_38910 139821 139585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38910 139986 140501 gene locus_tag LOCUS_38920 139986 140501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 142099 141341 gene locus_tag LOCUS_38930 142099 141341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38930 142782 143549 gene locus_tag LOCUS_38940 142782 143549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 143771 144079 gene locus_tag LOCUS_38950 143771 144079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 144037 144507 gene locus_tag LOCUS_38960 144037 144507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 144801 145019 gene locus_tag LOCUS_38970 144801 145019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 145612 145983 gene locus_tag LOCUS_38980 145612 145983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 146063 146872 gene locus_tag LOCUS_38990 146063 146872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 >Feature sequence15 1602 496 gene locus_tag LOCUS_39000 1602 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39000 1925 1602 gene locus_tag LOCUS_39010 1925 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39010 2113 1961 gene locus_tag LOCUS_39020 2113 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 2779 2132 gene locus_tag LOCUS_39030 2779 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39030 3540 3394 gene locus_tag LOCUS_39040 3540 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 3797 4642 gene locus_tag LOCUS_39050 3797 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39050 4639 5415 gene locus_tag LOCUS_39060 4639 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39060 6598 5864 gene locus_tag LOCUS_39070 6598 5864 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_39070 7372 6665 gene locus_tag LOCUS_39080 7372 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39080 7545 7369 gene locus_tag LOCUS_39090 7545 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 7841 8287 gene locus_tag LOCUS_39100 7841 8287 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_39100 8287 8958 gene locus_tag LOCUS_39110 gene folE 8287 8958 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_39110 9001 9396 gene locus_tag LOCUS_39120 9001 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39120 9381 9878 gene locus_tag LOCUS_39130 9381 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39130 10067 10624 gene locus_tag LOCUS_39140 10067 10624 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_39140 10983 10771 gene locus_tag LOCUS_39150 10983 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 11838 11422 gene locus_tag LOCUS_39160 11838 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39160 14141 11856 gene locus_tag LOCUS_39170 gene ppdK 14141 11856 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39170 14480 15094 gene locus_tag LOCUS_39180 14480 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39180 15091 16341 gene locus_tag LOCUS_39190 15091 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39190 16329 17786 gene locus_tag LOCUS_39200 16329 17786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 18350 20887 gene locus_tag LOCUS_39210 18350 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 20884 21618 gene locus_tag LOCUS_39220 20884 21618 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259509.1 protein_id gnl|my_center|LOCUS_39220 21864 22766 gene locus_tag LOCUS_39230 21864 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 22779 23648 gene locus_tag LOCUS_39240 22779 23648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 23743 24738 gene locus_tag LOCUS_39250 gene moaA 23743 24738 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 protein_id gnl|my_center|LOCUS_39250 24973 25290 gene locus_tag LOCUS_39260 24973 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39260 25633 25295 gene locus_tag LOCUS_39270 25633 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 26207 25710 gene locus_tag LOCUS_39280 26207 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 26719 26429 gene locus_tag LOCUS_39290 26719 26429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39290 26974 26732 gene locus_tag LOCUS_39300 26974 26732 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809331.1 protein_id gnl|my_center|LOCUS_39300 27634 26978 gene locus_tag LOCUS_39310 27634 26978 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084806.1 protein_id gnl|my_center|LOCUS_39310 27889 28497 gene locus_tag LOCUS_39320 27889 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 28487 29212 gene locus_tag LOCUS_39330 28487 29212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39330 29182 29610 gene locus_tag LOCUS_39340 29182 29610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39340 29656 30621 gene locus_tag LOCUS_39350 29656 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 30623 31441 gene locus_tag LOCUS_39360 30623 31441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 31532 32371 gene locus_tag LOCUS_39370 31532 32371 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_39370 32999 32334 gene locus_tag LOCUS_39380 32999 32334 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364337.1 protein_id gnl|my_center|LOCUS_39380 33791 33150 gene locus_tag LOCUS_39390 33791 33150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 34851 33823 gene locus_tag LOCUS_39400 34851 33823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39400 35414 34800 gene locus_tag LOCUS_39410 35414 34800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39410 36010 35579 gene locus_tag LOCUS_39420 36010 35579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 37356 36067 gene locus_tag LOCUS_39430 37356 36067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39430 37949 37539 gene locus_tag LOCUS_39440 37949 37539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39440 39474 37849 gene locus_tag LOCUS_39450 39474 37849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39450 39729 40706 gene locus_tag LOCUS_39460 39729 40706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39460 40703 41500 gene locus_tag LOCUS_39470 40703 41500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39470 41500 42600 gene locus_tag LOCUS_39480 41500 42600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39480 44423 42780 gene locus_tag LOCUS_39490 44423 42780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39490 44533 44928 gene locus_tag LOCUS_39500 44533 44928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 44934 45383 gene locus_tag LOCUS_39510 44934 45383 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_39510 45955 45581 gene locus_tag LOCUS_39520 45955 45581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 47693 45918 gene locus_tag LOCUS_39530 47693 45918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 48894 48178 gene locus_tag LOCUS_39540 48894 48178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 49488 48904 gene locus_tag LOCUS_39550 49488 48904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 50196 50372 gene locus_tag LOCUS_39560 50196 50372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 50873 50589 gene locus_tag LOCUS_39570 50873 50589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39570 51253 50858 gene locus_tag LOCUS_39580 51253 50858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39580 53277 51352 gene locus_tag LOCUS_39590 53277 51352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 55374 54079 gene locus_tag LOCUS_39600 55374 54079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 56317 55385 gene locus_tag LOCUS_39610 56317 55385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 56825 57688 gene locus_tag LOCUS_39620 56825 57688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 57688 58833 gene locus_tag LOCUS_39630 57688 58833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 58833 59435 gene locus_tag LOCUS_39640 58833 59435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 59678 62086 gene locus_tag LOCUS_39650 59678 62086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 62089 63123 gene locus_tag LOCUS_39660 62089 63123 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_39660 63414 63770 gene locus_tag LOCUS_39670 63414 63770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 63960 63772 gene locus_tag LOCUS_39680 63960 63772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 63922 64464 gene locus_tag LOCUS_39690 63922 64464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 64413 65087 gene locus_tag LOCUS_39700 64413 65087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 65091 66338 gene locus_tag LOCUS_39710 65091 66338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 66588 67880 gene locus_tag LOCUS_39720 66588 67880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 68021 68722 gene locus_tag LOCUS_39730 68021 68722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 68738 69514 gene locus_tag LOCUS_39740 68738 69514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 69741 70370 gene locus_tag LOCUS_39750 69741 70370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 70363 71115 gene locus_tag LOCUS_39760 70363 71115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 71108 71485 gene locus_tag LOCUS_39770 71108 71485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 71457 71840 gene locus_tag LOCUS_39780 71457 71840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39780 71921 72616 gene locus_tag LOCUS_39790 71921 72616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39790 72644 73813 gene locus_tag LOCUS_39800 72644 73813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 73905 75032 gene locus_tag LOCUS_39810 73905 75032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 75352 75960 gene locus_tag LOCUS_39820 75352 75960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 76725 77030 gene locus_tag LOCUS_39830 76725 77030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 77978 77325 gene locus_tag LOCUS_39840 77978 77325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 78298 80256 gene locus_tag LOCUS_39850 78298 80256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 80543 80334 gene locus_tag LOCUS_39860 80543 80334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 81388 80480 gene locus_tag LOCUS_39870 81388 80480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 83445 82666 gene locus_tag LOCUS_39880 83445 82666 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_39880 84920 83598 gene locus_tag LOCUS_39890 84920 83598 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_39890 85408 84959 gene locus_tag LOCUS_39900 85408 84959 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_39900 86073 85546 gene locus_tag LOCUS_39910 86073 85546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39910 88073 86070 gene locus_tag LOCUS_39920 88073 86070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39920 89017 88196 gene locus_tag LOCUS_39930 89017 88196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 89606 89031 gene locus_tag LOCUS_39940 89606 89031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 89812 90846 gene locus_tag LOCUS_39950 gene hemE 89812 90846 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404447.1 protein_id gnl|my_center|LOCUS_39950 91074 91808 gene locus_tag LOCUS_39960 gene accD 91074 91808 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39960 92990 91989 gene locus_tag LOCUS_39970 92990 91989 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39970 94339 93068 gene locus_tag LOCUS_39980 94339 93068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 95203 94766 gene locus_tag LOCUS_39990 95203 94766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 95624 95340 gene locus_tag LOCUS_40000 95624 95340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 96322 95852 gene locus_tag LOCUS_40010 96322 95852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 97037 96495 gene locus_tag LOCUS_40020 97037 96495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 97178 97669 gene locus_tag LOCUS_40030 97178 97669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 99216 97690 gene locus_tag LOCUS_40040 99216 97690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 99288 99800 gene locus_tag LOCUS_40050 99288 99800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 100047 100676 gene locus_tag LOCUS_40060 100047 100676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 101209 100847 gene locus_tag LOCUS_40070 101209 100847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 101619 101206 gene locus_tag LOCUS_40080 101619 101206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40080 102764 101616 gene locus_tag LOCUS_40090 102764 101616 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_40090 102991 103821 gene locus_tag LOCUS_40100 102991 103821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 104985 103954 gene locus_tag LOCUS_40110 104985 103954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 106439 104952 gene locus_tag LOCUS_40120 106439 104952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 106868 106458 gene locus_tag LOCUS_40130 106868 106458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 107603 107839 gene locus_tag LOCUS_40140 107603 107839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 107760 107966 gene locus_tag LOCUS_40150 107760 107966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 108097 108534 gene locus_tag LOCUS_40160 108097 108534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 108697 108972 gene locus_tag LOCUS_40170 108697 108972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 111969 109051 gene locus_tag LOCUS_40180 111969 109051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 113302 112028 gene locus_tag LOCUS_40190 113302 112028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 113556 113308 gene locus_tag LOCUS_40200 113556 113308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 115077 113713 gene locus_tag LOCUS_40210 115077 113713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 115576 115070 gene locus_tag LOCUS_40220 115576 115070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 115860 115609 gene locus_tag LOCUS_40230 115860 115609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 116440 115904 gene locus_tag LOCUS_40240 116440 115904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 117126 116434 gene locus_tag LOCUS_40250 117126 116434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 117369 117211 gene locus_tag LOCUS_40260 117369 117211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 119612 117378 gene locus_tag LOCUS_40270 119612 117378 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_40270 120422 120021 gene locus_tag LOCUS_40280 120422 120021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40280 120632 121216 gene locus_tag LOCUS_40290 120632 121216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 121312 122208 gene locus_tag LOCUS_40300 gene era 121312 122208 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_40300 123339 122215 gene locus_tag LOCUS_40310 123339 122215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 124798 123422 gene locus_tag LOCUS_40320 124798 123422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 125252 124707 gene locus_tag LOCUS_40330 125252 124707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 125383 126045 gene locus_tag LOCUS_40340 125383 126045 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_40340 126051 126575 gene locus_tag LOCUS_40350 gene bstA 126051 126575 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_40350 126854 128413 gene locus_tag LOCUS_40360 126854 128413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 128320 128922 gene locus_tag LOCUS_40370 128320 128922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 129415 128999 gene locus_tag LOCUS_40380 129415 128999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 130047 129463 gene locus_tag LOCUS_40390 130047 129463 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400839.1 protein_id gnl|my_center|LOCUS_40390 130567 130061 gene locus_tag LOCUS_40400 130567 130061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 131964 130603 gene locus_tag LOCUS_40410 131964 130603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 133408 132092 gene locus_tag LOCUS_40420 gene metK 133408 132092 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_40420 133643 135814 gene locus_tag LOCUS_40430 133643 135814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 135833 136234 gene locus_tag LOCUS_40440 135833 136234 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_40440 136254 136820 gene locus_tag LOCUS_40450 136254 136820 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_40450 136933 137331 gene locus_tag LOCUS_40460 136933 137331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 137309 137512 gene locus_tag LOCUS_40470 137309 137512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 137502 138191 gene locus_tag LOCUS_40480 137502 138191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 139620 138241 gene locus_tag LOCUS_40490 139620 138241 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_40490 140205 139639 gene locus_tag LOCUS_40500 140205 139639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 140811 140224 gene locus_tag LOCUS_40510 140811 140224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 141248 140847 gene locus_tag LOCUS_40520 141248 140847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 142321 141578 gene locus_tag LOCUS_40530 142321 141578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 142523 143290 gene locus_tag LOCUS_40540 142523 143290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 143389 143853 gene locus_tag LOCUS_40550 143389 143853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 143867 144169 gene locus_tag LOCUS_40560 143867 144169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 144279 145232 gene locus_tag LOCUS_40570 144279 145232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 145389 146621 gene locus_tag LOCUS_40580 145389 146621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40580 >Feature sequence16 <1 2168 gene locus_tag LOCUS_40590 <1 2168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:S9 family peptidase 2386 3516 gene locus_tag LOCUS_40600 2386 3516 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_40600 3549 4922 gene locus_tag LOCUS_40610 gene ricT 3549 4922 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_40610 4927 6330 gene locus_tag LOCUS_40620 gene lpdA 4927 6330 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_40620 6449 7438 gene locus_tag LOCUS_40630 6449 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40630 7453 8604 gene locus_tag LOCUS_40640 7453 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40640 8927 8619 gene locus_tag LOCUS_40650 8927 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 12645 9040 gene locus_tag LOCUS_40660 12645 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 13068 12733 gene locus_tag LOCUS_40670 13068 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 14437 13115 gene locus_tag LOCUS_40680 14437 13115 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_40680 14498 15352 gene locus_tag LOCUS_40690 14498 15352 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_40690 16692 15454 gene locus_tag LOCUS_40700 gene hutI 16692 15454 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_40700 17345 16782 gene locus_tag LOCUS_40710 17345 16782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 18460 17300 gene locus_tag LOCUS_40720 18460 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 19163 18570 gene locus_tag LOCUS_40730 19163 18570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_40730 19567 21390 gene locus_tag LOCUS_40740 19567 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 22369 21383 gene locus_tag LOCUS_40750 22369 21383 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_40750 24010 23060 gene locus_tag LOCUS_40760 24010 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 25308 24043 gene locus_tag LOCUS_40770 25308 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40770 25982 25311 gene locus_tag LOCUS_40780 25982 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40780 28230 26041 gene locus_tag LOCUS_40790 28230 26041 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_40790 28370 28810 gene locus_tag LOCUS_40800 28370 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 29939 29022 gene locus_tag LOCUS_40810 29939 29022 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_40810 34746 30349 gene locus_tag LOCUS_40820 34746 30349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 35868 35044 gene locus_tag LOCUS_40830 gene prmA 35868 35044 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_40830 36226 35879 gene locus_tag LOCUS_40840 36226 35879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40840 36396 36214 gene locus_tag LOCUS_40850 36396 36214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 37367 36489 gene locus_tag LOCUS_40860 gene folD 37367 36489 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_40860 37810 43314 gene locus_tag LOCUS_40870 37810 43314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 43512 44447 gene locus_tag LOCUS_40880 43512 44447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 44542 45261 gene locus_tag LOCUS_40890 44542 45261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 45265 45957 gene locus_tag LOCUS_40900 45265 45957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 48292 46085 gene locus_tag LOCUS_40910 gene rpsA 48292 46085 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_40910 48491 50164 gene locus_tag LOCUS_40920 gene fadD 48491 50164 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_40920 51821 50214 gene locus_tag LOCUS_40930 51821 50214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 53027 52005 gene locus_tag LOCUS_40940 53027 52005 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_40940 53150 54682 gene locus_tag LOCUS_40950 53150 54682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 54696 55739 gene locus_tag LOCUS_40960 54696 55739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 55915 56328 gene locus_tag LOCUS_40970 gene ruvX 55915 56328 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_40970 56337 56894 gene locus_tag LOCUS_40980 gene def 56337 56894 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_40980 57318 56887 gene locus_tag LOCUS_40990 57318 56887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 57480 60011 gene locus_tag LOCUS_41000 57480 60011 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_41000 61910 60159 gene locus_tag LOCUS_41010 gene feoB 61910 60159 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41010 62314 61925 gene locus_tag LOCUS_41020 62314 61925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41020 63581 62787 gene locus_tag LOCUS_41030 63581 62787 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_41030 64297 63701 gene locus_tag LOCUS_41040 64297 63701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764108.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41040 64392 65138 gene locus_tag LOCUS_41050 64392 65138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_41050 65732 65145 gene locus_tag LOCUS_41060 65732 65145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 65899 65747 gene locus_tag LOCUS_41070 65899 65747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 66483 66046 gene locus_tag LOCUS_41080 66483 66046 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_41080 68163 66610 gene locus_tag LOCUS_41090 68163 66610 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_41090 68270 69121 gene locus_tag LOCUS_41100 gene paaG 68270 69121 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_41100 70007 69168 gene locus_tag LOCUS_41110 70007 69168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 70976 70395 gene locus_tag LOCUS_41120 70976 70395 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_41120 71185 70973 gene locus_tag LOCUS_41130 71185 70973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 71951 71226 gene locus_tag LOCUS_41140 gene recO 71951 71226 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_41140 72304 72969 gene locus_tag LOCUS_41150 72304 72969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 72966 74132 gene locus_tag LOCUS_41160 72966 74132 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_41160 74217 74468 gene locus_tag LOCUS_41170 74217 74468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41170 74452 76137 gene locus_tag LOCUS_41180 gene thrS 74452 76137 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_41180 76375 76710 gene locus_tag LOCUS_41190 76375 76710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 77832 76900 gene locus_tag LOCUS_41200 77832 76900 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_41200 80392 77954 gene locus_tag LOCUS_41210 80392 77954 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_41210 81601 80546 gene locus_tag LOCUS_41220 81601 80546 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_41220 83566 82325 gene locus_tag LOCUS_41230 83566 82325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 84711 83755 gene locus_tag LOCUS_41240 84711 83755 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 protein_id gnl|my_center|LOCUS_41240 84962 85348 gene locus_tag LOCUS_41250 84962 85348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 85476 85850 gene locus_tag LOCUS_41260 85476 85850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 85862 86959 gene locus_tag LOCUS_41270 85862 86959 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_41270 88288 87728 gene locus_tag LOCUS_41280 88288 87728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 90106 88343 gene locus_tag LOCUS_41290 90106 88343 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41290 90671 90063 gene locus_tag LOCUS_41300 90671 90063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41300 91349 91116 gene locus_tag LOCUS_41310 91349 91116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 91727 91407 gene locus_tag LOCUS_41320 91727 91407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 92008 93045 gene locus_tag LOCUS_41330 92008 93045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 93080 94291 gene locus_tag LOCUS_41340 93080 94291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 95351 94299 gene locus_tag LOCUS_41350 95351 94299 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869813.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41350 95548 95321 gene locus_tag LOCUS_41360 95548 95321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 96126 95548 gene locus_tag LOCUS_41370 gene lptC 96126 95548 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_41370 96651 96289 gene locus_tag LOCUS_41380 96651 96289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 97400 96648 gene locus_tag LOCUS_41390 97400 96648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41390 97457 98113 gene locus_tag LOCUS_41400 97457 98113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 98091 98369 gene locus_tag LOCUS_41410 98091 98369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41410 98421 101120 gene locus_tag LOCUS_41420 98421 101120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 101268 101726 gene locus_tag LOCUS_41430 101268 101726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 101790 102272 gene locus_tag LOCUS_41440 101790 102272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 103115 102513 gene locus_tag LOCUS_41450 103115 102513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 103584 104621 gene locus_tag LOCUS_41460 103584 104621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 106510 104708 gene locus_tag LOCUS_41470 106510 104708 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_41470 106800 107558 gene locus_tag LOCUS_41480 106800 107558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41480 107596 108084 gene locus_tag LOCUS_41490 107596 108084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41490 108290 109051 gene locus_tag LOCUS_41500 108290 109051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41500 109223 109768 gene locus_tag LOCUS_41510 109223 109768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41510 >Feature sequence17 730 1170 gene locus_tag LOCUS_41520 730 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 2160 2525 gene locus_tag LOCUS_41530 2160 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 3588 3809 gene locus_tag LOCUS_41540 3588 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 4609 4872 gene locus_tag LOCUS_41550 4609 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 5645 5436 gene locus_tag LOCUS_41560 5645 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 6191 5940 gene locus_tag LOCUS_41570 6191 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 7355 7041 gene locus_tag LOCUS_41580 7355 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 8261 7902 gene locus_tag LOCUS_41590 8261 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 9016 8213 gene locus_tag LOCUS_41600 9016 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41600 9631 9044 gene locus_tag LOCUS_41610 9631 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41610 9941 9711 gene locus_tag LOCUS_41620 9941 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41620 10480 10809 gene locus_tag LOCUS_41630 10480 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41630 12315 12611 gene locus_tag LOCUS_41640 12315 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 13143 12934 gene locus_tag LOCUS_41650 13143 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 14153 14878 gene locus_tag LOCUS_41660 14153 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 14960 15220 gene locus_tag LOCUS_41670 14960 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 15641 16054 gene locus_tag LOCUS_41680 15641 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 19492 16040 gene locus_tag LOCUS_41690 gene mfd 19492 16040 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_41690 21234 19729 gene locus_tag LOCUS_41700 21234 19729 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_41700 22375 21323 gene locus_tag LOCUS_41710 gene rlmN 22375 21323 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_41710 23407 22562 gene locus_tag LOCUS_41720 23407 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41720 23604 23431 gene locus_tag LOCUS_41730 23604 23431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 24349 23588 gene locus_tag LOCUS_41740 24349 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41740 24690 25961 gene locus_tag LOCUS_41750 24690 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41750 25843 26235 gene locus_tag LOCUS_41760 25843 26235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 26441 26992 gene locus_tag LOCUS_41770 26441 26992 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084757677.1 protein_id gnl|my_center|LOCUS_41770 26985 27293 gene locus_tag LOCUS_41780 26985 27293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 27350 28162 gene locus_tag LOCUS_41790 27350 28162 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_41790 28200 29246 gene locus_tag LOCUS_41800 28200 29246 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_41800 29680 29973 gene locus_tag LOCUS_41810 29680 29973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 29976 30578 gene locus_tag LOCUS_41820 29976 30578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41820 31719 31072 gene locus_tag LOCUS_41830 31719 31072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 32032 32445 gene locus_tag LOCUS_41840 32032 32445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 32451 33272 gene locus_tag LOCUS_41850 32451 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 33560 35218 gene locus_tag LOCUS_41860 33560 35218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 35116 38277 gene locus_tag LOCUS_41870 35116 38277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 38549 39796 gene locus_tag LOCUS_41880 38549 39796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 39976 41868 gene locus_tag LOCUS_41890 39976 41868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 41772 42452 gene locus_tag LOCUS_41900 41772 42452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 42558 43298 gene locus_tag LOCUS_41910 42558 43298 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225350.1 protein_id gnl|my_center|LOCUS_41910 45721 43367 gene locus_tag LOCUS_41920 45721 43367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 46032 46721 gene locus_tag LOCUS_41930 46032 46721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 46702 50055 gene locus_tag LOCUS_41940 46702 50055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 50351 58945 gene locus_tag LOCUS_41950 50351 58945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 59046 60950 gene locus_tag LOCUS_41960 59046 60950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 60961 61890 gene locus_tag LOCUS_41970 60961 61890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 61937 62515 gene locus_tag LOCUS_41980 61937 62515 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_41980 62577 63311 gene locus_tag LOCUS_41990 62577 63311 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383980.1 protein_id gnl|my_center|LOCUS_41990 63398 64351 gene locus_tag LOCUS_42000 gene paaA 63398 64351 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_42000 64380 64664 gene locus_tag LOCUS_42010 gene paaB 64380 64664 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_42010 64709 65476 gene locus_tag LOCUS_42020 gene paaC 64709 65476 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_42020 66543 65515 gene locus_tag LOCUS_42030 66543 65515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_42030 66715 70218 gene locus_tag LOCUS_42040 66715 70218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 70282 71523 gene locus_tag LOCUS_42050 70282 71523 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_42050 71593 72996 gene locus_tag LOCUS_42060 71593 72996 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 protein_id gnl|my_center|LOCUS_42060 73630 73067 gene locus_tag LOCUS_42070 73630 73067 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973791.1 protein_id gnl|my_center|LOCUS_42070 74676 73771 gene locus_tag LOCUS_42080 74676 73771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42080 75293 74619 gene locus_tag LOCUS_42090 75293 74619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42090 75460 75242 gene locus_tag LOCUS_42100 75460 75242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42100 75568 75987 gene locus_tag LOCUS_42110 75568 75987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 75972 76271 gene locus_tag LOCUS_42120 75972 76271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 76474 76268 gene locus_tag LOCUS_42130 76474 76268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 77011 77175 gene locus_tag LOCUS_42140 77011 77175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 77793 77383 gene locus_tag LOCUS_42150 77793 77383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 78193 77753 gene locus_tag LOCUS_42160 78193 77753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 79557 78637 gene locus_tag LOCUS_42170 79557 78637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 79814 80212 gene locus_tag LOCUS_42180 79814 80212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 80221 80538 gene locus_tag LOCUS_42190 80221 80538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 80834 81271 gene locus_tag LOCUS_42200 80834 81271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 81274 81675 gene locus_tag LOCUS_42210 81274 81675 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_42210 82060 82890 gene locus_tag LOCUS_42220 82060 82890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 84681 82933 gene locus_tag LOCUS_42230 84681 82933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 85406 84975 gene locus_tag LOCUS_42240 85406 84975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42240 86810 85794 gene locus_tag LOCUS_42250 86810 85794 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267627.1 protein_id gnl|my_center|LOCUS_42250 87481 86813 gene locus_tag LOCUS_42260 87481 86813 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_42260 87638 87880 gene locus_tag LOCUS_42270 87638 87880 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908691.1 protein_id gnl|my_center|LOCUS_42270 87884 89023 gene locus_tag LOCUS_42280 87884 89023 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_42280 89773 89030 gene locus_tag LOCUS_42290 89773 89030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42290 90189 89716 gene locus_tag LOCUS_42300 90189 89716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42300 91155 90283 gene locus_tag LOCUS_42310 91155 90283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 93184 91064 gene locus_tag LOCUS_42320 93184 91064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 93347 93670 gene locus_tag LOCUS_42330 93347 93670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42330 93642 94253 gene locus_tag LOCUS_42340 93642 94253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 94599 94823 gene locus_tag LOCUS_42350 94599 94823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 94913 95092 gene locus_tag LOCUS_42360 94913 95092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42360 95324 95797 gene locus_tag LOCUS_42370 95324 95797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42370 95815 96837 gene locus_tag LOCUS_42380 95815 96837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42380 96871 97179 gene locus_tag LOCUS_42390 96871 97179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 98331 98777 gene locus_tag LOCUS_42400 98331 98777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42400 100827 99601 gene locus_tag LOCUS_42410 100827 99601 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930448.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42410 101392 101544 gene locus_tag LOCUS_42420 101392 101544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 101541 101846 gene locus_tag LOCUS_42430 101541 101846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 102014 102601 gene locus_tag LOCUS_42440 102014 102601 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_42440 102598 103497 gene locus_tag LOCUS_42450 102598 103497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42450 103409 104431 gene locus_tag LOCUS_42460 103409 104431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42460 104482 106068 gene locus_tag LOCUS_42470 104482 106068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42470 106070 107800 gene locus_tag LOCUS_42480 106070 107800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42480 108364 109494 gene locus_tag LOCUS_42490 108364 109494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42490 109713 110726 gene locus_tag LOCUS_42500 109713 110726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 111118 111702 gene locus_tag LOCUS_42510 111118 111702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 111689 111901 gene locus_tag LOCUS_42520 111689 111901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence18 1048 176 gene locus_tag LOCUS_42530 1048 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 1455 1009 gene locus_tag LOCUS_42540 1455 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 1970 1479 gene locus_tag LOCUS_42550 1970 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 3062 2253 gene locus_tag LOCUS_42560 3062 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 3326 5233 gene locus_tag LOCUS_42570 3326 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 5205 5615 gene locus_tag LOCUS_42580 5205 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 5841 7115 gene locus_tag LOCUS_42590 gene miaB 5841 7115 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_42590 7168 8445 gene locus_tag LOCUS_42600 7168 8445 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_42600 8456 8965 gene locus_tag LOCUS_42610 8456 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 9623 8976 gene locus_tag LOCUS_42620 9623 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42620 10237 9668 gene locus_tag LOCUS_42630 10237 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42630 11213 10254 gene locus_tag LOCUS_42640 11213 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 12316 11384 gene locus_tag LOCUS_42650 12316 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 13038 12313 gene locus_tag LOCUS_42660 13038 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 13184 13849 gene locus_tag LOCUS_42670 13184 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 13860 14054 gene locus_tag LOCUS_42680 13860 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 14094 14489 gene locus_tag LOCUS_42690 14094 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 14566 15123 gene locus_tag LOCUS_42700 14566 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 15184 15735 gene locus_tag LOCUS_42710 15184 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 16174 15737 gene locus_tag LOCUS_42720 16174 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 16328 16403 gene locus_tag LOCUS_t00250 16328 16403 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 16510 16923 gene locus_tag LOCUS_42730 16510 16923 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_42730 16913 17269 gene locus_tag LOCUS_42740 16913 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 17187 17393 gene locus_tag LOCUS_42750 17187 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 17445 17924 gene locus_tag LOCUS_42760 17445 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42760 18011 19108 gene locus_tag LOCUS_42770 18011 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838453.1 protein_id gnl|my_center|LOCUS_42770 19791 19168 gene locus_tag LOCUS_42780 19791 19168 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_42780 20040 20480 gene locus_tag LOCUS_42790 20040 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42790 20526 21605 gene locus_tag LOCUS_42800 20526 21605 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_42800 21605 22453 gene locus_tag LOCUS_42810 21605 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 22450 22863 gene locus_tag LOCUS_42820 22450 22863 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 protein_id gnl|my_center|LOCUS_42820 23016 24968 gene locus_tag LOCUS_42830 23016 24968 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_42830 25934 25059 gene locus_tag LOCUS_42840 gene gnd 25934 25059 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765995.1 protein_id gnl|my_center|LOCUS_42840 27319 26162 gene locus_tag LOCUS_42850 gene gntT 27319 26162 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42850 27477 27289 gene locus_tag LOCUS_42860 27477 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42860 28923 27481 gene locus_tag LOCUS_42870 gene gntK 28923 27481 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 protein_id gnl|my_center|LOCUS_42870 29003 29446 gene locus_tag LOCUS_42880 29003 29446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42880 29392 30444 gene locus_tag LOCUS_42890 29392 30444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42890 30411 32402 gene locus_tag LOCUS_42900 30411 32402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42900 32644 33114 gene locus_tag LOCUS_42910 gene coaD 32644 33114 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_42910 33253 33951 gene locus_tag LOCUS_42920 33253 33951 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875893.1 protein_id gnl|my_center|LOCUS_42920 33980 35611 gene locus_tag LOCUS_42930 gene pruA 33980 35611 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_42930 36034 37110 gene locus_tag LOCUS_42940 gene fbaA 36034 37110 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_42940 37357 38499 gene locus_tag LOCUS_42950 37357 38499 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_42950 39297 38566 gene locus_tag LOCUS_42960 39297 38566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 39694 39329 gene locus_tag LOCUS_42970 39694 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 39960 41096 gene locus_tag LOCUS_42980 39960 41096 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_42980 41286 42428 gene locus_tag LOCUS_42990 gene acdA 41286 42428 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_42990 43882 42524 gene locus_tag LOCUS_43000 43882 42524 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_43000 44764 43904 gene locus_tag LOCUS_43010 44764 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 44789 45514 gene locus_tag LOCUS_43020 gene kdsB 44789 45514 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_43020 46193 45687 gene locus_tag LOCUS_43030 gene cdd 46193 45687 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_43030 46268 47599 gene locus_tag LOCUS_43040 46268 47599 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_43040 48088 47735 gene locus_tag LOCUS_43050 48088 47735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 49014 48064 gene locus_tag LOCUS_43060 49014 48064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43060 49240 48908 gene locus_tag LOCUS_43070 49240 48908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 49516 50451 gene locus_tag LOCUS_43080 gene trxB 49516 50451 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_43080 50455 51477 gene locus_tag LOCUS_43090 50455 51477 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_43090 51780 52484 gene locus_tag LOCUS_43100 51780 52484 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43100 52804 52505 gene locus_tag LOCUS_43110 52804 52505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43110 53080 52901 gene locus_tag LOCUS_43120 53080 52901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 53899 53129 gene locus_tag LOCUS_43130 53899 53129 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002084071.1 protein_id gnl|my_center|LOCUS_43130 54620 53991 gene locus_tag LOCUS_43140 54620 53991 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_43140 55132 54659 gene locus_tag LOCUS_43150 gene rlmH 55132 54659 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_43150 56831 55137 gene locus_tag LOCUS_43160 56831 55137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 57267 56842 gene locus_tag LOCUS_43170 57267 56842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 57998 57270 gene locus_tag LOCUS_43180 57998 57270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 58221 59630 gene locus_tag LOCUS_43190 58221 59630 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_43190 59640 60254 gene locus_tag LOCUS_43200 59640 60254 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_43200 61390 60314 gene locus_tag LOCUS_43210 gene selD 61390 60314 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 protein_id gnl|my_center|LOCUS_43210 62277 61384 gene locus_tag LOCUS_43220 gene mnmH 62277 61384 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937872.1 protein_id gnl|my_center|LOCUS_43220 62645 62433 gene locus_tag LOCUS_43230 62645 62433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 64045 62669 gene locus_tag LOCUS_43240 64045 62669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 64214 65815 gene locus_tag LOCUS_43250 gene bshC 64214 65815 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_43250 67792 65906 gene locus_tag LOCUS_43260 67792 65906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43260 67964 67737 gene locus_tag LOCUS_43270 67964 67737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 72486 67945 gene locus_tag LOCUS_43280 72486 67945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 76296 72814 gene locus_tag LOCUS_43290 76296 72814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 77774 76251 gene locus_tag LOCUS_43300 77774 76251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43300 79201 77996 gene locus_tag LOCUS_43310 79201 77996 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_43310 79997 79254 gene locus_tag LOCUS_43320 79997 79254 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_43320 80085 80285 gene locus_tag LOCUS_43330 80085 80285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43330 80243 82333 gene locus_tag LOCUS_43340 80243 82333 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_43340 82602 83417 gene locus_tag LOCUS_43350 82602 83417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 83508 84326 gene locus_tag LOCUS_43360 83508 84326 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_43360 85643 84405 gene locus_tag LOCUS_43370 85643 84405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 86682 85675 gene locus_tag LOCUS_43380 86682 85675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 87101 86691 gene locus_tag LOCUS_43390 87101 86691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 88318 87050 gene locus_tag LOCUS_43400 88318 87050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 88605 88390 gene locus_tag LOCUS_43410 88605 88390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43410 89120 88548 gene locus_tag LOCUS_43420 89120 88548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43420 89620 89177 gene locus_tag LOCUS_43430 89620 89177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 90054 89647 gene locus_tag LOCUS_43440 90054 89647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 90341 90012 gene locus_tag LOCUS_43450 90341 90012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 91256 90351 gene locus_tag LOCUS_43460 gene gldA 91256 90351 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_43460 91461 91802 gene locus_tag LOCUS_43470 gene fdx 91461 91802 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656373.1 protein_id gnl|my_center|LOCUS_43470 91821 92072 gene locus_tag LOCUS_43480 91821 92072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 92069 92581 gene locus_tag LOCUS_43490 92069 92581 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_43490 92592 93482 gene locus_tag LOCUS_43500 92592 93482 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_43500 93606 94181 gene locus_tag LOCUS_43510 93606 94181 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_43510 94624 94178 gene locus_tag LOCUS_43520 94624 94178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 94774 95007 gene locus_tag LOCUS_43530 94774 95007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 95151 96170 gene locus_tag LOCUS_43540 95151 96170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 96930 96214 gene locus_tag LOCUS_43550 96930 96214 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_43550 97426 96950 gene locus_tag LOCUS_43560 97426 96950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 97663 97875 gene locus_tag LOCUS_43570 97663 97875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 97914 98294 gene locus_tag LOCUS_43580 97914 98294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 98387 98941 gene locus_tag LOCUS_43590 98387 98941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43590 98829 99233 gene locus_tag LOCUS_43600 98829 99233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43600 99531 99304 gene locus_tag LOCUS_43610 99531 99304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 99919 99470 gene locus_tag LOCUS_43620 99919 99470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 101424 99925 gene locus_tag LOCUS_43630 gene recQ 101424 99925 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555810.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43630 103010 101676 gene locus_tag LOCUS_43640 103010 101676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 protein_id gnl|my_center|LOCUS_43640 106248 103390 gene locus_tag LOCUS_43650 106248 103390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 107098 106472 gene locus_tag LOCUS_43660 107098 106472 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_43660 107298 108062 gene locus_tag LOCUS_43670 107298 108062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43670 108026 108361 gene locus_tag LOCUS_43680 108026 108361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43680 108662 108994 gene locus_tag LOCUS_43690 108662 108994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 >Feature sequence19 1716 724 gene locus_tag LOCUS_43700 1716 724 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43700 1976 1713 gene locus_tag LOCUS_43710 1976 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43710 3188 2043 gene locus_tag LOCUS_43720 3188 2043 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_43720 4876 3680 gene locus_tag LOCUS_43730 gene lhgO 4876 3680 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_43730 5392 5120 gene locus_tag LOCUS_43740 5392 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 7112 5466 gene locus_tag LOCUS_43750 7112 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 7429 8607 gene locus_tag LOCUS_43760 7429 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 8604 12020 gene locus_tag LOCUS_43770 8604 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 12337 12531 gene locus_tag LOCUS_43780 12337 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 12584 13492 gene locus_tag LOCUS_43790 12584 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 14465 13581 gene locus_tag LOCUS_43800 14465 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 16832 14736 gene locus_tag LOCUS_43810 16832 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 17647 17291 gene locus_tag LOCUS_43820 17647 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 19737 18052 gene locus_tag LOCUS_43830 19737 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 20875 19859 gene locus_tag LOCUS_43840 gene mgrA 20875 19859 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_43840 20941 21996 gene locus_tag LOCUS_43850 20941 21996 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_43850 22112 22987 gene locus_tag LOCUS_43860 22112 22987 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_43860 24094 22976 gene locus_tag LOCUS_43870 24094 22976 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_43870 25597 24287 gene locus_tag LOCUS_43880 gene fucP 25597 24287 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039140.1 protein_id gnl|my_center|LOCUS_43880 27541 25694 gene locus_tag LOCUS_43890 27541 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 28882 27686 gene locus_tag LOCUS_43900 28882 27686 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_43900 30308 29100 gene locus_tag LOCUS_43910 30308 29100 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_43910 31196 30312 gene locus_tag LOCUS_43920 31196 30312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43920 32143 31127 gene locus_tag LOCUS_43930 32143 31127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43930 33298 32150 gene locus_tag LOCUS_43940 33298 32150 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_43940 33636 34304 gene locus_tag LOCUS_43950 33636 34304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43950 34369 34914 gene locus_tag LOCUS_43960 34369 34914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43960 34919 35743 gene locus_tag LOCUS_43970 34919 35743 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_43970 35861 36145 gene locus_tag LOCUS_43980 35861 36145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 36049 36861 gene locus_tag LOCUS_43990 gene glk 36049 36861 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43990 38226 36883 gene locus_tag LOCUS_44000 38226 36883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_44000 38768 38364 gene locus_tag LOCUS_44010 38768 38364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 39434 38799 gene locus_tag LOCUS_44020 39434 38799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 39975 39811 gene locus_tag LOCUS_44030 39975 39811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 40758 41420 gene locus_tag LOCUS_44040 40758 41420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 41640 42074 gene locus_tag LOCUS_44050 41640 42074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44050 42085 43713 gene locus_tag LOCUS_44060 42085 43713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44060 43938 44198 gene locus_tag LOCUS_44070 43938 44198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 44547 45551 gene locus_tag LOCUS_44080 44547 45551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 45629 47752 gene locus_tag LOCUS_44090 45629 47752 CDS product chitobiase/beta-hexosaminidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222583402.1 protein_id gnl|my_center|LOCUS_44090 48110 47832 gene locus_tag LOCUS_44100 48110 47832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 48186 50966 gene locus_tag LOCUS_44110 48186 50966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 50944 54522 gene locus_tag LOCUS_44120 50944 54522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 54498 55751 gene locus_tag LOCUS_44130 54498 55751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 55953 58772 gene locus_tag LOCUS_44140 55953 58772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 58789 59097 gene locus_tag LOCUS_44150 58789 59097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 59130 59372 gene locus_tag LOCUS_44160 59130 59372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 59591 62410 gene locus_tag LOCUS_44170 59591 62410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 62930 64909 gene locus_tag LOCUS_44180 62930 64909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 65855 65673 gene locus_tag LOCUS_44190 65855 65673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 65932 68829 gene locus_tag LOCUS_44200 65932 68829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 68826 69035 gene locus_tag LOCUS_44210 68826 69035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 69351 72020 gene locus_tag LOCUS_44220 69351 72020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44220 72154 73218 gene locus_tag LOCUS_44230 72154 73218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44230 73550 74242 gene locus_tag LOCUS_44240 73550 74242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44240 74568 78368 gene locus_tag LOCUS_44250 74568 78368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 78314 78628 gene locus_tag LOCUS_44260 78314 78628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 78661 78939 gene locus_tag LOCUS_44270 78661 78939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 78899 80284 gene locus_tag LOCUS_44280 78899 80284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 80244 80696 gene locus_tag LOCUS_44290 80244 80696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 82491 82234 gene locus_tag LOCUS_44300 82491 82234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 83108 83359 gene locus_tag LOCUS_44310 83108 83359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 83513 85042 gene locus_tag LOCUS_44320 83513 85042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 85106 87532 gene locus_tag LOCUS_44330 85106 87532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 87844 88626 gene locus_tag LOCUS_44340 87844 88626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 88681 91251 gene locus_tag LOCUS_44350 88681 91251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 91325 94036 gene locus_tag LOCUS_44360 91325 94036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 94497 98894 gene locus_tag LOCUS_44370 94497 98894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 100632 100303 gene locus_tag LOCUS_44380 100632 100303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 100773 101921 gene locus_tag LOCUS_44390 100773 101921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 102289 102840 gene locus_tag LOCUS_44400 102289 102840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44400 102883 103220 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caactgcagtttttccggcaattcgg 103769 104176 gene locus_tag LOCUS_44410 103769 104176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 104453 105136 gene locus_tag LOCUS_44420 104453 105136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 >Feature sequence20 590 78 gene locus_tag LOCUS_44430 590 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 2584 1022 gene locus_tag LOCUS_44440 2584 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 3434 2601 gene locus_tag LOCUS_44450 3434 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 4270 3449 gene locus_tag LOCUS_44460 4270 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405042.1 protein_id gnl|my_center|LOCUS_44460 5154 4363 gene locus_tag LOCUS_44470 5154 4363 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_44470 5263 5763 gene locus_tag LOCUS_44480 gene sixA 5263 5763 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_44480 5760 6092 gene locus_tag LOCUS_44490 5760 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 6132 6509 gene locus_tag LOCUS_44500 6132 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 6562 8103 gene locus_tag LOCUS_44510 6562 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 8456 8187 gene locus_tag LOCUS_44520 8456 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 8727 8410 gene locus_tag LOCUS_44530 8727 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 8833 9513 gene locus_tag LOCUS_44540 8833 9513 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_44540 9556 10077 gene locus_tag LOCUS_44550 9556 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 10088 11011 gene locus_tag LOCUS_44560 10088 11011 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_44560 11158 11721 gene locus_tag LOCUS_44570 11158 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 11951 15079 gene locus_tag LOCUS_44580 11951 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 15514 16017 gene locus_tag LOCUS_44590 15514 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 16684 16061 gene locus_tag LOCUS_44600 gene upp 16684 16061 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_44600 18067 16736 gene locus_tag LOCUS_44610 18067 16736 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_44610 18286 18948 gene locus_tag LOCUS_44620 18286 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 19129 20001 gene locus_tag LOCUS_44630 gene lipA 19129 20001 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_44630 20742 20065 gene locus_tag LOCUS_44640 20742 20065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 23734 21194 gene locus_tag LOCUS_44650 23734 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 25069 23909 gene locus_tag LOCUS_44660 25069 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 25265 26677 gene locus_tag LOCUS_44670 25265 26677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 27178 26681 gene locus_tag LOCUS_44680 gene msrB 27178 26681 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 protein_id gnl|my_center|LOCUS_44680 27463 27323 gene locus_tag LOCUS_44690 27463 27323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 27629 28348 gene locus_tag LOCUS_44700 27629 28348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 28409 28774 gene locus_tag LOCUS_44710 28409 28774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 28787 29200 gene locus_tag LOCUS_44720 28787 29200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 29246 29800 gene locus_tag LOCUS_44730 29246 29800 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_44730 29905 30792 gene locus_tag LOCUS_44740 29905 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 35629 30866 gene locus_tag LOCUS_44750 35629 30866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 35861 36166 gene locus_tag LOCUS_44760 35861 36166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44760 36124 36609 gene locus_tag LOCUS_44770 36124 36609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44770 36613 37452 gene locus_tag LOCUS_44780 36613 37452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 37491 38294 gene locus_tag LOCUS_44790 37491 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 38408 41668 gene locus_tag LOCUS_44800 38408 41668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 42133 41669 gene locus_tag LOCUS_44810 42133 41669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 42531 43844 gene locus_tag LOCUS_44820 gene ahcY 42531 43844 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_44820 43943 44194 gene locus_tag LOCUS_44830 gene yidD 43943 44194 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938375.1 protein_id gnl|my_center|LOCUS_44830 44191 45684 gene locus_tag LOCUS_44840 44191 45684 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_44840 46811 45789 gene locus_tag LOCUS_44850 46811 45789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 47481 46891 gene locus_tag LOCUS_44860 47481 46891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 48271 47765 gene locus_tag LOCUS_44870 48271 47765 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930581.1 protein_id gnl|my_center|LOCUS_44870 49074 48322 gene locus_tag LOCUS_44880 49074 48322 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_44880 49624 50097 gene locus_tag LOCUS_44890 49624 50097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 50133 51401 gene locus_tag LOCUS_44900 50133 51401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 51943 51587 gene locus_tag LOCUS_44910 51943 51587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 53306 51948 gene locus_tag LOCUS_44920 53306 51948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 53469 54122 gene locus_tag LOCUS_44930 53469 54122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 55081 54191 gene locus_tag LOCUS_44940 55081 54191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 55221 55730 gene locus_tag LOCUS_44950 55221 55730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44950 55727 56422 gene locus_tag LOCUS_44960 55727 56422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44960 56579 57157 gene locus_tag LOCUS_44970 56579 57157 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_44970 57162 57959 gene locus_tag LOCUS_44980 57162 57959 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_44980 58156 58830 gene locus_tag LOCUS_44990 gene msrA 58156 58830 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_44990 59134 60507 gene locus_tag LOCUS_45000 59134 60507 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447544.1 protein_id gnl|my_center|LOCUS_45000 60695 61288 gene locus_tag LOCUS_45010 60695 61288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 61999 61292 gene locus_tag LOCUS_45020 61999 61292 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_45020 62277 61999 gene locus_tag LOCUS_45030 62277 61999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 62861 63469 gene locus_tag LOCUS_45040 62861 63469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 63611 64756 gene locus_tag LOCUS_45050 63611 64756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 64847 65743 gene locus_tag LOCUS_45060 64847 65743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 65857 66624 gene locus_tag LOCUS_45070 65857 66624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 66548 67504 gene locus_tag LOCUS_45080 66548 67504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 67501 68256 gene locus_tag LOCUS_45090 67501 68256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 68916 68410 gene locus_tag LOCUS_45100 68916 68410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 69075 70253 gene locus_tag LOCUS_45110 69075 70253 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_45110 70369 70980 gene locus_tag LOCUS_45120 70369 70980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 71027 72661 gene locus_tag LOCUS_45130 71027 72661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 72869 73804 gene locus_tag LOCUS_45140 72869 73804 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188734295.1 protein_id gnl|my_center|LOCUS_45140 73952 74815 gene locus_tag LOCUS_45150 73952 74815 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140079.1 protein_id gnl|my_center|LOCUS_45150 76662 74926 gene locus_tag LOCUS_45160 76662 74926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45160 77924 76650 gene locus_tag LOCUS_45170 77924 76650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 78232 79203 gene locus_tag LOCUS_45180 78232 79203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 79206 79421 gene locus_tag LOCUS_45190 79206 79421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 79652 79969 gene locus_tag LOCUS_45200 gene groES 79652 79969 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_45200 80027 81655 gene locus_tag LOCUS_45210 gene groL 80027 81655 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_45210 81763 82503 gene locus_tag LOCUS_45220 81763 82503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 83055 82971 gene locus_tag LOCUS_t00260 83055 82971 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 83209 83134 gene locus_tag LOCUS_t00270 83209 83134 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 83321 83233 gene locus_tag LOCUS_t00280 83321 83233 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85092 83506 gene locus_tag LOCUS_45230 85092 83506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 88217 85110 gene locus_tag LOCUS_45240 88217 85110 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_45240 89828 88833 gene locus_tag LOCUS_45250 89828 88833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 91620 89884 gene locus_tag LOCUS_45260 91620 89884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45260 93580 91565 gene locus_tag LOCUS_45270 93580 91565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45270 93859 93617 gene locus_tag LOCUS_45280 93859 93617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 97066 93899 gene locus_tag LOCUS_45290 97066 93899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 97651 97091 gene locus_tag LOCUS_45300 97651 97091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 97781 98308 gene locus_tag LOCUS_45310 gene rimM 97781 98308 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657443.1 protein_id gnl|my_center|LOCUS_45310 >Feature sequence21 454 65 gene locus_tag LOCUS_45320 454 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45320 752 357 gene locus_tag LOCUS_45330 752 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45330 940 1212 gene locus_tag LOCUS_45340 940 1212 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_45340 1346 2581 gene locus_tag LOCUS_45350 1346 2581 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_45350 2641 3234 gene locus_tag LOCUS_45360 2641 3234 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_45360 3407 3934 gene locus_tag LOCUS_45370 gene gmhB 3407 3934 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107287.1 protein_id gnl|my_center|LOCUS_45370 3959 5065 gene locus_tag LOCUS_45380 3959 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 8028 5353 gene locus_tag LOCUS_45390 8028 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 10416 8131 gene locus_tag LOCUS_45400 10416 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 10792 11649 gene locus_tag LOCUS_45410 10792 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 11558 11785 gene locus_tag LOCUS_45420 11558 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 11823 13520 gene locus_tag LOCUS_45430 11823 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 13532 14698 gene locus_tag LOCUS_45440 13532 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 14752 15435 gene locus_tag LOCUS_45450 14752 15435 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_45450 15610 16326 gene locus_tag LOCUS_45460 15610 16326 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_45460 16433 17602 gene locus_tag LOCUS_45470 gene galK 16433 17602 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_45470 17683 17758 gene locus_tag LOCUS_t00290 17683 17758 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17914 20478 gene locus_tag LOCUS_45480 17914 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 21161 20775 gene locus_tag LOCUS_45490 21161 20775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 22025 21369 gene locus_tag LOCUS_45500 22025 21369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_45500 22151 22549 gene locus_tag LOCUS_45510 22151 22549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 22540 22815 gene locus_tag LOCUS_45520 22540 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 23467 22820 gene locus_tag LOCUS_45530 23467 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 23967 23467 gene locus_tag LOCUS_45540 23967 23467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 25019 24351 gene locus_tag LOCUS_45550 25019 24351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45550 25558 25049 gene locus_tag LOCUS_45560 25558 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45560 25744 25920 gene locus_tag LOCUS_45570 25744 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 25976 26296 gene locus_tag LOCUS_45580 25976 26296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45580 28156 26471 gene locus_tag LOCUS_45590 28156 26471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 28723 28163 gene locus_tag LOCUS_45600 28723 28163 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_45600 29788 28931 gene locus_tag LOCUS_45610 29788 28931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 30036 30536 gene locus_tag LOCUS_45620 30036 30536 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_45620 30579 31541 gene locus_tag LOCUS_45630 30579 31541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 31456 32016 gene locus_tag LOCUS_45640 31456 32016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 34938 32155 gene locus_tag LOCUS_45650 34938 32155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 35368 34913 gene locus_tag LOCUS_45660 35368 34913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 35545 36990 gene locus_tag LOCUS_45670 35545 36990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 37020 39602 gene locus_tag LOCUS_45680 37020 39602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 39619 41454 gene locus_tag LOCUS_45690 39619 41454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45690 41427 41621 gene locus_tag LOCUS_45700 41427 41621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45700 41666 42763 gene locus_tag LOCUS_45710 gene gcvT 41666 42763 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_45710 42794 43294 gene locus_tag LOCUS_45720 42794 43294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 44256 43300 gene locus_tag LOCUS_45730 44256 43300 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_45730 44932 44579 gene locus_tag LOCUS_45740 44932 44579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 45369 45725 gene locus_tag LOCUS_45750 45369 45725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 46392 45922 gene locus_tag LOCUS_45760 46392 45922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 46667 46558 gene locus_tag LOCUS_r00040 46667 46558 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 49667 46788 gene locus_tag LOCUS_r00050 49667 46788 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 51498 49977 gene locus_tag LOCUS_r00060 51498 49977 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 52104 53174 gene locus_tag LOCUS_45770 gene serC 52104 53174 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_45770 54388 53213 gene locus_tag LOCUS_45780 54388 53213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 54594 54370 gene locus_tag LOCUS_45790 54594 54370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 55379 54747 gene locus_tag LOCUS_45800 55379 54747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45800 55713 55438 gene locus_tag LOCUS_45810 55713 55438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45810 55757 56497 gene locus_tag LOCUS_45820 55757 56497 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970604.1 protein_id gnl|my_center|LOCUS_45820 57055 56609 gene locus_tag LOCUS_45830 gene rplI 57055 56609 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_45830 57370 57101 gene locus_tag LOCUS_45840 gene rpsR 57370 57101 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_45840 57877 57413 gene locus_tag LOCUS_45850 57877 57413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 59296 57881 gene locus_tag LOCUS_45860 59296 57881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 59480 59567 gene locus_tag LOCUS_t00300 59480 59567 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 59629 60915 gene locus_tag LOCUS_45870 59629 60915 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_45870 61121 61564 gene locus_tag LOCUS_45880 61121 61564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 61645 62427 gene locus_tag LOCUS_45890 61645 62427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 62449 62727 gene locus_tag LOCUS_45900 62449 62727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 62752 63060 gene locus_tag LOCUS_45910 62752 63060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 68622 63157 gene locus_tag LOCUS_45920 68622 63157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 69502 68624 gene locus_tag LOCUS_45930 69502 68624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 72156 69499 gene locus_tag LOCUS_45940 72156 69499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 73425 72286 gene locus_tag LOCUS_45950 73425 72286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 74110 75042 gene locus_tag LOCUS_45960 74110 75042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 76346 75102 gene locus_tag LOCUS_45970 76346 75102 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_45970 77143 76700 gene locus_tag LOCUS_45980 77143 76700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45980 77584 77276 gene locus_tag LOCUS_45990 77584 77276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 77599 78207 gene locus_tag LOCUS_46000 77599 78207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 78220 78717 gene locus_tag LOCUS_46010 78220 78717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 78982 79746 gene locus_tag LOCUS_46020 78982 79746 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46020 79752 80216 gene locus_tag LOCUS_46030 79752 80216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 80427 82175 gene locus_tag LOCUS_46040 80427 82175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 82105 82374 gene locus_tag LOCUS_46050 82105 82374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 82395 82664 gene locus_tag LOCUS_46060 82395 82664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 82785 84521 gene locus_tag LOCUS_46070 82785 84521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 84534 86600 gene locus_tag LOCUS_46080 84534 86600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 86708 87586 gene locus_tag LOCUS_46090 86708 87586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 87652 87945 gene locus_tag LOCUS_46100 87652 87945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 88158 89039 gene locus_tag LOCUS_46110 88158 89039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 89142 89870 gene locus_tag LOCUS_46120 89142 89870 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_46120 91221 89905 gene locus_tag LOCUS_46130 91221 89905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 92180 91212 gene locus_tag LOCUS_46140 92180 91212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 92286 93071 gene locus_tag LOCUS_46150 gene hemB 92286 93071 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_46150 93493 93140 gene locus_tag LOCUS_46160 93493 93140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719490.1 protein_id gnl|my_center|LOCUS_46160 93867 94340 gene locus_tag LOCUS_46170 93867 94340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46170 95068 94427 gene locus_tag LOCUS_46180 95068 94427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46180 95198 94950 gene locus_tag LOCUS_46190 95198 94950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46190 95890 95399 gene locus_tag LOCUS_46200 95890 95399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 96374 95955 gene locus_tag LOCUS_46210 96374 95955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 96822 96613 gene locus_tag LOCUS_46220 96822 96613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 97197 96994 gene locus_tag LOCUS_46230 97197 96994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46230 >Feature sequence22 2927 2697 gene locus_tag LOCUS_46240 2927 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 3924 4085 gene locus_tag LOCUS_46250 3924 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 4597 5373 gene locus_tag LOCUS_46260 4597 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 5808 6149 gene locus_tag LOCUS_46270 5808 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 6958 6380 gene locus_tag LOCUS_46280 6958 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 7377 7045 gene locus_tag LOCUS_46290 7377 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 8171 9223 gene locus_tag LOCUS_46300 8171 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 9951 9295 gene locus_tag LOCUS_46310 9951 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 10461 11957 gene locus_tag LOCUS_46320 10461 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 12725 12246 gene locus_tag LOCUS_46330 12725 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46330 12969 12727 gene locus_tag LOCUS_46340 12969 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46340 15264 13255 gene locus_tag LOCUS_46350 15264 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 17030 15261 gene locus_tag LOCUS_46360 17030 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 19394 17421 gene locus_tag LOCUS_46370 19394 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 19946 21691 gene locus_tag LOCUS_46380 19946 21691 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_46380 22434 22829 gene locus_tag LOCUS_46390 22434 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 22878 23153 gene locus_tag LOCUS_46400 22878 23153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 23150 23323 gene locus_tag LOCUS_46410 23150 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 25393 24410 gene locus_tag LOCUS_46420 25393 24410 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_46420 25587 26942 gene locus_tag LOCUS_46430 25587 26942 CDS product IS4-like element ISBthe3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113760757.1 protein_id gnl|my_center|LOCUS_46430 27456 27181 gene locus_tag LOCUS_46440 27456 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 28323 27933 gene locus_tag LOCUS_tm00010 28323 27933 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 28621 28466 gene locus_tag LOCUS_46450 28621 28466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 28767 28618 gene locus_tag LOCUS_46460 28767 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 29186 28806 gene locus_tag LOCUS_46470 29186 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 29733 30182 gene locus_tag LOCUS_46480 gene mraZ 29733 30182 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_46480 30185 31099 gene locus_tag LOCUS_46490 gene rsmH 30185 31099 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_46490 31115 31285 gene locus_tag LOCUS_46500 31115 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 31251 31427 gene locus_tag LOCUS_46510 31251 31427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 31439 32719 gene locus_tag LOCUS_46520 31439 32719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46520 32710 33288 gene locus_tag LOCUS_46530 32710 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46530 33282 33563 gene locus_tag LOCUS_46540 33282 33563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46540 33735 34268 gene locus_tag LOCUS_46550 33735 34268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46550 34273 35067 gene locus_tag LOCUS_46560 34273 35067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46560 35101 36369 gene locus_tag LOCUS_46570 gene mraY 35101 36369 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_46570 36380 36577 gene locus_tag LOCUS_46580 36380 36577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46580 36892 37218 gene locus_tag LOCUS_46590 36892 37218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46590 37209 37688 gene locus_tag LOCUS_46600 37209 37688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46600 37693 38850 gene locus_tag LOCUS_46610 37693 38850 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_46610 38864 39991 gene locus_tag LOCUS_46620 gene murG 38864 39991 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_46620 40081 41460 gene locus_tag LOCUS_46630 gene murC 40081 41460 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_46630 41457 42230 gene locus_tag LOCUS_46640 41457 42230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 42278 43609 gene locus_tag LOCUS_46650 gene ftsA 42278 43609 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_46650 43747 44811 gene locus_tag LOCUS_46660 43747 44811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 44745 45206 gene locus_tag LOCUS_46670 44745 45206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 45580 45852 gene locus_tag LOCUS_46680 45580 45852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 48470 46077 gene locus_tag LOCUS_46690 48470 46077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46690 49417 48476 gene locus_tag LOCUS_46700 49417 48476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46700 49532 50356 gene locus_tag LOCUS_46710 49532 50356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46710 50332 52014 gene locus_tag LOCUS_46720 50332 52014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 53065 52121 gene locus_tag LOCUS_46730 53065 52121 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_46730 53365 53066 gene locus_tag LOCUS_46740 53365 53066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 53842 56403 gene locus_tag LOCUS_46750 53842 56403 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_46750 56635 57180 gene locus_tag LOCUS_46760 gene infC 56635 57180 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_46760 57271 57465 gene locus_tag LOCUS_46770 gene rpmI 57271 57465 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_46770 57593 57886 gene locus_tag LOCUS_46780 gene rplT 57593 57886 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_46780 58890 57991 gene locus_tag LOCUS_46790 gene prfB 58890 57991 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46790 60040 59195 gene locus_tag LOCUS_46800 60040 59195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 60865 60056 gene locus_tag LOCUS_46810 60865 60056 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46810 61203 61622 gene locus_tag LOCUS_46820 61203 61622 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_46820 62385 61708 gene locus_tag LOCUS_46830 62385 61708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 64648 62519 gene locus_tag LOCUS_46840 64648 62519 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_46840 64904 64656 gene locus_tag LOCUS_46850 64904 64656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 65152 65706 gene locus_tag LOCUS_46860 65152 65706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46860 65675 66223 gene locus_tag LOCUS_46870 65675 66223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46870 67264 66296 gene locus_tag LOCUS_46880 67264 66296 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_46880 68526 67366 gene locus_tag LOCUS_46890 gene aar 68526 67366 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_46890 68654 69277 gene locus_tag LOCUS_46900 68654 69277 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_46900 69420 70463 gene locus_tag LOCUS_46910 69420 70463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46910 70463 71980 gene locus_tag LOCUS_46920 70463 71980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46920 72021 73070 gene locus_tag LOCUS_46930 72021 73070 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831154.1 protein_id gnl|my_center|LOCUS_46930 73167 73718 gene locus_tag LOCUS_46940 73167 73718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46940 73616 74140 gene locus_tag LOCUS_46950 73616 74140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46950 74255 76429 gene locus_tag LOCUS_46960 74255 76429 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_46960 76530 77366 gene locus_tag LOCUS_46970 76530 77366 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_46970 77439 78158 gene locus_tag LOCUS_46980 gene tpiA 77439 78158 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_46980 78494 78222 gene locus_tag LOCUS_46990 78494 78222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46990 79474 78404 gene locus_tag LOCUS_47000 79474 78404 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47000 79913 80725 gene locus_tag LOCUS_47010 79913 80725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 80758 81378 gene locus_tag LOCUS_47020 80758 81378 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_47020 82315 82085 gene locus_tag LOCUS_47030 82315 82085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 82962 82321 gene locus_tag LOCUS_47040 82962 82321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 84158 83265 gene locus_tag LOCUS_47050 84158 83265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 84888 84190 gene locus_tag LOCUS_47060 84888 84190 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_47060 84920 85714 gene locus_tag LOCUS_47070 84920 85714 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_47070 86561 85692 gene locus_tag LOCUS_47080 86561 85692 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_47080 86970 87356 gene locus_tag LOCUS_47090 86970 87356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 87840 87454 gene locus_tag LOCUS_47100 87840 87454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 88025 88957 gene locus_tag LOCUS_47110 88025 88957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 88933 90738 gene locus_tag LOCUS_47120 88933 90738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 90771 90953 gene locus_tag LOCUS_47130 90771 90953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 91082 91516 gene locus_tag LOCUS_47140 91082 91516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 91880 93997 gene locus_tag LOCUS_47150 91880 93997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 94032 94379 gene locus_tag LOCUS_47160 94032 94379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47160 94376 94585 gene locus_tag LOCUS_47170 94376 94585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47170 94582 95103 gene locus_tag LOCUS_47180 94582 95103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47180 95307 95585 gene locus_tag LOCUS_47190 95307 95585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 95622 95807 gene locus_tag LOCUS_47200 95622 95807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 >Feature sequence23 434 736 gene locus_tag LOCUS_47210 434 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 757 1011 gene locus_tag LOCUS_47220 757 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 1545 1724 gene locus_tag LOCUS_47230 1545 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 1807 2820 gene locus_tag LOCUS_47240 1807 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 2881 3003 gene locus_tag LOCUS_47250 2881 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 3087 3317 gene locus_tag LOCUS_47260 3087 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 3289 3822 gene locus_tag LOCUS_47270 3289 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 3968 4222 gene locus_tag LOCUS_47280 3968 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 4341 4925 gene locus_tag LOCUS_47290 4341 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 5019 11222 gene locus_tag LOCUS_47300 5019 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 11716 12090 gene locus_tag LOCUS_47310 11716 12090 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_47310 12452 12243 gene locus_tag LOCUS_47320 12452 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47320 13776 14222 gene locus_tag LOCUS_47330 13776 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 14224 14910 gene locus_tag LOCUS_47340 14224 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 14907 15395 gene locus_tag LOCUS_47350 14907 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 15516 16265 gene locus_tag LOCUS_47360 15516 16265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 16298 18196 gene locus_tag LOCUS_47370 16298 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 18312 20126 gene locus_tag LOCUS_47380 18312 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 20123 20419 gene locus_tag LOCUS_47390 20123 20419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 21098 21688 gene locus_tag LOCUS_47400 21098 21688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 21689 22255 gene locus_tag LOCUS_47410 21689 22255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 22303 22998 gene locus_tag LOCUS_47420 22303 22998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 23164 26430 gene locus_tag LOCUS_47430 23164 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 26367 29660 gene locus_tag LOCUS_47440 26367 29660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 29720 32494 gene locus_tag LOCUS_47450 29720 32494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 32509 34881 gene locus_tag LOCUS_47460 32509 34881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 34830 34973 gene locus_tag LOCUS_47470 34830 34973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 35304 37319 gene locus_tag LOCUS_47480 35304 37319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 37505 37717 gene locus_tag LOCUS_47490 37505 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 37969 39918 gene locus_tag LOCUS_47500 37969 39918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 40083 40301 gene locus_tag LOCUS_47510 40083 40301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 41053 41550 gene locus_tag LOCUS_47520 41053 41550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 41700 42017 gene locus_tag LOCUS_47530 41700 42017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 42014 43915 gene locus_tag LOCUS_47540 42014 43915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 44643 43924 gene locus_tag LOCUS_47550 44643 43924 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_47550 44997 45293 gene locus_tag LOCUS_47560 44997 45293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 45396 45998 gene locus_tag LOCUS_47570 45396 45998 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_47570 46131 49775 gene locus_tag LOCUS_47580 46131 49775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 49679 51544 gene locus_tag LOCUS_47590 49679 51544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 51882 52448 gene locus_tag LOCUS_47600 51882 52448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 52645 53952 gene locus_tag LOCUS_47610 52645 53952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 54484 54068 gene locus_tag LOCUS_47620 54484 54068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47620 55291 54815 gene locus_tag LOCUS_47630 55291 54815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 55567 56817 gene locus_tag LOCUS_47640 55567 56817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 57224 56883 gene locus_tag LOCUS_47650 57224 56883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 57456 57271 gene locus_tag LOCUS_47660 57456 57271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 58175 57438 gene locus_tag LOCUS_47670 58175 57438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 58648 58232 gene locus_tag LOCUS_47680 58648 58232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 59241 58900 gene locus_tag LOCUS_47690 59241 58900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 60278 59415 gene locus_tag LOCUS_47700 60278 59415 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809962.1 protein_id gnl|my_center|LOCUS_47700 60828 61082 gene locus_tag LOCUS_47710 60828 61082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 61084 61749 gene locus_tag LOCUS_47720 61084 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 61637 61993 gene locus_tag LOCUS_47730 61637 61993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 62371 62069 gene locus_tag LOCUS_47740 62371 62069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 62898 62677 gene locus_tag LOCUS_47750 62898 62677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 63076 64206 gene locus_tag LOCUS_47760 63076 64206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47760 64226 65218 gene locus_tag LOCUS_47770 64226 65218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47770 65199 65792 gene locus_tag LOCUS_47780 65199 65792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47780 66828 67094 gene locus_tag LOCUS_47790 66828 67094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 67453 68355 gene locus_tag LOCUS_47800 67453 68355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47800 68352 69002 gene locus_tag LOCUS_47810 68352 69002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47810 68938 71643 gene locus_tag LOCUS_47820 68938 71643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 71740 72468 gene locus_tag LOCUS_47830 71740 72468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 72656 73045 gene locus_tag LOCUS_47840 72656 73045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 73457 73888 gene locus_tag LOCUS_47850 73457 73888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 74697 74011 gene locus_tag LOCUS_47860 74697 74011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 75371 74697 gene locus_tag LOCUS_47870 75371 74697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 76032 75646 gene locus_tag LOCUS_47880 76032 75646 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_47880 76978 76226 gene locus_tag LOCUS_47890 76978 76226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 78719 77097 gene locus_tag LOCUS_47900 78719 77097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47900 79321 78716 gene locus_tag LOCUS_47910 79321 78716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 79823 80071 gene locus_tag LOCUS_47920 79823 80071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 80246 80842 gene locus_tag LOCUS_47930 80246 80842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 82060 81497 gene locus_tag LOCUS_47940 82060 81497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47940 82473 82943 gene locus_tag LOCUS_47950 82473 82943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47950 83986 84387 gene locus_tag LOCUS_47960 83986 84387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47960 85006 84827 gene locus_tag LOCUS_47970 85006 84827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 85691 85029 gene locus_tag LOCUS_47980 85691 85029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 86344 86111 gene locus_tag LOCUS_47990 86344 86111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 >Feature sequence24 282 563 gene locus_tag LOCUS_48000 282 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 1014 2309 gene locus_tag LOCUS_48010 1014 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 2309 2488 gene locus_tag LOCUS_48020 2309 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 2497 2934 gene locus_tag LOCUS_48030 2497 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 2889 5285 gene locus_tag LOCUS_48040 2889 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 5282 6094 gene locus_tag LOCUS_48050 5282 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 6145 6552 gene locus_tag LOCUS_48060 6145 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 6486 6719 gene locus_tag LOCUS_48070 6486 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 7189 9081 gene locus_tag LOCUS_48080 7189 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48080 9078 10094 gene locus_tag LOCUS_48090 9078 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48090 10283 11251 gene locus_tag LOCUS_48100 10283 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48100 11274 13853 gene locus_tag LOCUS_48110 11274 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 13861 14484 gene locus_tag LOCUS_48120 13861 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 14510 15505 gene locus_tag LOCUS_48130 14510 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 15641 16612 gene locus_tag LOCUS_48140 15641 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 16654 17481 gene locus_tag LOCUS_48150 16654 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 17825 17753 gene locus_tag LOCUS_t00310 17825 17753 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17898 18257 gene locus_tag LOCUS_48160 17898 18257 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_48160 18261 18908 gene locus_tag LOCUS_48170 18261 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 19023 19187 gene locus_tag LOCUS_48180 19023 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 19184 19444 gene locus_tag LOCUS_48190 19184 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48190 19630 24735 gene locus_tag LOCUS_48200 19630 24735 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48200 24762 25652 gene locus_tag LOCUS_48210 24762 25652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48210 25755 26447 gene locus_tag LOCUS_48220 25755 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 26717 26535 gene locus_tag LOCUS_48230 26717 26535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 26875 26714 gene locus_tag LOCUS_48240 26875 26714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48240 27743 26910 gene locus_tag LOCUS_48250 27743 26910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48250 27870 28085 gene locus_tag LOCUS_48260 27870 28085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 28132 28431 gene locus_tag LOCUS_48270 28132 28431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 30654 28546 gene locus_tag LOCUS_48280 30654 28546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 31550 30552 gene locus_tag LOCUS_48290 31550 30552 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_48290 32862 31789 gene locus_tag LOCUS_48300 32862 31789 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_48300 33866 32871 gene locus_tag LOCUS_48310 gene ftsY 33866 32871 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_48310 34102 33926 gene locus_tag LOCUS_48320 34102 33926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 34352 34164 gene locus_tag LOCUS_48330 gene rpmG 34352 34164 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_48330 34627 34379 gene locus_tag LOCUS_48340 gene rpmB 34627 34379 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_48340 34733 34660 gene locus_tag LOCUS_t00320 34733 34660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35355 34897 gene locus_tag LOCUS_48350 35355 34897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 36521 35358 gene locus_tag LOCUS_48360 36521 35358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48360 37437 36811 gene locus_tag LOCUS_48370 37437 36811 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_48370 37432 37563 gene locus_tag LOCUS_48380 37432 37563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 37951 37667 gene locus_tag LOCUS_48390 37951 37667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 38843 38013 gene locus_tag LOCUS_48400 38843 38013 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_48400 39081 40472 gene locus_tag LOCUS_48410 39081 40472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48410 40375 40743 gene locus_tag LOCUS_48420 40375 40743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48420 40747 42039 gene locus_tag LOCUS_48430 40747 42039 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_48430 42201 43385 gene locus_tag LOCUS_48440 42201 43385 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_48440 43480 43827 gene locus_tag LOCUS_48450 43480 43827 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_48450 45284 43884 gene locus_tag LOCUS_48460 45284 43884 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_48460 45386 46636 gene locus_tag LOCUS_48470 45386 46636 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_48470 48339 46714 gene locus_tag LOCUS_48480 48339 46714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 48587 48336 gene locus_tag LOCUS_48490 48587 48336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 49770 48763 gene locus_tag LOCUS_48500 gene rfaE1 49770 48763 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_48500 50352 49882 gene locus_tag LOCUS_48510 50352 49882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 50720 50352 gene locus_tag LOCUS_48520 50720 50352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 50957 52627 gene locus_tag LOCUS_48530 50957 52627 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_48530 52765 53208 gene locus_tag LOCUS_48540 52765 53208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 53111 53521 gene locus_tag LOCUS_48550 53111 53521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 53658 54455 gene locus_tag LOCUS_48560 53658 54455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48560 54575 54934 gene locus_tag LOCUS_48570 54575 54934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48570 54948 55781 gene locus_tag LOCUS_48580 54948 55781 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_48580 56492 58243 gene locus_tag LOCUS_48590 56492 58243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48590 58146 60371 gene locus_tag LOCUS_48600 58146 60371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48600 60329 62002 gene locus_tag LOCUS_48610 60329 62002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48610 62874 62320 gene locus_tag LOCUS_48620 62874 62320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48620 63465 62923 gene locus_tag LOCUS_48630 63465 62923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 64505 63594 gene locus_tag LOCUS_48640 64505 63594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 65769 64387 gene locus_tag LOCUS_48650 65769 64387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 66775 65993 gene locus_tag LOCUS_48660 66775 65993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48660 67173 66850 gene locus_tag LOCUS_48670 67173 66850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48670 67702 67187 gene locus_tag LOCUS_48680 gene ribH 67702 67187 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_48680 68616 67792 gene locus_tag LOCUS_48690 68616 67792 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_48690 69679 68651 gene locus_tag LOCUS_48700 gene pdhA 69679 68651 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_48700 69848 70966 gene locus_tag LOCUS_48710 gene recF 69848 70966 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_48710 70963 71235 gene locus_tag LOCUS_48720 70963 71235 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_48720 71395 72372 gene locus_tag LOCUS_48730 gene rfbB 71395 72372 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_48730 73645 72296 gene locus_tag LOCUS_48740 73645 72296 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_48740 74802 73633 gene locus_tag LOCUS_48750 74802 73633 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_48750 75691 74810 gene locus_tag LOCUS_48760 75691 74810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 76113 77177 gene locus_tag LOCUS_48770 76113 77177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 77159 78322 gene locus_tag LOCUS_48780 77159 78322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 80786 78360 gene locus_tag LOCUS_48790 80786 78360 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_48790 81153 80923 gene locus_tag LOCUS_48800 81153 80923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 >Feature sequence25 504 833 gene locus_tag LOCUS_48810 504 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 1073 2035 gene locus_tag LOCUS_48820 1073 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 1990 2718 gene locus_tag LOCUS_48830 1990 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 2948 6703 gene locus_tag LOCUS_48840 2948 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 6694 7050 gene locus_tag LOCUS_48850 6694 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 7155 7547 gene locus_tag LOCUS_48860 7155 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 8624 7851 gene locus_tag LOCUS_48870 8624 7851 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_48870 11481 8617 gene locus_tag LOCUS_48880 gene ccsA 11481 8617 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_48880 11889 11554 gene locus_tag LOCUS_48890 11889 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 11988 12674 gene locus_tag LOCUS_48900 11988 12674 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_48900 12757 12996 gene locus_tag LOCUS_48910 12757 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48910 13976 13134 gene locus_tag LOCUS_48920 gene tsaD 13976 13134 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48920 14349 14987 gene locus_tag LOCUS_48930 14349 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_48930 14975 15835 gene locus_tag LOCUS_48940 14975 15835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 15912 16475 gene locus_tag LOCUS_48950 gene rsmD 15912 16475 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_48950 16486 16902 gene locus_tag LOCUS_48960 16486 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 17916 16933 gene locus_tag LOCUS_48970 17916 16933 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_48970 18826 17990 gene locus_tag LOCUS_48980 gene sucD 18826 17990 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_48980 19193 18894 gene locus_tag LOCUS_48990 19193 18894 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_48990 20506 19220 gene locus_tag LOCUS_49000 gene eno 20506 19220 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_49000 21726 20572 gene locus_tag LOCUS_49010 gene carA 21726 20572 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_49010 21989 22228 gene locus_tag LOCUS_49020 21989 22228 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_49020 22391 23641 gene locus_tag LOCUS_49030 gene fabF 22391 23641 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_49030 23642 24103 gene locus_tag LOCUS_49040 23642 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49040 24112 24405 gene locus_tag LOCUS_49050 24112 24405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49050 24897 24538 gene locus_tag LOCUS_49060 24897 24538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 25046 25672 gene locus_tag LOCUS_49070 25046 25672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 26013 25735 gene locus_tag LOCUS_49080 26013 25735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 27617 25899 gene locus_tag LOCUS_49090 27617 25899 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49090 27693 28265 gene locus_tag LOCUS_49100 27693 28265 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_49100 28455 28829 gene locus_tag LOCUS_49110 28455 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 28959 30365 gene locus_tag LOCUS_49120 28959 30365 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_49120 30604 30798 gene locus_tag LOCUS_49130 gene rpsU 30604 30798 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_49130 31437 30913 gene locus_tag LOCUS_49140 31437 30913 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_49140 32454 31546 gene locus_tag LOCUS_49150 32454 31546 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_49150 32638 33840 gene locus_tag LOCUS_49160 gene sucC 32638 33840 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_49160 34004 35251 gene locus_tag LOCUS_49170 gene pepT 34004 35251 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_49170 35374 37710 gene locus_tag LOCUS_49180 35374 37710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 38809 37787 gene locus_tag LOCUS_49190 38809 37787 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_49190 39864 38809 gene locus_tag LOCUS_49200 39864 38809 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_49200 40012 41208 gene locus_tag LOCUS_49210 gene megL 40012 41208 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_49210 41875 41177 gene locus_tag LOCUS_49220 41875 41177 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_49220 42999 41872 gene locus_tag LOCUS_49230 42999 41872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 43527 43003 gene locus_tag LOCUS_49240 gene paiA 43527 43003 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 protein_id gnl|my_center|LOCUS_49240 44301 43567 gene locus_tag LOCUS_49250 gene trpA 44301 43567 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_49250 45596 44379 gene locus_tag LOCUS_49260 gene trpB 45596 44379 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_49260 46275 45619 gene locus_tag LOCUS_49270 46275 45619 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_49270 47090 46422 gene locus_tag LOCUS_49280 gene trpC 47090 46422 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202962.1 protein_id gnl|my_center|LOCUS_49280 48244 47258 gene locus_tag LOCUS_49290 gene trpD 48244 47258 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763093.1 protein_id gnl|my_center|LOCUS_49290 48841 48248 gene locus_tag LOCUS_49300 48841 48248 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_49300 50299 48860 gene locus_tag LOCUS_49310 50299 48860 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_49310 52006 50384 gene locus_tag LOCUS_49320 52006 50384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 52967 51930 gene locus_tag LOCUS_49330 52967 51930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 53324 54001 gene locus_tag LOCUS_49340 53324 54001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 53902 55494 gene locus_tag LOCUS_49350 53902 55494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 55613 58051 gene locus_tag LOCUS_49360 55613 58051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 58105 58872 gene locus_tag LOCUS_49370 58105 58872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 58924 59538 gene locus_tag LOCUS_49380 58924 59538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 60834 59779 gene locus_tag LOCUS_49390 gene holA 60834 59779 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_49390 60887 61429 gene locus_tag LOCUS_49400 60887 61429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49400 61753 64107 gene locus_tag LOCUS_49410 61753 64107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 65294 64569 gene locus_tag LOCUS_49420 gene trmD 65294 64569 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_49420 65436 65705 gene locus_tag LOCUS_49430 65436 65705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 67021 65747 gene locus_tag LOCUS_49440 67021 65747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 67766 67113 gene locus_tag LOCUS_49450 67766 67113 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_49450 70260 67843 gene locus_tag LOCUS_49460 70260 67843 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_49460 70548 70955 gene locus_tag LOCUS_49470 70548 70955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 71521 72147 gene locus_tag LOCUS_49480 71521 72147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49480 72119 73066 gene locus_tag LOCUS_49490 72119 73066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49490 73153 73953 gene locus_tag LOCUS_49500 73153 73953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49500 73966 74322 gene locus_tag LOCUS_49510 73966 74322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 74500 74880 gene locus_tag LOCUS_49520 74500 74880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 74898 75671 gene locus_tag LOCUS_49530 74898 75671 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_49530 <76218 75678 gene locus_tag LOCUS_49540 <76218 75678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964076.1:formimidoylglutamase >Feature sequence26 821 459 gene locus_tag LOCUS_49550 821 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 2959 1496 gene locus_tag LOCUS_49560 2959 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 5693 4110 gene locus_tag LOCUS_49570 5693 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 7019 5964 gene locus_tag LOCUS_49580 7019 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 7489 7130 gene locus_tag LOCUS_49590 7489 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 9850 7727 gene locus_tag LOCUS_49600 9850 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49600 10992 9745 gene locus_tag LOCUS_49610 10992 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49610 11280 12530 gene locus_tag LOCUS_49620 11280 12530 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_49620 12911 12986 gene locus_tag LOCUS_t00330 12911 12986 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13030 13104 gene locus_tag LOCUS_t00340 13030 13104 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16052 13341 gene locus_tag LOCUS_49630 16052 13341 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166522727.1 protein_id gnl|my_center|LOCUS_49630 16359 17171 gene locus_tag LOCUS_49640 16359 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49640 17257 17658 gene locus_tag LOCUS_49650 17257 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49650 17946 19262 gene locus_tag LOCUS_49660 gene xylA 17946 19262 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_49660 19333 19578 gene locus_tag LOCUS_49670 19333 19578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 19702 20622 gene locus_tag LOCUS_49680 19702 20622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 20714 21646 gene locus_tag LOCUS_49690 20714 21646 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_49690 22425 21760 gene locus_tag LOCUS_49700 gene udk 22425 21760 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_49700 22613 22473 gene locus_tag LOCUS_49710 22613 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 23267 22677 gene locus_tag LOCUS_49720 23267 22677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 23852 23310 gene locus_tag LOCUS_49730 23852 23310 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460302.1 protein_id gnl|my_center|LOCUS_49730 25183 23870 gene locus_tag LOCUS_49740 25183 23870 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_49740 25769 26221 gene locus_tag LOCUS_49750 25769 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 26513 26845 gene locus_tag LOCUS_49760 26513 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 27611 27225 gene locus_tag LOCUS_49770 27611 27225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 27792 28919 gene locus_tag LOCUS_49780 27792 28919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 28877 29986 gene locus_tag LOCUS_49790 28877 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 30281 29976 gene locus_tag LOCUS_49800 30281 29976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 31087 30305 gene locus_tag LOCUS_49810 31087 30305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 31850 31095 gene locus_tag LOCUS_49820 31850 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 32061 33062 gene locus_tag LOCUS_49830 32061 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 34609 33098 gene locus_tag LOCUS_49840 34609 33098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 35979 35023 gene locus_tag LOCUS_49850 35979 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49850 36963 36076 gene locus_tag LOCUS_49860 36963 36076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49860 37168 37383 gene locus_tag LOCUS_49870 37168 37383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 37464 37664 gene locus_tag LOCUS_49880 37464 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 39228 37624 gene locus_tag LOCUS_49890 39228 37624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 39434 39883 gene locus_tag LOCUS_49900 39434 39883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 39999 41186 gene locus_tag LOCUS_49910 39999 41186 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_49910 41397 42965 gene locus_tag LOCUS_49920 41397 42965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 42997 44367 gene locus_tag LOCUS_49930 42997 44367 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 protein_id gnl|my_center|LOCUS_49930 44700 46133 gene locus_tag LOCUS_49940 44700 46133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49940 46084 46398 gene locus_tag LOCUS_49950 46084 46398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49950 46411 47316 gene locus_tag LOCUS_49960 46411 47316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49960 47228 48430 gene locus_tag LOCUS_49970 47228 48430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49970 48434 48967 gene locus_tag LOCUS_49980 48434 48967 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963800.1 protein_id gnl|my_center|LOCUS_49980 48998 50119 gene locus_tag LOCUS_49990 48998 50119 CDS product two-component system sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963798.1 protein_id gnl|my_center|LOCUS_49990 50121 50333 gene locus_tag LOCUS_50000 50121 50333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 50293 51864 gene locus_tag LOCUS_50010 50293 51864 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_50010 52117 55260 gene locus_tag LOCUS_50020 52117 55260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 56308 55424 gene locus_tag LOCUS_50030 56308 55424 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_50030 57187 56396 gene locus_tag LOCUS_50040 57187 56396 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899767.1 protein_id gnl|my_center|LOCUS_50040 57787 57194 gene locus_tag LOCUS_50050 57787 57194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50050 58089 57850 gene locus_tag LOCUS_50060 58089 57850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50060 58670 58248 gene locus_tag LOCUS_50070 58670 58248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 58920 58672 gene locus_tag LOCUS_50080 58920 58672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 59033 60250 gene locus_tag LOCUS_50090 59033 60250 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_50090 61727 60318 gene locus_tag LOCUS_50100 61727 60318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 61849 64584 gene locus_tag LOCUS_50110 61849 64584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 64758 65507 gene locus_tag LOCUS_50120 64758 65507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 65522 65716 gene locus_tag LOCUS_50130 65522 65716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 66036 67364 gene locus_tag LOCUS_50140 66036 67364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 >Feature sequence27 34 807 gene locus_tag LOCUS_50150 34 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50150 808 1185 gene locus_tag LOCUS_50160 808 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 1402 2985 gene locus_tag LOCUS_50170 1402 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 3021 3794 gene locus_tag LOCUS_50180 3021 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 3791 4870 gene locus_tag LOCUS_50190 3791 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 4867 5310 gene locus_tag LOCUS_50200 4867 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 5774 5598 gene locus_tag LOCUS_50210 5774 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 8103 5788 gene locus_tag LOCUS_50220 8103 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 9084 8431 gene locus_tag LOCUS_50230 9084 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 11049 9277 gene locus_tag LOCUS_50240 11049 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 12182 11076 gene locus_tag LOCUS_50250 12182 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 13430 12243 gene locus_tag LOCUS_50260 13430 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 14257 13412 gene locus_tag LOCUS_50270 14257 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 14516 14241 gene locus_tag LOCUS_50280 14516 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 14731 14450 gene locus_tag LOCUS_50290 14731 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 14915 14751 gene locus_tag LOCUS_50300 14915 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 15404 14925 gene locus_tag LOCUS_50310 15404 14925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 16351 15482 gene locus_tag LOCUS_50320 16351 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 18486 16894 gene locus_tag LOCUS_50330 18486 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 18670 18500 gene locus_tag LOCUS_50340 18670 18500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 19230 18700 gene locus_tag LOCUS_50350 19230 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 22232 19407 gene locus_tag LOCUS_50360 22232 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50360 23078 22263 gene locus_tag LOCUS_50370 23078 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50370 23433 23756 gene locus_tag LOCUS_50380 23433 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50380 23818 24627 gene locus_tag LOCUS_50390 23818 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50390 25551 24691 gene locus_tag LOCUS_50400 25551 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 27027 25786 gene locus_tag LOCUS_50410 27027 25786 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_50410 28274 27117 gene locus_tag LOCUS_50420 28274 27117 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_50420 28545 28393 gene locus_tag LOCUS_50430 28545 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 30083 28542 gene locus_tag LOCUS_50440 30083 28542 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_50440 35925 30349 gene locus_tag LOCUS_50450 35925 30349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50450 37645 35909 gene locus_tag LOCUS_50460 37645 35909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50460 38679 38086 gene locus_tag LOCUS_50470 gene ruvA 38679 38086 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_50470 39538 38723 gene locus_tag LOCUS_50480 gene lgt 39538 38723 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_50480 41092 39800 gene locus_tag LOCUS_50490 41092 39800 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_50490 43993 41156 gene locus_tag LOCUS_50500 43993 41156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 44391 43972 gene locus_tag LOCUS_50510 44391 43972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 46820 44430 gene locus_tag LOCUS_50520 46820 44430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 46994 47314 gene locus_tag LOCUS_50530 46994 47314 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817201.1 protein_id gnl|my_center|LOCUS_50530 47406 47792 gene locus_tag LOCUS_50540 47406 47792 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_50540 47939 48469 gene locus_tag LOCUS_50550 47939 48469 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_50550 48600 50123 gene locus_tag LOCUS_50560 48600 50123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 50388 50645 gene locus_tag LOCUS_50570 50388 50645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 51345 50662 gene locus_tag LOCUS_50580 51345 50662 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 protein_id gnl|my_center|LOCUS_50580 51557 51363 gene locus_tag LOCUS_50590 51557 51363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 51809 51561 gene locus_tag LOCUS_50600 51809 51561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 52533 52246 gene locus_tag LOCUS_50610 52533 52246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 53051 54376 gene locus_tag LOCUS_50620 53051 54376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 54282 56159 gene locus_tag LOCUS_50630 54282 56159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 56319 65183 gene locus_tag LOCUS_50640 56319 65183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50640 65217 66998 gene locus_tag LOCUS_50650 65217 66998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50650 >Feature sequence28 591 812 gene locus_tag LOCUS_50660 591 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 800 1030 gene locus_tag LOCUS_50670 800 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 1693 1100 gene locus_tag LOCUS_50680 1693 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 3537 1732 gene locus_tag LOCUS_50690 3537 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 4448 3432 gene locus_tag LOCUS_50700 4448 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 4716 4513 gene locus_tag LOCUS_50710 4716 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 5120 4815 gene locus_tag LOCUS_50720 5120 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 5612 5172 gene locus_tag LOCUS_50730 5612 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 6685 5744 gene locus_tag LOCUS_50740 6685 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 8778 6709 gene locus_tag LOCUS_50750 8778 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 9313 8897 gene locus_tag LOCUS_50760 9313 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 10380 9433 gene locus_tag LOCUS_50770 10380 9433 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_50770 11474 10377 gene locus_tag LOCUS_50780 11474 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 11617 12039 gene locus_tag LOCUS_50790 11617 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50790 11973 12140 gene locus_tag LOCUS_50800 11973 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50800 13579 12344 gene locus_tag LOCUS_50810 13579 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 14049 13741 gene locus_tag LOCUS_50820 14049 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 15047 14214 gene locus_tag LOCUS_50830 15047 14214 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584085.1 protein_id gnl|my_center|LOCUS_50830 16088 15087 gene locus_tag LOCUS_50840 gene fbp 16088 15087 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_50840 16232 16474 gene locus_tag LOCUS_50850 16232 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 16471 18027 gene locus_tag LOCUS_50860 16471 18027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_50860 18310 18648 gene locus_tag LOCUS_50870 18310 18648 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_50870 18941 20023 gene locus_tag LOCUS_50880 18941 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 20080 20475 gene locus_tag LOCUS_50890 20080 20475 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_50890 20957 20493 gene locus_tag LOCUS_50900 20957 20493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 21833 21210 gene locus_tag LOCUS_50910 21833 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 23228 21846 gene locus_tag LOCUS_50920 23228 21846 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_50920 23536 23324 gene locus_tag LOCUS_50930 23536 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 24177 23551 gene locus_tag LOCUS_50940 24177 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50940 25219 24944 gene locus_tag LOCUS_50950 25219 24944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 26030 25410 gene locus_tag LOCUS_50960 26030 25410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 27203 26283 gene locus_tag LOCUS_50970 27203 26283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 27511 27140 gene locus_tag LOCUS_50980 27511 27140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 28156 27848 gene locus_tag LOCUS_50990 28156 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 28876 28370 gene locus_tag LOCUS_51000 28876 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 29580 29230 gene locus_tag LOCUS_51010 29580 29230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51010 30167 29679 gene locus_tag LOCUS_51020 30167 29679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51020 30517 30269 gene locus_tag LOCUS_51030 30517 30269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51030 31317 30526 gene locus_tag LOCUS_51040 31317 30526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51040 31762 31304 gene locus_tag LOCUS_51050 31762 31304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 32392 31862 gene locus_tag LOCUS_51060 32392 31862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 32896 32450 gene locus_tag LOCUS_51070 32896 32450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 33185 32889 gene locus_tag LOCUS_51080 33185 32889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 34497 33166 gene locus_tag LOCUS_51090 34497 33166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 35014 34637 gene locus_tag LOCUS_51100 35014 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51100 35583 34960 gene locus_tag LOCUS_51110 35583 34960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51110 36816 35962 gene locus_tag LOCUS_51120 36816 35962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51120 37902 36955 gene locus_tag LOCUS_51130 37902 36955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51130 38414 38058 gene locus_tag LOCUS_51140 38414 38058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 38703 38918 gene locus_tag LOCUS_51150 38703 38918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 41160 39640 gene locus_tag LOCUS_51160 41160 39640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51160 41618 41256 gene locus_tag LOCUS_51170 41618 41256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51170 44388 42139 gene locus_tag LOCUS_51180 44388 42139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 45400 44423 gene locus_tag LOCUS_51190 gene add 45400 44423 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966287.1 protein_id gnl|my_center|LOCUS_51190 45486 45854 gene locus_tag LOCUS_51200 45486 45854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 45839 46693 gene locus_tag LOCUS_51210 45839 46693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51210 46699 47289 gene locus_tag LOCUS_51220 46699 47289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51220 47202 48524 gene locus_tag LOCUS_51230 47202 48524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 48616 48861 gene locus_tag LOCUS_51240 48616 48861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 48852 49055 gene locus_tag LOCUS_51250 48852 49055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 49111 51540 gene locus_tag LOCUS_51260 49111 51540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 52332 51535 gene locus_tag LOCUS_51270 52332 51535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962726.1 protein_id gnl|my_center|LOCUS_51270 52602 53348 gene locus_tag LOCUS_51280 52602 53348 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_51280 54662 53427 gene locus_tag LOCUS_51290 54662 53427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 55675 54656 gene locus_tag LOCUS_51300 55675 54656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 56277 56591 gene locus_tag LOCUS_51310 56277 56591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 56811 57011 gene locus_tag LOCUS_51320 56811 57011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 58305 57322 gene locus_tag LOCUS_51330 58305 57322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51330 58687 58334 gene locus_tag LOCUS_51340 58687 58334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51340 59077 61695 gene locus_tag LOCUS_51350 59077 61695 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51350 61589 61897 gene locus_tag LOCUS_51360 61589 61897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 61869 62270 gene locus_tag LOCUS_51370 61869 62270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 62418 62963 gene locus_tag LOCUS_51380 62418 62963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51380 63089 63781 gene locus_tag LOCUS_51390 63089 63781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51390 66277 63854 gene locus_tag LOCUS_51400 66277 63854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143193.1 protein_id gnl|my_center|LOCUS_51400 66500 67009 gene locus_tag LOCUS_51410 66500 67009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 >Feature sequence29 1839 1033 gene locus_tag LOCUS_51420 1839 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 2726 1920 gene locus_tag LOCUS_51430 2726 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 3717 3214 gene locus_tag LOCUS_51440 3717 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 3907 4821 gene locus_tag LOCUS_51450 3907 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 4807 4878 gene locus_tag LOCUS_t00350 4807 4878 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6246 4945 gene locus_tag LOCUS_51460 6246 4945 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_51460 6539 7471 gene locus_tag LOCUS_51470 6539 7471 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_51470 7532 8116 gene locus_tag LOCUS_51480 7532 8116 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_51480 8189 8962 gene locus_tag LOCUS_51490 8189 8962 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_51490 9225 9833 gene locus_tag LOCUS_51500 9225 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 9947 10519 gene locus_tag LOCUS_51510 9947 10519 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_51510 12419 10527 gene locus_tag LOCUS_51520 12419 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 12609 13877 gene locus_tag LOCUS_51530 12609 13877 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_51530 14102 15079 gene locus_tag LOCUS_51540 14102 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 15095 16873 gene locus_tag LOCUS_51550 15095 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 17079 17612 gene locus_tag LOCUS_51560 17079 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 17678 17923 gene locus_tag LOCUS_51570 17678 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 18460 18065 gene locus_tag LOCUS_51580 18460 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 19052 18426 gene locus_tag LOCUS_51590 19052 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 20424 19027 gene locus_tag LOCUS_51600 20424 19027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 20988 20584 gene locus_tag LOCUS_51610 20988 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 22820 21069 gene locus_tag LOCUS_51620 22820 21069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 23587 22850 gene locus_tag LOCUS_51630 23587 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51630 24197 23580 gene locus_tag LOCUS_51640 24197 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51640 24351 24857 gene locus_tag LOCUS_51650 24351 24857 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_51650 26706 24865 gene locus_tag LOCUS_51660 26706 24865 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_51660 27383 26964 gene locus_tag LOCUS_51670 27383 26964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 28265 27624 gene locus_tag LOCUS_51680 28265 27624 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_51680 29044 28493 gene locus_tag LOCUS_51690 29044 28493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 29542 29114 gene locus_tag LOCUS_51700 29542 29114 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_51700 29683 30066 gene locus_tag LOCUS_51710 29683 30066 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_51710 30299 32410 gene locus_tag LOCUS_51720 30299 32410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 32626 33237 gene locus_tag LOCUS_51730 32626 33237 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_51730 33378 33659 gene locus_tag LOCUS_51740 33378 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 35146 33656 gene locus_tag LOCUS_51750 35146 33656 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_51750 35262 36371 gene locus_tag LOCUS_51760 35262 36371 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_51760 36382 36624 gene locus_tag LOCUS_51770 36382 36624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 36657 37391 gene locus_tag LOCUS_51780 36657 37391 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_51780 37429 38724 gene locus_tag LOCUS_51790 37429 38724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 38697 39221 gene locus_tag LOCUS_51800 38697 39221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 39238 39507 gene locus_tag LOCUS_51810 39238 39507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 39504 40127 gene locus_tag LOCUS_51820 39504 40127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 40456 40235 gene locus_tag LOCUS_51830 40456 40235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 41053 40643 gene locus_tag LOCUS_51840 41053 40643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 41792 41454 gene locus_tag LOCUS_51850 41792 41454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 41673 41945 gene locus_tag LOCUS_51860 41673 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 41997 42752 gene locus_tag LOCUS_51870 41997 42752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 42698 43999 gene locus_tag LOCUS_51880 42698 43999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 44128 44796 gene locus_tag LOCUS_51890 gene cutC 44128 44796 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365979.1 protein_id gnl|my_center|LOCUS_51890 44929 46053 gene locus_tag LOCUS_51900 44929 46053 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_51900 46549 46187 gene locus_tag LOCUS_51910 46549 46187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 47381 46602 gene locus_tag LOCUS_51920 47381 46602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 48157 47417 gene locus_tag LOCUS_51930 48157 47417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 48624 48133 gene locus_tag LOCUS_51940 48624 48133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 49630 49316 gene locus_tag LOCUS_51950 49630 49316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51950 50799 50434 gene locus_tag LOCUS_51960 50799 50434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 51135 50893 gene locus_tag LOCUS_51970 51135 50893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 52899 52348 gene locus_tag LOCUS_51980 52899 52348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 53453 53268 gene locus_tag LOCUS_51990 53453 53268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 53971 53570 gene locus_tag LOCUS_52000 53971 53570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52000 54382 54101 gene locus_tag LOCUS_52010 54382 54101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52010 54720 54490 gene locus_tag LOCUS_52020 54720 54490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52020 55196 54819 gene locus_tag LOCUS_52030 55196 54819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52030 55479 55213 gene locus_tag LOCUS_52040 55479 55213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52040 57218 55566 gene locus_tag LOCUS_52050 57218 55566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52050 57972 57397 gene locus_tag LOCUS_52060 57972 57397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52060 >Feature sequence30 269 448 gene locus_tag LOCUS_52070 269 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 666 839 gene locus_tag LOCUS_52080 666 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 1179 1883 gene locus_tag LOCUS_52090 1179 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 1910 6670 gene locus_tag LOCUS_52100 1910 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52100 6628 7026 gene locus_tag LOCUS_52110 6628 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 7168 9948 gene locus_tag LOCUS_52120 7168 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 9952 10545 gene locus_tag LOCUS_52130 9952 10545 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_52130 10594 11436 gene locus_tag LOCUS_52140 10594 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 15704 11697 gene locus_tag LOCUS_52150 15704 11697 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_52150 16220 18772 gene locus_tag LOCUS_52160 16220 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 18756 18944 gene locus_tag LOCUS_52170 18756 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 18914 19039 gene locus_tag LOCUS_52180 18914 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 19045 19719 gene locus_tag LOCUS_52190 19045 19719 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_52190 21070 19808 gene locus_tag LOCUS_52200 21070 19808 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_52200 22743 21247 gene locus_tag LOCUS_52210 gene gldJ 22743 21247 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_52210 23909 22881 gene locus_tag LOCUS_52220 23909 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 24091 26178 gene locus_tag LOCUS_52230 24091 26178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52230 26141 27946 gene locus_tag LOCUS_52240 26141 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52240 28042 28386 gene locus_tag LOCUS_52250 28042 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 28344 29252 gene locus_tag LOCUS_52260 gene porV 28344 29252 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52260 29903 32422 gene locus_tag LOCUS_52270 29903 32422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52270 32439 32750 gene locus_tag LOCUS_52280 32439 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 32881 34341 gene locus_tag LOCUS_52290 gene crtI 32881 34341 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_52290 34389 34961 gene locus_tag LOCUS_52300 34389 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 35025 35495 gene locus_tag LOCUS_52310 35025 35495 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_52310 36263 35655 gene locus_tag LOCUS_52320 36263 35655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 36477 36256 gene locus_tag LOCUS_52330 36477 36256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 37133 36708 gene locus_tag LOCUS_52340 37133 36708 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038648.1 protein_id gnl|my_center|LOCUS_52340 38215 37595 gene locus_tag LOCUS_52350 38215 37595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 39332 38334 gene locus_tag LOCUS_52360 39332 38334 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_52360 40042 39455 gene locus_tag LOCUS_52370 gene rpsD 40042 39455 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_52370 40468 40079 gene locus_tag LOCUS_52380 gene rpsK 40468 40079 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_52380 40890 40513 gene locus_tag LOCUS_52390 gene rpsM 40890 40513 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_52390 41273 41055 gene locus_tag LOCUS_52400 gene infA 41273 41055 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_52400 42209 41388 gene locus_tag LOCUS_52410 gene map 42209 41388 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_52410 43598 42231 gene locus_tag LOCUS_52420 gene secY 43598 42231 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_52420 44055 43609 gene locus_tag LOCUS_52430 gene rplO 44055 43609 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_52430 44265 44086 gene locus_tag LOCUS_52440 gene rpmD 44265 44086 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_52440 44805 44281 gene locus_tag LOCUS_52450 gene rpsE 44805 44281 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_52450 45182 44829 gene locus_tag LOCUS_52460 gene rplR 45182 44829 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_52460 45817 45263 gene locus_tag LOCUS_52470 gene rplF 45817 45263 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_52470 46255 45845 gene locus_tag LOCUS_52480 gene rpsH 46255 45845 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_52480 46592 46323 gene locus_tag LOCUS_52490 gene rpsN 46592 46323 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403808.1 protein_id gnl|my_center|LOCUS_52490 47171 46611 gene locus_tag LOCUS_52500 gene rplE 47171 46611 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_52500 47525 47196 gene locus_tag LOCUS_52510 47525 47196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 47921 47556 gene locus_tag LOCUS_52520 gene rplN 47921 47556 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_52520 48495 47965 gene locus_tag LOCUS_52530 48495 47965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 48934 48515 gene locus_tag LOCUS_52540 gene rplP 48934 48515 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_52540 49941 49033 gene locus_tag LOCUS_52550 49941 49033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 50366 49968 gene locus_tag LOCUS_52560 gene rplV 50366 49968 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_52560 >Feature sequence31 1515 775 gene locus_tag LOCUS_52570 1515 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 3569 1575 gene locus_tag LOCUS_52580 3569 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 5489 3756 gene locus_tag LOCUS_52590 5489 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 7540 5594 gene locus_tag LOCUS_52600 7540 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 8553 7615 gene locus_tag LOCUS_52610 8553 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 9194 8508 gene locus_tag LOCUS_52620 9194 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 9471 9280 gene locus_tag LOCUS_52630 9471 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 10790 9420 gene locus_tag LOCUS_52640 10790 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 11625 10816 gene locus_tag LOCUS_52650 11625 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 12329 11883 gene locus_tag LOCUS_52660 12329 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 12933 12310 gene locus_tag LOCUS_52670 12933 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 13233 13973 gene locus_tag LOCUS_52680 13233 13973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 13871 14323 gene locus_tag LOCUS_52690 13871 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 14868 14530 gene locus_tag LOCUS_52700 14868 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 15059 14865 gene locus_tag LOCUS_52710 15059 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 16432 15200 gene locus_tag LOCUS_52720 16432 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 17084 16542 gene locus_tag LOCUS_52730 17084 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 17476 17132 gene locus_tag LOCUS_52740 17476 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52740 18644 17556 gene locus_tag LOCUS_52750 18644 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52750 20882 18765 gene locus_tag LOCUS_52760 20882 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52760 22642 20996 gene locus_tag LOCUS_52770 22642 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 23392 22769 gene locus_tag LOCUS_52780 23392 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 24105 23497 gene locus_tag LOCUS_52790 24105 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964330.1 protein_id gnl|my_center|LOCUS_52790 24221 25093 gene locus_tag LOCUS_52800 24221 25093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52800 25051 25899 gene locus_tag LOCUS_52810 25051 25899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52810 27214 25970 gene locus_tag LOCUS_52820 27214 25970 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_52820 28578 27283 gene locus_tag LOCUS_52830 28578 27283 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_52830 28758 29084 gene locus_tag LOCUS_52840 28758 29084 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_52840 29330 30415 gene locus_tag LOCUS_52850 gene arsB 29330 30415 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_52850 30654 30890 gene locus_tag LOCUS_52860 30654 30890 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080561.1 protein_id gnl|my_center|LOCUS_52860 30908 31354 gene locus_tag LOCUS_52870 30908 31354 CDS product nitrophenyl compound nitroreductase subunit ArsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292399.1 protein_id gnl|my_center|LOCUS_52870 31351 32061 gene locus_tag LOCUS_52880 31351 32061 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_52880 32089 32631 gene locus_tag LOCUS_52890 32089 32631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52890 32818 33405 gene locus_tag LOCUS_52900 32818 33405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52900 34054 33981 gene locus_tag LOCUS_t00360 34054 33981 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34158 34844 gene locus_tag LOCUS_52910 gene ung 34158 34844 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206598.1 protein_id gnl|my_center|LOCUS_52910 36244 34880 gene locus_tag LOCUS_52920 36244 34880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 37498 36464 gene locus_tag LOCUS_52930 37498 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 38733 37498 gene locus_tag LOCUS_52940 38733 37498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 40265 39063 gene locus_tag LOCUS_52950 40265 39063 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_52950 41150 40347 gene locus_tag LOCUS_52960 41150 40347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 41591 41664 gene locus_tag LOCUS_t00370 41591 41664 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44155 41798 gene locus_tag LOCUS_52970 44155 41798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 44385 44161 gene locus_tag LOCUS_52980 44385 44161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 45329 44349 gene locus_tag LOCUS_52990 45329 44349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 45781 45341 gene locus_tag LOCUS_53000 45781 45341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 46460 46023 gene locus_tag LOCUS_53010 46460 46023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 46792 46562 gene locus_tag LOCUS_53020 46792 46562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 47499 47795 gene locus_tag LOCUS_53030 47499 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 47814 48053 gene locus_tag LOCUS_53040 47814 48053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 >Feature sequence32 657 1073 gene locus_tag LOCUS_53050 657 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 1556 1074 gene locus_tag LOCUS_53060 1556 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 1657 2100 gene locus_tag LOCUS_53070 1657 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 2155 2394 gene locus_tag LOCUS_53080 2155 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 2689 3570 gene locus_tag LOCUS_53090 2689 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 4451 4723 gene locus_tag LOCUS_53100 4451 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 4720 5733 gene locus_tag LOCUS_53110 4720 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 5721 5951 gene locus_tag LOCUS_53120 5721 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 6450 5989 gene locus_tag LOCUS_53130 6450 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 7787 6345 gene locus_tag LOCUS_53140 7787 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 8015 9295 gene locus_tag LOCUS_53150 8015 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 9744 9556 gene locus_tag LOCUS_53160 9744 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 11113 9731 gene locus_tag LOCUS_53170 gene nhaD 11113 9731 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_53170 11278 12273 gene locus_tag LOCUS_53180 gene dusB 11278 12273 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_53180 12300 13715 gene locus_tag LOCUS_53190 12300 13715 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_53190 14454 15908 gene locus_tag LOCUS_53200 gene dnaA 14454 15908 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_53200 16116 16205 gene locus_tag LOCUS_t00380 16116 16205 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16498 16574 gene locus_tag LOCUS_t00390 16498 16574 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16811 18577 gene locus_tag LOCUS_53210 16811 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 18702 21632 gene locus_tag LOCUS_53220 18702 21632 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_53220 21645 23111 gene locus_tag LOCUS_53230 21645 23111 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_53230 23239 24657 gene locus_tag LOCUS_53240 23239 24657 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_53240 25004 24630 gene locus_tag LOCUS_53250 25004 24630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53250 25532 25161 gene locus_tag LOCUS_53260 25532 25161 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966538.1 protein_id gnl|my_center|LOCUS_53260 25771 25535 gene locus_tag LOCUS_53270 25771 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 26202 25903 gene locus_tag LOCUS_53280 26202 25903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 26237 27400 gene locus_tag LOCUS_53290 gene hypD 26237 27400 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_53290 27486 28532 gene locus_tag LOCUS_53300 gene ilvC 27486 28532 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_53300 33114 28618 gene locus_tag LOCUS_53310 33114 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 33636 33274 gene locus_tag LOCUS_53320 33636 33274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 33701 33850 gene locus_tag LOCUS_53330 33701 33850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 33957 34436 gene locus_tag LOCUS_53340 33957 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 34579 36015 gene locus_tag LOCUS_53350 34579 36015 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_53350 36051 37649 gene locus_tag LOCUS_53360 36051 37649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 37582 38154 gene locus_tag LOCUS_53370 37582 38154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53370 38247 39410 gene locus_tag LOCUS_53380 38247 39410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 39434 39916 gene locus_tag LOCUS_53390 39434 39916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 39977 41005 gene locus_tag LOCUS_53400 39977 41005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 41024 41551 gene locus_tag LOCUS_53410 41024 41551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 41639 44560 gene locus_tag LOCUS_53420 41639 44560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 44518 44724 gene locus_tag LOCUS_53430 44518 44724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 44727 45467 gene locus_tag LOCUS_53440 44727 45467 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_53440 >Feature sequence33 318 1454 gene locus_tag LOCUS_53450 318 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 1698 1922 gene locus_tag LOCUS_53460 1698 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 1919 2305 gene locus_tag LOCUS_53470 1919 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 2305 2949 gene locus_tag LOCUS_53480 2305 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53480 2954 4390 gene locus_tag LOCUS_53490 2954 4390 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_53490 4401 5087 gene locus_tag LOCUS_53500 4401 5087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_53500 5286 6797 gene locus_tag LOCUS_53510 5286 6797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_53510 7083 7268 gene locus_tag LOCUS_53520 7083 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 7268 7879 gene locus_tag LOCUS_53530 7268 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 7883 9268 gene locus_tag LOCUS_53540 7883 9268 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_53540 9265 10548 gene locus_tag LOCUS_53550 9265 10548 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_53550 10757 11572 gene locus_tag LOCUS_53560 10757 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 13239 11689 gene locus_tag LOCUS_53570 13239 11689 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_53570 14721 13267 gene locus_tag LOCUS_53580 gene gatB 14721 13267 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_53580 15867 14779 gene locus_tag LOCUS_53590 15867 14779 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015861.1 protein_id gnl|my_center|LOCUS_53590 17094 15949 gene locus_tag LOCUS_53600 17094 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 17962 17111 gene locus_tag LOCUS_53610 17962 17111 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_53610 18509 18886 gene locus_tag LOCUS_53620 18509 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53620 19013 20914 gene locus_tag LOCUS_53630 19013 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53630 20911 21144 gene locus_tag LOCUS_53640 20911 21144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53640 21396 21109 gene locus_tag LOCUS_53650 21396 21109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 22352 21405 gene locus_tag LOCUS_53660 22352 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 22443 22892 gene locus_tag LOCUS_53670 22443 22892 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_53670 23621 22893 gene locus_tag LOCUS_53680 23621 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53680 24085 23585 gene locus_tag LOCUS_53690 24085 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53690 24281 24727 gene locus_tag LOCUS_53700 24281 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53700 24800 25027 gene locus_tag LOCUS_53710 24800 25027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53710 25538 25140 gene locus_tag LOCUS_53720 25538 25140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 25771 25538 gene locus_tag LOCUS_53730 25771 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 26447 25905 gene locus_tag LOCUS_53740 26447 25905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 26839 28749 gene locus_tag LOCUS_53750 26839 28749 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_53750 28746 30821 gene locus_tag LOCUS_53760 28746 30821 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764740.1 protein_id gnl|my_center|LOCUS_53760 30888 31199 gene locus_tag LOCUS_53770 30888 31199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 31227 31523 gene locus_tag LOCUS_53780 31227 31523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 40252 31580 gene locus_tag LOCUS_53790 40252 31580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 41666 40794 gene locus_tag LOCUS_53800 41666 40794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 >Feature sequence34 1465 1968 gene locus_tag LOCUS_53810 1465 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 2062 2289 gene locus_tag LOCUS_53820 2062 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 2463 2942 gene locus_tag LOCUS_53830 2463 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53830 2998 3573 gene locus_tag LOCUS_53840 2998 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 3542 4156 gene locus_tag LOCUS_53850 3542 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 4285 5562 gene locus_tag LOCUS_53860 4285 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 5538 5786 gene locus_tag LOCUS_53870 5538 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 6334 7980 gene locus_tag LOCUS_53880 6334 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 8023 10353 gene locus_tag LOCUS_53890 8023 10353 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_53890 10901 10350 gene locus_tag LOCUS_53900 10901 10350 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_53900 11316 10915 gene locus_tag LOCUS_53910 11316 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 12375 11467 gene locus_tag LOCUS_53920 12375 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 12582 13916 gene locus_tag LOCUS_53930 12582 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 13916 14530 gene locus_tag LOCUS_53940 13916 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 14527 15153 gene locus_tag LOCUS_53950 14527 15153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_53950 15571 15173 gene locus_tag LOCUS_53960 15571 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 15951 15622 gene locus_tag LOCUS_53970 15951 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 16342 17634 gene locus_tag LOCUS_53980 16342 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 17955 19661 gene locus_tag LOCUS_53990 17955 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53990 20609 20034 gene locus_tag LOCUS_54000 20609 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 21874 20798 gene locus_tag LOCUS_54010 21874 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54010 22077 21865 gene locus_tag LOCUS_54020 22077 21865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 23345 22437 gene locus_tag LOCUS_54030 23345 22437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 26086 23363 gene locus_tag LOCUS_54040 26086 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 26960 26133 gene locus_tag LOCUS_54050 26960 26133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 28252 26957 gene locus_tag LOCUS_54060 28252 26957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 29006 28341 gene locus_tag LOCUS_54070 29006 28341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 29650 28991 gene locus_tag LOCUS_54080 29650 28991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 30365 29625 gene locus_tag LOCUS_54090 30365 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 30945 30559 gene locus_tag LOCUS_54100 30945 30559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 31193 30951 gene locus_tag LOCUS_54110 31193 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 31940 31746 gene locus_tag LOCUS_54120 31940 31746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54120 32327 32055 gene locus_tag LOCUS_54130 32327 32055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54130 32727 32506 gene locus_tag LOCUS_54140 32727 32506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54140 33555 33274 gene locus_tag LOCUS_54150 33555 33274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 >Feature sequence35 1457 75 gene locus_tag LOCUS_54160 1457 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54160 6562 1472 gene locus_tag LOCUS_54170 6562 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54170 8492 6543 gene locus_tag LOCUS_54180 8492 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 9093 8725 gene locus_tag LOCUS_54190 9093 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 10389 9352 gene locus_tag LOCUS_54200 gene iaaA 10389 9352 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 protein_id gnl|my_center|LOCUS_54200 13012 10493 gene locus_tag LOCUS_54210 13012 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54210 13451 12921 gene locus_tag LOCUS_54220 13451 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54220 15925 13490 gene locus_tag LOCUS_54230 15925 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 17040 16159 gene locus_tag LOCUS_54240 gene hemF 17040 16159 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_54240 17142 18029 gene locus_tag LOCUS_54250 17142 18029 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947145.1 protein_id gnl|my_center|LOCUS_54250 18889 18221 gene locus_tag LOCUS_54260 gene fsa 18889 18221 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789246.1 protein_id gnl|my_center|LOCUS_54260 20163 19024 gene locus_tag LOCUS_54270 20163 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54270 20936 20160 gene locus_tag LOCUS_54280 20936 20160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54280 22047 20998 gene locus_tag LOCUS_54290 22047 20998 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_54290 22730 22047 gene locus_tag LOCUS_54300 22730 22047 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_54300 24646 22874 gene locus_tag LOCUS_54310 gene sppA 24646 22874 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_54310 24946 25224 gene locus_tag LOCUS_54320 24946 25224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 25415 26401 gene locus_tag LOCUS_54330 25415 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 26403 27740 gene locus_tag LOCUS_54340 gene tilS 26403 27740 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_54340 28224 27889 gene locus_tag LOCUS_54350 28224 27889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 28319 28975 gene locus_tag LOCUS_54360 28319 28975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 29546 29094 gene locus_tag LOCUS_54370 29546 29094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 >Feature sequence36 101 382 gene locus_tag LOCUS_54380 101 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 298 1587 gene locus_tag LOCUS_54390 298 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 1683 1952 gene locus_tag LOCUS_54400 1683 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 1949 3592 gene locus_tag LOCUS_54410 1949 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 3538 7146 gene locus_tag LOCUS_54420 3538 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 7205 8536 gene locus_tag LOCUS_54430 7205 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 8484 9431 gene locus_tag LOCUS_54440 8484 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 9525 15260 gene locus_tag LOCUS_54450 9525 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54450 15266 15601 gene locus_tag LOCUS_54460 15266 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 15751 16785 gene locus_tag LOCUS_54470 15751 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 16788 17489 gene locus_tag LOCUS_54480 16788 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 18473 17532 gene locus_tag LOCUS_54490 18473 17532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 19041 18493 gene locus_tag LOCUS_54500 19041 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 19848 19396 gene locus_tag LOCUS_54510 19848 19396 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54510 22707 20236 gene locus_tag LOCUS_54520 22707 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 22962 24380 gene locus_tag LOCUS_54530 22962 24380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 25244 24453 gene locus_tag LOCUS_54540 25244 24453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54540 26374 25202 gene locus_tag LOCUS_54550 26374 25202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54550 27076 26537 gene locus_tag LOCUS_54560 27076 26537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 >Feature sequence37 292 38 gene locus_tag LOCUS_54570 292 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 2743 1292 gene locus_tag LOCUS_54580 2743 1292 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_54580 3296 2895 gene locus_tag LOCUS_54590 3296 2895 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_54590 4186 4449 gene locus_tag LOCUS_54600 4186 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 4668 5081 gene locus_tag LOCUS_54610 4668 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 5078 5680 gene locus_tag LOCUS_54620 5078 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 6029 5700 gene locus_tag LOCUS_54630 6029 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 6527 6351 gene locus_tag LOCUS_54640 6527 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 7612 8079 gene locus_tag LOCUS_54650 7612 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 8246 8443 gene locus_tag LOCUS_54660 8246 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 8440 8838 gene locus_tag LOCUS_54670 8440 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54670 8949 9467 gene locus_tag LOCUS_54680 8949 9467 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243497.1 protein_id gnl|my_center|LOCUS_54680 9540 11075 gene locus_tag LOCUS_54690 9540 11075 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_54690 11114 11467 gene locus_tag LOCUS_54700 11114 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_54700 11496 11972 gene locus_tag LOCUS_54710 11496 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54710 12270 13157 gene locus_tag LOCUS_54720 12270 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 13167 13922 gene locus_tag LOCUS_54730 13167 13922 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_54730 13919 14779 gene locus_tag LOCUS_54740 13919 14779 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_54740 14937 15644 gene locus_tag LOCUS_54750 gene pssA 14937 15644 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_54750 15641 15892 gene locus_tag LOCUS_54760 gene purS 15641 15892 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_54760 15905 16591 gene locus_tag LOCUS_54770 gene rsmI 15905 16591 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_54770 18586 17885 gene locus_tag LOCUS_54780 18586 17885 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_54780 18996 19928 gene locus_tag LOCUS_54790 18996 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 19954 21126 gene locus_tag LOCUS_54800 19954 21126 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_54800 21113 22048 gene locus_tag LOCUS_54810 21113 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 22932 22126 gene locus_tag LOCUS_54820 22932 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 23714 22929 gene locus_tag LOCUS_54830 23714 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 23992 24837 gene locus_tag LOCUS_54840 23992 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 24885 25922 gene locus_tag LOCUS_54850 gene pheS 24885 25922 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_54850 26071 25919 gene locus_tag LOCUS_54860 26071 25919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 26696 26397 gene locus_tag LOCUS_54870 26696 26397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54870 >Feature sequence38 550 248 gene locus_tag LOCUS_54880 550 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 870 547 gene locus_tag LOCUS_54890 870 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 1027 863 gene locus_tag LOCUS_54900 1027 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 1332 1024 gene locus_tag LOCUS_54910 1332 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 2805 1453 gene locus_tag LOCUS_54920 2805 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 3185 2712 gene locus_tag LOCUS_54930 3185 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 4051 3182 gene locus_tag LOCUS_54940 4051 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 4798 4526 gene locus_tag LOCUS_54950 4798 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 5081 4809 gene locus_tag LOCUS_54960 5081 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 5328 5089 gene locus_tag LOCUS_54970 5328 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 5735 5325 gene locus_tag LOCUS_54980 5735 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 5971 5741 gene locus_tag LOCUS_54990 5971 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 6964 6089 gene locus_tag LOCUS_55000 6964 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 7530 6961 gene locus_tag LOCUS_55010 7530 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 8101 7742 gene locus_tag LOCUS_55020 8101 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 8572 8162 gene locus_tag LOCUS_55030 8572 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 8753 9151 gene locus_tag LOCUS_55040 8753 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 9156 10472 gene locus_tag LOCUS_55050 9156 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 10496 10795 gene locus_tag LOCUS_55060 10496 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 11038 11301 gene locus_tag LOCUS_55070 11038 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 11706 11296 gene locus_tag LOCUS_55080 11706 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 11996 11736 gene locus_tag LOCUS_55090 11996 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 13557 12019 gene locus_tag LOCUS_55100 13557 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 14043 13750 gene locus_tag LOCUS_55110 14043 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 14826 14056 gene locus_tag LOCUS_55120 14826 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 15548 14835 gene locus_tag LOCUS_55130 15548 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 15919 15545 gene locus_tag LOCUS_55140 15919 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 17025 15937 gene locus_tag LOCUS_55150 17025 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 18420 17998 gene locus_tag LOCUS_55160 18420 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 18860 18417 gene locus_tag LOCUS_55170 18860 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 19494 18835 gene locus_tag LOCUS_55180 19494 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 20939 19461 gene locus_tag LOCUS_55190 20939 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 23113 20939 gene locus_tag LOCUS_55200 23113 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 23394 23113 gene locus_tag LOCUS_55210 23394 23113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 23794 23399 gene locus_tag LOCUS_55220 23794 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 24754 24359 gene locus_tag LOCUS_55230 24754 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 >Feature sequence39 159 458 gene locus_tag LOCUS_55240 159 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 807 1586 gene locus_tag LOCUS_55250 807 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55250 1768 2487 gene locus_tag LOCUS_55260 1768 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 2414 3565 gene locus_tag LOCUS_55270 2414 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 3552 4034 gene locus_tag LOCUS_55280 3552 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 3932 4438 gene locus_tag LOCUS_55290 3932 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55290 4447 4773 gene locus_tag LOCUS_55300 4447 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55300 4890 5705 gene locus_tag LOCUS_55310 4890 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 5833 6042 gene locus_tag LOCUS_55320 5833 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 6176 6931 gene locus_tag LOCUS_55330 6176 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 7175 7804 gene locus_tag LOCUS_55340 7175 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55340 7816 8010 gene locus_tag LOCUS_55350 7816 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 8007 8327 gene locus_tag LOCUS_55360 8007 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 8318 8683 gene locus_tag LOCUS_55370 8318 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 9638 8793 gene locus_tag LOCUS_55380 9638 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 9656 10663 gene locus_tag LOCUS_55390 9656 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 11451 10771 gene locus_tag LOCUS_55400 11451 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 11702 11484 gene locus_tag LOCUS_55410 11702 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 11848 12873 gene locus_tag LOCUS_55420 11848 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 12848 14638 gene locus_tag LOCUS_55430 gene asnB 12848 14638 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_55430 14666 15160 gene locus_tag LOCUS_55440 14666 15160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 15252 15800 gene locus_tag LOCUS_55450 15252 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 16409 15840 gene locus_tag LOCUS_55460 16409 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55460 16723 16406 gene locus_tag LOCUS_55470 16723 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55470 17133 16729 gene locus_tag LOCUS_55480 17133 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55480 17326 19017 gene locus_tag LOCUS_55490 17326 19017 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_55490 20083 19136 gene locus_tag LOCUS_55500 20083 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55500 20535 20029 gene locus_tag LOCUS_55510 20535 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55510 21994 20429 gene locus_tag LOCUS_55520 21994 20429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55520 >Feature sequence40 3 227 gene locus_tag LOCUS_55530 3 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 1222 959 gene locus_tag LOCUS_55540 1222 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 1860 1333 gene locus_tag LOCUS_55550 1860 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 2081 2407 gene locus_tag LOCUS_55560 2081 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 2407 3024 gene locus_tag LOCUS_55570 2407 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55570 2954 4291 gene locus_tag LOCUS_55580 2954 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55580 4365 4937 gene locus_tag LOCUS_55590 4365 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 4934 5917 gene locus_tag LOCUS_55600 4934 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_55600 5955 7259 gene locus_tag LOCUS_55610 5955 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 7285 7833 gene locus_tag LOCUS_55620 7285 7833 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 protein_id gnl|my_center|LOCUS_55620 8422 7817 gene locus_tag LOCUS_55630 8422 7817 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_55630 8922 8422 gene locus_tag LOCUS_55640 8922 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 9194 8907 gene locus_tag LOCUS_55650 9194 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 9961 9260 gene locus_tag LOCUS_55660 9961 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 10352 9990 gene locus_tag LOCUS_55670 10352 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 10994 10434 gene locus_tag LOCUS_55680 10994 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55680 11523 11323 gene locus_tag LOCUS_55690 11523 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55690 11647 11489 gene locus_tag LOCUS_55700 11647 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55700 12563 11784 gene locus_tag LOCUS_55710 12563 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55710 13439 13822 gene locus_tag LOCUS_55720 13439 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 16040 16828 gene locus_tag LOCUS_55730 16040 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 17591 18706 gene locus_tag LOCUS_55740 17591 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 18722 18979 gene locus_tag LOCUS_55750 18722 18979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 19395 19042 gene locus_tag LOCUS_55760 19395 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 19692 19411 gene locus_tag LOCUS_55770 19692 19411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55770 20165 19878 gene locus_tag LOCUS_55780 20165 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55780 20696 20172 gene locus_tag LOCUS_55790 20696 20172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55790 21288 21139 gene locus_tag LOCUS_55800 21288 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 >Feature sequence41 614 372 gene locus_tag LOCUS_55810 614 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 1682 1891 gene locus_tag LOCUS_55820 1682 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 2063 2248 gene locus_tag LOCUS_55830 2063 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 2235 2426 gene locus_tag LOCUS_55840 2235 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 2446 2685 gene locus_tag LOCUS_55850 2446 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 2825 3043 gene locus_tag LOCUS_55860 2825 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 3249 3632 gene locus_tag LOCUS_55870 3249 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 3640 3837 gene locus_tag LOCUS_55880 3640 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 3821 4714 gene locus_tag LOCUS_55890 3821 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 4711 5346 gene locus_tag LOCUS_55900 4711 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 5515 5832 gene locus_tag LOCUS_55910 5515 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 5798 6079 gene locus_tag LOCUS_55920 5798 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 6072 6728 gene locus_tag LOCUS_55930 6072 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 6730 6864 gene locus_tag LOCUS_55940 6730 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 6854 7435 gene locus_tag LOCUS_55950 6854 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 7464 7763 gene locus_tag LOCUS_55960 7464 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 7828 8073 gene locus_tag LOCUS_55970 7828 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 8086 8592 gene locus_tag LOCUS_55980 8086 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 8678 8857 gene locus_tag LOCUS_55990 8678 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 8876 9094 gene locus_tag LOCUS_56000 8876 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 9110 9430 gene locus_tag LOCUS_56010 9110 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 9411 9557 gene locus_tag LOCUS_56020 9411 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 9575 9904 gene locus_tag LOCUS_56030 9575 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 10062 10235 gene locus_tag LOCUS_56040 10062 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 10240 12066 gene locus_tag LOCUS_56050 10240 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 12104 12598 gene locus_tag LOCUS_56060 12104 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 12613 12837 gene locus_tag LOCUS_56070 12613 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 12797 14443 gene locus_tag LOCUS_56080 12797 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 14508 14936 gene locus_tag LOCUS_56090 14508 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 15022 15333 gene locus_tag LOCUS_56100 15022 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 15376 15741 gene locus_tag LOCUS_56110 15376 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 15801 16346 gene locus_tag LOCUS_56120 15801 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 16352 16768 gene locus_tag LOCUS_56130 16352 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 17021 17281 gene locus_tag LOCUS_56140 17021 17281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 17294 17947 gene locus_tag LOCUS_56150 17294 17947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 18027 18323 gene locus_tag LOCUS_56160 18027 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 18418 18567 gene locus_tag LOCUS_56170 18418 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 18606 19154 gene locus_tag LOCUS_56180 18606 19154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 19303 19902 gene locus_tag LOCUS_56190 19303 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 19913 20200 gene locus_tag LOCUS_56200 19913 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 20323 20652 gene locus_tag LOCUS_56210 20323 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 >Feature sequence42 1735 1064 gene locus_tag LOCUS_56220 1735 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56220 2225 1827 gene locus_tag LOCUS_56230 2225 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56230 2544 2149 gene locus_tag LOCUS_56240 2544 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56240 2878 2492 gene locus_tag LOCUS_56250 2878 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 3107 3358 gene locus_tag LOCUS_56260 3107 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 3336 4145 gene locus_tag LOCUS_56270 3336 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 4423 4142 gene locus_tag LOCUS_56280 4423 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 5099 4329 gene locus_tag LOCUS_56290 5099 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 6596 5376 gene locus_tag LOCUS_56300 6596 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 7511 6714 gene locus_tag LOCUS_56310 7511 6714 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085124.1 protein_id gnl|my_center|LOCUS_56310 8892 7612 gene locus_tag LOCUS_56320 8892 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56320 9697 8927 gene locus_tag LOCUS_56330 9697 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56330 10058 9756 gene locus_tag LOCUS_56340 10058 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 11638 10313 gene locus_tag LOCUS_56350 11638 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 13231 11720 gene locus_tag LOCUS_56360 13231 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 13521 14171 gene locus_tag LOCUS_56370 13521 14171 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_56370 >Feature sequence43 295 1041 gene locus_tag LOCUS_56380 295 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 927 1148 gene locus_tag LOCUS_56390 927 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 1255 1710 gene locus_tag LOCUS_56400 1255 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 3593 1944 gene locus_tag LOCUS_56410 3593 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56410 5074 3497 gene locus_tag LOCUS_56420 5074 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56420 5971 5252 gene locus_tag LOCUS_56430 5971 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 6681 6163 gene locus_tag LOCUS_56440 6681 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 7148 8245 gene locus_tag LOCUS_56450 7148 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 8865 8248 gene locus_tag LOCUS_56460 8865 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 8944 10098 gene locus_tag LOCUS_56470 8944 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 10110 11108 gene locus_tag LOCUS_56480 10110 11108 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_56480 11120 11680 gene locus_tag LOCUS_56490 11120 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 11683 13119 gene locus_tag LOCUS_56500 11683 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 14381 13116 gene locus_tag LOCUS_56510 14381 13116 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_56510 14391 15353 gene locus_tag LOCUS_56520 gene metF 14391 15353 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_56520 15515 16555 gene locus_tag LOCUS_56530 gene meaB 15515 16555 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_56530 >Feature sequence44 75 737 gene locus_tag LOCUS_56540 75 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 740 1402 gene locus_tag LOCUS_56550 740 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 1381 1620 gene locus_tag LOCUS_56560 1381 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 1678 2979 gene locus_tag LOCUS_56570 1678 2979 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 protein_id gnl|my_center|LOCUS_56570 2954 3610 gene locus_tag LOCUS_56580 2954 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 3637 4911 gene locus_tag LOCUS_56590 3637 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 4929 5129 gene locus_tag LOCUS_56600 4929 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 5113 5691 gene locus_tag LOCUS_56610 5113 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 5693 6085 gene locus_tag LOCUS_56620 5693 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 6064 6684 gene locus_tag LOCUS_56630 6064 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 6722 7117 gene locus_tag LOCUS_56640 6722 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 7142 7588 gene locus_tag LOCUS_56650 7142 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 7736 7909 gene locus_tag LOCUS_56660 7736 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 8089 8370 gene locus_tag LOCUS_56670 8089 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 8370 10319 gene locus_tag LOCUS_56680 8370 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 10319 11332 gene locus_tag LOCUS_56690 10319 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 11457 11933 gene locus_tag LOCUS_56700 11457 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 11998 12348 gene locus_tag LOCUS_56710 11998 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 12321 12614 gene locus_tag LOCUS_56720 12321 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 >Feature sequence45 904 1440 gene locus_tag LOCUS_56730 904 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 1904 2890 gene locus_tag LOCUS_56740 1904 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 2936 3151 gene locus_tag LOCUS_56750 2936 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 3342 4757 gene locus_tag LOCUS_56760 3342 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 4824 5564 gene locus_tag LOCUS_56770 4824 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 5561 6040 gene locus_tag LOCUS_56780 5561 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 6077 6400 gene locus_tag LOCUS_56790 6077 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 6602 6832 gene locus_tag LOCUS_56800 6602 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 6850 7305 gene locus_tag LOCUS_56810 6850 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 7669 7493 gene locus_tag LOCUS_56820 7669 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 8326 8556 gene locus_tag LOCUS_56830 8326 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 9567 9172 gene locus_tag LOCUS_56840 9567 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 9804 10043 gene locus_tag LOCUS_56850 9804 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 10046 10315 gene locus_tag LOCUS_56860 10046 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 10318 10614 gene locus_tag LOCUS_56870 10318 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 10616 10960 gene locus_tag LOCUS_56880 10616 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 10948 11178 gene locus_tag LOCUS_56890 10948 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 11175 11564 gene locus_tag LOCUS_56900 11175 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 >Feature sequence46 1048 293 gene locus_tag LOCUS_56910 1048 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 1547 1209 gene locus_tag LOCUS_56920 1547 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 3233 2472 gene locus_tag LOCUS_56930 3233 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 4330 4070 gene locus_tag LOCUS_56940 4330 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 5063 4791 gene locus_tag LOCUS_56950 5063 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 5472 5134 gene locus_tag LOCUS_56960 5472 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 6401 5361 gene locus_tag LOCUS_56970 6401 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 7070 6636 gene locus_tag LOCUS_56980 7070 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 7910 7125 gene locus_tag LOCUS_56990 7910 7125 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_56990 8267 7926 gene locus_tag LOCUS_57000 8267 7926 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_57000 8494 8264 gene locus_tag LOCUS_57010 8494 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 8630 8424 gene locus_tag LOCUS_57020 8630 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 10428 9253 gene locus_tag LOCUS_57030 10428 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 >Feature sequence47 162 497 gene locus_tag LOCUS_57040 162 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57040 515 1006 gene locus_tag LOCUS_57050 515 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 1253 1696 gene locus_tag LOCUS_57060 1253 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57060 1721 2329 gene locus_tag LOCUS_57070 1721 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57070 2298 2765 gene locus_tag LOCUS_57080 2298 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 2922 3563 gene locus_tag LOCUS_57090 2922 3563 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337721.1 protein_id gnl|my_center|LOCUS_57090 3573 4478 gene locus_tag LOCUS_57100 3573 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 5236 5535 gene locus_tag LOCUS_57110 5236 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 5723 5995 gene locus_tag LOCUS_57120 5723 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 6133 6330 gene locus_tag LOCUS_57130 6133 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 6666 6857 gene locus_tag LOCUS_57140 6666 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 6817 7113 gene locus_tag LOCUS_57150 6817 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 7252 7452 gene locus_tag LOCUS_57160 7252 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 7490 8461 gene locus_tag LOCUS_57170 7490 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 8483 8848 gene locus_tag LOCUS_57180 8483 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 8910 9191 gene locus_tag LOCUS_57190 8910 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 9191 9535 gene locus_tag LOCUS_57200 9191 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 >Feature sequence48 411 139 gene locus_tag LOCUS_57210 411 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 773 1237 gene locus_tag LOCUS_57220 773 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 1185 1697 gene locus_tag LOCUS_57230 1185 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 1699 1896 gene locus_tag LOCUS_57240 1699 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 2641 1964 gene locus_tag LOCUS_57250 2641 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 3167 3841 gene locus_tag LOCUS_57260 3167 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 3792 4250 gene locus_tag LOCUS_57270 3792 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 4247 4504 gene locus_tag LOCUS_57280 4247 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 5358 4501 gene locus_tag LOCUS_57290 5358 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 6383 5424 gene locus_tag LOCUS_57300 6383 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57300 >Feature sequence49 465 890 gene locus_tag LOCUS_57310 465 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 1678 2079 gene locus_tag LOCUS_57320 1678 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 2187 2678 gene locus_tag LOCUS_57330 2187 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 2853 4358 gene locus_tag LOCUS_57340 2853 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 4606 4848 gene locus_tag LOCUS_57350 4606 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 4933 5139 gene locus_tag LOCUS_57360 4933 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 >Feature sequence50 307 1908 gene locus_tag LOCUS_57370 307 1908 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_57370 2024 2290 gene locus_tag LOCUS_57380 2024 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57380 2274 3518 gene locus_tag LOCUS_57390 gene glpK 2274 3518 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57390 3672 4364 gene locus_tag LOCUS_57400 3672 4364 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_57400 >Feature sequence51 801 995 gene locus_tag LOCUS_57410 801 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 1590 2126 gene locus_tag LOCUS_57420 1590 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 2192 2731 gene locus_tag LOCUS_57430 2192 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 3915 3676 gene locus_tag LOCUS_57440 3915 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440