>Feature sequence01 <1 605 gene locus_tag LOCUS_00010 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245964.1:metal-dependent hydrolase 1204 1506 gene locus_tag LOCUS_00020 1204 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00020 1984 2181 gene locus_tag LOCUS_00030 1984 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00030 2208 2525 gene locus_tag LOCUS_00040 2208 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 2599 2910 gene locus_tag LOCUS_00050 2599 2910 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869815.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 4240 3905 gene locus_tag LOCUS_00060 gene trxA 4240 3905 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_00060 7884 4300 gene locus_tag LOCUS_00070 7884 4300 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_00070 8338 9600 gene locus_tag LOCUS_00080 8338 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9527 9889 gene locus_tag LOCUS_00090 9527 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10197 11762 gene locus_tag LOCUS_00100 10197 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12164 11901 gene locus_tag LOCUS_00110 12164 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12508 12245 gene locus_tag LOCUS_00120 12508 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12624 12551 gene locus_tag LOCUS_t00010 12624 12551 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12782 13900 gene locus_tag LOCUS_00130 12782 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14151 14657 gene locus_tag LOCUS_00140 14151 14657 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949392.1 protein_id gnl|my_center|LOCUS_00140 14790 16808 gene locus_tag LOCUS_00150 14790 16808 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_00150 16950 17417 gene locus_tag LOCUS_00160 16950 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18162 17524 gene locus_tag LOCUS_00170 18162 17524 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_00170 19839 18352 gene locus_tag LOCUS_00180 gene nrfA 19839 18352 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_00180 20419 19844 gene locus_tag LOCUS_00190 gene nrfH 20419 19844 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107765.1 protein_id gnl|my_center|LOCUS_00190 20666 21211 gene locus_tag LOCUS_00200 20666 21211 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038812.1 protein_id gnl|my_center|LOCUS_00200 21266 22162 gene locus_tag LOCUS_00210 21266 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22212 24329 gene locus_tag LOCUS_00220 22212 24329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24602 24964 gene locus_tag LOCUS_00230 24602 24964 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 protein_id gnl|my_center|LOCUS_00230 25093 27150 gene locus_tag LOCUS_00240 25093 27150 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_00240 27271 28023 gene locus_tag LOCUS_00250 27271 28023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29486 28122 gene locus_tag LOCUS_00260 29486 28122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30563 29526 gene locus_tag LOCUS_00270 gene waaF 30563 29526 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_00270 31301 30576 gene locus_tag LOCUS_00280 31301 30576 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_00280 32430 31633 gene locus_tag LOCUS_00290 32430 31633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00290 33236 32973 gene locus_tag LOCUS_00300 33236 32973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34318 33296 gene locus_tag LOCUS_00310 34318 33296 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963600.1 protein_id gnl|my_center|LOCUS_00310 35129 36376 gene locus_tag LOCUS_00320 35129 36376 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933230.1 protein_id gnl|my_center|LOCUS_00320 36784 37044 gene locus_tag LOCUS_00330 gene rpsT 36784 37044 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887951.1 protein_id gnl|my_center|LOCUS_00330 37578 37111 gene locus_tag LOCUS_00340 37578 37111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37964 37587 gene locus_tag LOCUS_00350 37964 37587 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_00350 38878 37982 gene locus_tag LOCUS_00360 38878 37982 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_00360 39788 38871 gene locus_tag LOCUS_00370 39788 38871 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_00370 40509 39832 gene locus_tag LOCUS_00380 40509 39832 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_00380 41441 40797 gene locus_tag LOCUS_00390 41441 40797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42127 41474 gene locus_tag LOCUS_00400 42127 41474 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784472.1 protein_id gnl|my_center|LOCUS_00400 43075 44589 gene locus_tag LOCUS_00410 43075 44589 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_00410 44692 45189 gene locus_tag LOCUS_00420 44692 45189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 45179 46069 gene locus_tag LOCUS_00430 gene era 45179 46069 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_00430 47310 46063 gene locus_tag LOCUS_00440 47310 46063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47499 48944 gene locus_tag LOCUS_00450 gene sufB 47499 48944 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_00450 49018 49413 gene locus_tag LOCUS_00460 49018 49413 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_00460 49557 50330 gene locus_tag LOCUS_00470 gene sufC 49557 50330 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_00470 50656 51987 gene locus_tag LOCUS_00480 gene sufD 50656 51987 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_00480 52009 53271 gene locus_tag LOCUS_00490 52009 53271 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_00490 53281 53712 gene locus_tag LOCUS_00500 53281 53712 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_00500 53690 54190 gene locus_tag LOCUS_00510 53690 54190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54274 55347 gene locus_tag LOCUS_00520 gene paaK 54274 55347 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551026.1 protein_id gnl|my_center|LOCUS_00520 55995 55570 gene locus_tag LOCUS_00530 55995 55570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56529 56143 gene locus_tag LOCUS_00540 56529 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00540 56691 56533 gene locus_tag LOCUS_00550 56691 56533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57241 56693 gene locus_tag LOCUS_00560 57241 56693 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_00560 57626 57225 gene locus_tag LOCUS_00570 57626 57225 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888313.1 protein_id gnl|my_center|LOCUS_00570 57960 57691 gene locus_tag LOCUS_00580 57960 57691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 58693 58022 gene locus_tag LOCUS_00590 58693 58022 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721422.1 protein_id gnl|my_center|LOCUS_00590 59411 58755 gene locus_tag LOCUS_00600 59411 58755 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_00600 60224 59421 gene locus_tag LOCUS_00610 60224 59421 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_00610 60971 60228 gene locus_tag LOCUS_00620 60971 60228 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814256.1 protein_id gnl|my_center|LOCUS_00620 61308 61024 gene locus_tag LOCUS_00630 61308 61024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 61459 61710 gene locus_tag LOCUS_00640 61459 61710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 61753 62160 gene locus_tag LOCUS_00650 61753 62160 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049420.1 protein_id gnl|my_center|LOCUS_00650 62898 64406 gene locus_tag LOCUS_00660 62898 64406 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_00660 64403 64912 gene locus_tag LOCUS_00670 64403 64912 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786452.1 protein_id gnl|my_center|LOCUS_00670 64968 65969 gene locus_tag LOCUS_00680 64968 65969 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257805.1 protein_id gnl|my_center|LOCUS_00680 65972 66811 gene locus_tag LOCUS_00690 65972 66811 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_00690 66811 68373 gene locus_tag LOCUS_00700 66811 68373 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870580.1 protein_id gnl|my_center|LOCUS_00700 68378 69142 gene locus_tag LOCUS_00710 68378 69142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69139 70224 gene locus_tag LOCUS_00720 69139 70224 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476090.1 protein_id gnl|my_center|LOCUS_00720 70202 71155 gene locus_tag LOCUS_00730 70202 71155 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_00730 71272 72243 gene locus_tag LOCUS_00740 71272 72243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 72246 73112 gene locus_tag LOCUS_00750 72246 73112 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_00750 73109 74224 gene locus_tag LOCUS_00760 73109 74224 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101303.1 protein_id gnl|my_center|LOCUS_00760 74229 74813 gene locus_tag LOCUS_00770 74229 74813 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699801.1 protein_id gnl|my_center|LOCUS_00770 74944 75714 gene locus_tag LOCUS_00780 74944 75714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 75730 76881 gene locus_tag LOCUS_00790 75730 76881 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_00790 77234 77689 gene locus_tag LOCUS_00800 gene rplM 77234 77689 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_00800 77723 78115 gene locus_tag LOCUS_00810 gene rpsI 77723 78115 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_00810 78387 79127 gene locus_tag LOCUS_00820 gene rpsB 78387 79127 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_00820 79155 80018 gene locus_tag LOCUS_00830 gene tsf 79155 80018 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933440.1 protein_id gnl|my_center|LOCUS_00830 80042 80752 gene locus_tag LOCUS_00840 gene pyrH 80042 80752 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933439.1 protein_id gnl|my_center|LOCUS_00840 80785 81342 gene locus_tag LOCUS_00850 gene frr 80785 81342 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_00850 81347 81649 gene locus_tag LOCUS_00860 81347 81649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 81615 82094 gene locus_tag LOCUS_00870 81615 82094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00870 82091 82648 gene locus_tag LOCUS_00880 82091 82648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 82694 83281 gene locus_tag LOCUS_00890 82694 83281 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_00890 85049 83229 gene locus_tag LOCUS_00900 85049 83229 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_00900 86750 85380 gene locus_tag LOCUS_00910 86750 85380 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_00910 87774 86833 gene locus_tag LOCUS_00920 87774 86833 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 protein_id gnl|my_center|LOCUS_00920 89050 87944 gene locus_tag LOCUS_00930 gene rfbE 89050 87944 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_00930 90212 89052 gene locus_tag LOCUS_00940 90212 89052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 91232 90216 gene locus_tag LOCUS_00950 91232 90216 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545405.1 protein_id gnl|my_center|LOCUS_00950 91369 93159 gene locus_tag LOCUS_00960 91369 93159 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_00960 93324 93527 gene locus_tag LOCUS_00970 93324 93527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 94177 93650 gene locus_tag LOCUS_00980 94177 93650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 94761 94450 gene locus_tag LOCUS_00990 94761 94450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 95593 96426 gene locus_tag LOCUS_01000 95593 96426 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_01000 96505 97836 gene locus_tag LOCUS_01010 96505 97836 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969941.1 protein_id gnl|my_center|LOCUS_01010 97881 98714 gene locus_tag LOCUS_01020 97881 98714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901785.1 protein_id gnl|my_center|LOCUS_01020 98722 99492 gene locus_tag LOCUS_01030 98722 99492 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_01030 99522 100583 gene locus_tag LOCUS_01040 gene hisC 99522 100583 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897361.1 protein_id gnl|my_center|LOCUS_01040 100592 101170 gene locus_tag LOCUS_01050 100592 101170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 101890 101177 gene locus_tag LOCUS_01060 101890 101177 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443881.1 protein_id gnl|my_center|LOCUS_01060 102010 103008 gene locus_tag LOCUS_01070 102010 103008 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_01070 103331 103495 gene locus_tag LOCUS_01080 103331 103495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 103595 105838 gene locus_tag LOCUS_01090 103595 105838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 105871 108165 gene locus_tag LOCUS_01100 105871 108165 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356699.1 protein_id gnl|my_center|LOCUS_01100 108308 110113 gene locus_tag LOCUS_01110 108308 110113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 110091 110873 gene locus_tag LOCUS_01120 110091 110873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 110940 112172 gene locus_tag LOCUS_01130 110940 112172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113495 112260 gene locus_tag LOCUS_01140 113495 112260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 113636 113941 gene locus_tag LOCUS_01150 113636 113941 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_01150 113958 114422 gene locus_tag LOCUS_01160 113958 114422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 115552 114479 gene locus_tag LOCUS_01170 115552 114479 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_01170 117365 115911 gene locus_tag LOCUS_01180 gene glnA 117365 115911 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141054.1 protein_id gnl|my_center|LOCUS_01180 117752 117387 gene locus_tag LOCUS_01190 117752 117387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 118029 118367 gene locus_tag LOCUS_01200 118029 118367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 119523 118627 gene locus_tag LOCUS_01210 119523 118627 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027482.1 protein_id gnl|my_center|LOCUS_01210 120799 119654 gene locus_tag LOCUS_01220 120799 119654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_01220 121009 122112 gene locus_tag LOCUS_01230 121009 122112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 122581 122231 gene locus_tag LOCUS_01240 122581 122231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 122708 123347 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaatggaacggcaatgaaatttattttta 123571 123840 gene locus_tag LOCUS_01250 123571 123840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 124021 125184 gene locus_tag LOCUS_01260 124021 125184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 125194 126111 gene locus_tag LOCUS_01270 125194 126111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 127453 126494 gene locus_tag LOCUS_01280 127453 126494 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_01280 127649 127494 gene locus_tag LOCUS_01290 127649 127494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 127884 128741 gene locus_tag LOCUS_01300 gene pucL 127884 128741 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_01300 129320 128754 gene locus_tag LOCUS_01310 129320 128754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 131073 129331 gene locus_tag LOCUS_01320 131073 129331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 132910 131282 gene locus_tag LOCUS_01330 132910 131282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 135041 133410 gene locus_tag LOCUS_01340 135041 133410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 135561 136913 gene locus_tag LOCUS_01350 135561 136913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 136976 138283 gene locus_tag LOCUS_01360 136976 138283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 138330 139934 gene locus_tag LOCUS_01370 138330 139934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 139961 141286 gene locus_tag LOCUS_01380 139961 141286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 141431 142708 gene locus_tag LOCUS_01390 141431 142708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 143447 144562 gene locus_tag LOCUS_01400 143447 144562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 144705 148217 gene locus_tag LOCUS_01410 144705 148217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 148278 149537 gene locus_tag LOCUS_01420 148278 149537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 150297 149974 gene locus_tag LOCUS_01430 150297 149974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 151793 150387 gene locus_tag LOCUS_01440 151793 150387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 152397 151777 gene locus_tag LOCUS_01450 152397 151777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 152665 152402 gene locus_tag LOCUS_01460 152665 152402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 153690 152662 gene locus_tag LOCUS_01470 153690 152662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01470 154347 153856 gene locus_tag LOCUS_01480 154347 153856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 154954 154622 gene locus_tag LOCUS_01490 154954 154622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 156181 155465 gene locus_tag LOCUS_01500 156181 155465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 157474 157094 gene locus_tag LOCUS_01510 157474 157094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01510 157868 157467 gene locus_tag LOCUS_01520 157868 157467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 159971 158739 gene locus_tag LOCUS_01530 159971 158739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 161454 160165 gene locus_tag LOCUS_01540 161454 160165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 162365 161634 gene locus_tag LOCUS_01550 162365 161634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 162625 163029 gene locus_tag LOCUS_01560 162625 163029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163529 164416 gene locus_tag LOCUS_01570 163529 164416 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_01570 164532 165716 gene locus_tag LOCUS_01580 164532 165716 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_01580 165676 165810 gene locus_tag LOCUS_01590 165676 165810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 165922 166872 gene locus_tag LOCUS_01600 165922 166872 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208138.1 protein_id gnl|my_center|LOCUS_01600 166862 167773 gene locus_tag LOCUS_01610 166862 167773 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_01610 168418 169005 gene locus_tag LOCUS_01620 168418 169005 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_01620 169014 169235 gene locus_tag LOCUS_01630 169014 169235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 169228 172452 gene locus_tag LOCUS_01640 169228 172452 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_01640 172449 173846 gene locus_tag LOCUS_01650 gene nrfD 172449 173846 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_01650 173839 175047 gene locus_tag LOCUS_01660 173839 175047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 175099 176271 gene locus_tag LOCUS_01670 175099 176271 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_01670 176290 177243 gene locus_tag LOCUS_01680 176290 177243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 177296 178039 gene locus_tag LOCUS_01690 177296 178039 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_01690 178044 179693 gene locus_tag LOCUS_01700 gene ctaD 178044 179693 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939102.1 protein_id gnl|my_center|LOCUS_01700 179694 180332 gene locus_tag LOCUS_01710 179694 180332 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_01710 180341 180664 gene locus_tag LOCUS_01720 180341 180664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 180705 181469 gene locus_tag LOCUS_01730 180705 181469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 181596 182447 gene locus_tag LOCUS_01740 gene cyoE 181596 182447 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_01740 182465 183826 gene locus_tag LOCUS_01750 182465 183826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 183980 184672 gene locus_tag LOCUS_01760 183980 184672 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_01760 186467 184686 gene locus_tag LOCUS_01770 186467 184686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 186659 188140 gene locus_tag LOCUS_01780 186659 188140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 188154 188930 gene locus_tag LOCUS_01790 188154 188930 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_01790 189106 190290 gene locus_tag LOCUS_01800 189106 190290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 192181 190448 gene locus_tag LOCUS_01810 192181 190448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 192120 192371 gene locus_tag LOCUS_01820 192120 192371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 192816 193811 gene locus_tag LOCUS_01830 192816 193811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 194094 195602 gene locus_tag LOCUS_01840 gene rmuC 194094 195602 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_01840 195824 196282 gene locus_tag LOCUS_01850 195824 196282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 196427 198067 gene locus_tag LOCUS_01860 196427 198067 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 protein_id gnl|my_center|LOCUS_01860 198058 198957 gene locus_tag LOCUS_01870 198058 198957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 199646 199005 gene locus_tag LOCUS_01880 199646 199005 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061971.1 protein_id gnl|my_center|LOCUS_01880 200102 199647 gene locus_tag LOCUS_01890 gene ruvX 200102 199647 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_01890 200436 200092 gene locus_tag LOCUS_01900 200436 200092 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_01900 200848 200426 gene locus_tag LOCUS_01910 200848 200426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 201126 202283 gene locus_tag LOCUS_01920 201126 202283 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948824.1 protein_id gnl|my_center|LOCUS_01920 203043 202285 gene locus_tag LOCUS_01930 gene pssA 203043 202285 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_01930 203718 203044 gene locus_tag LOCUS_01940 203718 203044 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933279.1 protein_id gnl|my_center|LOCUS_01940 204427 203720 gene locus_tag LOCUS_01950 204427 203720 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932640.1 protein_id gnl|my_center|LOCUS_01950 204575 206413 gene locus_tag LOCUS_01960 gene dnaG 204575 206413 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_01960 206429 206902 gene locus_tag LOCUS_01970 206429 206902 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493263.1 protein_id gnl|my_center|LOCUS_01970 206967 207473 gene locus_tag LOCUS_01980 gene nusB 206967 207473 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933372.1 protein_id gnl|my_center|LOCUS_01980 207517 208722 gene locus_tag LOCUS_01990 207517 208722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_01990 208727 209614 gene locus_tag LOCUS_02000 208727 209614 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_02000 209607 210893 gene locus_tag LOCUS_02010 209607 210893 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103387.1 protein_id gnl|my_center|LOCUS_02010 211439 212641 gene locus_tag LOCUS_02020 211439 212641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 213052 212966 gene locus_tag LOCUS_t00020 213052 212966 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 213183 213662 gene locus_tag LOCUS_02030 gene ispF 213183 213662 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_02030 213763 214230 gene locus_tag LOCUS_02040 213763 214230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 214433 214227 gene locus_tag LOCUS_02050 214433 214227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 214384 215925 gene locus_tag LOCUS_02060 gene lnt 214384 215925 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_02060 216700 215909 gene locus_tag LOCUS_02070 216700 215909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 217196 216687 gene locus_tag LOCUS_02080 217196 216687 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_02080 219216 217198 gene locus_tag LOCUS_02090 gene ligA 219216 217198 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_02090 220340 219285 gene locus_tag LOCUS_02100 220340 219285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 220645 221337 gene locus_tag LOCUS_02110 gene bshB1 220645 221337 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_02110 221421 221756 gene locus_tag LOCUS_02120 221421 221756 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_02120 221770 222378 gene locus_tag LOCUS_02130 gene recR 221770 222378 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932487.1 protein_id gnl|my_center|LOCUS_02130 222390 223151 gene locus_tag LOCUS_02140 222390 223151 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932718.1 protein_id gnl|my_center|LOCUS_02140 223158 223745 gene locus_tag LOCUS_02150 223158 223745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 224002 224298 gene locus_tag LOCUS_02160 224002 224298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 225434 224295 gene locus_tag LOCUS_02170 225434 224295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 225915 225445 gene locus_tag LOCUS_02180 225915 225445 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_02180 226819 225947 gene locus_tag LOCUS_02190 226819 225947 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_02190 227713 226874 gene locus_tag LOCUS_02200 227713 226874 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_02200 228588 227791 gene locus_tag LOCUS_02210 228588 227791 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_02210 229181 228597 gene locus_tag LOCUS_02220 229181 228597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 229921 229229 gene locus_tag LOCUS_02230 229921 229229 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_02230 230114 230956 gene locus_tag LOCUS_02240 gene menB 230114 230956 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639996.1 protein_id gnl|my_center|LOCUS_02240 232712 231165 gene locus_tag LOCUS_02250 232712 231165 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_02250 233057 232743 gene locus_tag LOCUS_02260 233057 232743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 233863 233054 gene locus_tag LOCUS_02270 233863 233054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 234061 233873 gene locus_tag LOCUS_02280 234061 233873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 234729 234199 gene locus_tag LOCUS_02290 234729 234199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02290 235231 234734 gene locus_tag LOCUS_02300 gene folK 235231 234734 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_02300 235593 235231 gene locus_tag LOCUS_02310 gene folB 235593 235231 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262834.1 protein_id gnl|my_center|LOCUS_02310 236573 235608 gene locus_tag LOCUS_02320 gene sucD 236573 235608 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_02320 237257 236592 gene locus_tag LOCUS_02330 237257 236592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 237746 239650 gene locus_tag LOCUS_02340 237746 239650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 239785 241887 gene locus_tag LOCUS_02350 239785 241887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 242406 243464 gene locus_tag LOCUS_02360 242406 243464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 243505 244155 gene locus_tag LOCUS_02370 gene upp 243505 244155 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081012.1 protein_id gnl|my_center|LOCUS_02370 244329 246554 gene locus_tag LOCUS_02380 244329 246554 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403822.1 protein_id gnl|my_center|LOCUS_02380 246535 247617 gene locus_tag LOCUS_02390 246535 247617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 247979 247614 gene locus_tag LOCUS_02400 gene acpS 247979 247614 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 protein_id gnl|my_center|LOCUS_02400 248671 247982 gene locus_tag LOCUS_02410 248671 247982 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_02410 249205 248726 gene locus_tag LOCUS_02420 249205 248726 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_02420 250064 249186 gene locus_tag LOCUS_02430 250064 249186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 251498 250140 gene locus_tag LOCUS_02440 251498 250140 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_02440 252011 251526 gene locus_tag LOCUS_02450 gene ribE 252011 251526 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_02450 252847 252023 gene locus_tag LOCUS_02460 252847 252023 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_02460 253275 254312 gene locus_tag LOCUS_02470 253275 254312 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_02470 254321 254659 gene locus_tag LOCUS_02480 254321 254659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 254656 255675 gene locus_tag LOCUS_02490 254656 255675 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868430.1 protein_id gnl|my_center|LOCUS_02490 255725 256711 gene locus_tag LOCUS_02500 gene trpS 255725 256711 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518857.1 protein_id gnl|my_center|LOCUS_02500 256808 257593 gene locus_tag LOCUS_02510 256808 257593 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_02510 257590 259962 gene locus_tag LOCUS_02520 gene bamA 257590 259962 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_02520 260076 260570 gene locus_tag LOCUS_02530 260076 260570 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926824.1 protein_id gnl|my_center|LOCUS_02530 260644 261177 gene locus_tag LOCUS_02540 260644 261177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 261177 262199 gene locus_tag LOCUS_02550 gene lpxD 261177 262199 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933028.1 protein_id gnl|my_center|LOCUS_02550 262214 263620 gene locus_tag LOCUS_02560 262214 263620 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_02560 264917 263694 gene locus_tag LOCUS_02570 264917 263694 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_02570 266957 265032 gene locus_tag LOCUS_02580 266957 265032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 267611 267686 gene locus_tag LOCUS_t00030 267611 267686 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 267834 268853 gene locus_tag LOCUS_02590 267834 268853 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_02590 268863 269627 gene locus_tag LOCUS_02600 268863 269627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_02600 269794 270192 gene locus_tag LOCUS_02610 269794 270192 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_02610 270186 270893 gene locus_tag LOCUS_02620 270186 270893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_02620 271039 271386 gene locus_tag LOCUS_02630 271039 271386 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_02630 271513 272670 gene locus_tag LOCUS_02640 271513 272670 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_02640 272873 273316 gene locus_tag LOCUS_02650 272873 273316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 273471 275132 gene locus_tag LOCUS_02660 gene nadB 273471 275132 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932248.1 protein_id gnl|my_center|LOCUS_02660 275172 276113 gene locus_tag LOCUS_02670 275172 276113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 276106 276975 gene locus_tag LOCUS_02680 276106 276975 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_02680 276972 277808 gene locus_tag LOCUS_02690 276972 277808 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_02690 277899 278948 gene locus_tag LOCUS_02700 gene hrcA 277899 278948 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933152.1 protein_id gnl|my_center|LOCUS_02700 278952 279572 gene locus_tag LOCUS_02710 278952 279572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 279602 280774 gene locus_tag LOCUS_02720 gene dnaJ 279602 280774 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_02720 282403 281282 gene locus_tag LOCUS_02730 gene cfa 282403 281282 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_02730 282722 285496 gene locus_tag LOCUS_02740 282722 285496 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_02740 285615 287258 gene locus_tag LOCUS_02750 285615 287258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 287695 288609 gene locus_tag LOCUS_02760 287695 288609 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160261.1 protein_id gnl|my_center|LOCUS_02760 288587 289627 gene locus_tag LOCUS_02770 288587 289627 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_02770 289797 291248 gene locus_tag LOCUS_02780 289797 291248 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_02780 291374 292864 gene locus_tag LOCUS_02790 291374 292864 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_02790 293199 294065 gene locus_tag LOCUS_02800 293199 294065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 294247 295446 gene locus_tag LOCUS_02810 294247 295446 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_02810 295416 296234 gene locus_tag LOCUS_02820 295416 296234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 296285 297151 gene locus_tag LOCUS_02830 296285 297151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 297326 297739 gene locus_tag LOCUS_02840 297326 297739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 297999 300368 gene locus_tag LOCUS_02850 gene atsD 297999 300368 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_02850 302206 300698 gene locus_tag LOCUS_02860 302206 300698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 302700 305054 gene locus_tag LOCUS_02870 302700 305054 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_02870 305409 305771 gene locus_tag LOCUS_02880 305409 305771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 305880 306566 gene locus_tag LOCUS_02890 305880 306566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 306603 307163 gene locus_tag LOCUS_02900 306603 307163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 307260 308066 gene locus_tag LOCUS_02910 307260 308066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_02910 308129 308515 gene locus_tag LOCUS_02920 308129 308515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 308763 309617 gene locus_tag LOCUS_02930 308763 309617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 protein_id gnl|my_center|LOCUS_02930 309671 310453 gene locus_tag LOCUS_02940 309671 310453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 310561 311697 gene locus_tag LOCUS_02950 310561 311697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 311738 313402 gene locus_tag LOCUS_02960 311738 313402 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072293.1 protein_id gnl|my_center|LOCUS_02960 313474 314142 gene locus_tag LOCUS_02970 313474 314142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 314154 315155 gene locus_tag LOCUS_02980 314154 315155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 315679 315425 gene locus_tag LOCUS_02990 315679 315425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 318380 316287 gene locus_tag LOCUS_03000 gene recG 318380 316287 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_03000 318805 318575 gene locus_tag LOCUS_03010 318805 318575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 318965 318774 gene locus_tag LOCUS_03020 318965 318774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 320594 319416 gene locus_tag LOCUS_03030 320594 319416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 320995 321068 gene locus_tag LOCUS_t00040 320995 321068 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 321126 321434 gene locus_tag LOCUS_03040 321126 321434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 321501 321761 gene locus_tag LOCUS_03050 gene rpmA 321501 321761 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_03050 321852 322781 gene locus_tag LOCUS_03060 gene mdh 321852 322781 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_03060 323243 322839 gene locus_tag LOCUS_03070 323243 322839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 325085 323286 gene locus_tag LOCUS_03080 325085 323286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 326037 325180 gene locus_tag LOCUS_03090 326037 325180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_03090 326401 327021 gene locus_tag LOCUS_03100 326401 327021 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_03100 327036 328451 gene locus_tag LOCUS_03110 327036 328451 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_03110 329242 328793 gene locus_tag LOCUS_03120 329242 328793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 329646 330422 gene locus_tag LOCUS_03130 329646 330422 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_03130 331004 331480 gene locus_tag LOCUS_03140 gene rimP 331004 331480 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_03140 331502 332602 gene locus_tag LOCUS_03150 gene nusA 331502 332602 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962638.1 protein_id gnl|my_center|LOCUS_03150 332693 335587 gene locus_tag LOCUS_03160 332693 335587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 335596 335988 gene locus_tag LOCUS_03170 gene rbfA 335596 335988 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_03170 335997 336725 gene locus_tag LOCUS_03180 gene truB 335997 336725 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931935.1 protein_id gnl|my_center|LOCUS_03180 336792 336879 gene locus_tag LOCUS_t00050 336792 336879 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 337224 337859 gene locus_tag LOCUS_03190 337224 337859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 338210 337968 gene locus_tag LOCUS_03200 338210 337968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 338380 339153 gene locus_tag LOCUS_03210 338380 339153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 339181 340671 gene locus_tag LOCUS_03220 339181 340671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 341470 340799 gene locus_tag LOCUS_03230 341470 340799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 342221 343174 gene locus_tag LOCUS_03240 342221 343174 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963600.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03240 343137 343493 gene locus_tag LOCUS_03250 343137 343493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03250 343589 344290 gene locus_tag LOCUS_03260 343589 344290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 344314 345795 gene locus_tag LOCUS_03270 344314 345795 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225259.1 protein_id gnl|my_center|LOCUS_03270 346317 346400 gene locus_tag LOCUS_t00060 346317 346400 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 346455 346528 gene locus_tag LOCUS_t00070 346455 346528 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 346616 346689 gene locus_tag LOCUS_t00080 346616 346689 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 346830 347003 gene locus_tag LOCUS_03280 346830 347003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 347007 347080 gene locus_tag LOCUS_t00090 347007 347080 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 347124 347306 gene locus_tag LOCUS_03290 gene secE 347124 347306 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241323.1 protein_id gnl|my_center|LOCUS_03290 347324 347980 gene locus_tag LOCUS_03300 gene nusG 347324 347980 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_03300 348006 348431 gene locus_tag LOCUS_03310 gene rplK 348006 348431 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_03310 348458 349162 gene locus_tag LOCUS_03320 gene rplA 348458 349162 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931846.1 protein_id gnl|my_center|LOCUS_03320 349263 349796 gene locus_tag LOCUS_03330 gene rplJ 349263 349796 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_03330 349838 350209 gene locus_tag LOCUS_03340 gene rplL 349838 350209 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_03340 350330 354175 gene locus_tag LOCUS_03350 gene rpoB 350330 354175 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_03350 354376 358656 gene locus_tag LOCUS_03360 gene rpoC 354376 358656 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_03360 359162 359611 gene locus_tag LOCUS_03370 gene mraZ 359162 359611 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180984760.1 protein_id gnl|my_center|LOCUS_03370 359655 360596 gene locus_tag LOCUS_03380 gene rsmH 359655 360596 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_03380 360606 360917 gene locus_tag LOCUS_03390 360606 360917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 361002 363137 gene locus_tag LOCUS_03400 361002 363137 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931734.1 protein_id gnl|my_center|LOCUS_03400 363137 364615 gene locus_tag LOCUS_03410 363137 364615 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_03410 364612 366003 gene locus_tag LOCUS_03420 364612 366003 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_03420 366034 367143 gene locus_tag LOCUS_03430 gene mraY 366034 367143 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403333.1 protein_id gnl|my_center|LOCUS_03430 367140 368513 gene locus_tag LOCUS_03440 gene murD 367140 368513 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_03440 368515 369630 gene locus_tag LOCUS_03450 368515 369630 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931729.1 protein_id gnl|my_center|LOCUS_03450 369649 370737 gene locus_tag LOCUS_03460 gene murG 369649 370737 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_03460 370734 371207 gene locus_tag LOCUS_03470 370734 371207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 371204 372598 gene locus_tag LOCUS_03480 gene murC 371204 372598 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_03480 372595 373365 gene locus_tag LOCUS_03490 372595 373365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 373369 374646 gene locus_tag LOCUS_03500 gene ftsA 373369 374646 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015601.1 protein_id gnl|my_center|LOCUS_03500 374761 375993 gene locus_tag LOCUS_03510 gene ftsZ 374761 375993 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403340.1 protein_id gnl|my_center|LOCUS_03510 376303 379968 gene locus_tag LOCUS_03520 gene metH 376303 379968 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_03520 380054 381322 gene locus_tag LOCUS_03530 380054 381322 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_03530 381365 382093 gene locus_tag LOCUS_03540 381365 382093 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271070.1 protein_id gnl|my_center|LOCUS_03540 382077 383765 gene locus_tag LOCUS_03550 382077 383765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 383965 386244 gene locus_tag LOCUS_03560 383965 386244 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_03560 386623 386453 gene locus_tag LOCUS_03570 386623 386453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 386604 387272 gene locus_tag LOCUS_03580 386604 387272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 387277 388302 gene locus_tag LOCUS_03590 gene rfbB 387277 388302 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_03590 388406 389353 gene locus_tag LOCUS_03600 388406 389353 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_03600 389364 390071 gene locus_tag LOCUS_03610 389364 390071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_03610 390119 391726 gene locus_tag LOCUS_03620 390119 391726 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_03620 391754 392665 gene locus_tag LOCUS_03630 391754 392665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 392970 393662 gene locus_tag LOCUS_03640 gene plsY 392970 393662 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_03640 393684 394676 gene locus_tag LOCUS_03650 393684 394676 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_03650 396115 394703 gene locus_tag LOCUS_03660 396115 394703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 397563 396208 gene locus_tag LOCUS_03670 397563 396208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 399263 397863 gene locus_tag LOCUS_03680 399263 397863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 399538 401043 gene locus_tag LOCUS_03690 399538 401043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 402530 401118 gene locus_tag LOCUS_03700 402530 401118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 403244 402909 gene locus_tag LOCUS_03710 403244 402909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 403745 403314 gene locus_tag LOCUS_03720 403745 403314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 405149 403959 gene locus_tag LOCUS_03730 405149 403959 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_03730 406360 405371 gene locus_tag LOCUS_03740 gene trxB 406360 405371 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_03740 408042 406384 gene locus_tag LOCUS_03750 408042 406384 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_03750 408404 408700 gene locus_tag LOCUS_03760 408404 408700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 409219 410736 gene locus_tag LOCUS_r00010 409219 410736 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 410878 410952 gene locus_tag LOCUS_t00100 410878 410952 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 411112 411185 gene locus_tag LOCUS_t00110 411112 411185 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 411301 414277 gene locus_tag LOCUS_r00020 411301 414277 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 416402 414696 gene locus_tag LOCUS_03770 416402 414696 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_03770 416925 417320 gene locus_tag LOCUS_03780 416925 417320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 417539 418582 gene locus_tag LOCUS_03790 417539 418582 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868244.1 protein_id gnl|my_center|LOCUS_03790 418572 420962 gene locus_tag LOCUS_03800 418572 420962 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022354.1 protein_id gnl|my_center|LOCUS_03800 421107 421877 gene locus_tag LOCUS_03810 421107 421877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 421892 422491 gene locus_tag LOCUS_03820 421892 422491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 422742 423443 gene locus_tag LOCUS_03830 422742 423443 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220090.1 protein_id gnl|my_center|LOCUS_03830 423568 423999 gene locus_tag LOCUS_03840 423568 423999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 424258 424767 gene locus_tag LOCUS_03850 424258 424767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 425508 425717 gene locus_tag LOCUS_03860 425508 425717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 425818 426756 gene locus_tag LOCUS_03870 425818 426756 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267746.1 protein_id gnl|my_center|LOCUS_03870 426942 427439 gene locus_tag LOCUS_03880 426942 427439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 427514 427843 gene locus_tag LOCUS_03890 427514 427843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 427946 428512 gene locus_tag LOCUS_03900 427946 428512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 429085 429843 gene locus_tag LOCUS_03910 429085 429843 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 protein_id gnl|my_center|LOCUS_03910 431833 430124 gene locus_tag LOCUS_03920 431833 430124 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_03920 433860 432007 gene locus_tag LOCUS_03930 433860 432007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_03930 435695 433941 gene locus_tag LOCUS_03940 435695 433941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_03940 437866 437126 gene locus_tag LOCUS_03950 437866 437126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 437960 438199 gene locus_tag LOCUS_03960 437960 438199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 438507 438698 gene locus_tag LOCUS_03970 438507 438698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 438708 439844 gene locus_tag LOCUS_03980 gene metK 438708 439844 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_03980 440122 441564 gene locus_tag LOCUS_03990 440122 441564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 441573 442040 gene locus_tag LOCUS_04000 441573 442040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 442027 443322 gene locus_tag LOCUS_04010 442027 443322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 443344 444426 gene locus_tag LOCUS_04020 gene metK 443344 444426 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002663127.1 protein_id gnl|my_center|LOCUS_04020 444614 445597 gene locus_tag LOCUS_04030 444614 445597 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_04030 445821 447719 gene locus_tag LOCUS_04040 445821 447719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 447801 448580 gene locus_tag LOCUS_04050 447801 448580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 451319 449388 gene locus_tag LOCUS_04060 451319 449388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 451911 453503 gene locus_tag LOCUS_04070 451911 453503 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_04070 454215 455375 gene locus_tag LOCUS_04080 454215 455375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 456176 456919 gene locus_tag LOCUS_04090 456176 456919 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_04090 457160 457306 gene locus_tag LOCUS_04100 457160 457306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 457324 460296 gene locus_tag LOCUS_04110 457324 460296 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094146567.1 protein_id gnl|my_center|LOCUS_04110 460986 461228 gene locus_tag LOCUS_04120 460986 461228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 461441 461752 gene locus_tag LOCUS_04130 461441 461752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 461828 462472 gene locus_tag LOCUS_04140 461828 462472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 462537 464165 gene locus_tag LOCUS_04150 462537 464165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 464476 464733 gene locus_tag LOCUS_04160 464476 464733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 464783 467221 gene locus_tag LOCUS_04170 464783 467221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 467422 469890 gene locus_tag LOCUS_04180 467422 469890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 469997 472192 gene locus_tag LOCUS_04190 469997 472192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 473247 472261 gene locus_tag LOCUS_04200 473247 472261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 474916 473459 gene locus_tag LOCUS_04210 474916 473459 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_04210 475964 475233 gene locus_tag LOCUS_04220 475964 475233 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_04220 477022 476483 gene locus_tag LOCUS_04230 477022 476483 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868177.1 protein_id gnl|my_center|LOCUS_04230 478367 477063 gene locus_tag LOCUS_04240 478367 477063 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_04240 478729 479802 gene locus_tag LOCUS_04250 478729 479802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04250 480185 480976 gene locus_tag LOCUS_04260 480185 480976 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861569.1 protein_id gnl|my_center|LOCUS_04260 482797 481004 gene locus_tag LOCUS_04270 482797 481004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 483708 486227 gene locus_tag LOCUS_04280 483708 486227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 486831 487961 gene locus_tag LOCUS_04290 486831 487961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 488055 489188 gene locus_tag LOCUS_04300 488055 489188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 489354 491792 gene locus_tag LOCUS_04310 489354 491792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 492080 493348 gene locus_tag LOCUS_04320 gene pepT 492080 493348 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_04320 493369 494454 gene locus_tag LOCUS_04330 493369 494454 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_04330 494490 494918 gene locus_tag LOCUS_04340 494490 494918 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_04340 496099 495062 gene locus_tag LOCUS_04350 496099 495062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 496997 496614 gene locus_tag LOCUS_04360 gene queF 496997 496614 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_04360 497100 498074 gene locus_tag LOCUS_04370 497100 498074 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_04370 498851 498303 gene locus_tag LOCUS_04380 gene rfbC 498851 498303 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100804.1 protein_id gnl|my_center|LOCUS_04380 499727 498864 gene locus_tag LOCUS_04390 gene rfbA 499727 498864 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_04390 500459 499851 gene locus_tag LOCUS_04400 500459 499851 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 protein_id gnl|my_center|LOCUS_04400 500614 501114 gene locus_tag LOCUS_04410 500614 501114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 501136 501208 gene locus_tag LOCUS_t00120 501136 501208 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 501228 501440 gene locus_tag LOCUS_04420 501228 501440 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083352.1 protein_id gnl|my_center|LOCUS_04420 501440 501664 gene locus_tag LOCUS_04430 501440 501664 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079902.1 protein_id gnl|my_center|LOCUS_04430 501665 503566 gene locus_tag LOCUS_04440 501665 503566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 503567 504646 gene locus_tag LOCUS_04450 503567 504646 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963343.1 protein_id gnl|my_center|LOCUS_04450 506269 504728 gene locus_tag LOCUS_04460 506269 504728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 507397 506288 gene locus_tag LOCUS_04470 507397 506288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786796.1 protein_id gnl|my_center|LOCUS_04470 507814 508386 gene locus_tag LOCUS_04480 507814 508386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 508493 509374 gene locus_tag LOCUS_04490 508493 509374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 509801 509442 gene locus_tag LOCUS_04500 509801 509442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 510869 509850 gene locus_tag LOCUS_04510 gene ltaE 510869 509850 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_04510 513379 510914 gene locus_tag LOCUS_04520 gene gyrA 513379 510914 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_04520 513618 513545 gene locus_tag LOCUS_t00130 513618 513545 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 514404 513730 gene locus_tag LOCUS_04530 514404 513730 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_04530 514629 514877 gene locus_tag LOCUS_04540 514629 514877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 515073 517412 gene locus_tag LOCUS_04550 515073 517412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 517409 517636 gene locus_tag LOCUS_04560 517409 517636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 518660 517716 gene locus_tag LOCUS_04570 518660 517716 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_04570 518960 518706 gene locus_tag LOCUS_04580 518960 518706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 519224 519412 gene locus_tag LOCUS_04590 519224 519412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 520363 519599 gene locus_tag LOCUS_04600 gene radC 520363 519599 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_04600 520461 520387 gene locus_tag LOCUS_t00140 520461 520387 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 521028 520585 gene locus_tag LOCUS_04610 521028 520585 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909062.1 protein_id gnl|my_center|LOCUS_04610 521692 521048 gene locus_tag LOCUS_04620 gene pdxH 521692 521048 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371278.1 protein_id gnl|my_center|LOCUS_04620 521882 523825 gene locus_tag LOCUS_04630 521882 523825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 523972 524157 gene locus_tag LOCUS_04640 523972 524157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 524170 525573 gene locus_tag LOCUS_04650 gene mgtE 524170 525573 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_04650 525577 526533 gene locus_tag LOCUS_04660 525577 526533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 527573 526536 gene locus_tag LOCUS_04670 gene hemW 527573 526536 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583471.1 protein_id gnl|my_center|LOCUS_04670 528909 527962 gene locus_tag LOCUS_04680 gene lepB 528909 527962 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_04680 530769 528973 gene locus_tag LOCUS_04690 gene lepA 530769 528973 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_04690 531089 530898 gene locus_tag LOCUS_04700 531089 530898 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_04700 531554 531177 gene locus_tag LOCUS_04710 531554 531177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 532015 531578 gene locus_tag LOCUS_04720 532015 531578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 533210 532212 gene locus_tag LOCUS_04730 533210 532212 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_04730 534633 533230 gene locus_tag LOCUS_04740 534633 533230 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_04740 535929 534637 gene locus_tag LOCUS_04750 535929 534637 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_04750 537255 535936 gene locus_tag LOCUS_04760 537255 535936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 537805 539718 gene locus_tag LOCUS_04770 537805 539718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04770 539858 540880 gene locus_tag LOCUS_04780 539858 540880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 540877 542112 gene locus_tag LOCUS_04790 540877 542112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 542290 542865 gene locus_tag LOCUS_04800 542290 542865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 542936 543628 gene locus_tag LOCUS_04810 542936 543628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 543667 544863 gene locus_tag LOCUS_04820 543667 544863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 544991 545383 gene locus_tag LOCUS_04830 544991 545383 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940728.1 protein_id gnl|my_center|LOCUS_04830 545440 546378 gene locus_tag LOCUS_04840 545440 546378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 546513 546941 gene locus_tag LOCUS_04850 546513 546941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 546955 547179 gene locus_tag LOCUS_04860 546955 547179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 548020 548445 gene locus_tag LOCUS_04870 548020 548445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 548468 548746 gene locus_tag LOCUS_04880 548468 548746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 548752 549039 gene locus_tag LOCUS_04890 gene rpsS 548752 549039 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_04890 549043 549393 gene locus_tag LOCUS_04900 gene rplV 549043 549393 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933837.1 protein_id gnl|my_center|LOCUS_04900 549423 549980 gene locus_tag LOCUS_04910 549423 549980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 550084 550455 gene locus_tag LOCUS_04920 gene rplP 550084 550455 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_04920 550511 550816 gene locus_tag LOCUS_04930 550511 550816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 550863 551228 gene locus_tag LOCUS_04940 550863 551228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 551266 551505 gene locus_tag LOCUS_04950 551266 551505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04950 551647 551997 gene locus_tag LOCUS_04960 gene rplX 551647 551997 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963459.1 protein_id gnl|my_center|LOCUS_04960 552005 552361 gene locus_tag LOCUS_04970 552005 552361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 552475 552666 gene locus_tag LOCUS_04980 552475 552666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 552682 552951 gene locus_tag LOCUS_04990 gene rpsN 552682 552951 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_04990 553056 553376 gene locus_tag LOCUS_05000 gene rpsH 553056 553376 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 553473 553937 gene locus_tag LOCUS_05010 gene rplF 553473 553937 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933827.1 protein_id gnl|my_center|LOCUS_05010 553956 554327 gene locus_tag LOCUS_05020 gene rplR 553956 554327 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_05020 554371 554442 gene locus_tag LOCUS_t00150 554371 554442 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 554476 554988 gene locus_tag LOCUS_05030 gene rpsE 554476 554988 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_05030 555006 555188 gene locus_tag LOCUS_05040 gene rpmD 555006 555188 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933824.1 protein_id gnl|my_center|LOCUS_05040 555302 555760 gene locus_tag LOCUS_05050 gene rplO 555302 555760 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_05050 555757 555924 gene locus_tag LOCUS_05060 555757 555924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05060 555932 557092 gene locus_tag LOCUS_05070 gene secY 555932 557092 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_05070 557103 557864 gene locus_tag LOCUS_05080 gene map 557103 557864 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_05080 557901 558119 gene locus_tag LOCUS_05090 gene infA 557901 558119 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_05090 558291 558674 gene locus_tag LOCUS_05100 gene rpsM 558291 558674 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_05100 558760 559146 gene locus_tag LOCUS_05110 gene rpsK 558760 559146 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923548.1 protein_id gnl|my_center|LOCUS_05110 559343 559822 gene locus_tag LOCUS_05120 gene rpsD 559343 559822 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_05120 559876 560856 gene locus_tag LOCUS_05130 559876 560856 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933815.1 protein_id gnl|my_center|LOCUS_05130 560899 561468 gene locus_tag LOCUS_05140 560899 561468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 561566 562150 gene locus_tag LOCUS_05150 gene yihA 561566 562150 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894870.1 protein_id gnl|my_center|LOCUS_05150 562278 563201 gene locus_tag LOCUS_05160 562278 563201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 563369 565027 gene locus_tag LOCUS_05170 563369 565027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 565172 568006 gene locus_tag LOCUS_05180 565172 568006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 568034 571588 gene locus_tag LOCUS_05190 568034 571588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 571649 572674 gene locus_tag LOCUS_05200 gene porV 571649 572674 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_05200 572761 574134 gene locus_tag LOCUS_05210 572761 574134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 574145 575065 gene locus_tag LOCUS_05220 574145 575065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 575062 575832 gene locus_tag LOCUS_05230 575062 575832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 575932 576651 gene locus_tag LOCUS_05240 575932 576651 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932023.1 protein_id gnl|my_center|LOCUS_05240 576666 577412 gene locus_tag LOCUS_05250 gene lptB 576666 577412 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_05250 577805 577422 gene locus_tag LOCUS_05260 577805 577422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 581216 577815 gene locus_tag LOCUS_05270 581216 577815 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530124.1 protein_id gnl|my_center|LOCUS_05270 582047 581253 gene locus_tag LOCUS_05280 582047 581253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_05280 582667 582101 gene locus_tag LOCUS_05290 582667 582101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 584030 582693 gene locus_tag LOCUS_05300 gene accC 584030 582693 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_05300 584573 584079 gene locus_tag LOCUS_05310 gene accB 584573 584079 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472869.1 protein_id gnl|my_center|LOCUS_05310 585167 584604 gene locus_tag LOCUS_05320 gene efp 585167 584604 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_05320 587090 585669 gene locus_tag LOCUS_05330 587090 585669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 588467 587100 gene locus_tag LOCUS_05340 588467 587100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 588784 589776 gene locus_tag LOCUS_05350 gene gap 588784 589776 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_05350 589856 590125 gene locus_tag LOCUS_05360 589856 590125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 590289 590362 gene locus_tag LOCUS_t00160 590289 590362 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 590396 590470 gene locus_tag LOCUS_t00170 590396 590470 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 592355 590535 gene locus_tag LOCUS_05370 592355 590535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 592803 592390 gene locus_tag LOCUS_05380 592803 592390 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790413.1 protein_id gnl|my_center|LOCUS_05380 593010 593564 gene locus_tag LOCUS_05390 593010 593564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 594038 593574 gene locus_tag LOCUS_05400 594038 593574 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964318.1 protein_id gnl|my_center|LOCUS_05400 595325 594048 gene locus_tag LOCUS_05410 595325 594048 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071480.1 protein_id gnl|my_center|LOCUS_05410 595720 595403 gene locus_tag LOCUS_05420 595720 595403 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_05420 596687 595713 gene locus_tag LOCUS_05430 gene secF 596687 595713 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_05430 598775 596736 gene locus_tag LOCUS_05440 gene secD 598775 596736 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_05440 599702 598992 gene locus_tag LOCUS_05450 599702 598992 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932296.1 protein_id gnl|my_center|LOCUS_05450 601307 599733 gene locus_tag LOCUS_05460 601307 599733 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_05460 601708 601400 gene locus_tag LOCUS_05470 601708 601400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 602560 601832 gene locus_tag LOCUS_05480 gene fabG 602560 601832 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_05480 603217 602582 gene locus_tag LOCUS_05490 603217 602582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 604146 603214 gene locus_tag LOCUS_05500 gene fabD 604146 603214 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_05500 604416 605114 gene locus_tag LOCUS_05510 604416 605114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 605369 607336 gene locus_tag LOCUS_05520 gene acs 605369 607336 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933316.1 protein_id gnl|my_center|LOCUS_05520 607658 608086 gene locus_tag LOCUS_05530 607658 608086 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256036.1 protein_id gnl|my_center|LOCUS_05530 609520 608081 gene locus_tag LOCUS_05540 609520 608081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 609950 613168 gene locus_tag LOCUS_05550 609950 613168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 613328 614674 gene locus_tag LOCUS_05560 613328 614674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 614936 615556 gene locus_tag LOCUS_05570 gene purN 614936 615556 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_05570 615572 617110 gene locus_tag LOCUS_05580 gene purH 615572 617110 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932012.1 protein_id gnl|my_center|LOCUS_05580 617163 618179 gene locus_tag LOCUS_05590 617163 618179 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404386.1 protein_id gnl|my_center|LOCUS_05590 618338 619126 gene locus_tag LOCUS_05600 618338 619126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 619393 620223 gene locus_tag LOCUS_05610 gene mreC 619393 620223 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926883.1 protein_id gnl|my_center|LOCUS_05610 620229 620741 gene locus_tag LOCUS_05620 620229 620741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 620741 622531 gene locus_tag LOCUS_05630 gene mrdA 620741 622531 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_05630 622564 623787 gene locus_tag LOCUS_05640 gene rodA 622564 623787 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926830.1 protein_id gnl|my_center|LOCUS_05640 623841 624380 gene locus_tag LOCUS_05650 gene dcd 623841 624380 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_05650 624459 625280 gene locus_tag LOCUS_05660 gene pyrF 624459 625280 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_05660 625734 626204 gene locus_tag LOCUS_05670 625734 626204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 626119 627753 gene locus_tag LOCUS_05680 626119 627753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 628141 629874 gene locus_tag LOCUS_05690 628141 629874 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_05690 629975 630622 gene locus_tag LOCUS_05700 629975 630622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 630713 631639 gene locus_tag LOCUS_05710 630713 631639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868767.1 protein_id gnl|my_center|LOCUS_05710 631688 632770 gene locus_tag LOCUS_05720 631688 632770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 633202 632795 gene locus_tag LOCUS_05730 633202 632795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 633365 633814 gene locus_tag LOCUS_05740 633365 633814 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_05740 633842 634516 gene locus_tag LOCUS_05750 633842 634516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 634541 635257 gene locus_tag LOCUS_05760 634541 635257 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_05760 635304 635798 gene locus_tag LOCUS_05770 635304 635798 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_05770 635802 636365 gene locus_tag LOCUS_05780 635802 636365 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_05780 636466 637311 gene locus_tag LOCUS_05790 636466 637311 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_05790 637330 637641 gene locus_tag LOCUS_05800 637330 637641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 637638 638513 gene locus_tag LOCUS_05810 637638 638513 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311263.1 protein_id gnl|my_center|LOCUS_05810 639669 638518 gene locus_tag LOCUS_05820 639669 638518 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_05820 640239 639781 gene locus_tag LOCUS_05830 640239 639781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 640390 642075 gene locus_tag LOCUS_05840 640390 642075 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_05840 642081 642959 gene locus_tag LOCUS_05850 642081 642959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 642956 643414 gene locus_tag LOCUS_05860 gene dtd 642956 643414 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545012.1 protein_id gnl|my_center|LOCUS_05860 643421 644341 gene locus_tag LOCUS_05870 643421 644341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 644357 645049 gene locus_tag LOCUS_05880 644357 645049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 646080 645046 gene locus_tag LOCUS_05890 646080 645046 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_05890 649198 646214 gene locus_tag LOCUS_05900 649198 646214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 650483 649332 gene locus_tag LOCUS_05910 gene porV 650483 649332 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_05910 654557 650508 gene locus_tag LOCUS_05920 gene porU 654557 650508 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_05920 655761 654922 gene locus_tag LOCUS_05930 gene rnc 655761 654922 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933773.1 protein_id gnl|my_center|LOCUS_05930 657033 655786 gene locus_tag LOCUS_05940 gene fabF 657033 655786 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583310.1 protein_id gnl|my_center|LOCUS_05940 657304 657056 gene locus_tag LOCUS_05950 657304 657056 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405458.1 protein_id gnl|my_center|LOCUS_05950 658154 657537 gene locus_tag LOCUS_05960 658154 657537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 659264 658197 gene locus_tag LOCUS_05970 659264 658197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 660072 659314 gene locus_tag LOCUS_05980 660072 659314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_05980 660920 660105 gene locus_tag LOCUS_05990 660920 660105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_05990 661604 660960 gene locus_tag LOCUS_06000 661604 660960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 663990 661657 gene locus_tag LOCUS_06010 gene purL 663990 661657 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_06010 664614 664054 gene locus_tag LOCUS_06020 664614 664054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 665363 664611 gene locus_tag LOCUS_06030 gene cysZ 665363 664611 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693426.1 protein_id gnl|my_center|LOCUS_06030 666607 665465 gene locus_tag LOCUS_06040 gene metK 666607 665465 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 protein_id gnl|my_center|LOCUS_06040 668706 666694 gene locus_tag LOCUS_06050 668706 666694 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_06050 671138 669354 gene locus_tag LOCUS_06060 671138 669354 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_06060 672248 671184 gene locus_tag LOCUS_06070 672248 671184 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658381.1 protein_id gnl|my_center|LOCUS_06070 673340 672252 gene locus_tag LOCUS_06080 673340 672252 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_06080 674031 673342 gene locus_tag LOCUS_06090 gene queC 674031 673342 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_06090 675717 674407 gene locus_tag LOCUS_06100 675717 674407 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_06100 677925 675796 gene locus_tag LOCUS_06110 677925 675796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 678272 679336 gene locus_tag LOCUS_06120 678272 679336 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_06120 679810 682404 gene locus_tag LOCUS_06130 679810 682404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 682951 685767 gene locus_tag LOCUS_06140 682951 685767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 686111 687403 gene locus_tag LOCUS_06150 686111 687403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 687887 689188 gene locus_tag LOCUS_06160 687887 689188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 689554 690087 gene locus_tag LOCUS_06170 689554 690087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_06170 692033 690261 gene locus_tag LOCUS_06180 692033 690261 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_06180 692002 692163 gene locus_tag LOCUS_06190 692002 692163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 692491 693942 gene locus_tag LOCUS_06200 692491 693942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 694025 695473 gene locus_tag LOCUS_06210 694025 695473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 695586 697025 gene locus_tag LOCUS_06220 695586 697025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 697562 698830 gene locus_tag LOCUS_06230 697562 698830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 699537 701198 gene locus_tag LOCUS_06240 699537 701198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 701866 704052 gene locus_tag LOCUS_06250 701866 704052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 704302 705486 gene locus_tag LOCUS_06260 704302 705486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 707412 707786 gene locus_tag LOCUS_06270 707412 707786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 708077 709306 gene locus_tag LOCUS_06280 708077 709306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 709523 710827 gene locus_tag LOCUS_06290 709523 710827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 711507 711695 gene locus_tag LOCUS_06300 711507 711695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 711989 713053 gene locus_tag LOCUS_06310 711989 713053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 714978 713356 gene locus_tag LOCUS_06320 714978 713356 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_06320 715992 714991 gene locus_tag LOCUS_06330 715992 714991 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_06330 718722 716017 gene locus_tag LOCUS_06340 gene alaS 718722 716017 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_06340 720843 721082 gene locus_tag LOCUS_06350 720843 721082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 721304 722074 gene locus_tag LOCUS_06360 721304 722074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 722715 724208 gene locus_tag LOCUS_06370 722715 724208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 724280 725716 gene locus_tag LOCUS_06380 724280 725716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 726156 727277 gene locus_tag LOCUS_06390 726156 727277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 727330 728142 gene locus_tag LOCUS_06400 727330 728142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 728127 729773 gene locus_tag LOCUS_06410 728127 729773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 730000 731427 gene locus_tag LOCUS_06420 730000 731427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 731857 731696 gene locus_tag LOCUS_06430 731857 731696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 732663 731890 gene locus_tag LOCUS_06440 732663 731890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 733475 733768 gene locus_tag LOCUS_06450 gene rpsR 733475 733768 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963955.1 protein_id gnl|my_center|LOCUS_06450 733875 734870 gene locus_tag LOCUS_06460 733875 734870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 736665 734923 gene locus_tag LOCUS_06470 736665 734923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 737108 736692 gene locus_tag LOCUS_06480 737108 736692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 737462 737118 gene locus_tag LOCUS_06490 737462 737118 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_06490 737629 738798 gene locus_tag LOCUS_06500 gene anmK 737629 738798 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_06500 738799 739527 gene locus_tag LOCUS_06510 gene fabG 738799 739527 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144338.1 protein_id gnl|my_center|LOCUS_06510 739567 740610 gene locus_tag LOCUS_06520 739567 740610 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_06520 740636 742000 gene locus_tag LOCUS_06530 740636 742000 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989613.1 protein_id gnl|my_center|LOCUS_06530 742188 742751 gene locus_tag LOCUS_06540 742188 742751 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_06540 742819 742903 gene locus_tag LOCUS_t00180 742819 742903 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 743168 743710 gene locus_tag LOCUS_06550 743168 743710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 743766 744233 gene locus_tag LOCUS_06560 743766 744233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 744297 744788 gene locus_tag LOCUS_06570 gene rplI 744297 744788 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_06570 748181 744873 gene locus_tag LOCUS_06580 748181 744873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 749049 748372 gene locus_tag LOCUS_06590 gene pdxH 749049 748372 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_06590 751793 749445 gene locus_tag LOCUS_06600 751793 749445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 753617 751812 gene locus_tag LOCUS_06610 753617 751812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 753903 753619 gene locus_tag LOCUS_06620 753903 753619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 754699 753956 gene locus_tag LOCUS_06630 754699 753956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 755714 754707 gene locus_tag LOCUS_06640 gene porV 755714 754707 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_06640 758582 755772 gene locus_tag LOCUS_06650 758582 755772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 760005 758647 gene locus_tag LOCUS_06660 760005 758647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 762435 760144 gene locus_tag LOCUS_06670 762435 760144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 764597 762477 gene locus_tag LOCUS_06680 764597 762477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 766167 764731 gene locus_tag LOCUS_06690 766167 764731 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_06690 766632 766213 gene locus_tag LOCUS_06700 766632 766213 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_06700 767378 766629 gene locus_tag LOCUS_06710 767378 766629 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519040.1 protein_id gnl|my_center|LOCUS_06710 768029 767448 gene locus_tag LOCUS_06720 768029 767448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 768731 768075 gene locus_tag LOCUS_06730 768731 768075 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_06730 769827 768817 gene locus_tag LOCUS_06740 769827 768817 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_06740 770621 769932 gene locus_tag LOCUS_06750 770621 769932 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_06750 770766 770839 gene locus_tag LOCUS_t00190 770766 770839 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 771720 770908 gene locus_tag LOCUS_06760 771720 770908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 772388 772771 gene locus_tag LOCUS_06770 gene gcvH 772388 772771 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_06770 772830 773342 gene locus_tag LOCUS_06780 772830 773342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 773360 773542 gene locus_tag LOCUS_06790 gene rpmF 773360 773542 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290970.1 protein_id gnl|my_center|LOCUS_06790 773626 774633 gene locus_tag LOCUS_06800 gene plsX 773626 774633 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_06800 774819 775025 gene locus_tag LOCUS_06810 774819 775025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 775061 775273 gene locus_tag LOCUS_06820 gene rpmB 775061 775273 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_06820 775266 776015 gene locus_tag LOCUS_06830 775266 776015 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_06830 776088 777233 gene locus_tag LOCUS_06840 gene tgt 776088 777233 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933064.1 protein_id gnl|my_center|LOCUS_06840 777266 777613 gene locus_tag LOCUS_06850 777266 777613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 777653 778930 gene locus_tag LOCUS_06860 777653 778930 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_06860 778938 779423 gene locus_tag LOCUS_06870 gene greA 778938 779423 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933113.1 protein_id gnl|my_center|LOCUS_06870 779428 780339 gene locus_tag LOCUS_06880 779428 780339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 781331 780417 gene locus_tag LOCUS_06890 gene porQ 781331 780417 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_06890 781804 781535 gene locus_tag LOCUS_06900 781804 781535 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_06900 782726 781791 gene locus_tag LOCUS_06910 782726 781791 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_06910 783621 782731 gene locus_tag LOCUS_06920 783621 782731 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_06920 784121 783618 gene locus_tag LOCUS_06930 784121 783618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 784492 784674 gene locus_tag LOCUS_06940 784492 784674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 784705 784908 gene locus_tag LOCUS_06950 784705 784908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 786931 785267 gene locus_tag LOCUS_06960 786931 785267 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_06960 787677 787069 gene locus_tag LOCUS_06970 787677 787069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 788759 788175 gene locus_tag LOCUS_06980 788759 788175 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896008.1 protein_id gnl|my_center|LOCUS_06980 789542 788856 gene locus_tag LOCUS_06990 789542 788856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 792005 789759 gene locus_tag LOCUS_07000 792005 789759 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_07000 792794 792069 gene locus_tag LOCUS_07010 792794 792069 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_07010 793463 792984 gene locus_tag LOCUS_07020 793463 792984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 795079 793460 gene locus_tag LOCUS_07030 795079 793460 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07030 795510 795187 gene locus_tag LOCUS_07040 795510 795187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 795725 795507 gene locus_tag LOCUS_07050 795725 795507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 796041 796205 gene locus_tag LOCUS_07060 796041 796205 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_07060 796233 796451 gene locus_tag LOCUS_07070 796233 796451 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_07070 796638 796931 gene locus_tag LOCUS_07080 796638 796931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 797772 797047 gene locus_tag LOCUS_07090 797772 797047 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801900.1 protein_id gnl|my_center|LOCUS_07090 799440 797887 gene locus_tag LOCUS_07100 799440 797887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 799603 799905 gene locus_tag LOCUS_07110 799603 799905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 800167 802314 gene locus_tag LOCUS_07120 800167 802314 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404269.1 protein_id gnl|my_center|LOCUS_07120 802347 803267 gene locus_tag LOCUS_07130 gene xerD 802347 803267 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932289.1 protein_id gnl|my_center|LOCUS_07130 803354 804292 gene locus_tag LOCUS_07140 803354 804292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 804297 805250 gene locus_tag LOCUS_07150 gene sppA 804297 805250 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_07150 805269 805556 gene locus_tag LOCUS_07160 805269 805556 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_07160 807188 805734 gene locus_tag LOCUS_07170 gene gltX 807188 805734 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_07170 807922 807197 gene locus_tag LOCUS_07180 gene rsmI 807922 807197 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_07180 808015 808764 gene locus_tag LOCUS_07190 gene rlmB 808015 808764 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_07190 810117 808765 gene locus_tag LOCUS_07200 810117 808765 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_07200 811647 810187 gene locus_tag LOCUS_07210 gene crtI 811647 810187 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_07210 814007 811644 gene locus_tag LOCUS_07220 814007 811644 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_07220 814556 814035 gene locus_tag LOCUS_07230 814556 814035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 815069 814623 gene locus_tag LOCUS_07240 815069 814623 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 protein_id gnl|my_center|LOCUS_07240 815723 815088 gene locus_tag LOCUS_07250 815723 815088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 816651 816163 gene locus_tag LOCUS_07260 816651 816163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 817160 816675 gene locus_tag LOCUS_07270 817160 816675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 817352 818857 gene locus_tag LOCUS_07280 817352 818857 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_07280 819519 818959 gene locus_tag LOCUS_07290 819519 818959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 820309 819551 gene locus_tag LOCUS_07300 820309 819551 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_07300 820707 821294 gene locus_tag LOCUS_07310 820707 821294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 821291 821659 gene locus_tag LOCUS_07320 821291 821659 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_07320 822508 821660 gene locus_tag LOCUS_07330 822508 821660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 824581 822734 gene locus_tag LOCUS_07340 824581 822734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 826662 824638 gene locus_tag LOCUS_07350 826662 824638 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838619.1 protein_id gnl|my_center|LOCUS_07350 828508 826736 gene locus_tag LOCUS_07360 828508 826736 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933778.1 protein_id gnl|my_center|LOCUS_07360 829316 828516 gene locus_tag LOCUS_07370 829316 828516 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_07370 830376 829366 gene locus_tag LOCUS_07380 gene dusB 830376 829366 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_07380 830823 832178 gene locus_tag LOCUS_07390 830823 832178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 832398 833291 gene locus_tag LOCUS_07400 832398 833291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 833633 835819 gene locus_tag LOCUS_07410 833633 835819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 836518 836057 gene locus_tag LOCUS_07420 836518 836057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 837215 836913 gene locus_tag LOCUS_07430 837215 836913 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259549.1 protein_id gnl|my_center|LOCUS_07430 837572 837396 gene locus_tag LOCUS_07440 837572 837396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 839847 838207 gene locus_tag LOCUS_07450 gene groL 839847 838207 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_07450 840192 839908 gene locus_tag LOCUS_07460 gene groES 840192 839908 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_07460 840587 840952 gene locus_tag LOCUS_07470 840587 840952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 842622 841405 gene locus_tag LOCUS_07480 842622 841405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 843419 843222 gene locus_tag LOCUS_07490 843419 843222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 843719 845797 gene locus_tag LOCUS_07500 843719 845797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 846575 848761 gene locus_tag LOCUS_07510 846575 848761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 849723 848893 gene locus_tag LOCUS_07520 849723 848893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 851234 849885 gene locus_tag LOCUS_07530 851234 849885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 851816 854260 gene locus_tag LOCUS_07540 851816 854260 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_07540 854257 854430 gene locus_tag LOCUS_07550 854257 854430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 854443 855645 gene locus_tag LOCUS_07560 854443 855645 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_07560 855665 857782 gene locus_tag LOCUS_07570 gene ccoN 855665 857782 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_07570 857801 857962 gene locus_tag LOCUS_07580 857801 857962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 858062 858952 gene locus_tag LOCUS_07590 858062 858952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 858959 860356 gene locus_tag LOCUS_07600 gene ccoG 858959 860356 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_07600 860369 860812 gene locus_tag LOCUS_07610 860369 860812 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_07610 860812 861519 gene locus_tag LOCUS_07620 860812 861519 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_07620 861852 862595 gene locus_tag LOCUS_07630 861852 862595 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_07630 862618 863022 gene locus_tag LOCUS_07640 862618 863022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 863231 863055 gene locus_tag LOCUS_07650 863231 863055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 864031 863228 gene locus_tag LOCUS_07660 864031 863228 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 865468 864044 gene locus_tag LOCUS_07670 gene pyk 865468 864044 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_07670 865613 866386 gene locus_tag LOCUS_07680 865613 866386 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_07680 866971 866456 gene locus_tag LOCUS_07690 866971 866456 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_07690 868184 867009 gene locus_tag LOCUS_07700 868184 867009 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_07700 870123 868615 gene locus_tag LOCUS_07710 870123 868615 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_07710 871137 870142 gene locus_tag LOCUS_07720 871137 870142 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_07720 871523 873046 gene locus_tag LOCUS_07730 871523 873046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_07730 873043 874086 gene locus_tag LOCUS_07740 873043 874086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932871.1 protein_id gnl|my_center|LOCUS_07740 874087 874989 gene locus_tag LOCUS_07750 874087 874989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933345.1 protein_id gnl|my_center|LOCUS_07750 876481 875609 gene locus_tag LOCUS_07760 876481 875609 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_07760 876826 876488 gene locus_tag LOCUS_07770 876826 876488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 878596 877367 gene locus_tag LOCUS_07780 878596 877367 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545658.1 protein_id gnl|my_center|LOCUS_07780 880443 878632 gene locus_tag LOCUS_07790 880443 878632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_07790 881206 880448 gene locus_tag LOCUS_07800 881206 880448 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_07800 882026 881199 gene locus_tag LOCUS_07810 882026 881199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 882279 882653 gene locus_tag LOCUS_07820 882279 882653 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_07820 882806 884071 gene locus_tag LOCUS_07830 882806 884071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 884127 884558 gene locus_tag LOCUS_07840 884127 884558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 886501 884585 gene locus_tag LOCUS_07850 886501 884585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 888907 887252 gene locus_tag LOCUS_07860 888907 887252 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_07860 890289 889006 gene locus_tag LOCUS_07870 gene clpX 890289 889006 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_07870 890453 890371 gene locus_tag LOCUS_t00200 890453 890371 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 890836 893127 gene locus_tag LOCUS_07880 890836 893127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 893901 893987 gene locus_tag LOCUS_t00210 893901 893987 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 894058 895896 gene locus_tag LOCUS_07890 gene glmS 894058 895896 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_07890 896107 897525 gene locus_tag LOCUS_07900 gene atpD 896107 897525 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_07900 897545 897946 gene locus_tag LOCUS_07910 897545 897946 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_07910 898038 898220 gene locus_tag LOCUS_07920 898038 898220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 898391 899626 gene locus_tag LOCUS_07930 898391 899626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 899807 904438 gene locus_tag LOCUS_07940 899807 904438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 904768 905253 gene locus_tag LOCUS_07950 904768 905253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 905804 907510 gene locus_tag LOCUS_07960 905804 907510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 907846 909993 gene locus_tag LOCUS_07970 907846 909993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 911037 910066 gene locus_tag LOCUS_07980 911037 910066 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_07980 914677 911087 gene locus_tag LOCUS_07990 gene nifJ 914677 911087 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_07990 914904 916760 gene locus_tag LOCUS_08000 914904 916760 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931857.1 protein_id gnl|my_center|LOCUS_08000 916765 917802 gene locus_tag LOCUS_08010 916765 917802 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931856.1 protein_id gnl|my_center|LOCUS_08010 918575 918243 gene locus_tag LOCUS_08020 918575 918243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 920006 918579 gene locus_tag LOCUS_08030 920006 918579 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_08030 921527 920025 gene locus_tag LOCUS_08040 921527 920025 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_08040 923466 921544 gene locus_tag LOCUS_08050 gene nuoL 923466 921544 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_08050 923807 923490 gene locus_tag LOCUS_08060 gene nuoK 923807 923490 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_08060 924323 923817 gene locus_tag LOCUS_08070 924323 923817 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_08070 924816 924328 gene locus_tag LOCUS_08080 924816 924328 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_08080 925924 924836 gene locus_tag LOCUS_08090 gene nuoH 925924 924836 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_08090 927090 925939 gene locus_tag LOCUS_08100 927090 925939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08100 927556 927095 gene locus_tag LOCUS_08110 927556 927095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08110 928163 927609 gene locus_tag LOCUS_08120 928163 927609 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_08120 928504 928154 gene locus_tag LOCUS_08130 928504 928154 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_08130 929699 929280 gene locus_tag LOCUS_08140 929699 929280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 930541 929789 gene locus_tag LOCUS_08150 930541 929789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 931301 930687 gene locus_tag LOCUS_08160 931301 930687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 931770 931366 gene locus_tag LOCUS_08170 931770 931366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 932323 932535 gene locus_tag LOCUS_08180 932323 932535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 932539 933438 gene locus_tag LOCUS_08190 932539 933438 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_08190 933448 934509 gene locus_tag LOCUS_08200 933448 934509 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_08200 934711 935634 gene locus_tag LOCUS_08210 934711 935634 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_08210 935624 937042 gene locus_tag LOCUS_08220 935624 937042 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932225.1 protein_id gnl|my_center|LOCUS_08220 937061 938062 gene locus_tag LOCUS_08230 937061 938062 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_08230 938132 939001 gene locus_tag LOCUS_08240 938132 939001 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933259.1 protein_id gnl|my_center|LOCUS_08240 938998 940452 gene locus_tag LOCUS_08250 938998 940452 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_08250 940864 940469 gene locus_tag LOCUS_08260 940864 940469 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_08260 942393 940972 gene locus_tag LOCUS_08270 942393 940972 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_08270 943564 942977 gene locus_tag LOCUS_08280 943564 942977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 945069 943579 gene locus_tag LOCUS_08290 945069 943579 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259175.1 protein_id gnl|my_center|LOCUS_08290 945641 945159 gene locus_tag LOCUS_08300 945641 945159 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_08300 947481 945808 gene locus_tag LOCUS_08310 gene asnB 947481 945808 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_08310 949670 947667 gene locus_tag LOCUS_08320 949670 947667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 950515 949718 gene locus_tag LOCUS_08330 950515 949718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 950969 950604 gene locus_tag LOCUS_08340 950969 950604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 951722 951108 gene locus_tag LOCUS_08350 gene coaE 951722 951108 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_08350 953399 951744 gene locus_tag LOCUS_08360 gene rny 953399 951744 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_08360 954083 953784 gene locus_tag LOCUS_08370 954083 953784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 954560 954177 gene locus_tag LOCUS_08380 954560 954177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 957002 954591 gene locus_tag LOCUS_08390 gene pheT 957002 954591 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_08390 957469 957116 gene locus_tag LOCUS_08400 957469 957116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08400 958078 957470 gene locus_tag LOCUS_08410 958078 957470 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_08410 958850 958254 gene locus_tag LOCUS_08420 958850 958254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 959570 961510 gene locus_tag LOCUS_08430 959570 961510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 961600 962172 gene locus_tag LOCUS_08440 961600 962172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 964517 962325 gene locus_tag LOCUS_08450 964517 962325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 965391 964921 gene locus_tag LOCUS_08460 965391 964921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 965509 966606 gene locus_tag LOCUS_08470 gene mnmA 965509 966606 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_08470 966634 967611 gene locus_tag LOCUS_08480 gene pta 966634 967611 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965049.1 protein_id gnl|my_center|LOCUS_08480 967626 967985 gene locus_tag LOCUS_08490 967626 967985 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_08490 968908 968174 gene locus_tag LOCUS_08500 968908 968174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_08500 969044 970123 gene locus_tag LOCUS_08510 969044 970123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 970367 971863 gene locus_tag LOCUS_08520 970367 971863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 971960 973327 gene locus_tag LOCUS_08530 971960 973327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 973602 974927 gene locus_tag LOCUS_08540 973602 974927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 975060 976382 gene locus_tag LOCUS_08550 975060 976382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 976987 977874 gene locus_tag LOCUS_08560 gene hpnC 976987 977874 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_08560 977871 978779 gene locus_tag LOCUS_08570 977871 978779 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_08570 978776 980116 gene locus_tag LOCUS_08580 gene hpnE 978776 980116 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_08580 980168 981955 gene locus_tag LOCUS_08590 980168 981955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_08590 982073 985711 gene locus_tag LOCUS_08600 982073 985711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 986211 985786 gene locus_tag LOCUS_08610 986211 985786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 989306 986220 gene locus_tag LOCUS_08620 gene secA 989306 986220 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_08620 990924 989800 gene locus_tag LOCUS_08630 990924 989800 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287273.1 protein_id gnl|my_center|LOCUS_08630 992404 991895 gene locus_tag LOCUS_08640 992404 991895 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723566.1 protein_id gnl|my_center|LOCUS_08640 993123 992533 gene locus_tag LOCUS_08650 993123 992533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 993366 996278 gene locus_tag LOCUS_08660 993366 996278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 996286 997629 gene locus_tag LOCUS_08670 gene gnfM 996286 997629 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_08670 998074 998307 gene locus_tag LOCUS_08680 998074 998307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 998342 998554 gene locus_tag LOCUS_08690 998342 998554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 998915 999247 gene locus_tag LOCUS_08700 998915 999247 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_08700 1000119 999310 gene locus_tag LOCUS_08710 1000119 999310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1000830 1000129 gene locus_tag LOCUS_08720 1000830 1000129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1004045 1000872 gene locus_tag LOCUS_08730 gene ileS 1004045 1000872 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932003.1 protein_id gnl|my_center|LOCUS_08730 1005031 1004540 gene locus_tag LOCUS_08740 1005031 1004540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1005870 1005031 gene locus_tag LOCUS_08750 1005870 1005031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1006480 1005878 gene locus_tag LOCUS_08760 1006480 1005878 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_08760 1007061 1006606 gene locus_tag LOCUS_08770 1007061 1006606 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 protein_id gnl|my_center|LOCUS_08770 1007264 1008034 gene locus_tag LOCUS_08780 1007264 1008034 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403590.1 protein_id gnl|my_center|LOCUS_08780 1008040 1008684 gene locus_tag LOCUS_08790 1008040 1008684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1008697 1009584 gene locus_tag LOCUS_08800 1008697 1009584 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932643.1 protein_id gnl|my_center|LOCUS_08800 1009959 1010804 gene locus_tag LOCUS_08810 1009959 1010804 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929455.1 protein_id gnl|my_center|LOCUS_08810 1010857 1013523 gene locus_tag LOCUS_08820 gene cphA 1010857 1013523 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144309.1 protein_id gnl|my_center|LOCUS_08820 1013804 1014244 gene locus_tag LOCUS_08830 1013804 1014244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1015802 1014348 gene locus_tag LOCUS_08840 1015802 1014348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1016064 1016276 gene locus_tag LOCUS_08850 1016064 1016276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1016913 1017263 gene locus_tag LOCUS_08860 1016913 1017263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1017700 1017266 gene locus_tag LOCUS_08870 1017700 1017266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1019517 1018441 gene locus_tag LOCUS_08880 1019517 1018441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1020916 1019633 gene locus_tag LOCUS_08890 gene aceA 1020916 1019633 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_08890 1022515 1020935 gene locus_tag LOCUS_08900 gene aceB 1022515 1020935 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_08900 1022686 1023570 gene locus_tag LOCUS_08910 1022686 1023570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1024261 1023704 gene locus_tag LOCUS_08920 1024261 1023704 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_08920 1026752 1024296 gene locus_tag LOCUS_08930 1026752 1024296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1027324 1029489 gene locus_tag LOCUS_08940 1027324 1029489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1029847 1032639 gene locus_tag LOCUS_08950 1029847 1032639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1032819 1034888 gene locus_tag LOCUS_08960 1032819 1034888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1035791 1035246 gene locus_tag LOCUS_08970 1035791 1035246 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_08970 1037399 1036119 gene locus_tag LOCUS_08980 1037399 1036119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1039599 1037800 gene locus_tag LOCUS_08990 1039599 1037800 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317502.1 protein_id gnl|my_center|LOCUS_08990 1040418 1039768 gene locus_tag LOCUS_09000 1040418 1039768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1040938 1040426 gene locus_tag LOCUS_09010 1040938 1040426 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_09010 1043320 1041233 gene locus_tag LOCUS_09020 1043320 1041233 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256502.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09020 1044095 1043481 gene locus_tag LOCUS_09030 1044095 1043481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1044697 1044509 gene locus_tag LOCUS_09040 1044697 1044509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1045270 1044926 gene locus_tag LOCUS_09050 1045270 1044926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1045817 1045350 gene locus_tag LOCUS_09060 1045817 1045350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 1046544 1045951 gene locus_tag LOCUS_09070 1046544 1045951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09070 1046948 1046541 gene locus_tag LOCUS_09080 1046948 1046541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09080 1047493 1047074 gene locus_tag LOCUS_09090 1047493 1047074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09090 1048358 1047789 gene locus_tag LOCUS_09100 1048358 1047789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1048611 1048405 gene locus_tag LOCUS_09110 1048611 1048405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1049972 1049094 gene locus_tag LOCUS_09120 1049972 1049094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1050797 1049991 gene locus_tag LOCUS_09130 1050797 1049991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_09130 1051247 1051017 gene locus_tag LOCUS_09140 1051247 1051017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1052052 1051435 gene locus_tag LOCUS_09150 1052052 1051435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09150 1052410 1052054 gene locus_tag LOCUS_09160 1052410 1052054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09160 1052699 1052373 gene locus_tag LOCUS_09170 1052699 1052373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09170 >Feature sequence02 <1 923 gene locus_tag LOCUS_09180 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531683.1:phage/plasmid primase, P4 family 1114 1365 gene locus_tag LOCUS_09190 1114 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1392 2369 gene locus_tag LOCUS_09200 1392 2369 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_09200 2439 2999 gene locus_tag LOCUS_09210 2439 2999 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816478.1 protein_id gnl|my_center|LOCUS_09210 4516 3527 gene locus_tag LOCUS_09220 4516 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 5748 4519 gene locus_tag LOCUS_09230 5748 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09230 5880 6263 gene locus_tag LOCUS_09240 5880 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6443 6694 gene locus_tag LOCUS_09250 6443 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6811 7587 gene locus_tag LOCUS_09260 6811 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7575 8231 gene locus_tag LOCUS_09270 7575 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 8240 8464 gene locus_tag LOCUS_09280 8240 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 8638 8910 gene locus_tag LOCUS_09290 8638 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 9064 9684 gene locus_tag LOCUS_09300 9064 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 9761 10330 gene locus_tag LOCUS_09310 9761 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10423 11391 gene locus_tag LOCUS_09320 10423 11391 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_09320 11550 11888 gene locus_tag LOCUS_09330 11550 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 11957 13255 gene locus_tag LOCUS_09340 11957 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 13867 15978 gene locus_tag LOCUS_09350 13867 15978 CDS product PHD finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922228.1 protein_id gnl|my_center|LOCUS_09350 16421 17062 gene locus_tag LOCUS_09360 16421 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 17425 17955 gene locus_tag LOCUS_09370 17425 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 19015 18257 gene locus_tag LOCUS_09380 19015 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09380 19347 19096 gene locus_tag LOCUS_09390 19347 19096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 19717 19412 gene locus_tag LOCUS_09400 19717 19412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 20409 19918 gene locus_tag LOCUS_09410 20409 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 22933 20651 gene locus_tag LOCUS_09420 22933 20651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 23624 23199 gene locus_tag LOCUS_09430 23624 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 23921 23748 gene locus_tag LOCUS_09440 23921 23748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 25633 24107 gene locus_tag LOCUS_09450 25633 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 26214 25741 gene locus_tag LOCUS_09460 26214 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 27187 26291 gene locus_tag LOCUS_09470 27187 26291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 28350 27193 gene locus_tag LOCUS_09480 28350 27193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 28818 29081 gene locus_tag LOCUS_09490 28818 29081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 29078 29599 gene locus_tag LOCUS_09500 29078 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 29670 30953 gene locus_tag LOCUS_09510 29670 30953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 31165 30992 gene locus_tag LOCUS_09520 31165 30992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 32306 31515 gene locus_tag LOCUS_09530 32306 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 32919 32308 gene locus_tag LOCUS_09540 32919 32308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 34377 34697 gene locus_tag LOCUS_09550 34377 34697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 34675 35025 gene locus_tag LOCUS_09560 34675 35025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 35309 35740 gene locus_tag LOCUS_09570 35309 35740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 35895 35822 gene locus_tag LOCUS_t00220 35895 35822 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 36671 36159 gene locus_tag LOCUS_09580 36671 36159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 38070 36583 gene locus_tag LOCUS_09590 38070 36583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 39113 40273 gene locus_tag LOCUS_09600 gene purT 39113 40273 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932738.1 protein_id gnl|my_center|LOCUS_09600 40834 41994 gene locus_tag LOCUS_09610 40834 41994 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104944.1 protein_id gnl|my_center|LOCUS_09610 42186 43691 gene locus_tag LOCUS_09620 42186 43691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 43784 44485 gene locus_tag LOCUS_09630 gene thyX 43784 44485 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 protein_id gnl|my_center|LOCUS_09630 44542 45777 gene locus_tag LOCUS_09640 44542 45777 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086689.1 protein_id gnl|my_center|LOCUS_09640 46751 45816 gene locus_tag LOCUS_09650 46751 45816 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_09650 47174 46788 gene locus_tag LOCUS_09660 47174 46788 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_09660 47895 47461 gene locus_tag LOCUS_09670 47895 47461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 48826 47888 gene locus_tag LOCUS_09680 48826 47888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 51605 49017 gene locus_tag LOCUS_09690 gene leuS 51605 49017 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199945.1 protein_id gnl|my_center|LOCUS_09690 52202 51747 gene locus_tag LOCUS_09700 52202 51747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 52837 54891 gene locus_tag LOCUS_09710 52837 54891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 55754 57010 gene locus_tag LOCUS_09720 55754 57010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 58899 57217 gene locus_tag LOCUS_09730 58899 57217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 59946 59122 gene locus_tag LOCUS_09740 59946 59122 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529999.1 protein_id gnl|my_center|LOCUS_09740 60406 60044 gene locus_tag LOCUS_09750 60406 60044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 64113 60457 gene locus_tag LOCUS_09760 64113 60457 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141852.1 protein_id gnl|my_center|LOCUS_09760 64624 64259 gene locus_tag LOCUS_09770 64624 64259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 67505 64902 gene locus_tag LOCUS_09780 gene cphA 67505 64902 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_09780 69908 67707 gene locus_tag LOCUS_09790 69908 67707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 70734 69901 gene locus_tag LOCUS_09800 70734 69901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 71677 71850 gene locus_tag LOCUS_09810 71677 71850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 71953 72549 gene locus_tag LOCUS_09820 71953 72549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 72672 73337 gene locus_tag LOCUS_09830 72672 73337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615968.1 protein_id gnl|my_center|LOCUS_09830 73485 74150 gene locus_tag LOCUS_09840 gene gntA 73485 74150 CDS product guanitoxin biosynthesis heme-dependent pre-guanitoxin N-hydroxylase GntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_09840 74153 74737 gene locus_tag LOCUS_09850 74153 74737 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_09850 76023 75580 gene locus_tag LOCUS_09860 76023 75580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 77292 76300 gene locus_tag LOCUS_09870 77292 76300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 77965 77327 gene locus_tag LOCUS_09880 77965 77327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 80090 78051 gene locus_tag LOCUS_09890 80090 78051 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401304.1 protein_id gnl|my_center|LOCUS_09890 80659 80850 gene locus_tag LOCUS_09900 80659 80850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 82443 80992 gene locus_tag LOCUS_09910 82443 80992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 83494 82850 gene locus_tag LOCUS_09920 83494 82850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 83565 84149 gene locus_tag LOCUS_09930 83565 84149 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_09930 84151 84987 gene locus_tag LOCUS_09940 gene kdsA 84151 84987 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785350.1 protein_id gnl|my_center|LOCUS_09940 84980 85285 gene locus_tag LOCUS_09950 84980 85285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 85282 85536 gene locus_tag LOCUS_09960 85282 85536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 85833 86147 gene locus_tag LOCUS_09970 85833 86147 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_09970 86470 88767 gene locus_tag LOCUS_09980 86470 88767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 88804 90108 gene locus_tag LOCUS_09990 gene pfp 88804 90108 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_09990 90140 91171 gene locus_tag LOCUS_10000 90140 91171 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_10000 91216 92640 gene locus_tag LOCUS_10010 91216 92640 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_10010 94210 92966 gene locus_tag LOCUS_10020 94210 92966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 94644 94234 gene locus_tag LOCUS_10030 94644 94234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 95181 94651 gene locus_tag LOCUS_10040 95181 94651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 95501 95181 gene locus_tag LOCUS_10050 95501 95181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 96141 95566 gene locus_tag LOCUS_10060 96141 95566 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_10060 96309 98021 gene locus_tag LOCUS_10070 96309 98021 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_10070 98098 98724 gene locus_tag LOCUS_10080 98098 98724 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_10080 99040 99513 gene locus_tag LOCUS_10090 99040 99513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 99755 100402 gene locus_tag LOCUS_10100 gene fsa 99755 100402 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_10100 100822 101052 gene locus_tag LOCUS_10110 100822 101052 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096582717.1 protein_id gnl|my_center|LOCUS_10110 101064 102140 gene locus_tag LOCUS_10120 gene gcvT 101064 102140 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_10120 102196 103032 gene locus_tag LOCUS_10130 102196 103032 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_10130 103052 105625 gene locus_tag LOCUS_10140 103052 105625 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_10140 105692 106255 gene locus_tag LOCUS_10150 105692 106255 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543140.1 protein_id gnl|my_center|LOCUS_10150 107398 106298 gene locus_tag LOCUS_10160 107398 106298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475594.1 protein_id gnl|my_center|LOCUS_10160 108185 107424 gene locus_tag LOCUS_10170 108185 107424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_10170 109836 108307 gene locus_tag LOCUS_10180 109836 108307 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_10180 110284 112389 gene locus_tag LOCUS_10190 110284 112389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 112406 114493 gene locus_tag LOCUS_10200 112406 114493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 114625 116427 gene locus_tag LOCUS_10210 114625 116427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 117247 116537 gene locus_tag LOCUS_10220 117247 116537 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552948.1 protein_id gnl|my_center|LOCUS_10220 118053 117268 gene locus_tag LOCUS_10230 118053 117268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 119821 118064 gene locus_tag LOCUS_10240 gene sdhA 119821 118064 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_10240 121480 119903 gene locus_tag LOCUS_10250 121480 119903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 122421 121609 gene locus_tag LOCUS_10260 122421 121609 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330822.1 protein_id gnl|my_center|LOCUS_10260 123308 122502 gene locus_tag LOCUS_10270 123308 122502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 124654 123305 gene locus_tag LOCUS_10280 124654 123305 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_10280 125373 124654 gene locus_tag LOCUS_10290 125373 124654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_10290 125735 125436 gene locus_tag LOCUS_10300 125735 125436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723515.1 protein_id gnl|my_center|LOCUS_10300 130862 126060 gene locus_tag LOCUS_10310 130862 126060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 131419 132219 gene locus_tag LOCUS_10320 131419 132219 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_10320 132281 132904 gene locus_tag LOCUS_10330 132281 132904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 132954 133721 gene locus_tag LOCUS_10340 132954 133721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 133993 133790 gene locus_tag LOCUS_10350 133993 133790 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_10350 135836 134385 gene locus_tag LOCUS_10360 135836 134385 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_10360 136411 135956 gene locus_tag LOCUS_10370 136411 135956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021829.1 protein_id gnl|my_center|LOCUS_10370 137980 136421 gene locus_tag LOCUS_10380 137980 136421 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_10380 138379 138023 gene locus_tag LOCUS_10390 138379 138023 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_10390 138987 138406 gene locus_tag LOCUS_10400 138987 138406 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_10400 139514 139005 gene locus_tag LOCUS_10410 139514 139005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 140094 139603 gene locus_tag LOCUS_10420 140094 139603 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_10420 140370 140104 gene locus_tag LOCUS_10430 140370 140104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 140539 141423 gene locus_tag LOCUS_10440 140539 141423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 141617 143038 gene locus_tag LOCUS_10450 141617 143038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 145654 143183 gene locus_tag LOCUS_10460 145654 143183 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_10460 146988 145651 gene locus_tag LOCUS_10470 146988 145651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 149133 147016 gene locus_tag LOCUS_10480 149133 147016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_10480 150392 149250 gene locus_tag LOCUS_10490 150392 149250 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_10490 152327 150537 gene locus_tag LOCUS_10500 152327 150537 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_10500 152604 154307 gene locus_tag LOCUS_10510 152604 154307 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404191.1 protein_id gnl|my_center|LOCUS_10510 155390 154317 gene locus_tag LOCUS_10520 155390 154317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 157456 155516 gene locus_tag LOCUS_10530 gene dnaK 157456 155516 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_10530 158000 157563 gene locus_tag LOCUS_10540 158000 157563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 158681 158244 gene locus_tag LOCUS_10550 158681 158244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 159424 158771 gene locus_tag LOCUS_10560 159424 158771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 160159 159467 gene locus_tag LOCUS_10570 160159 159467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 161107 160172 gene locus_tag LOCUS_10580 161107 160172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 161318 162832 gene locus_tag LOCUS_10590 161318 162832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 162890 164524 gene locus_tag LOCUS_10600 gene ade 162890 164524 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_10600 164543 165379 gene locus_tag LOCUS_10610 164543 165379 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_10610 165502 167355 gene locus_tag LOCUS_10620 165502 167355 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_10620 168085 169377 gene locus_tag LOCUS_10630 168085 169377 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_10630 169411 169938 gene locus_tag LOCUS_10640 169411 169938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 170274 170582 gene locus_tag LOCUS_10650 170274 170582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 170606 171385 gene locus_tag LOCUS_10660 170606 171385 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073994.1 protein_id gnl|my_center|LOCUS_10660 171421 172233 gene locus_tag LOCUS_10670 171421 172233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 174571 172241 gene locus_tag LOCUS_10680 174571 172241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 175598 174693 gene locus_tag LOCUS_10690 175598 174693 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_10690 177062 175662 gene locus_tag LOCUS_10700 177062 175662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 177301 178716 gene locus_tag LOCUS_10710 177301 178716 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_10710 179743 178766 gene locus_tag LOCUS_10720 gene pdxA 179743 178766 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838548.1 protein_id gnl|my_center|LOCUS_10720 180094 179747 gene locus_tag LOCUS_10730 gene rsfS 180094 179747 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926804.1 protein_id gnl|my_center|LOCUS_10730 180571 180101 gene locus_tag LOCUS_10740 180571 180101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 181163 180651 gene locus_tag LOCUS_10750 181163 180651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 181851 181312 gene locus_tag LOCUS_10760 181851 181312 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_10760 182058 183953 gene locus_tag LOCUS_10770 182058 183953 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480299.1 protein_id gnl|my_center|LOCUS_10770 184134 185573 gene locus_tag LOCUS_10780 gene rsmB 184134 185573 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_10780 186558 185578 gene locus_tag LOCUS_10790 186558 185578 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404164.1 protein_id gnl|my_center|LOCUS_10790 187516 186647 gene locus_tag LOCUS_10800 187516 186647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 187897 187601 gene locus_tag LOCUS_10810 187897 187601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 189308 188046 gene locus_tag LOCUS_10820 189308 188046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 190308 189337 gene locus_tag LOCUS_10830 190308 189337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 191342 190338 gene locus_tag LOCUS_10840 191342 190338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 192787 191456 gene locus_tag LOCUS_10850 192787 191456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 194346 192778 gene locus_tag LOCUS_10860 gene guaA 194346 192778 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_10860 195294 194356 gene locus_tag LOCUS_10870 195294 194356 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_10870 195675 195887 gene locus_tag LOCUS_10880 195675 195887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 195922 198321 gene locus_tag LOCUS_10890 195922 198321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 199004 198381 gene locus_tag LOCUS_10900 199004 198381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 200141 199077 gene locus_tag LOCUS_10910 gene recA 200141 199077 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_10910 200524 200267 gene locus_tag LOCUS_10920 200524 200267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 201881 200568 gene locus_tag LOCUS_10930 201881 200568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 203387 202467 gene locus_tag LOCUS_10940 203387 202467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 203499 204338 gene locus_tag LOCUS_10950 203499 204338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 204357 205313 gene locus_tag LOCUS_10960 204357 205313 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_10960 205310 206245 gene locus_tag LOCUS_10970 205310 206245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 206263 207156 gene locus_tag LOCUS_10980 gene rfbD 206263 207156 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_10980 207179 208453 gene locus_tag LOCUS_10990 gene serS 207179 208453 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932293.1 protein_id gnl|my_center|LOCUS_10990 208982 208464 gene locus_tag LOCUS_11000 208982 208464 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_11000 210360 209044 gene locus_tag LOCUS_11010 210360 209044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 212395 210833 gene locus_tag LOCUS_11020 212395 210833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 212502 213377 gene locus_tag LOCUS_11030 212502 213377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 215314 213584 gene locus_tag LOCUS_11040 215314 213584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 215871 215311 gene locus_tag LOCUS_11050 215871 215311 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_11050 216135 219659 gene locus_tag LOCUS_11060 216135 219659 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_11060 219831 222533 gene locus_tag LOCUS_11070 gene glgB 219831 222533 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_11070 222627 222941 gene locus_tag LOCUS_11080 222627 222941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 223066 224016 gene locus_tag LOCUS_11090 gene deoC 223066 224016 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_11090 224122 224934 gene locus_tag LOCUS_11100 224122 224934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 224941 225141 gene locus_tag LOCUS_11110 224941 225141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 227746 225188 gene locus_tag LOCUS_11120 227746 225188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 228659 227805 gene locus_tag LOCUS_11130 228659 227805 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_11130 229127 228678 gene locus_tag LOCUS_11140 229127 228678 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722083.1 protein_id gnl|my_center|LOCUS_11140 229721 229257 gene locus_tag LOCUS_11150 229721 229257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 230136 229783 gene locus_tag LOCUS_11160 230136 229783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 230414 230662 gene locus_tag LOCUS_11170 230414 230662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 230821 231153 gene locus_tag LOCUS_11180 230821 231153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 231492 233882 gene locus_tag LOCUS_11190 231492 233882 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_11190 234260 236404 gene locus_tag LOCUS_11200 gene pqqU 234260 236404 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_11200 236469 238067 gene locus_tag LOCUS_11210 236469 238067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 238192 240483 gene locus_tag LOCUS_11220 238192 240483 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_11220 240720 240535 gene locus_tag LOCUS_11230 240720 240535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 242586 240793 gene locus_tag LOCUS_11240 242586 240793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 243252 242623 gene locus_tag LOCUS_11250 243252 242623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 245425 243314 gene locus_tag LOCUS_11260 245425 243314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 246728 245481 gene locus_tag LOCUS_11270 246728 245481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_11270 247499 246732 gene locus_tag LOCUS_11280 247499 246732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_11280 249201 247519 gene locus_tag LOCUS_11290 249201 247519 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_11290 249391 249759 gene locus_tag LOCUS_11300 249391 249759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 251097 250021 gene locus_tag LOCUS_11310 gene nhaA 251097 250021 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_11310 251926 251324 gene locus_tag LOCUS_11320 251926 251324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 252628 251948 gene locus_tag LOCUS_11330 252628 251948 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_11330 254841 252775 gene locus_tag LOCUS_11340 254841 252775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 255688 255050 gene locus_tag LOCUS_11350 255688 255050 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_11350 259210 255851 gene locus_tag LOCUS_11360 gene mfd 259210 255851 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_11360 259479 259210 gene locus_tag LOCUS_11370 259479 259210 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933864.1 protein_id gnl|my_center|LOCUS_11370 260533 259541 gene locus_tag LOCUS_11380 260533 259541 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931948.1 protein_id gnl|my_center|LOCUS_11380 260635 262278 gene locus_tag LOCUS_11390 260635 262278 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_11390 263852 262290 gene locus_tag LOCUS_11400 263852 262290 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_11400 264335 263859 gene locus_tag LOCUS_11410 264335 263859 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_11410 264555 266576 gene locus_tag LOCUS_11420 264555 266576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 266619 267668 gene locus_tag LOCUS_11430 gene mltG 266619 267668 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_11430 267681 269228 gene locus_tag LOCUS_11440 267681 269228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 269238 269888 gene locus_tag LOCUS_11450 269238 269888 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_11450 272791 269912 gene locus_tag LOCUS_11460 272791 269912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 273161 274732 gene locus_tag LOCUS_11470 273161 274732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 274834 276144 gene locus_tag LOCUS_11480 274834 276144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 276747 276205 gene locus_tag LOCUS_11490 gene msrA 276747 276205 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962794.1 protein_id gnl|my_center|LOCUS_11490 279418 276971 gene locus_tag LOCUS_11500 279418 276971 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_11500 279883 280335 gene locus_tag LOCUS_11510 279883 280335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 280510 280806 gene locus_tag LOCUS_11520 280510 280806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 280914 281531 gene locus_tag LOCUS_11530 280914 281531 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_11530 281588 282172 gene locus_tag LOCUS_11540 281588 282172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 282181 284013 gene locus_tag LOCUS_11550 282181 284013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 284094 284564 gene locus_tag LOCUS_11560 284094 284564 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403602.1 protein_id gnl|my_center|LOCUS_11560 286281 284680 gene locus_tag LOCUS_11570 286281 284680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 287048 287704 gene locus_tag LOCUS_11580 287048 287704 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_11580 287871 288644 gene locus_tag LOCUS_11590 287871 288644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11590 288715 289602 gene locus_tag LOCUS_11600 288715 289602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11600 289700 291238 gene locus_tag LOCUS_11610 289700 291238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 291411 292667 gene locus_tag LOCUS_11620 291411 292667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 292937 294163 gene locus_tag LOCUS_11630 292937 294163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 294379 297474 gene locus_tag LOCUS_11640 294379 297474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 299224 297719 gene locus_tag LOCUS_11650 gene carB 299224 297719 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933336.1 protein_id gnl|my_center|LOCUS_11650 301411 299273 gene locus_tag LOCUS_11660 gene ppk1 301411 299273 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_11660 305028 301798 gene locus_tag LOCUS_11670 305028 301798 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_11670 305338 305114 gene locus_tag LOCUS_11680 305338 305114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 305887 305420 gene locus_tag LOCUS_11690 305887 305420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 307432 306092 gene locus_tag LOCUS_11700 307432 306092 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_11700 308744 307434 gene locus_tag LOCUS_11710 308744 307434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 309080 308790 gene locus_tag LOCUS_11720 309080 308790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 309774 310793 gene locus_tag LOCUS_11730 309774 310793 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_11730 310790 312265 gene locus_tag LOCUS_11740 310790 312265 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_11740 313744 312350 gene locus_tag LOCUS_11750 gene glmM 313744 312350 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_11750 314515 313757 gene locus_tag LOCUS_11760 314515 313757 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931943.1 protein_id gnl|my_center|LOCUS_11760 314898 314719 gene locus_tag LOCUS_11770 314898 314719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 315601 314903 gene locus_tag LOCUS_11780 gene panC 315601 314903 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546748.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11780 316443 315601 gene locus_tag LOCUS_11790 gene accD 316443 315601 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933219.1 protein_id gnl|my_center|LOCUS_11790 317128 316493 gene locus_tag LOCUS_11800 gene tsaB 317128 316493 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_11800 317589 317146 gene locus_tag LOCUS_11810 gene tsaE 317589 317146 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_11810 319178 317586 gene locus_tag LOCUS_11820 319178 317586 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_11820 320205 320801 gene locus_tag LOCUS_11830 320205 320801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 321472 321293 gene locus_tag LOCUS_11840 321472 321293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 322478 322263 gene locus_tag LOCUS_11850 322478 322263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 322627 322475 gene locus_tag LOCUS_11860 322627 322475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 322909 324234 gene locus_tag LOCUS_11870 gene mtaB 322909 324234 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_11870 324262 325197 gene locus_tag LOCUS_11880 324262 325197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11880 325194 325601 gene locus_tag LOCUS_11890 325194 325601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11890 325719 326087 gene locus_tag LOCUS_11900 325719 326087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 326041 326403 gene locus_tag LOCUS_11910 326041 326403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 326403 326579 gene locus_tag LOCUS_11920 326403 326579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 326576 326965 gene locus_tag LOCUS_11930 326576 326965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 327051 327317 gene locus_tag LOCUS_11940 327051 327317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 327358 328974 gene locus_tag LOCUS_11950 327358 328974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 330334 329021 gene locus_tag LOCUS_11960 330334 329021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 330948 330331 gene locus_tag LOCUS_11970 330948 330331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 331558 330977 gene locus_tag LOCUS_11980 331558 330977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 332008 331868 gene locus_tag LOCUS_11990 332008 331868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 335382 332251 gene locus_tag LOCUS_12000 335382 332251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 336206 336838 gene locus_tag LOCUS_12010 gene tmk 336206 336838 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583153.1 protein_id gnl|my_center|LOCUS_12010 336848 338512 gene locus_tag LOCUS_12020 336848 338512 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_12020 338573 339694 gene locus_tag LOCUS_12030 338573 339694 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909198.1 protein_id gnl|my_center|LOCUS_12030 339725 340666 gene locus_tag LOCUS_12040 339725 340666 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_12040 340670 340939 gene locus_tag LOCUS_12050 340670 340939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 340942 342267 gene locus_tag LOCUS_12060 340942 342267 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_12060 342753 342283 gene locus_tag LOCUS_12070 342753 342283 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_12070 343066 344352 gene locus_tag LOCUS_12080 gene eno 343066 344352 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_12080 344420 345460 gene locus_tag LOCUS_12090 gene queA 344420 345460 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_12090 345569 346225 gene locus_tag LOCUS_12100 gene ispD 345569 346225 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_12100 346269 347303 gene locus_tag LOCUS_12110 346269 347303 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_12110 347368 348327 gene locus_tag LOCUS_12120 347368 348327 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_12120 348335 350095 gene locus_tag LOCUS_12130 348335 350095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 350095 350571 gene locus_tag LOCUS_12140 350095 350571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 350622 351467 gene locus_tag LOCUS_12150 gene folE2 350622 351467 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_12150 351830 352273 gene locus_tag LOCUS_12160 351830 352273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 352304 353059 gene locus_tag LOCUS_12170 352304 353059 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_12170 353077 355374 gene locus_tag LOCUS_12180 353077 355374 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_12180 355426 355842 gene locus_tag LOCUS_12190 355426 355842 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_12190 355885 358815 gene locus_tag LOCUS_12200 355885 358815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 359030 360661 gene locus_tag LOCUS_12210 359030 360661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 361522 360716 gene locus_tag LOCUS_12220 361522 360716 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_12220 361973 363187 gene locus_tag LOCUS_12230 361973 363187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 364088 363285 gene locus_tag LOCUS_12240 364088 363285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 364322 365665 gene locus_tag LOCUS_12250 gene gnfM 364322 365665 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_12250 366016 366303 gene locus_tag LOCUS_12260 366016 366303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 366300 368201 gene locus_tag LOCUS_12270 366300 368201 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842747.1 protein_id gnl|my_center|LOCUS_12270 368191 368910 gene locus_tag LOCUS_12280 368191 368910 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811924.1 protein_id gnl|my_center|LOCUS_12280 368935 371016 gene locus_tag LOCUS_12290 368935 371016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 371072 371635 gene locus_tag LOCUS_12300 371072 371635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 371687 372280 gene locus_tag LOCUS_12310 371687 372280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 372290 373582 gene locus_tag LOCUS_12320 372290 373582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 373598 374842 gene locus_tag LOCUS_12330 373598 374842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 375006 375845 gene locus_tag LOCUS_12340 375006 375845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 378603 376222 gene locus_tag LOCUS_12350 gene ccsA 378603 376222 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_12350 379021 378629 gene locus_tag LOCUS_12360 379021 378629 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_12360 379555 379055 gene locus_tag LOCUS_12370 379555 379055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 379993 380067 gene locus_tag LOCUS_t00230 379993 380067 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 380307 381254 gene locus_tag LOCUS_12380 gene pyrD 380307 381254 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072542.1 protein_id gnl|my_center|LOCUS_12380 381256 381885 gene locus_tag LOCUS_12390 381256 381885 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838198.1 protein_id gnl|my_center|LOCUS_12390 381887 382078 gene locus_tag LOCUS_12400 381887 382078 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038881.1 protein_id gnl|my_center|LOCUS_12400 382130 383086 gene locus_tag LOCUS_12410 382130 383086 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_12410 387074 383292 gene locus_tag LOCUS_12420 387074 383292 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_12420 387237 387740 gene locus_tag LOCUS_12430 387237 387740 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_12430 387808 388176 gene locus_tag LOCUS_12440 387808 388176 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_12440 388198 389238 gene locus_tag LOCUS_12450 388198 389238 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_12450 389235 389744 gene locus_tag LOCUS_12460 389235 389744 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_12460 390907 389768 gene locus_tag LOCUS_12470 390907 389768 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906142.1 protein_id gnl|my_center|LOCUS_12470 391647 390937 gene locus_tag LOCUS_12480 391647 390937 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_12480 392738 391668 gene locus_tag LOCUS_12490 392738 391668 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_12490 393430 392735 gene locus_tag LOCUS_12500 gene rpiA 393430 392735 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722798.1 protein_id gnl|my_center|LOCUS_12500 394296 393442 gene locus_tag LOCUS_12510 394296 393442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 396271 394559 gene locus_tag LOCUS_12520 396271 394559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 399939 396649 gene locus_tag LOCUS_12530 399939 396649 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_12530 400405 400088 gene locus_tag LOCUS_12540 400405 400088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 400658 401281 gene locus_tag LOCUS_12550 400658 401281 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_12550 402109 401303 gene locus_tag LOCUS_12560 402109 401303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 402503 402093 gene locus_tag LOCUS_12570 402503 402093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 402597 403835 gene locus_tag LOCUS_12580 402597 403835 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656022.1 protein_id gnl|my_center|LOCUS_12580 404669 403902 gene locus_tag LOCUS_12590 404669 403902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 405537 404911 gene locus_tag LOCUS_12600 405537 404911 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479827.1 protein_id gnl|my_center|LOCUS_12600 406190 405540 gene locus_tag LOCUS_12610 406190 405540 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_12610 406491 406285 gene locus_tag LOCUS_12620 406491 406285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 407953 406535 gene locus_tag LOCUS_12630 407953 406535 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_12630 408475 407960 gene locus_tag LOCUS_12640 408475 407960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 410434 408497 gene locus_tag LOCUS_12650 gene uvrC 410434 408497 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_12650 410906 410508 gene locus_tag LOCUS_12660 gene mce 410906 410508 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_12660 412054 410948 gene locus_tag LOCUS_12670 412054 410948 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_12670 414001 412064 gene locus_tag LOCUS_12680 414001 412064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 415182 414019 gene locus_tag LOCUS_12690 gene alr 415182 414019 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437830.1 protein_id gnl|my_center|LOCUS_12690 415603 417180 gene locus_tag LOCUS_12700 gene dnaA 415603 417180 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_12700 417441 419156 gene locus_tag LOCUS_12710 gene recN 417441 419156 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_12710 420331 419336 gene locus_tag LOCUS_12720 420331 419336 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897260.1 protein_id gnl|my_center|LOCUS_12720 420488 420997 gene locus_tag LOCUS_12730 420488 420997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 421079 421447 gene locus_tag LOCUS_12740 421079 421447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 421688 422671 gene locus_tag LOCUS_12750 421688 422671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_12750 423463 422882 gene locus_tag LOCUS_12760 423463 422882 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693800.1 protein_id gnl|my_center|LOCUS_12760 424062 423484 gene locus_tag LOCUS_12770 424062 423484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 425340 424234 gene locus_tag LOCUS_12780 425340 424234 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_12780 425949 425458 gene locus_tag LOCUS_12790 425949 425458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 426681 426118 gene locus_tag LOCUS_12800 426681 426118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 427240 426824 gene locus_tag LOCUS_12810 427240 426824 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267309.1 protein_id gnl|my_center|LOCUS_12810 427602 428237 gene locus_tag LOCUS_12820 427602 428237 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_12820 429655 428291 gene locus_tag LOCUS_12830 gene radA 429655 428291 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989380.1 protein_id gnl|my_center|LOCUS_12830 429829 430302 gene locus_tag LOCUS_12840 429829 430302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 430326 431270 gene locus_tag LOCUS_12850 430326 431270 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_12850 431271 432563 gene locus_tag LOCUS_12860 431271 432563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 432629 434266 gene locus_tag LOCUS_12870 432629 434266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 434459 437953 gene locus_tag LOCUS_12880 434459 437953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840147.1 protein_id gnl|my_center|LOCUS_12880 438451 440244 gene locus_tag LOCUS_12890 438451 440244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 440767 440246 gene locus_tag LOCUS_12900 440767 440246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 442128 440866 gene locus_tag LOCUS_12910 442128 440866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 444875 442224 gene locus_tag LOCUS_12920 444875 442224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 446691 448598 gene locus_tag LOCUS_12930 gene mnmG 446691 448598 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_12930 448682 450022 gene locus_tag LOCUS_12940 448682 450022 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_12940 450215 451552 gene locus_tag LOCUS_12950 450215 451552 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_12950 451678 453378 gene locus_tag LOCUS_12960 451678 453378 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_12960 453460 454125 gene locus_tag LOCUS_12970 453460 454125 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_12970 454930 454244 gene locus_tag LOCUS_12980 454930 454244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 455668 455036 gene locus_tag LOCUS_12990 455668 455036 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_12990 456273 455668 gene locus_tag LOCUS_13000 456273 455668 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083512.1 protein_id gnl|my_center|LOCUS_13000 456999 456451 gene locus_tag LOCUS_13010 456999 456451 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_13010 457557 457054 gene locus_tag LOCUS_13020 457557 457054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 458510 457725 gene locus_tag LOCUS_13030 458510 457725 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_13030 459495 458503 gene locus_tag LOCUS_13040 459495 458503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 459677 460684 gene locus_tag LOCUS_13050 459677 460684 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_13050 460737 461945 gene locus_tag LOCUS_13060 460737 461945 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932672.1 protein_id gnl|my_center|LOCUS_13060 462698 461955 gene locus_tag LOCUS_13070 gene pgeF 462698 461955 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_13070 464792 462750 gene locus_tag LOCUS_13080 464792 462750 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_13080 466047 464959 gene locus_tag LOCUS_13090 466047 464959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 467725 466073 gene locus_tag LOCUS_13100 467725 466073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 468270 467782 gene locus_tag LOCUS_13110 468270 467782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 469361 468327 gene locus_tag LOCUS_13120 gene nuoH 469361 468327 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552781.1 protein_id gnl|my_center|LOCUS_13120 471291 469561 gene locus_tag LOCUS_13130 gene ptsP 471291 469561 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_13130 471645 472133 gene locus_tag LOCUS_13140 471645 472133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 472198 473130 gene locus_tag LOCUS_13150 472198 473130 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_13150 473909 473223 gene locus_tag LOCUS_13160 gene aqpZ 473909 473223 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071520.1 protein_id gnl|my_center|LOCUS_13160 474573 474091 gene locus_tag LOCUS_13170 474573 474091 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_13170 474910 474593 gene locus_tag LOCUS_13180 474910 474593 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_13180 476163 474931 gene locus_tag LOCUS_13190 476163 474931 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_13190 477120 476305 gene locus_tag LOCUS_13200 477120 476305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 477390 477809 gene locus_tag LOCUS_13210 477390 477809 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_13210 477837 478157 gene locus_tag LOCUS_13220 477837 478157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 478191 478724 gene locus_tag LOCUS_13230 478191 478724 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818608.1 protein_id gnl|my_center|LOCUS_13230 478944 480056 gene locus_tag LOCUS_13240 478944 480056 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603918.1 protein_id gnl|my_center|LOCUS_13240 480114 481217 gene locus_tag LOCUS_13250 480114 481217 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174672.1 protein_id gnl|my_center|LOCUS_13250 481234 481704 gene locus_tag LOCUS_13260 481234 481704 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115458779.1 protein_id gnl|my_center|LOCUS_13260 481816 482976 gene locus_tag LOCUS_13270 481816 482976 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_13270 483237 485813 gene locus_tag LOCUS_13280 483237 485813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 486211 488742 gene locus_tag LOCUS_13290 486211 488742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 488987 489373 gene locus_tag LOCUS_13300 488987 489373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 489392 490195 gene locus_tag LOCUS_13310 489392 490195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 490251 490898 gene locus_tag LOCUS_13320 gene sigW 490251 490898 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_13320 490895 491374 gene locus_tag LOCUS_13330 490895 491374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 491516 492901 gene locus_tag LOCUS_13340 491516 492901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 493242 493024 gene locus_tag LOCUS_13350 493242 493024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 493968 493270 gene locus_tag LOCUS_13360 493968 493270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 494580 496100 gene locus_tag LOCUS_13370 494580 496100 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816030.1 protein_id gnl|my_center|LOCUS_13370 496294 496761 gene locus_tag LOCUS_13380 496294 496761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 497046 497663 gene locus_tag LOCUS_13390 497046 497663 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 protein_id gnl|my_center|LOCUS_13390 498336 497767 gene locus_tag LOCUS_13400 498336 497767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 498789 499286 gene locus_tag LOCUS_13410 498789 499286 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 protein_id gnl|my_center|LOCUS_13410 500409 499288 gene locus_tag LOCUS_13420 500409 499288 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191163231.1 protein_id gnl|my_center|LOCUS_13420 502882 500663 gene locus_tag LOCUS_13430 502882 500663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 505112 503025 gene locus_tag LOCUS_13440 505112 503025 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_13440 505495 508158 gene locus_tag LOCUS_13450 505495 508158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 509658 508192 gene locus_tag LOCUS_13460 509658 508192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 509847 510044 gene locus_tag LOCUS_13470 509847 510044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 510074 510934 gene locus_tag LOCUS_13480 510074 510934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 510961 513162 gene locus_tag LOCUS_13490 510961 513162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 513727 513921 gene locus_tag LOCUS_13500 513727 513921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 513954 514397 gene locus_tag LOCUS_13510 513954 514397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 514438 517314 gene locus_tag LOCUS_13520 514438 517314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 517440 518672 gene locus_tag LOCUS_13530 gene lde 517440 518672 CDS product multidrug efflux MFS transporter Lde inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990057.1 protein_id gnl|my_center|LOCUS_13530 518842 519015 gene locus_tag LOCUS_13540 518842 519015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 520762 519197 gene locus_tag LOCUS_13550 520762 519197 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933910.1 protein_id gnl|my_center|LOCUS_13550 521884 520790 gene locus_tag LOCUS_13560 gene rho 521884 520790 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456756.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13560 522084 521842 gene locus_tag LOCUS_13570 522084 521842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 522734 522339 gene locus_tag LOCUS_13580 522734 522339 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_13580 524818 523145 gene locus_tag LOCUS_13590 524818 523145 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_13590 525681 524815 gene locus_tag LOCUS_13600 525681 524815 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435855.1 protein_id gnl|my_center|LOCUS_13600 527160 526138 gene locus_tag LOCUS_13610 527160 526138 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916593.1 protein_id gnl|my_center|LOCUS_13610 528171 527341 gene locus_tag LOCUS_13620 528171 527341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 528520 529980 gene locus_tag LOCUS_13630 528520 529980 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 protein_id gnl|my_center|LOCUS_13630 529881 530093 gene locus_tag LOCUS_13640 529881 530093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 530178 530378 gene locus_tag LOCUS_13650 530178 530378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 530498 530719 gene locus_tag LOCUS_13660 530498 530719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 531005 532357 gene locus_tag LOCUS_13670 531005 532357 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_13670 532423 534525 gene locus_tag LOCUS_13680 532423 534525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 534683 536185 gene locus_tag LOCUS_13690 534683 536185 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_13690 536237 537634 gene locus_tag LOCUS_13700 gene hydA 536237 537634 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_13700 537715 538224 gene locus_tag LOCUS_13710 537715 538224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 538827 538249 gene locus_tag LOCUS_13720 538827 538249 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_13720 539989 538847 gene locus_tag LOCUS_13730 gene bshA 539989 538847 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_13730 540193 541494 gene locus_tag LOCUS_13740 540193 541494 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_13740 541755 542837 gene locus_tag LOCUS_13750 541755 542837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 542893 543648 gene locus_tag LOCUS_13760 542893 543648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 544557 543661 gene locus_tag LOCUS_13770 544557 543661 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_13770 546023 544584 gene locus_tag LOCUS_13780 546023 544584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 546990 546037 gene locus_tag LOCUS_13790 546990 546037 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_13790 547560 547129 gene locus_tag LOCUS_13800 547560 547129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 549015 547648 gene locus_tag LOCUS_13810 549015 547648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 549414 549028 gene locus_tag LOCUS_13820 549414 549028 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_13820 549619 549416 gene locus_tag LOCUS_13830 549619 549416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 549928 549638 gene locus_tag LOCUS_13840 549928 549638 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_13840 550352 550056 gene locus_tag LOCUS_13850 550352 550056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 550513 550283 gene locus_tag LOCUS_13860 550513 550283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 550733 550506 gene locus_tag LOCUS_13870 550733 550506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 550991 551518 gene locus_tag LOCUS_13880 550991 551518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 553039 551573 gene locus_tag LOCUS_13890 553039 551573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 554266 553154 gene locus_tag LOCUS_13900 gene ald 554266 553154 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937875.1 protein_id gnl|my_center|LOCUS_13900 555007 554381 gene locus_tag LOCUS_13910 555007 554381 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_13910 555518 556309 gene locus_tag LOCUS_13920 gene mazG 555518 556309 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_13920 556345 556812 gene locus_tag LOCUS_13930 556345 556812 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546138.1 protein_id gnl|my_center|LOCUS_13930 556875 558050 gene locus_tag LOCUS_13940 556875 558050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 558017 558325 gene locus_tag LOCUS_13950 558017 558325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 558359 560266 gene locus_tag LOCUS_13960 558359 560266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 560310 562334 gene locus_tag LOCUS_13970 gene uvrB 560310 562334 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_13970 562413 563864 gene locus_tag LOCUS_13980 562413 563864 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_13980 564010 564615 gene locus_tag LOCUS_13990 564010 564615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 564612 564911 gene locus_tag LOCUS_14000 564612 564911 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668966.1 protein_id gnl|my_center|LOCUS_14000 564930 565214 gene locus_tag LOCUS_14010 564930 565214 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_14010 565232 567445 gene locus_tag LOCUS_14020 565232 567445 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_14020 567481 568269 gene locus_tag LOCUS_14030 567481 568269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 568385 570031 gene locus_tag LOCUS_14040 gene hutU 568385 570031 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_14040 570681 570166 gene locus_tag LOCUS_14050 570681 570166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 571017 572636 gene locus_tag LOCUS_14060 571017 572636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 573863 573189 gene locus_tag LOCUS_14070 573863 573189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14070 574243 573920 gene locus_tag LOCUS_14080 574243 573920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14080 576417 574444 gene locus_tag LOCUS_14090 gene asnB 576417 574444 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_14090 579052 576449 gene locus_tag LOCUS_14100 579052 576449 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_14100 580523 579210 gene locus_tag LOCUS_14110 580523 579210 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_14110 581171 580548 gene locus_tag LOCUS_14120 581171 580548 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 protein_id gnl|my_center|LOCUS_14120 582011 581205 gene locus_tag LOCUS_14130 582011 581205 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_14130 583239 582091 gene locus_tag LOCUS_14140 583239 582091 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_14140 583394 583600 gene locus_tag LOCUS_14150 583394 583600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 583706 584143 gene locus_tag LOCUS_14160 583706 584143 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762782.1 protein_id gnl|my_center|LOCUS_14160 584303 585823 gene locus_tag LOCUS_14170 584303 585823 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_14170 586009 588489 gene locus_tag LOCUS_14180 586009 588489 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_14180 588493 589311 gene locus_tag LOCUS_14190 gene dapF 588493 589311 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_14190 590567 589401 gene locus_tag LOCUS_14200 590567 589401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 590794 592206 gene locus_tag LOCUS_14210 gene lpdA 590794 592206 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_14210 592266 592685 gene locus_tag LOCUS_14220 gene arfB 592266 592685 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_14220 594283 592964 gene locus_tag LOCUS_14230 594283 592964 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_14230 596971 594296 gene locus_tag LOCUS_14240 gene aceE 596971 594296 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_14240 597772 597308 gene locus_tag LOCUS_14250 597772 597308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 598570 597848 gene locus_tag LOCUS_14260 gene ric 598570 597848 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_14260 598883 598584 gene locus_tag LOCUS_14270 598883 598584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 599322 598885 gene locus_tag LOCUS_14280 599322 598885 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_14280 599872 599444 gene locus_tag LOCUS_14290 599872 599444 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723377.1 protein_id gnl|my_center|LOCUS_14290 600642 600148 gene locus_tag LOCUS_14300 600642 600148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 602764 600782 gene locus_tag LOCUS_14310 602764 600782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14310 603398 602748 gene locus_tag LOCUS_14320 603398 602748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14320 604355 603480 gene locus_tag LOCUS_14330 604355 603480 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970774.1 protein_id gnl|my_center|LOCUS_14330 604822 604896 gene locus_tag LOCUS_t00240 604822 604896 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 605170 606621 gene locus_tag LOCUS_14340 605170 606621 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_14340 606631 606912 gene locus_tag LOCUS_14350 606631 606912 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_14350 607729 608466 gene locus_tag LOCUS_14360 607729 608466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 608486 609007 gene locus_tag LOCUS_14370 gene purE 608486 609007 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_14370 609074 609661 gene locus_tag LOCUS_14380 609074 609661 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040689791.1 protein_id gnl|my_center|LOCUS_14380 611398 609713 gene locus_tag LOCUS_14390 611398 609713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 613852 611696 gene locus_tag LOCUS_14400 613852 611696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 615387 614161 gene locus_tag LOCUS_14410 615387 614161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 617401 615476 gene locus_tag LOCUS_14420 617401 615476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 619427 617664 gene locus_tag LOCUS_14430 619427 617664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 622749 619795 gene locus_tag LOCUS_14440 622749 619795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 623054 623587 gene locus_tag LOCUS_14450 623054 623587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 624736 623696 gene locus_tag LOCUS_14460 624736 623696 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027998716.1 protein_id gnl|my_center|LOCUS_14460 625123 624749 gene locus_tag LOCUS_14470 625123 624749 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085647.1 protein_id gnl|my_center|LOCUS_14470 625927 625247 gene locus_tag LOCUS_14480 625927 625247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 627558 627178 gene locus_tag LOCUS_14490 627558 627178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 630094 628115 gene locus_tag LOCUS_14500 630094 628115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 631149 630094 gene locus_tag LOCUS_14510 631149 630094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 632444 631287 gene locus_tag LOCUS_14520 632444 631287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 639588 632665 gene locus_tag LOCUS_14530 639588 632665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 640435 639818 gene locus_tag LOCUS_14540 640435 639818 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_14540 643534 640436 gene locus_tag LOCUS_14550 643534 640436 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_14550 644146 643649 gene locus_tag LOCUS_14560 644146 643649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 644869 644231 gene locus_tag LOCUS_14570 gene nth 644869 644231 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546206.1 protein_id gnl|my_center|LOCUS_14570 645234 646424 gene locus_tag LOCUS_14580 gene kbl 645234 646424 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_14580 646647 647006 gene locus_tag LOCUS_14590 646647 647006 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_14590 647079 648437 gene locus_tag LOCUS_14600 647079 648437 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_14600 648626 649633 gene locus_tag LOCUS_14610 648626 649633 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_14610 649686 650384 gene locus_tag LOCUS_14620 649686 650384 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_14620 650547 651485 gene locus_tag LOCUS_14630 650547 651485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 651673 654093 gene locus_tag LOCUS_14640 651673 654093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 656176 654131 gene locus_tag LOCUS_14650 656176 654131 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871691.1 protein_id gnl|my_center|LOCUS_14650 656358 657137 gene locus_tag LOCUS_14660 656358 657137 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_14660 657718 657479 gene locus_tag LOCUS_14670 657718 657479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 658122 658334 gene locus_tag LOCUS_14680 658122 658334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 658420 658614 gene locus_tag LOCUS_14690 658420 658614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 658894 660036 gene locus_tag LOCUS_14700 gene dinB 658894 660036 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_14700 660361 660050 gene locus_tag LOCUS_14710 660361 660050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 661654 660377 gene locus_tag LOCUS_14720 661654 660377 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503612.1 protein_id gnl|my_center|LOCUS_14720 662049 664163 gene locus_tag LOCUS_14730 662049 664163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 664559 664828 gene locus_tag LOCUS_14740 664559 664828 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_14740 666259 664973 gene locus_tag LOCUS_14750 666259 664973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 666667 666263 gene locus_tag LOCUS_14760 666667 666263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 667819 666860 gene locus_tag LOCUS_14770 667819 666860 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_14770 670131 667816 gene locus_tag LOCUS_14780 gene xdhB 670131 667816 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_14780 671551 670118 gene locus_tag LOCUS_14790 gene xdhA 671551 670118 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_14790 672412 671759 gene locus_tag LOCUS_14800 672412 671759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 672576 673421 gene locus_tag LOCUS_14810 672576 673421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 673510 675321 gene locus_tag LOCUS_14820 673510 675321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 675442 676464 gene locus_tag LOCUS_14830 675442 676464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 677965 676565 gene locus_tag LOCUS_14840 gene nuoF 677965 676565 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_14840 678474 677974 gene locus_tag LOCUS_14850 678474 677974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 679872 678586 gene locus_tag LOCUS_14860 gene nuoD 679872 678586 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403174.1 protein_id gnl|my_center|LOCUS_14860 680495 680013 gene locus_tag LOCUS_14870 680495 680013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 681518 680598 gene locus_tag LOCUS_14880 681518 680598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 682050 681562 gene locus_tag LOCUS_14890 682050 681562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 682409 682041 gene locus_tag LOCUS_14900 682409 682041 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_14900 682874 683656 gene locus_tag LOCUS_14910 682874 683656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 683784 684554 gene locus_tag LOCUS_14920 683784 684554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 684554 686179 gene locus_tag LOCUS_14930 684554 686179 CDS product FlgD immunoglobulin-like domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838502.1 protein_id gnl|my_center|LOCUS_14930 686180 687253 gene locus_tag LOCUS_14940 686180 687253 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840096.1 protein_id gnl|my_center|LOCUS_14940 687307 688161 gene locus_tag LOCUS_14950 687307 688161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 688181 689413 gene locus_tag LOCUS_14960 688181 689413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 689394 689861 gene locus_tag LOCUS_14970 689394 689861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 689868 690845 gene locus_tag LOCUS_14980 689868 690845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 690858 691826 gene locus_tag LOCUS_14990 690858 691826 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_14990 691827 692585 gene locus_tag LOCUS_15000 691827 692585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 693133 692702 gene locus_tag LOCUS_15010 693133 692702 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_15010 693764 693423 gene locus_tag LOCUS_15020 693764 693423 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_15020 694038 694673 gene locus_tag LOCUS_15030 694038 694673 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072194.1 protein_id gnl|my_center|LOCUS_15030 695962 694877 gene locus_tag LOCUS_15040 695962 694877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 696281 695985 gene locus_tag LOCUS_15050 696281 695985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 697143 696358 gene locus_tag LOCUS_15060 697143 696358 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887914.1 protein_id gnl|my_center|LOCUS_15060 697520 697188 gene locus_tag LOCUS_15070 697520 697188 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619585.1 protein_id gnl|my_center|LOCUS_15070 699401 697536 gene locus_tag LOCUS_15080 699401 697536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 702008 701175 gene locus_tag LOCUS_15090 702008 701175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 702571 702053 gene locus_tag LOCUS_15100 702571 702053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 703009 702776 gene locus_tag LOCUS_15110 703009 702776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 704132 702900 gene locus_tag LOCUS_15120 704132 702900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 706607 704328 gene locus_tag LOCUS_15130 706607 704328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 707189 706941 gene locus_tag LOCUS_15140 707189 706941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 707693 707538 gene locus_tag LOCUS_15150 707693 707538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 707695 708738 gene locus_tag LOCUS_15160 707695 708738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 709032 710540 gene locus_tag LOCUS_15170 709032 710540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 710776 711741 gene locus_tag LOCUS_15180 710776 711741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 712640 711990 gene locus_tag LOCUS_15190 712640 711990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 713185 712691 gene locus_tag LOCUS_15200 713185 712691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 713880 713287 gene locus_tag LOCUS_15210 713880 713287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 714262 713912 gene locus_tag LOCUS_15220 714262 713912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 715126 714266 gene locus_tag LOCUS_15230 715126 714266 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704940.1 protein_id gnl|my_center|LOCUS_15230 715626 716216 gene locus_tag LOCUS_15240 715626 716216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15240 716104 717057 gene locus_tag LOCUS_15250 716104 717057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15250 717101 718135 gene locus_tag LOCUS_15260 717101 718135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 718169 718624 gene locus_tag LOCUS_15270 718169 718624 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359498.1 protein_id gnl|my_center|LOCUS_15270 719655 718807 gene locus_tag LOCUS_15280 gene rsmA 719655 718807 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020263.1 protein_id gnl|my_center|LOCUS_15280 722190 719662 gene locus_tag LOCUS_15290 722190 719662 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_15290 722798 723343 gene locus_tag LOCUS_15300 722798 723343 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946945.1 protein_id gnl|my_center|LOCUS_15300 724599 723487 gene locus_tag LOCUS_15310 724599 723487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 725395 724625 gene locus_tag LOCUS_15320 725395 724625 CDS product TylF/MycF family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428855.1 protein_id gnl|my_center|LOCUS_15320 726145 725417 gene locus_tag LOCUS_15330 726145 725417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 727620 726151 gene locus_tag LOCUS_15340 727620 726151 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_15340 728466 727744 gene locus_tag LOCUS_15350 728466 727744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 729585 728719 gene locus_tag LOCUS_15360 729585 728719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 730870 729731 gene locus_tag LOCUS_15370 730870 729731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 731276 730983 gene locus_tag LOCUS_15380 731276 730983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 732879 731191 gene locus_tag LOCUS_15390 732879 731191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 733503 732919 gene locus_tag LOCUS_15400 733503 732919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 733982 733659 gene locus_tag LOCUS_15410 733982 733659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 735553 734048 gene locus_tag LOCUS_15420 735553 734048 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168007557.1 protein_id gnl|my_center|LOCUS_15420 736000 737511 gene locus_tag LOCUS_15430 736000 737511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 738244 737522 gene locus_tag LOCUS_15440 738244 737522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 739700 738897 gene locus_tag LOCUS_15450 739700 738897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 740401 739835 gene locus_tag LOCUS_15460 740401 739835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 741094 740693 gene locus_tag LOCUS_15470 741094 740693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 741432 741145 gene locus_tag LOCUS_15480 741432 741145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 741766 741443 gene locus_tag LOCUS_15490 741766 741443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 741737 741892 gene locus_tag LOCUS_15500 741737 741892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 742243 742491 gene locus_tag LOCUS_15510 742243 742491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 742798 743580 gene locus_tag LOCUS_15520 742798 743580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 743693 745078 gene locus_tag LOCUS_15530 743693 745078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 745220 746629 gene locus_tag LOCUS_15540 745220 746629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 746886 748229 gene locus_tag LOCUS_15550 746886 748229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 750017 750604 gene locus_tag LOCUS_15560 750017 750604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 750580 751176 gene locus_tag LOCUS_15570 750580 751176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 751225 751500 gene locus_tag LOCUS_15580 751225 751500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15580 751482 751847 gene locus_tag LOCUS_15590 751482 751847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15590 752875 753045 gene locus_tag LOCUS_15600 752875 753045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 755020 754751 gene locus_tag LOCUS_15610 755020 754751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 756094 756276 gene locus_tag LOCUS_15620 756094 756276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 756302 756517 gene locus_tag LOCUS_15630 756302 756517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence03 2763 952 gene locus_tag LOCUS_15640 2763 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3275 2793 gene locus_tag LOCUS_15650 3275 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 4960 3254 gene locus_tag LOCUS_15660 4960 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 6053 5058 gene locus_tag LOCUS_15670 6053 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 6462 6094 gene locus_tag LOCUS_15680 6462 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6727 6488 gene locus_tag LOCUS_15690 6727 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6917 6714 gene locus_tag LOCUS_15700 6917 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 9141 6880 gene locus_tag LOCUS_15710 9141 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15710 10202 9207 gene locus_tag LOCUS_15720 10202 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15720 11286 11765 gene locus_tag LOCUS_15730 11286 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 12890 12069 gene locus_tag LOCUS_15740 12890 12069 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_15740 13320 13009 gene locus_tag LOCUS_15750 13320 13009 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_15750 13543 13328 gene locus_tag LOCUS_15760 13543 13328 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_15760 14836 14264 gene locus_tag LOCUS_15770 14836 14264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 16006 15335 gene locus_tag LOCUS_15780 16006 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 17856 16843 gene locus_tag LOCUS_15790 17856 16843 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_15790 18464 17853 gene locus_tag LOCUS_15800 18464 17853 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_15800 19840 18791 gene locus_tag LOCUS_15810 19840 18791 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869866.1 protein_id gnl|my_center|LOCUS_15810 19976 19812 gene locus_tag LOCUS_15820 19976 19812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 20959 20711 gene locus_tag LOCUS_15830 20959 20711 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832208.1 protein_id gnl|my_center|LOCUS_15830 21137 21063 gene locus_tag LOCUS_t00250 21137 21063 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 21552 23636 gene locus_tag LOCUS_15840 21552 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 24084 25892 gene locus_tag LOCUS_15850 24084 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 26121 30995 gene locus_tag LOCUS_15860 26121 30995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 32348 31161 gene locus_tag LOCUS_15870 32348 31161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 33442 32420 gene locus_tag LOCUS_15880 33442 32420 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_15880 34614 33439 gene locus_tag LOCUS_15890 34614 33439 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_15890 35663 34647 gene locus_tag LOCUS_15900 35663 34647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_15900 36067 36450 gene locus_tag LOCUS_15910 36067 36450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 36502 36840 gene locus_tag LOCUS_15920 36502 36840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 37008 37382 gene locus_tag LOCUS_15930 37008 37382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 37406 38476 gene locus_tag LOCUS_15940 gene prfA 37406 38476 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931817.1 protein_id gnl|my_center|LOCUS_15940 38948 38715 gene locus_tag LOCUS_15950 38948 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 39840 39043 gene locus_tag LOCUS_15960 39840 39043 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_15960 40014 40088 gene locus_tag LOCUS_t00260 40014 40088 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 40188 42119 gene locus_tag LOCUS_15970 gene thrS 40188 42119 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_15970 42198 42782 gene locus_tag LOCUS_15980 42198 42782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 42775 42969 gene locus_tag LOCUS_15990 gene rpmI 42775 42969 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_15990 42995 43342 gene locus_tag LOCUS_16000 gene rplT 42995 43342 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933783.1 protein_id gnl|my_center|LOCUS_16000 43423 44448 gene locus_tag LOCUS_16010 gene pheS 43423 44448 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_16010 44529 45251 gene locus_tag LOCUS_16020 44529 45251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 46088 45318 gene locus_tag LOCUS_16030 gene surE 46088 45318 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933221.1 protein_id gnl|my_center|LOCUS_16030 47163 46147 gene locus_tag LOCUS_16040 gene obgE 47163 46147 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_16040 48306 47167 gene locus_tag LOCUS_16050 48306 47167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 49728 48367 gene locus_tag LOCUS_16060 49728 48367 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_16060 51100 49811 gene locus_tag LOCUS_16070 gene kynU 51100 49811 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_16070 52168 51128 gene locus_tag LOCUS_16080 52168 51128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 53234 52203 gene locus_tag LOCUS_16090 53234 52203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 54111 53299 gene locus_tag LOCUS_16100 54111 53299 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_16100 54302 54982 gene locus_tag LOCUS_16110 54302 54982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 56235 54985 gene locus_tag LOCUS_16120 56235 54985 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_16120 56885 59608 gene locus_tag LOCUS_16130 gene ppdK 56885 59608 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_16130 59812 60882 gene locus_tag LOCUS_16140 59812 60882 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_16140 61898 60969 gene locus_tag LOCUS_16150 gene queG 61898 60969 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_16150 62173 61898 gene locus_tag LOCUS_16160 62173 61898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 62871 62566 gene locus_tag LOCUS_16170 62871 62566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 64979 62871 gene locus_tag LOCUS_16180 64979 62871 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933313.1 protein_id gnl|my_center|LOCUS_16180 65271 64999 gene locus_tag LOCUS_16190 gene rpsO 65271 64999 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057119.1 protein_id gnl|my_center|LOCUS_16190 66220 65285 gene locus_tag LOCUS_16200 66220 65285 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_16200 66831 66349 gene locus_tag LOCUS_16210 66831 66349 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_16210 67069 68421 gene locus_tag LOCUS_16220 gene allB 67069 68421 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_16220 68442 69455 gene locus_tag LOCUS_16230 gene alc 68442 69455 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104661.1 protein_id gnl|my_center|LOCUS_16230 69466 69969 gene locus_tag LOCUS_16240 gene uraD 69466 69969 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076325.1 protein_id gnl|my_center|LOCUS_16240 69966 70307 gene locus_tag LOCUS_16250 gene uraH 69966 70307 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852246.1 protein_id gnl|my_center|LOCUS_16250 73432 70439 gene locus_tag LOCUS_16260 73432 70439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 76095 73654 gene locus_tag LOCUS_16270 76095 73654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 76410 77873 gene locus_tag LOCUS_16280 76410 77873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 79435 77900 gene locus_tag LOCUS_16290 79435 77900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 81309 79591 gene locus_tag LOCUS_16300 81309 79591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 81730 81299 gene locus_tag LOCUS_16310 81730 81299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 84203 81861 gene locus_tag LOCUS_16320 84203 81861 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_16320 85847 84420 gene locus_tag LOCUS_16330 85847 84420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 86107 87852 gene locus_tag LOCUS_16340 86107 87852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 88116 90485 gene locus_tag LOCUS_16350 88116 90485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 91808 90906 gene locus_tag LOCUS_16360 gene speB 91808 90906 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_16360 93188 91815 gene locus_tag LOCUS_16370 93188 91815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 95712 93238 gene locus_tag LOCUS_16380 gene lon 95712 93238 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_16380 97348 95921 gene locus_tag LOCUS_16390 gene gatA 97348 95921 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_16390 97681 97496 gene locus_tag LOCUS_16400 gene tatA 97681 97496 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_16400 98393 97722 gene locus_tag LOCUS_16410 gene purQ 98393 97722 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 protein_id gnl|my_center|LOCUS_16410 98644 98393 gene locus_tag LOCUS_16420 gene purS 98644 98393 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_16420 99497 98676 gene locus_tag LOCUS_16430 99497 98676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 100129 99518 gene locus_tag LOCUS_16440 100129 99518 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_16440 101252 100176 gene locus_tag LOCUS_16450 101252 100176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 102643 101363 gene locus_tag LOCUS_16460 102643 101363 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_16460 103543 103043 gene locus_tag LOCUS_16470 103543 103043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 104756 103554 gene locus_tag LOCUS_16480 gene lhgO 104756 103554 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_16480 104961 105116 gene locus_tag LOCUS_16490 104961 105116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 105247 105900 gene locus_tag LOCUS_16500 105247 105900 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529467.1 protein_id gnl|my_center|LOCUS_16500 105999 108413 gene locus_tag LOCUS_16510 105999 108413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 108591 110165 gene locus_tag LOCUS_16520 gene zwf 108591 110165 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 protein_id gnl|my_center|LOCUS_16520 110326 111066 gene locus_tag LOCUS_16530 gene pgl 110326 111066 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263331.1 protein_id gnl|my_center|LOCUS_16530 111134 111829 gene locus_tag LOCUS_16540 111134 111829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 111845 112825 gene locus_tag LOCUS_16550 gene glk 111845 112825 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_16550 114633 113008 gene locus_tag LOCUS_16560 114633 113008 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_16560 114813 116462 gene locus_tag LOCUS_16570 114813 116462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 116669 117160 gene locus_tag LOCUS_16580 116669 117160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 117251 117799 gene locus_tag LOCUS_16590 117251 117799 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_16590 118268 117801 gene locus_tag LOCUS_16600 118268 117801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 118335 119381 gene locus_tag LOCUS_16610 gene ruvB 118335 119381 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_16610 119394 119921 gene locus_tag LOCUS_16620 119394 119921 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941173.1 protein_id gnl|my_center|LOCUS_16620 119930 120379 gene locus_tag LOCUS_16630 119930 120379 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707284.1 protein_id gnl|my_center|LOCUS_16630 120376 120822 gene locus_tag LOCUS_16640 120376 120822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 120909 123137 gene locus_tag LOCUS_16650 120909 123137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 124274 123507 gene locus_tag LOCUS_16660 124274 123507 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_16660 125042 124275 gene locus_tag LOCUS_16670 125042 124275 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_16670 125372 125064 gene locus_tag LOCUS_16680 125372 125064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 126121 125411 gene locus_tag LOCUS_16690 126121 125411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 126231 127316 gene locus_tag LOCUS_16700 126231 127316 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403585.1 protein_id gnl|my_center|LOCUS_16700 127350 127775 gene locus_tag LOCUS_16710 127350 127775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 127806 128042 gene locus_tag LOCUS_16720 127806 128042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 128727 128056 gene locus_tag LOCUS_16730 128727 128056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 128882 129646 gene locus_tag LOCUS_16740 128882 129646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 129688 131358 gene locus_tag LOCUS_16750 129688 131358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 131648 132628 gene locus_tag LOCUS_16760 131648 132628 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582571.1 protein_id gnl|my_center|LOCUS_16760 133803 132625 gene locus_tag LOCUS_16770 133803 132625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583336.1 protein_id gnl|my_center|LOCUS_16770 134078 135070 gene locus_tag LOCUS_16780 gene nadA 134078 135070 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_16780 135980 135561 gene locus_tag LOCUS_16790 135980 135561 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628813.1 protein_id gnl|my_center|LOCUS_16790 136872 135991 gene locus_tag LOCUS_16800 136872 135991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927023.1 protein_id gnl|my_center|LOCUS_16800 137498 136875 gene locus_tag LOCUS_16810 137498 136875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 138625 137675 gene locus_tag LOCUS_16820 gene metF 138625 137675 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_16820 139680 138691 gene locus_tag LOCUS_16830 139680 138691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 141815 140025 gene locus_tag LOCUS_16840 141815 140025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_16840 143604 141844 gene locus_tag LOCUS_16850 143604 141844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_16850 145335 143920 gene locus_tag LOCUS_16860 145335 143920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948370.1 protein_id gnl|my_center|LOCUS_16860 145519 147864 gene locus_tag LOCUS_16870 145519 147864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 147995 147907 gene locus_tag LOCUS_t00270 147995 147907 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 148745 148335 gene locus_tag LOCUS_16880 148745 148335 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_16880 151019 148782 gene locus_tag LOCUS_16890 151019 148782 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_16890 152484 151141 gene locus_tag LOCUS_16900 152484 151141 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_16900 154073 152547 gene locus_tag LOCUS_16910 gene purF 154073 152547 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421582.1 protein_id gnl|my_center|LOCUS_16910 155544 154462 gene locus_tag LOCUS_16920 155544 154462 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_16920 156054 155620 gene locus_tag LOCUS_16930 156054 155620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 156578 156051 gene locus_tag LOCUS_16940 156578 156051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 157113 156580 gene locus_tag LOCUS_16950 157113 156580 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871015.1 protein_id gnl|my_center|LOCUS_16950 157274 159076 gene locus_tag LOCUS_16960 157274 159076 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_16960 159236 159571 gene locus_tag LOCUS_16970 159236 159571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 159573 160619 gene locus_tag LOCUS_16980 gene hprK 159573 160619 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_16980 160724 162490 gene locus_tag LOCUS_16990 160724 162490 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_16990 162572 164692 gene locus_tag LOCUS_17000 162572 164692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 164770 164997 gene locus_tag LOCUS_17010 164770 164997 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_17010 165060 167054 gene locus_tag LOCUS_17020 165060 167054 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_17020 167064 168194 gene locus_tag LOCUS_17030 167064 168194 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_17030 169588 168191 gene locus_tag LOCUS_17040 169588 168191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 173642 169590 gene locus_tag LOCUS_17050 173642 169590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 174329 173856 gene locus_tag LOCUS_17060 174329 173856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 174522 174598 gene locus_tag LOCUS_t00280 174522 174598 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 174735 175367 gene locus_tag LOCUS_17070 174735 175367 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_17070 175393 176046 gene locus_tag LOCUS_17080 gene pth 175393 176046 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_17080 176176 178527 gene locus_tag LOCUS_17090 176176 178527 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_17090 180358 178595 gene locus_tag LOCUS_17100 180358 178595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 180954 181610 gene locus_tag LOCUS_17110 gene cmk 180954 181610 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 protein_id gnl|my_center|LOCUS_17110 181761 183728 gene locus_tag LOCUS_17120 gene rpsA 181761 183728 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_17120 184730 184086 gene locus_tag LOCUS_17130 184730 184086 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_17130 185242 186138 gene locus_tag LOCUS_17140 185242 186138 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021284.1 protein_id gnl|my_center|LOCUS_17140 186251 186943 gene locus_tag LOCUS_17150 186251 186943 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_17150 187169 188092 gene locus_tag LOCUS_17160 187169 188092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 188085 189560 gene locus_tag LOCUS_17170 188085 189560 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055578.1 protein_id gnl|my_center|LOCUS_17170 189565 190374 gene locus_tag LOCUS_17180 189565 190374 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036853.1 protein_id gnl|my_center|LOCUS_17180 190381 192213 gene locus_tag LOCUS_17190 190381 192213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 192229 193428 gene locus_tag LOCUS_17200 gene waaF 192229 193428 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115493.1 protein_id gnl|my_center|LOCUS_17200 193432 194184 gene locus_tag LOCUS_17210 193432 194184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 194181 195353 gene locus_tag LOCUS_17220 194181 195353 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143507.1 protein_id gnl|my_center|LOCUS_17220 196684 195428 gene locus_tag LOCUS_17230 196684 195428 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_17230 198966 196996 gene locus_tag LOCUS_17240 198966 196996 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_17240 199807 198980 gene locus_tag LOCUS_17250 199807 198980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 200108 202984 gene locus_tag LOCUS_17260 gene uvrA 200108 202984 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403227.1 protein_id gnl|my_center|LOCUS_17260 203003 203638 gene locus_tag LOCUS_17270 203003 203638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 206503 203639 gene locus_tag LOCUS_17280 gene uvrA 206503 203639 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_17280 208941 206641 gene locus_tag LOCUS_17290 208941 206641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 210176 208962 gene locus_tag LOCUS_17300 210176 208962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 210394 210227 gene locus_tag LOCUS_17310 210394 210227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 210372 211244 gene locus_tag LOCUS_17320 210372 211244 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 protein_id gnl|my_center|LOCUS_17320 211234 212622 gene locus_tag LOCUS_17330 gene mnmE 211234 212622 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_17330 213316 212774 gene locus_tag LOCUS_17340 213316 212774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 214028 215035 gene locus_tag LOCUS_17350 214028 215035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_17350 215116 216399 gene locus_tag LOCUS_17360 gene hutI 215116 216399 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_17360 216476 217597 gene locus_tag LOCUS_17370 216476 217597 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_17370 217844 217599 gene locus_tag LOCUS_17380 217844 217599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 219833 219072 gene locus_tag LOCUS_17390 gene hisA 219833 219072 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932164.1 protein_id gnl|my_center|LOCUS_17390 222124 219851 gene locus_tag LOCUS_17400 222124 219851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 223644 222499 gene locus_tag LOCUS_17410 223644 222499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 224129 223698 gene locus_tag LOCUS_17420 224129 223698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 225714 224155 gene locus_tag LOCUS_17430 225714 224155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 228071 225957 gene locus_tag LOCUS_17440 gene pqqU 228071 225957 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689344.1 protein_id gnl|my_center|LOCUS_17440 228491 228123 gene locus_tag LOCUS_17450 228491 228123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 228832 229770 gene locus_tag LOCUS_17460 228832 229770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 230861 229983 gene locus_tag LOCUS_17470 230861 229983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 232885 230945 gene locus_tag LOCUS_17480 232885 230945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 233743 233006 gene locus_tag LOCUS_17490 233743 233006 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268528.1 protein_id gnl|my_center|LOCUS_17490 234819 234010 gene locus_tag LOCUS_17500 234819 234010 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_17500 235213 234869 gene locus_tag LOCUS_17510 235213 234869 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_17510 235619 237022 gene locus_tag LOCUS_17520 235619 237022 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_17520 237033 238049 gene locus_tag LOCUS_17530 gene cydB 237033 238049 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_17530 238469 238230 gene locus_tag LOCUS_17540 238469 238230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 239661 238528 gene locus_tag LOCUS_17550 239661 238528 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_17550 240744 239749 gene locus_tag LOCUS_17560 240744 239749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 241309 240704 gene locus_tag LOCUS_17570 241309 240704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 241907 242101 gene locus_tag LOCUS_17580 241907 242101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 243422 242208 gene locus_tag LOCUS_17590 243422 242208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 243994 245379 gene locus_tag LOCUS_17600 243994 245379 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_17600 245402 245770 gene locus_tag LOCUS_17610 245402 245770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 245793 247205 gene locus_tag LOCUS_17620 245793 247205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 247265 247855 gene locus_tag LOCUS_17630 247265 247855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 247857 248123 gene locus_tag LOCUS_17640 247857 248123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 248543 249373 gene locus_tag LOCUS_17650 248543 249373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 249376 250155 gene locus_tag LOCUS_17660 249376 250155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 250159 250833 gene locus_tag LOCUS_17670 250159 250833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_17670 250838 251464 gene locus_tag LOCUS_17680 250838 251464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17680 251590 251742 gene locus_tag LOCUS_17690 251590 251742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 251745 252464 gene locus_tag LOCUS_17700 251745 252464 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_17700 252556 253155 gene locus_tag LOCUS_17710 252556 253155 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_17710 254156 253161 gene locus_tag LOCUS_17720 254156 253161 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_17720 254236 255930 gene locus_tag LOCUS_17730 254236 255930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 256355 257602 gene locus_tag LOCUS_17740 256355 257602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 257775 259169 gene locus_tag LOCUS_17750 257775 259169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 259442 260683 gene locus_tag LOCUS_17760 259442 260683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 260856 263477 gene locus_tag LOCUS_17770 260856 263477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 263759 265027 gene locus_tag LOCUS_17780 263759 265027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 265646 265074 gene locus_tag LOCUS_17790 gene thpR 265646 265074 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082411.1 protein_id gnl|my_center|LOCUS_17790 265725 266837 gene locus_tag LOCUS_17800 265725 266837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 266841 267629 gene locus_tag LOCUS_17810 266841 267629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_17810 268117 268536 gene locus_tag LOCUS_17820 268117 268536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 268739 269044 gene locus_tag LOCUS_17830 268739 269044 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_17830 269064 270512 gene locus_tag LOCUS_17840 gene hpaE 269064 270512 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807572.1 protein_id gnl|my_center|LOCUS_17840 270808 271170 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgtgacacttgtcattaaacc 271608 271922 gene locus_tag LOCUS_17850 gene rpsL 271608 271922 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_17850 271970 272437 gene locus_tag LOCUS_17860 gene rpsG 271970 272437 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403791.1 protein_id gnl|my_center|LOCUS_17860 272499 274592 gene locus_tag LOCUS_17870 gene fusA 272499 274592 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_17870 274733 274807 gene locus_tag LOCUS_t00290 274733 274807 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 274918 276153 gene locus_tag LOCUS_17880 gene tuf 274918 276153 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_17880 276209 276517 gene locus_tag LOCUS_17890 gene rpsJ 276209 276517 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403794.1 protein_id gnl|my_center|LOCUS_17890 276551 277171 gene locus_tag LOCUS_17900 gene rplC 276551 277171 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_17900 277175 277804 gene locus_tag LOCUS_17910 gene rplD 277175 277804 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933841.1 protein_id gnl|my_center|LOCUS_17910 277824 278120 gene locus_tag LOCUS_17920 gene rplW 277824 278120 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_17920 278164 278346 gene locus_tag LOCUS_17930 278164 278346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 278343 278807 gene locus_tag LOCUS_17940 278343 278807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 278809 279666 gene locus_tag LOCUS_17950 278809 279666 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_17950 280365 279721 gene locus_tag LOCUS_17960 280365 279721 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_17960 280415 280487 gene locus_tag LOCUS_t00300 280415 280487 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 281092 280508 gene locus_tag LOCUS_17970 281092 280508 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_17970 281371 282339 gene locus_tag LOCUS_17980 281371 282339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 283605 282382 gene locus_tag LOCUS_17990 283605 282382 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_17990 283897 284550 gene locus_tag LOCUS_18000 283897 284550 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_18000 284584 285948 gene locus_tag LOCUS_18010 284584 285948 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_18010 286408 285959 gene locus_tag LOCUS_18020 286408 285959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 287011 286580 gene locus_tag LOCUS_18030 287011 286580 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_18030 287097 287777 gene locus_tag LOCUS_18040 287097 287777 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_18040 287802 288092 gene locus_tag LOCUS_18050 gene gatC 287802 288092 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_18050 288099 288860 gene locus_tag LOCUS_18060 gene kdsB 288099 288860 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_18060 288850 289344 gene locus_tag LOCUS_18070 288850 289344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 289356 290963 gene locus_tag LOCUS_18080 289356 290963 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931836.1 protein_id gnl|my_center|LOCUS_18080 291312 291130 gene locus_tag LOCUS_18090 291312 291130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 292117 291257 gene locus_tag LOCUS_18100 292117 291257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 292722 295154 gene locus_tag LOCUS_18110 292722 295154 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948921.1 protein_id gnl|my_center|LOCUS_18110 295151 296641 gene locus_tag LOCUS_18120 295151 296641 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_18120 296689 297318 gene locus_tag LOCUS_18130 296689 297318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 302263 297401 gene locus_tag LOCUS_18140 302263 297401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 307245 302374 gene locus_tag LOCUS_18150 307245 302374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 308286 307282 gene locus_tag LOCUS_18160 308286 307282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 309574 308588 gene locus_tag LOCUS_18170 309574 308588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 310622 309639 gene locus_tag LOCUS_18180 310622 309639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 310927 310691 gene locus_tag LOCUS_18190 310927 310691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 312869 310935 gene locus_tag LOCUS_18200 312869 310935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 313758 312796 gene locus_tag LOCUS_18210 313758 312796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 314087 313881 gene locus_tag LOCUS_18220 314087 313881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 316653 314212 gene locus_tag LOCUS_18230 316653 314212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 317804 316935 gene locus_tag LOCUS_18240 317804 316935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 318917 318105 gene locus_tag LOCUS_18250 318917 318105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 319640 318942 gene locus_tag LOCUS_18260 319640 318942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 320308 319658 gene locus_tag LOCUS_18270 320308 319658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 320643 320317 gene locus_tag LOCUS_18280 320643 320317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 321344 320640 gene locus_tag LOCUS_18290 321344 320640 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_18290 321936 323543 gene locus_tag LOCUS_18300 321936 323543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 323774 324235 gene locus_tag LOCUS_18310 323774 324235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 325058 324246 gene locus_tag LOCUS_18320 325058 324246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 326645 325164 gene locus_tag LOCUS_18330 326645 325164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 327964 326705 gene locus_tag LOCUS_18340 327964 326705 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_18340 328894 327989 gene locus_tag LOCUS_18350 gene cysD 328894 327989 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_18350 329502 328906 gene locus_tag LOCUS_18360 gene cysC 329502 328906 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 protein_id gnl|my_center|LOCUS_18360 330070 330840 gene locus_tag LOCUS_18370 330070 330840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 331702 330929 gene locus_tag LOCUS_18380 331702 330929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 332710 331973 gene locus_tag LOCUS_18390 332710 331973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 333537 332908 gene locus_tag LOCUS_18400 333537 332908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 334776 333739 gene locus_tag LOCUS_18410 334776 333739 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_18410 334956 335150 gene locus_tag LOCUS_18420 334956 335150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 335668 337176 gene locus_tag LOCUS_18430 335668 337176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 337486 338187 gene locus_tag LOCUS_18440 337486 338187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 338342 338542 gene locus_tag LOCUS_18450 338342 338542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 338587 339717 gene locus_tag LOCUS_18460 gene pseC 338587 339717 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_18460 339880 340806 gene locus_tag LOCUS_18470 339880 340806 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_18470 341112 342713 gene locus_tag LOCUS_18480 341112 342713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 343255 344256 gene locus_tag LOCUS_18490 343255 344256 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_18490 344439 345371 gene locus_tag LOCUS_18500 344439 345371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 345715 346845 gene locus_tag LOCUS_18510 345715 346845 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_18510 347398 346928 gene locus_tag LOCUS_18520 347398 346928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 349288 348563 gene locus_tag LOCUS_18530 349288 348563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 350716 349304 gene locus_tag LOCUS_18540 350716 349304 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_18540 351505 350774 gene locus_tag LOCUS_18550 351505 350774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 352957 351545 gene locus_tag LOCUS_18560 352957 351545 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333676.1 protein_id gnl|my_center|LOCUS_18560 355240 354164 gene locus_tag LOCUS_18570 355240 354164 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014989.1 protein_id gnl|my_center|LOCUS_18570 356244 355264 gene locus_tag LOCUS_18580 356244 355264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 357567 356281 gene locus_tag LOCUS_18590 357567 356281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_18590 358445 357600 gene locus_tag LOCUS_18600 358445 357600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_18600 363333 358471 gene locus_tag LOCUS_18610 363333 358471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 364198 363467 gene locus_tag LOCUS_18620 364198 363467 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530227.1 protein_id gnl|my_center|LOCUS_18620 365250 364201 gene locus_tag LOCUS_18630 365250 364201 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966333.1 protein_id gnl|my_center|LOCUS_18630 366797 365256 gene locus_tag LOCUS_18640 366797 365256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 368446 366794 gene locus_tag LOCUS_18650 368446 366794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 369378 368443 gene locus_tag LOCUS_18660 369378 368443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 370976 369387 gene locus_tag LOCUS_18670 370976 369387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 372059 370995 gene locus_tag LOCUS_18680 372059 370995 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582960.1 protein_id gnl|my_center|LOCUS_18680 373147 372056 gene locus_tag LOCUS_18690 373147 372056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 373829 373158 gene locus_tag LOCUS_18700 373829 373158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 374170 373829 gene locus_tag LOCUS_18710 374170 373829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 375611 375144 gene locus_tag LOCUS_18720 375611 375144 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_18720 376731 375628 gene locus_tag LOCUS_18730 376731 375628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 376892 377131 gene locus_tag LOCUS_18740 376892 377131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 378200 377094 gene locus_tag LOCUS_18750 378200 377094 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_18750 378879 378181 gene locus_tag LOCUS_18760 378879 378181 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_18760 380080 378956 gene locus_tag LOCUS_18770 380080 378956 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987001.1 protein_id gnl|my_center|LOCUS_18770 381257 380103 gene locus_tag LOCUS_18780 381257 380103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 383158 381260 gene locus_tag LOCUS_18790 gene asnB 383158 381260 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_18790 384379 383159 gene locus_tag LOCUS_18800 384379 383159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 385164 384391 gene locus_tag LOCUS_18810 385164 384391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 386238 385171 gene locus_tag LOCUS_18820 386238 385171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 387547 386213 gene locus_tag LOCUS_18830 387547 386213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 388090 387554 gene locus_tag LOCUS_18840 388090 387554 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399156.1 protein_id gnl|my_center|LOCUS_18840 389507 388230 gene locus_tag LOCUS_18850 389507 388230 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_18850 390172 389504 gene locus_tag LOCUS_18860 gene rfbA 390172 389504 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_18860 391167 390157 gene locus_tag LOCUS_18870 391167 390157 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_18870 392114 391167 gene locus_tag LOCUS_18880 392114 391167 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_18880 393318 392131 gene locus_tag LOCUS_18890 393318 392131 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_18890 393940 393419 gene locus_tag LOCUS_18900 gene rfbC 393940 393419 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877392.1 protein_id gnl|my_center|LOCUS_18900 394993 393950 gene locus_tag LOCUS_18910 gene gmd 394993 393950 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_18910 396193 395027 gene locus_tag LOCUS_18920 396193 395027 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_18920 397549 396230 gene locus_tag LOCUS_18930 397549 396230 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020726.1 protein_id gnl|my_center|LOCUS_18930 398167 397586 gene locus_tag LOCUS_18940 398167 397586 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_18940 399151 398177 gene locus_tag LOCUS_18950 399151 398177 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_18950 400474 399167 gene locus_tag LOCUS_18960 gene wbpA 400474 399167 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_18960 402817 400532 gene locus_tag LOCUS_18970 402817 400532 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_18970 403396 403935 gene locus_tag LOCUS_18980 403396 403935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 403956 404462 gene locus_tag LOCUS_18990 403956 404462 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_18990 404643 405587 gene locus_tag LOCUS_19000 404643 405587 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_19000 405657 406289 gene locus_tag LOCUS_19010 405657 406289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 406342 408597 gene locus_tag LOCUS_19020 406342 408597 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706054.1 protein_id gnl|my_center|LOCUS_19020 408755 409612 gene locus_tag LOCUS_19030 408755 409612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_19030 409625 410956 gene locus_tag LOCUS_19040 409625 410956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 411105 411755 gene locus_tag LOCUS_19050 411105 411755 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_19050 411774 412514 gene locus_tag LOCUS_19060 411774 412514 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_19060 412550 413212 gene locus_tag LOCUS_19070 412550 413212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 413279 414256 gene locus_tag LOCUS_19080 413279 414256 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 protein_id gnl|my_center|LOCUS_19080 414269 415084 gene locus_tag LOCUS_19090 414269 415084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_19090 415124 416176 gene locus_tag LOCUS_19100 415124 416176 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937656.1 protein_id gnl|my_center|LOCUS_19100 416200 416856 gene locus_tag LOCUS_19110 416200 416856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 416977 418389 gene locus_tag LOCUS_19120 416977 418389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 418534 419316 gene locus_tag LOCUS_19130 418534 419316 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_19130 419309 420283 gene locus_tag LOCUS_19140 419309 420283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 420271 421590 gene locus_tag LOCUS_19150 420271 421590 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_19150 421591 422643 gene locus_tag LOCUS_19160 421591 422643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 422658 423221 gene locus_tag LOCUS_19170 422658 423221 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681196.1 protein_id gnl|my_center|LOCUS_19170 423228 424445 gene locus_tag LOCUS_19180 423228 424445 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_19180 424435 425820 gene locus_tag LOCUS_19190 424435 425820 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_19190 425878 427515 gene locus_tag LOCUS_19200 425878 427515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 427527 428210 gene locus_tag LOCUS_19210 gene fabG 427527 428210 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_19210 428217 429206 gene locus_tag LOCUS_19220 428217 429206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 429203 430504 gene locus_tag LOCUS_19230 gene aepX 429203 430504 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_19230 430504 431628 gene locus_tag LOCUS_19240 gene aepY 430504 431628 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817136.1 protein_id gnl|my_center|LOCUS_19240 431625 432764 gene locus_tag LOCUS_19250 431625 432764 CDS product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 protein_id gnl|my_center|LOCUS_19250 432765 433958 gene locus_tag LOCUS_19260 432765 433958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 433955 434773 gene locus_tag LOCUS_19270 gene legH 433955 434773 CDS product N-acetyltransferase LegH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856586.1 protein_id gnl|my_center|LOCUS_19270 434770 436047 gene locus_tag LOCUS_19280 434770 436047 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965493.1 protein_id gnl|my_center|LOCUS_19280 436110 437066 gene locus_tag LOCUS_19290 436110 437066 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_19290 437094 438380 gene locus_tag LOCUS_19300 437094 438380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_19300 438384 439457 gene locus_tag LOCUS_19310 438384 439457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 439472 440641 gene locus_tag LOCUS_19320 439472 440641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 440691 441974 gene locus_tag LOCUS_19330 440691 441974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_19330 442163 443455 gene locus_tag LOCUS_19340 442163 443455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 443457 444587 gene locus_tag LOCUS_19350 443457 444587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 444589 445023 gene locus_tag LOCUS_19360 444589 445023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 445020 446132 gene locus_tag LOCUS_19370 gene rfbE 445020 446132 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_19370 446156 447853 gene locus_tag LOCUS_19380 446156 447853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 447891 448679 gene locus_tag LOCUS_19390 447891 448679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 448691 449461 gene locus_tag LOCUS_19400 448691 449461 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780983.1 protein_id gnl|my_center|LOCUS_19400 449478 450665 gene locus_tag LOCUS_19410 449478 450665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 450669 451790 gene locus_tag LOCUS_19420 450669 451790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 451845 452972 gene locus_tag LOCUS_19430 451845 452972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 453010 454248 gene locus_tag LOCUS_19440 453010 454248 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_19440 454314 455432 gene locus_tag LOCUS_19450 454314 455432 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_19450 455456 456508 gene locus_tag LOCUS_19460 455456 456508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 456496 457152 gene locus_tag LOCUS_19470 456496 457152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 457243 457878 gene locus_tag LOCUS_19480 457243 457878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 457879 458865 gene locus_tag LOCUS_19490 457879 458865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 458874 460277 gene locus_tag LOCUS_19500 458874 460277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 460261 461463 gene locus_tag LOCUS_19510 460261 461463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 461460 462635 gene locus_tag LOCUS_19520 461460 462635 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_19520 462636 463568 gene locus_tag LOCUS_19530 462636 463568 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124535.1 protein_id gnl|my_center|LOCUS_19530 463570 464271 gene locus_tag LOCUS_19540 463570 464271 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_19540 464268 464936 gene locus_tag LOCUS_19550 464268 464936 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_19550 464936 465859 gene locus_tag LOCUS_19560 464936 465859 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028148.1 protein_id gnl|my_center|LOCUS_19560 465911 467068 gene locus_tag LOCUS_19570 gene rffA 465911 467068 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_19570 467145 468485 gene locus_tag LOCUS_19580 467145 468485 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440270.1 protein_id gnl|my_center|LOCUS_19580 468895 469374 gene locus_tag LOCUS_19590 468895 469374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 469430 470374 gene locus_tag LOCUS_19600 469430 470374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 470381 471751 gene locus_tag LOCUS_19610 470381 471751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 471738 472868 gene locus_tag LOCUS_19620 471738 472868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 472872 474755 gene locus_tag LOCUS_19630 gene asnB 472872 474755 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_19630 474752 475882 gene locus_tag LOCUS_19640 474752 475882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 475975 477312 gene locus_tag LOCUS_19650 475975 477312 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_19650 477309 478328 gene locus_tag LOCUS_19660 477309 478328 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_19660 478333 479634 gene locus_tag LOCUS_19670 478333 479634 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_19670 479636 480826 gene locus_tag LOCUS_19680 479636 480826 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_19680 480843 481658 gene locus_tag LOCUS_19690 480843 481658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 481685 482647 gene locus_tag LOCUS_19700 481685 482647 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_19700 482650 484449 gene locus_tag LOCUS_19710 gene asnB 482650 484449 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_19710 484409 485209 gene locus_tag LOCUS_19720 484409 485209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 485217 485882 gene locus_tag LOCUS_19730 485217 485882 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_19730 485884 486576 gene locus_tag LOCUS_19740 485884 486576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 486582 487460 gene locus_tag LOCUS_19750 486582 487460 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_19750 487997 487788 gene locus_tag LOCUS_19760 487997 487788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 488146 489066 gene locus_tag LOCUS_19770 488146 489066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 489066 490280 gene locus_tag LOCUS_19780 489066 490280 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203509.1 protein_id gnl|my_center|LOCUS_19780 490283 490873 gene locus_tag LOCUS_19790 490283 490873 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_19790 491060 492985 gene locus_tag LOCUS_19800 491060 492985 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_19800 493043 494722 gene locus_tag LOCUS_19810 493043 494722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 495013 497505 gene locus_tag LOCUS_19820 495013 497505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 497750 498844 gene locus_tag LOCUS_19830 497750 498844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 499243 500799 gene locus_tag LOCUS_19840 499243 500799 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_19840 500844 501050 gene locus_tag LOCUS_19850 500844 501050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 501131 501568 gene locus_tag LOCUS_19860 501131 501568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 501668 502462 gene locus_tag LOCUS_19870 501668 502462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 502463 503938 gene locus_tag LOCUS_19880 gene guaB 502463 503938 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404245.1 protein_id gnl|my_center|LOCUS_19880 504141 504641 gene locus_tag LOCUS_19890 504141 504641 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285028.1 protein_id gnl|my_center|LOCUS_19890 504738 505445 gene locus_tag LOCUS_19900 504738 505445 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_19900 506482 505640 gene locus_tag LOCUS_19910 506482 505640 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944036.1 protein_id gnl|my_center|LOCUS_19910 506598 507182 gene locus_tag LOCUS_19920 506598 507182 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_19920 507192 508925 gene locus_tag LOCUS_19930 507192 508925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 510724 509366 gene locus_tag LOCUS_19940 510724 509366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 511901 510927 gene locus_tag LOCUS_19950 511901 510927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 512732 514060 gene locus_tag LOCUS_19960 512732 514060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 514277 514663 gene locus_tag LOCUS_19970 514277 514663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 515807 515652 gene locus_tag LOCUS_19980 515807 515652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 515758 516207 gene locus_tag LOCUS_19990 515758 516207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 516170 516559 gene locus_tag LOCUS_20000 516170 516559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 516599 516784 gene locus_tag LOCUS_20010 516599 516784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 516939 518876 gene locus_tag LOCUS_20020 516939 518876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 519191 519454 gene locus_tag LOCUS_20030 519191 519454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 519994 520851 gene locus_tag LOCUS_20040 519994 520851 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_20040 520856 522571 gene locus_tag LOCUS_20050 520856 522571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 522668 524269 gene locus_tag LOCUS_20060 522668 524269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 525044 524271 gene locus_tag LOCUS_20070 525044 524271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 526542 525034 gene locus_tag LOCUS_20080 526542 525034 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_20080 527087 526581 gene locus_tag LOCUS_20090 527087 526581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 528202 527081 gene locus_tag LOCUS_20100 528202 527081 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_20100 528696 530330 gene locus_tag LOCUS_20110 528696 530330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 530337 531278 gene locus_tag LOCUS_20120 530337 531278 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_20120 531275 532012 gene locus_tag LOCUS_20130 531275 532012 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_20130 532709 531999 gene locus_tag LOCUS_20140 532709 531999 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533626.1 protein_id gnl|my_center|LOCUS_20140 534994 532706 gene locus_tag LOCUS_20150 534994 532706 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_20150 535839 535000 gene locus_tag LOCUS_20160 gene folP 535839 535000 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_20160 537863 535836 gene locus_tag LOCUS_20170 gene metG 537863 535836 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_20170 538629 538279 gene locus_tag LOCUS_20180 538629 538279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 538823 538629 gene locus_tag LOCUS_20190 538823 538629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 539214 538801 gene locus_tag LOCUS_20200 539214 538801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 539584 540123 gene locus_tag LOCUS_20210 539584 540123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405531.1 protein_id gnl|my_center|LOCUS_20210 541150 540170 gene locus_tag LOCUS_20220 541150 540170 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_20220 541290 543683 gene locus_tag LOCUS_20230 541290 543683 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_20230 543756 543831 gene locus_tag LOCUS_t00310 543756 543831 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 545009 544044 gene locus_tag LOCUS_20240 545009 544044 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_20240 547340 545166 gene locus_tag LOCUS_20250 547340 545166 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 protein_id gnl|my_center|LOCUS_20250 548304 548080 gene locus_tag LOCUS_20260 548304 548080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 548426 548947 gene locus_tag LOCUS_20270 548426 548947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 549851 549144 gene locus_tag LOCUS_20280 549851 549144 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_20280 550232 549897 gene locus_tag LOCUS_20290 550232 549897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 550772 550329 gene locus_tag LOCUS_20300 550772 550329 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358940.1 protein_id gnl|my_center|LOCUS_20300 551785 550811 gene locus_tag LOCUS_20310 551785 550811 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_20310 552873 551896 gene locus_tag LOCUS_20320 gene arsB 552873 551896 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498585.1 protein_id gnl|my_center|LOCUS_20320 554599 552992 gene locus_tag LOCUS_20330 554599 552992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 554813 554640 gene locus_tag LOCUS_20340 554813 554640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 555204 554776 gene locus_tag LOCUS_20350 555204 554776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 555555 555322 gene locus_tag LOCUS_20360 555555 555322 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_20360 555921 555616 gene locus_tag LOCUS_20370 555921 555616 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_20370 556148 557392 gene locus_tag LOCUS_20380 556148 557392 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_20380 559348 557723 gene locus_tag LOCUS_20390 559348 557723 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_20390 560077 559616 gene locus_tag LOCUS_20400 560077 559616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 560608 560144 gene locus_tag LOCUS_20410 560608 560144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 560740 561402 gene locus_tag LOCUS_20420 560740 561402 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865141.1 protein_id gnl|my_center|LOCUS_20420 561804 562763 gene locus_tag LOCUS_20430 561804 562763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 562900 564435 gene locus_tag LOCUS_20440 gene hutH 562900 564435 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_20440 564439 565347 gene locus_tag LOCUS_20450 564439 565347 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921423.1 protein_id gnl|my_center|LOCUS_20450 565372 566625 gene locus_tag LOCUS_20460 565372 566625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 566669 567451 gene locus_tag LOCUS_20470 566669 567451 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_20470 567594 568235 gene locus_tag LOCUS_20480 567594 568235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 568433 568933 gene locus_tag LOCUS_20490 568433 568933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 570448 568997 gene locus_tag LOCUS_20500 gene dnaB 570448 568997 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_20500 571360 570527 gene locus_tag LOCUS_20510 571360 570527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 572577 571357 gene locus_tag LOCUS_20520 gene coaBC 572577 571357 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_20520 572962 572663 gene locus_tag LOCUS_20530 572962 572663 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421566.1 protein_id gnl|my_center|LOCUS_20530 573530 572976 gene locus_tag LOCUS_20540 gene gmk 573530 572976 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402819.1 protein_id gnl|my_center|LOCUS_20540 574418 573537 gene locus_tag LOCUS_20550 574418 573537 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931938.1 protein_id gnl|my_center|LOCUS_20550 575258 574428 gene locus_tag LOCUS_20560 575258 574428 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_20560 576062 575322 gene locus_tag LOCUS_20570 576062 575322 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933426.1 protein_id gnl|my_center|LOCUS_20570 576216 576142 gene locus_tag LOCUS_t00320 576216 576142 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 576975 576514 gene locus_tag LOCUS_20580 576975 576514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 578193 580043 gene locus_tag LOCUS_20590 gene typA 578193 580043 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_20590 580047 580430 gene locus_tag LOCUS_20600 580047 580430 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_20600 580482 582188 gene locus_tag LOCUS_20610 580482 582188 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_20610 583541 582291 gene locus_tag LOCUS_20620 583541 582291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 586618 584168 gene locus_tag LOCUS_20630 586618 584168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 587162 588097 gene locus_tag LOCUS_20640 587162 588097 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246230.1 protein_id gnl|my_center|LOCUS_20640 588160 588627 gene locus_tag LOCUS_20650 588160 588627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 589972 588803 gene locus_tag LOCUS_20660 589972 588803 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 protein_id gnl|my_center|LOCUS_20660 591064 590336 gene locus_tag LOCUS_20670 591064 590336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 592457 591075 gene locus_tag LOCUS_20680 592457 591075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 593190 595007 gene locus_tag LOCUS_20690 593190 595007 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_20690 595073 596185 gene locus_tag LOCUS_20700 595073 596185 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 protein_id gnl|my_center|LOCUS_20700 596200 596688 gene locus_tag LOCUS_20710 596200 596688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 597660 596878 gene locus_tag LOCUS_20720 597660 596878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 597806 597890 gene locus_tag LOCUS_t00330 597806 597890 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 597915 599723 gene locus_tag LOCUS_20730 gene recJ 597915 599723 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_20730 599739 600467 gene locus_tag LOCUS_20740 599739 600467 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933329.1 protein_id gnl|my_center|LOCUS_20740 600489 601052 gene locus_tag LOCUS_20750 gene ruvC 600489 601052 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405380.1 protein_id gnl|my_center|LOCUS_20750 601049 601678 gene locus_tag LOCUS_20760 gene ruvA 601049 601678 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_20760 601695 602375 gene locus_tag LOCUS_20770 601695 602375 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_20770 602955 602617 gene locus_tag LOCUS_20780 602955 602617 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_20780 603337 602960 gene locus_tag LOCUS_20790 gene crcB 603337 602960 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_20790 604120 603746 gene locus_tag LOCUS_20800 604120 603746 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_20800 606371 604242 gene locus_tag LOCUS_20810 606371 604242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 607708 606407 gene locus_tag LOCUS_20820 607708 606407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 609410 607746 gene locus_tag LOCUS_20830 609410 607746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 611721 609493 gene locus_tag LOCUS_20840 611721 609493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 612633 611734 gene locus_tag LOCUS_20850 612633 611734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 613000 614718 gene locus_tag LOCUS_20860 613000 614718 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475821.1 protein_id gnl|my_center|LOCUS_20860 614720 615310 gene locus_tag LOCUS_20870 614720 615310 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_20870 615311 616294 gene locus_tag LOCUS_20880 615311 616294 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_20880 616330 616788 gene locus_tag LOCUS_20890 616330 616788 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_20890 616824 618236 gene locus_tag LOCUS_20900 616824 618236 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931971.1 protein_id gnl|my_center|LOCUS_20900 618266 619804 gene locus_tag LOCUS_20910 618266 619804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 620291 620992 gene locus_tag LOCUS_20920 620291 620992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 621659 622273 gene locus_tag LOCUS_20930 621659 622273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 622389 623780 gene locus_tag LOCUS_20940 gene murJ 622389 623780 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016596.1 protein_id gnl|my_center|LOCUS_20940 623791 624696 gene locus_tag LOCUS_20950 623791 624696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 624924 627065 gene locus_tag LOCUS_20960 624924 627065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 627126 628088 gene locus_tag LOCUS_20970 627126 628088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 628069 629184 gene locus_tag LOCUS_20980 628069 629184 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023718.1 protein_id gnl|my_center|LOCUS_20980 629194 629601 gene locus_tag LOCUS_20990 629194 629601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 629685 630800 gene locus_tag LOCUS_21000 629685 630800 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence04 1555 1085 gene locus_tag LOCUS_21010 1555 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3083 2004 gene locus_tag LOCUS_21020 3083 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3705 3902 gene locus_tag LOCUS_21030 3705 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4038 7340 gene locus_tag LOCUS_21040 4038 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21040 7306 7881 gene locus_tag LOCUS_21050 7306 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 7889 8980 gene locus_tag LOCUS_21060 7889 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 9007 9882 gene locus_tag LOCUS_21070 9007 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 10902 9883 gene locus_tag LOCUS_21080 10902 9883 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932714.1 protein_id gnl|my_center|LOCUS_21080 11531 10944 gene locus_tag LOCUS_21090 11531 10944 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_21090 11908 11546 gene locus_tag LOCUS_21100 11908 11546 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_21100 11945 12988 gene locus_tag LOCUS_21110 11945 12988 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880036.1 protein_id gnl|my_center|LOCUS_21110 13017 13184 gene locus_tag LOCUS_21120 13017 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21120 13150 14139 gene locus_tag LOCUS_21130 13150 14139 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21130 14161 14322 gene locus_tag LOCUS_21140 14161 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 15014 14391 gene locus_tag LOCUS_21150 15014 14391 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_21150 15541 15095 gene locus_tag LOCUS_21160 gene rplS 15541 15095 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932835.1 protein_id gnl|my_center|LOCUS_21160 16245 15568 gene locus_tag LOCUS_21170 gene trmD 16245 15568 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932836.1 protein_id gnl|my_center|LOCUS_21170 16813 16265 gene locus_tag LOCUS_21180 gene rimM 16813 16265 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575298.1 protein_id gnl|my_center|LOCUS_21180 17072 16821 gene locus_tag LOCUS_21190 17072 16821 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872031.1 protein_id gnl|my_center|LOCUS_21190 17619 17176 gene locus_tag LOCUS_21200 gene rpsP 17619 17176 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932838.1 protein_id gnl|my_center|LOCUS_21200 19021 17663 gene locus_tag LOCUS_21210 gene ffh 19021 17663 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_21210 19603 20070 gene locus_tag LOCUS_21220 19603 20070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 20407 21135 gene locus_tag LOCUS_21230 20407 21135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 21879 22844 gene locus_tag LOCUS_21240 21879 22844 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_21240 22900 24129 gene locus_tag LOCUS_21250 22900 24129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 24771 24238 gene locus_tag LOCUS_21260 24771 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 25930 27327 gene locus_tag LOCUS_21270 25930 27327 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_21270 27341 27742 gene locus_tag LOCUS_21280 27341 27742 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963594.1 protein_id gnl|my_center|LOCUS_21280 27749 28615 gene locus_tag LOCUS_21290 gene nadC 27749 28615 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_21290 28673 29179 gene locus_tag LOCUS_21300 28673 29179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 29208 29627 gene locus_tag LOCUS_21310 29208 29627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 29630 30049 gene locus_tag LOCUS_21320 29630 30049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 30119 31567 gene locus_tag LOCUS_21330 30119 31567 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_21330 31794 32420 gene locus_tag LOCUS_21340 gene lexA 31794 32420 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_21340 33767 32454 gene locus_tag LOCUS_21350 gene purB 33767 32454 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932669.1 protein_id gnl|my_center|LOCUS_21350 36267 33859 gene locus_tag LOCUS_21360 36267 33859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 39298 36569 gene locus_tag LOCUS_21370 39298 36569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 40790 39375 gene locus_tag LOCUS_21380 40790 39375 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_21380 41438 40800 gene locus_tag LOCUS_21390 41438 40800 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_21390 41716 43878 gene locus_tag LOCUS_21400 41716 43878 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_21400 44233 45201 gene locus_tag LOCUS_21410 44233 45201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 45440 45351 gene locus_tag LOCUS_t00340 45440 45351 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46882 45512 gene locus_tag LOCUS_21420 gene rseP 46882 45512 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_21420 48131 46968 gene locus_tag LOCUS_21430 48131 46968 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_21430 48872 48228 gene locus_tag LOCUS_21440 48872 48228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 49881 48892 gene locus_tag LOCUS_21450 49881 48892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 50658 49939 gene locus_tag LOCUS_21460 50658 49939 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_21460 50830 50757 gene locus_tag LOCUS_t00350 50830 50757 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 51395 51892 gene locus_tag LOCUS_21470 51395 51892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 52026 52098 gene locus_tag LOCUS_t00360 52026 52098 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 52339 53577 gene locus_tag LOCUS_21480 gene xseA 52339 53577 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_21480 53610 53834 gene locus_tag LOCUS_21490 53610 53834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 53877 55787 gene locus_tag LOCUS_21500 gene dxs 53877 55787 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_21500 55780 56241 gene locus_tag LOCUS_21510 55780 56241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 56245 57666 gene locus_tag LOCUS_21520 gene miaB 56245 57666 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_21520 57975 58595 gene locus_tag LOCUS_21530 57975 58595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 58585 59607 gene locus_tag LOCUS_21540 58585 59607 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_21540 59880 59599 gene locus_tag LOCUS_21550 59880 59599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 60560 59952 gene locus_tag LOCUS_21560 60560 59952 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_21560 61635 60520 gene locus_tag LOCUS_21570 gene ribD 61635 60520 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932429.1 protein_id gnl|my_center|LOCUS_21570 62290 61625 gene locus_tag LOCUS_21580 62290 61625 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932940.1 protein_id gnl|my_center|LOCUS_21580 63090 62287 gene locus_tag LOCUS_21590 63090 62287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 63757 63065 gene locus_tag LOCUS_21600 63757 63065 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_21600 64746 63754 gene locus_tag LOCUS_21610 gene lpxK 64746 63754 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881075.1 protein_id gnl|my_center|LOCUS_21610 65427 64831 gene locus_tag LOCUS_21620 65427 64831 CDS product DUF374 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933339.1 protein_id gnl|my_center|LOCUS_21620 66571 65435 gene locus_tag LOCUS_21630 gene lpxB 66571 65435 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_21630 67993 66632 gene locus_tag LOCUS_21640 67993 66632 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_21640 68386 69447 gene locus_tag LOCUS_21650 gene bpsA 68386 69447 CDS product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 protein_id gnl|my_center|LOCUS_21650 69477 69980 gene locus_tag LOCUS_21660 gene bpsB 69477 69980 CDS product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 protein_id gnl|my_center|LOCUS_21660 69995 70306 gene locus_tag LOCUS_21670 69995 70306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_21670 70546 71442 gene locus_tag LOCUS_21680 gene prfB 70546 71442 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453255.1 protein_id gnl|my_center|LOCUS_21680 71453 72670 gene locus_tag LOCUS_21690 71453 72670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404265.1 protein_id gnl|my_center|LOCUS_21690 72672 73370 gene locus_tag LOCUS_21700 gene ubiE 72672 73370 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926864.1 protein_id gnl|my_center|LOCUS_21700 73630 73854 gene locus_tag LOCUS_21710 73630 73854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 74408 74001 gene locus_tag LOCUS_21720 74408 74001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 75167 74481 gene locus_tag LOCUS_21730 75167 74481 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_21730 79243 75176 gene locus_tag LOCUS_21740 79243 75176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21740 83893 79247 gene locus_tag LOCUS_21750 83893 79247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21750 93246 83968 gene locus_tag LOCUS_21760 93246 83968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 94581 93286 gene locus_tag LOCUS_21770 94581 93286 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_21770 95277 94834 gene locus_tag LOCUS_21780 95277 94834 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_21780 96627 95362 gene locus_tag LOCUS_21790 96627 95362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 99109 96845 gene locus_tag LOCUS_21800 99109 96845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 100935 99451 gene locus_tag LOCUS_21810 100935 99451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 101235 102560 gene locus_tag LOCUS_21820 101235 102560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 105851 102675 gene locus_tag LOCUS_21830 105851 102675 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_21830 106801 105884 gene locus_tag LOCUS_21840 106801 105884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 108347 106968 gene locus_tag LOCUS_21850 108347 106968 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_21850 108978 108337 gene locus_tag LOCUS_21860 108978 108337 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_21860 109561 110949 gene locus_tag LOCUS_21870 109561 110949 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_21870 111007 111516 gene locus_tag LOCUS_21880 111007 111516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21880 111483 111770 gene locus_tag LOCUS_21890 111483 111770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 111796 112380 gene locus_tag LOCUS_21900 111796 112380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 113330 112647 gene locus_tag LOCUS_21910 113330 112647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21910 113650 113327 gene locus_tag LOCUS_21920 113650 113327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21920 114736 113675 gene locus_tag LOCUS_21930 114736 113675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_21930 115855 114788 gene locus_tag LOCUS_21940 115855 114788 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459031.1 protein_id gnl|my_center|LOCUS_21940 116922 115897 gene locus_tag LOCUS_21950 116922 115897 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458995.1 protein_id gnl|my_center|LOCUS_21950 118894 116927 gene locus_tag LOCUS_21960 118894 116927 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_21960 120012 121481 gene locus_tag LOCUS_21970 120012 121481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 122644 121805 gene locus_tag LOCUS_21980 122644 121805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 125952 122956 gene locus_tag LOCUS_21990 125952 122956 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_21990 126306 127667 gene locus_tag LOCUS_22000 126306 127667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 127830 128684 gene locus_tag LOCUS_22010 127830 128684 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385232.1 protein_id gnl|my_center|LOCUS_22010 128733 130403 gene locus_tag LOCUS_22020 128733 130403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 130431 131354 gene locus_tag LOCUS_22030 gene miaA 130431 131354 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965140.1 protein_id gnl|my_center|LOCUS_22030 132445 131777 gene locus_tag LOCUS_22040 132445 131777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 132467 133237 gene locus_tag LOCUS_22050 132467 133237 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_22050 133535 134602 gene locus_tag LOCUS_22060 133535 134602 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_22060 134704 135942 gene locus_tag LOCUS_22070 134704 135942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 135949 137259 gene locus_tag LOCUS_22080 gene purD 135949 137259 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016802.1 protein_id gnl|my_center|LOCUS_22080 137265 138284 gene locus_tag LOCUS_22090 gene galE 137265 138284 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_22090 138312 139256 gene locus_tag LOCUS_22100 gene meaB 138312 139256 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_22100 139375 141525 gene locus_tag LOCUS_22110 139375 141525 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931897.1 protein_id gnl|my_center|LOCUS_22110 141624 142358 gene locus_tag LOCUS_22120 141624 142358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 142374 144020 gene locus_tag LOCUS_22130 142374 144020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 144030 144827 gene locus_tag LOCUS_22140 144030 144827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 145472 148756 gene locus_tag LOCUS_22150 145472 148756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 148879 150063 gene locus_tag LOCUS_22160 148879 150063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 150097 150621 gene locus_tag LOCUS_22170 150097 150621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 150621 151148 gene locus_tag LOCUS_22180 150621 151148 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_22180 151368 151793 gene locus_tag LOCUS_22190 151368 151793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 151847 152278 gene locus_tag LOCUS_22200 gene ybeY 151847 152278 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783716.1 protein_id gnl|my_center|LOCUS_22200 152282 152737 gene locus_tag LOCUS_22210 152282 152737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 152795 155143 gene locus_tag LOCUS_22220 gene topA 152795 155143 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_22220 155171 156778 gene locus_tag LOCUS_22230 155171 156778 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506028.1 protein_id gnl|my_center|LOCUS_22230 156784 158121 gene locus_tag LOCUS_22240 156784 158121 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_22240 158133 159080 gene locus_tag LOCUS_22250 gene xerC 158133 159080 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_22250 159258 159614 gene locus_tag LOCUS_22260 159258 159614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 160102 159698 gene locus_tag LOCUS_22270 160102 159698 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_22270 160674 160255 gene locus_tag LOCUS_22280 160674 160255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 161448 160867 gene locus_tag LOCUS_22290 gene lmtA 161448 160867 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_22290 162253 161522 gene locus_tag LOCUS_22300 162253 161522 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_22300 165851 162234 gene locus_tag LOCUS_22310 gene smc 165851 162234 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933370.1 protein_id gnl|my_center|LOCUS_22310 168472 165863 gene locus_tag LOCUS_22320 168472 165863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 169265 168576 gene locus_tag LOCUS_22330 169265 168576 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_22330 171078 169285 gene locus_tag LOCUS_22340 gene aspS 171078 169285 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_22340 172386 171238 gene locus_tag LOCUS_22350 gene hppD 172386 171238 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_22350 173764 172808 gene locus_tag LOCUS_22360 173764 172808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 175148 174468 gene locus_tag LOCUS_22370 175148 174468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567248.1 protein_id gnl|my_center|LOCUS_22370 176032 175145 gene locus_tag LOCUS_22380 176032 175145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 176707 176120 gene locus_tag LOCUS_22390 176707 176120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 177360 176764 gene locus_tag LOCUS_22400 177360 176764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 177766 177350 gene locus_tag LOCUS_22410 177766 177350 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_22410 178675 177827 gene locus_tag LOCUS_22420 178675 177827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 180545 178950 gene locus_tag LOCUS_22430 180545 178950 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_22430 181416 180589 gene locus_tag LOCUS_22440 181416 180589 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971637.1 protein_id gnl|my_center|LOCUS_22440 181992 181450 gene locus_tag LOCUS_22450 181992 181450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 182793 182275 gene locus_tag LOCUS_22460 182793 182275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 183577 182912 gene locus_tag LOCUS_22470 183577 182912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 184523 183717 gene locus_tag LOCUS_22480 184523 183717 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_22480 185180 184626 gene locus_tag LOCUS_22490 185180 184626 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989581.1 protein_id gnl|my_center|LOCUS_22490 185612 185193 gene locus_tag LOCUS_22500 185612 185193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 186164 185709 gene locus_tag LOCUS_22510 186164 185709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 186606 186190 gene locus_tag LOCUS_22520 186606 186190 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967708.1 protein_id gnl|my_center|LOCUS_22520 186959 186603 gene locus_tag LOCUS_22530 186959 186603 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_22530 188462 187245 gene locus_tag LOCUS_22540 188462 187245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 189324 188677 gene locus_tag LOCUS_22550 189324 188677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 190121 189696 gene locus_tag LOCUS_22560 190121 189696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 190602 190309 gene locus_tag LOCUS_22570 190602 190309 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_22570 191167 190808 gene locus_tag LOCUS_22580 191167 190808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 191778 191296 gene locus_tag LOCUS_22590 191778 191296 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_22590 192497 191919 gene locus_tag LOCUS_22600 192497 191919 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_22600 193880 192627 gene locus_tag LOCUS_22610 193880 192627 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948582.1 protein_id gnl|my_center|LOCUS_22610 194577 193984 gene locus_tag LOCUS_22620 194577 193984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 195732 194785 gene locus_tag LOCUS_22630 195732 194785 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_22630 196099 195773 gene locus_tag LOCUS_22640 196099 195773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 198264 196552 gene locus_tag LOCUS_22650 198264 196552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 198849 198490 gene locus_tag LOCUS_22660 198849 198490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 199333 198953 gene locus_tag LOCUS_22670 199333 198953 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_22670 200406 199501 gene locus_tag LOCUS_22680 gene bla 200406 199501 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_22680 200848 200555 gene locus_tag LOCUS_22690 200848 200555 CDS product RNA polymerase alpha subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255732.1 protein_id gnl|my_center|LOCUS_22690 201353 201054 gene locus_tag LOCUS_22700 201353 201054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 202774 201476 gene locus_tag LOCUS_22710 202774 201476 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_22710 203874 203005 gene locus_tag LOCUS_22720 203874 203005 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_22720 204814 204146 gene locus_tag LOCUS_22730 gene paiB 204814 204146 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_22730 205584 205009 gene locus_tag LOCUS_22740 205584 205009 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_22740 206641 205784 gene locus_tag LOCUS_22750 206641 205784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 207743 207177 gene locus_tag LOCUS_22760 207743 207177 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_22760 208539 207997 gene locus_tag LOCUS_22770 208539 207997 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085781.1 protein_id gnl|my_center|LOCUS_22770 209377 208700 gene locus_tag LOCUS_22780 gene sodA 209377 208700 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_22780 210203 209610 gene locus_tag LOCUS_22790 210203 209610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020541.1 protein_id gnl|my_center|LOCUS_22790 211263 210469 gene locus_tag LOCUS_22800 211263 210469 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_22800 213259 212438 gene locus_tag LOCUS_22810 213259 212438 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_22810 214581 213640 gene locus_tag LOCUS_22820 214581 213640 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_22820 215037 214774 gene locus_tag LOCUS_22830 215037 214774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 215391 215134 gene locus_tag LOCUS_22840 215391 215134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 216453 215566 gene locus_tag LOCUS_22850 216453 215566 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_22850 217148 216672 gene locus_tag LOCUS_22860 217148 216672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 217536 217255 gene locus_tag LOCUS_22870 217536 217255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 218610 218152 gene locus_tag LOCUS_22880 218610 218152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 220339 219467 gene locus_tag LOCUS_22890 220339 219467 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_22890 221305 220883 gene locus_tag LOCUS_22900 221305 220883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 223327 221345 gene locus_tag LOCUS_22910 223327 221345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 224449 223901 gene locus_tag LOCUS_22920 224449 223901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 226209 225643 gene locus_tag LOCUS_22930 226209 225643 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_22930 227090 226212 gene locus_tag LOCUS_22940 227090 226212 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_22940 228159 227080 gene locus_tag LOCUS_22950 228159 227080 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_22950 228564 228232 gene locus_tag LOCUS_22960 228564 228232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 229417 229899 gene locus_tag LOCUS_22970 229417 229899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 229931 230329 gene locus_tag LOCUS_22980 229931 230329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 231324 230842 gene locus_tag LOCUS_22990 gene rraA 231324 230842 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_22990 232388 231339 gene locus_tag LOCUS_23000 232388 231339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 233474 236992 gene locus_tag LOCUS_23010 233474 236992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 237096 239945 gene locus_tag LOCUS_23020 237096 239945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 241256 240147 gene locus_tag LOCUS_23030 241256 240147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 243447 241510 gene locus_tag LOCUS_23040 243447 241510 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_23040 243807 243598 gene locus_tag LOCUS_23050 243807 243598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 244475 243819 gene locus_tag LOCUS_23060 gene cobO 244475 243819 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251080.1 protein_id gnl|my_center|LOCUS_23060 246543 244663 gene locus_tag LOCUS_23070 246543 244663 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_23070 247577 247137 gene locus_tag LOCUS_23080 247577 247137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 248783 247590 gene locus_tag LOCUS_23090 248783 247590 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927123.1 protein_id gnl|my_center|LOCUS_23090 248912 249892 gene locus_tag LOCUS_23100 248912 249892 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_23100 250045 251691 gene locus_tag LOCUS_23110 gene argS 250045 251691 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931709.1 protein_id gnl|my_center|LOCUS_23110 252194 251733 gene locus_tag LOCUS_23120 252194 251733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 257367 252337 gene locus_tag LOCUS_23130 257367 252337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 257532 258245 gene locus_tag LOCUS_23140 257532 258245 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_23140 258260 259051 gene locus_tag LOCUS_23150 258260 259051 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_23150 259044 259493 gene locus_tag LOCUS_23160 259044 259493 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421610.1 protein_id gnl|my_center|LOCUS_23160 259490 260233 gene locus_tag LOCUS_23170 gene truA 259490 260233 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544911.1 protein_id gnl|my_center|LOCUS_23170 261050 260343 gene locus_tag LOCUS_23180 261050 260343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 261430 262359 gene locus_tag LOCUS_23190 261430 262359 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_23190 262362 263375 gene locus_tag LOCUS_23200 262362 263375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 264594 263362 gene locus_tag LOCUS_23210 264594 263362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_23210 265830 264604 gene locus_tag LOCUS_23220 265830 264604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_23220 266592 265843 gene locus_tag LOCUS_23230 266592 265843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_23230 267979 266624 gene locus_tag LOCUS_23240 267979 266624 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_23240 269358 268015 gene locus_tag LOCUS_23250 269358 268015 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405552.1 protein_id gnl|my_center|LOCUS_23250 269822 270226 gene locus_tag LOCUS_23260 269822 270226 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_23260 270227 271018 gene locus_tag LOCUS_23270 270227 271018 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_23270 272684 271074 gene locus_tag LOCUS_23280 272684 271074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 275793 272965 gene locus_tag LOCUS_23290 275793 272965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 276075 276311 gene locus_tag LOCUS_23300 276075 276311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 276308 277138 gene locus_tag LOCUS_23310 276308 277138 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_23310 277189 277632 gene locus_tag LOCUS_23320 277189 277632 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_23320 277834 280371 gene locus_tag LOCUS_23330 277834 280371 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_23330 280378 281382 gene locus_tag LOCUS_23340 280378 281382 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_23340 281598 282467 gene locus_tag LOCUS_23350 gene ispE 281598 282467 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_23350 283361 282480 gene locus_tag LOCUS_23360 283361 282480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 284097 283363 gene locus_tag LOCUS_23370 gene truA 284097 283363 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544911.1 protein_id gnl|my_center|LOCUS_23370 284867 284106 gene locus_tag LOCUS_23380 284867 284106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 286714 284873 gene locus_tag LOCUS_23390 gene dsbD 286714 284873 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_23390 286966 287214 gene locus_tag LOCUS_23400 286966 287214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 287285 288103 gene locus_tag LOCUS_23410 287285 288103 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932247.1 protein_id gnl|my_center|LOCUS_23410 288110 289768 gene locus_tag LOCUS_23420 gene ggt 288110 289768 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_23420 289801 291453 gene locus_tag LOCUS_23430 289801 291453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 292765 291458 gene locus_tag LOCUS_23440 292765 291458 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_23440 293649 292789 gene locus_tag LOCUS_23450 293649 292789 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_23450 295203 294151 gene locus_tag LOCUS_23460 295203 294151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 295873 295280 gene locus_tag LOCUS_23470 295873 295280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 296689 296072 gene locus_tag LOCUS_23480 296689 296072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 298781 296898 gene locus_tag LOCUS_23490 298781 296898 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228601.1 protein_id gnl|my_center|LOCUS_23490 298992 299174 gene locus_tag LOCUS_23500 298992 299174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 300053 299373 gene locus_tag LOCUS_23510 300053 299373 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_23510 302497 300134 gene locus_tag LOCUS_23520 302497 300134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 302843 304021 gene locus_tag LOCUS_23530 gene dinB 302843 304021 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 protein_id gnl|my_center|LOCUS_23530 306010 304319 gene locus_tag LOCUS_23540 306010 304319 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_23540 306134 306934 gene locus_tag LOCUS_23550 306134 306934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 306981 307814 gene locus_tag LOCUS_23560 306981 307814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 308594 307935 gene locus_tag LOCUS_23570 308594 307935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 308836 310227 gene locus_tag LOCUS_23580 gene lpdA 308836 310227 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_23580 310291 310710 gene locus_tag LOCUS_23590 310291 310710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 310732 311256 gene locus_tag LOCUS_23600 310732 311256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 312351 311335 gene locus_tag LOCUS_23610 312351 311335 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_23610 313136 312348 gene locus_tag LOCUS_23620 gene xth 313136 312348 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_23620 313238 315910 gene locus_tag LOCUS_23630 313238 315910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 315901 318840 gene locus_tag LOCUS_23640 315901 318840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 319037 318837 gene locus_tag LOCUS_23650 319037 318837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 319319 319591 gene locus_tag LOCUS_23660 319319 319591 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_23660 319735 320187 gene locus_tag LOCUS_23670 319735 320187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 320485 322131 gene locus_tag LOCUS_23680 gene ettA 320485 322131 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_23680 322714 323280 gene locus_tag LOCUS_23690 322714 323280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 325649 323337 gene locus_tag LOCUS_23700 325649 323337 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 protein_id gnl|my_center|LOCUS_23700 326182 325712 gene locus_tag LOCUS_23710 326182 325712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 327504 326323 gene locus_tag LOCUS_23720 327504 326323 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932884.1 protein_id gnl|my_center|LOCUS_23720 328477 327536 gene locus_tag LOCUS_23730 328477 327536 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_23730 330155 328500 gene locus_tag LOCUS_23740 gene bshC 330155 328500 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_23740 330537 332288 gene locus_tag LOCUS_23750 330537 332288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 332627 334072 gene locus_tag LOCUS_23760 332627 334072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 334866 334264 gene locus_tag LOCUS_23770 334866 334264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 335888 334863 gene locus_tag LOCUS_23780 335888 334863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 336494 337546 gene locus_tag LOCUS_23790 336494 337546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 337565 338755 gene locus_tag LOCUS_23800 337565 338755 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_23800 339394 339011 gene locus_tag LOCUS_23810 339394 339011 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_23810 340404 339652 gene locus_tag LOCUS_23820 340404 339652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 341759 340677 gene locus_tag LOCUS_23830 341759 340677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 341885 342736 gene locus_tag LOCUS_23840 341885 342736 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_23840 342753 344198 gene locus_tag LOCUS_23850 342753 344198 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_23850 344436 346514 gene locus_tag LOCUS_23860 gene priA 344436 346514 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861610.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23860 346508 346939 gene locus_tag LOCUS_23870 346508 346939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23870 347212 347140 gene locus_tag LOCUS_t00370 347212 347140 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 347709 348293 gene locus_tag LOCUS_23880 347709 348293 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_23880 348503 349255 gene locus_tag LOCUS_23890 348503 349255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 349426 349800 gene locus_tag LOCUS_23900 349426 349800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 349904 350143 gene locus_tag LOCUS_23910 349904 350143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 350184 351287 gene locus_tag LOCUS_23920 350184 351287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 351438 352241 gene locus_tag LOCUS_23930 351438 352241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 352193 352840 gene locus_tag LOCUS_23940 352193 352840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 354421 353096 gene locus_tag LOCUS_23950 354421 353096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 354902 354546 gene locus_tag LOCUS_23960 354902 354546 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_23960 355205 354912 gene locus_tag LOCUS_23970 355205 354912 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_23970 355459 356700 gene locus_tag LOCUS_23980 355459 356700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 357228 356929 gene locus_tag LOCUS_23990 357228 356929 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_23990 357521 357240 gene locus_tag LOCUS_24000 357521 357240 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_24000 358199 357858 gene locus_tag LOCUS_24010 358199 357858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 358444 358196 gene locus_tag LOCUS_24020 358444 358196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 358672 358475 gene locus_tag LOCUS_24030 358672 358475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 358854 359063 gene locus_tag LOCUS_24040 358854 359063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 360354 359617 gene locus_tag LOCUS_24050 360354 359617 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_24050 360562 360269 gene locus_tag LOCUS_24060 360562 360269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 361191 360643 gene locus_tag LOCUS_24070 361191 360643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 362525 361803 gene locus_tag LOCUS_24080 362525 361803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 362932 362525 gene locus_tag LOCUS_24090 362932 362525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24090 363998 362925 gene locus_tag LOCUS_24100 363998 362925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 365983 363995 gene locus_tag LOCUS_24110 365983 363995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24110 366804 366079 gene locus_tag LOCUS_24120 366804 366079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24120 370129 366716 gene locus_tag LOCUS_24130 370129 366716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 372923 370224 gene locus_tag LOCUS_24140 372923 370224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 373568 373359 gene locus_tag LOCUS_24150 373568 373359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 374629 373976 gene locus_tag LOCUS_24160 374629 373976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24160 375080 374592 gene locus_tag LOCUS_24170 375080 374592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24170 375819 375544 gene locus_tag LOCUS_24180 375819 375544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 378884 376017 gene locus_tag LOCUS_24190 378884 376017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 382253 379128 gene locus_tag LOCUS_24200 382253 379128 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950392.1 protein_id gnl|my_center|LOCUS_24200 383158 382592 gene locus_tag LOCUS_24210 383158 382592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 383575 383267 gene locus_tag LOCUS_24220 383575 383267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 384308 383517 gene locus_tag LOCUS_24230 gene lgt 384308 383517 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_24230 384721 384308 gene locus_tag LOCUS_24240 384721 384308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 385964 384696 gene locus_tag LOCUS_24250 gene hisS 385964 384696 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366882.1 protein_id gnl|my_center|LOCUS_24250 386517 387569 gene locus_tag LOCUS_24260 386517 387569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 387743 388081 gene locus_tag LOCUS_24270 387743 388081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 388399 390558 gene locus_tag LOCUS_24280 388399 390558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 393952 390869 gene locus_tag LOCUS_24290 393952 390869 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_24290 395024 393954 gene locus_tag LOCUS_24300 395024 393954 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764016.1 protein_id gnl|my_center|LOCUS_24300 395284 397032 gene locus_tag LOCUS_24310 395284 397032 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_24310 398292 397201 gene locus_tag LOCUS_24320 398292 397201 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_24320 398837 399091 gene locus_tag LOCUS_24330 398837 399091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 399102 399956 gene locus_tag LOCUS_24340 399102 399956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 400705 400187 gene locus_tag LOCUS_24350 400705 400187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 401058 401909 gene locus_tag LOCUS_24360 401058 401909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_24360 402342 402605 gene locus_tag LOCUS_24370 402342 402605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 403334 404629 gene locus_tag LOCUS_24380 gene tig 403334 404629 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405385.1 protein_id gnl|my_center|LOCUS_24380 404708 405376 gene locus_tag LOCUS_24390 gene clpP 404708 405376 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933217.1 protein_id gnl|my_center|LOCUS_24390 405564 408224 gene locus_tag LOCUS_24400 405564 408224 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_24400 408280 410298 gene locus_tag LOCUS_24410 408280 410298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 410311 411372 gene locus_tag LOCUS_24420 410311 411372 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_24420 413278 411380 gene locus_tag LOCUS_24430 413278 411380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 414035 413355 gene locus_tag LOCUS_24440 gene phoU 414035 413355 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_24440 414855 414097 gene locus_tag LOCUS_24450 gene pstB 414855 414097 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_24450 415579 414902 gene locus_tag LOCUS_24460 415579 414902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_24460 416852 415626 gene locus_tag LOCUS_24470 416852 415626 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_24470 417704 416868 gene locus_tag LOCUS_24480 417704 416868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 419067 417730 gene locus_tag LOCUS_24490 419067 417730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 421330 419369 gene locus_tag LOCUS_24500 gene rnr 421330 419369 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926872.1 protein_id gnl|my_center|LOCUS_24500 426183 421531 gene locus_tag LOCUS_24510 426183 421531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 426675 426208 gene locus_tag LOCUS_24520 gene rfaE2 426675 426208 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_24520 427667 426672 gene locus_tag LOCUS_24530 gene rfaE1 427667 426672 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_24530 428339 427803 gene locus_tag LOCUS_24540 428339 427803 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060155.1 protein_id gnl|my_center|LOCUS_24540 428744 429181 gene locus_tag LOCUS_24550 428744 429181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 429962 432301 gene locus_tag LOCUS_24560 429962 432301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 435232 432368 gene locus_tag LOCUS_24570 435232 432368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 437389 436220 gene locus_tag LOCUS_24580 437389 436220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 437590 437411 gene locus_tag LOCUS_24590 437590 437411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 439877 438708 gene locus_tag LOCUS_24600 439877 438708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24600 441649 440390 gene locus_tag LOCUS_24610 441649 440390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 443986 442259 gene locus_tag LOCUS_24620 443986 442259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 444997 444005 gene locus_tag LOCUS_24630 gene rfaD 444997 444005 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_24630 445305 445072 gene locus_tag LOCUS_24640 445305 445072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 445694 445398 gene locus_tag LOCUS_24650 445694 445398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 446831 446043 gene locus_tag LOCUS_24660 446831 446043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24660 >Feature sequence05 504 262 gene locus_tag LOCUS_24670 504 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1399 971 gene locus_tag LOCUS_24680 1399 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24680 2006 1560 gene locus_tag LOCUS_24690 2006 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24690 3019 2222 gene locus_tag LOCUS_24700 3019 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24700 3450 2989 gene locus_tag LOCUS_24710 3450 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4597 3623 gene locus_tag LOCUS_24720 4597 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5732 4515 gene locus_tag LOCUS_24730 5732 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24730 7063 6029 gene locus_tag LOCUS_24740 7063 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 7760 6981 gene locus_tag LOCUS_24750 7760 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 11498 7854 gene locus_tag LOCUS_24760 11498 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 13684 11594 gene locus_tag LOCUS_24770 13684 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 16240 13913 gene locus_tag LOCUS_24780 16240 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 19225 16415 gene locus_tag LOCUS_24790 19225 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 20228 19398 gene locus_tag LOCUS_24800 20228 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24800 20637 20215 gene locus_tag LOCUS_24810 20637 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 23825 20967 gene locus_tag LOCUS_24820 23825 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 26774 23913 gene locus_tag LOCUS_24830 26774 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 27107 28315 gene locus_tag LOCUS_24840 27107 28315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 28635 29216 gene locus_tag LOCUS_24850 28635 29216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 31381 29246 gene locus_tag LOCUS_24860 31381 29246 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_24860 32139 31450 gene locus_tag LOCUS_24870 32139 31450 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_24870 33146 32136 gene locus_tag LOCUS_24880 33146 32136 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_24880 36750 33211 gene locus_tag LOCUS_24890 36750 33211 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_24890 37708 36800 gene locus_tag LOCUS_24900 37708 36800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_24900 38129 39178 gene locus_tag LOCUS_24910 gene pstS 38129 39178 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_24910 39212 40150 gene locus_tag LOCUS_24920 gene pstC 39212 40150 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_24920 40150 41022 gene locus_tag LOCUS_24930 gene pstA 40150 41022 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_24930 41031 41855 gene locus_tag LOCUS_24940 gene pstB 41031 41855 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_24940 42046 43023 gene locus_tag LOCUS_24950 42046 43023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 43237 44106 gene locus_tag LOCUS_24960 43237 44106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 44114 44368 gene locus_tag LOCUS_24970 44114 44368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 44358 45323 gene locus_tag LOCUS_24980 44358 45323 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803239.1 protein_id gnl|my_center|LOCUS_24980 45410 46837 gene locus_tag LOCUS_24990 45410 46837 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963737.1 protein_id gnl|my_center|LOCUS_24990 46916 48286 gene locus_tag LOCUS_25000 46916 48286 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_25000 48297 48641 gene locus_tag LOCUS_25010 48297 48641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 50010 48988 gene locus_tag LOCUS_25020 50010 48988 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 protein_id gnl|my_center|LOCUS_25020 51877 50027 gene locus_tag LOCUS_25030 gene yidC 51877 50027 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_25030 52644 52156 gene locus_tag LOCUS_25040 52644 52156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 53148 55541 gene locus_tag LOCUS_25050 53148 55541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 55731 58235 gene locus_tag LOCUS_25060 55731 58235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 58456 60891 gene locus_tag LOCUS_25070 58456 60891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 60988 62796 gene locus_tag LOCUS_25080 60988 62796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 62971 63426 gene locus_tag LOCUS_25090 62971 63426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 64227 63505 gene locus_tag LOCUS_25100 64227 63505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 64535 65974 gene locus_tag LOCUS_25110 64535 65974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 66030 66575 gene locus_tag LOCUS_25120 66030 66575 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012056.1 protein_id gnl|my_center|LOCUS_25120 66895 66695 gene locus_tag LOCUS_25130 66895 66695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 67785 66919 gene locus_tag LOCUS_25140 67785 66919 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384907.1 protein_id gnl|my_center|LOCUS_25140 68032 68631 gene locus_tag LOCUS_25150 68032 68631 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_25150 68944 70179 gene locus_tag LOCUS_25160 68944 70179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 70643 71140 gene locus_tag LOCUS_25170 70643 71140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 71174 72529 gene locus_tag LOCUS_25180 71174 72529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 72576 73280 gene locus_tag LOCUS_25190 72576 73280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 73623 75068 gene locus_tag LOCUS_25200 73623 75068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 75618 77078 gene locus_tag LOCUS_25210 75618 77078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 77300 78001 gene locus_tag LOCUS_25220 77300 78001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_25220 78145 78846 gene locus_tag LOCUS_25230 78145 78846 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_25230 79105 79377 gene locus_tag LOCUS_25240 79105 79377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 81995 79905 gene locus_tag LOCUS_25250 81995 79905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 82537 83289 gene locus_tag LOCUS_25260 82537 83289 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_25260 83471 83743 gene locus_tag LOCUS_25270 83471 83743 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 protein_id gnl|my_center|LOCUS_25270 83783 84181 gene locus_tag LOCUS_25280 83783 84181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 84315 86738 gene locus_tag LOCUS_25290 84315 86738 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_25290 87020 86778 gene locus_tag LOCUS_25300 87020 86778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 87114 87554 gene locus_tag LOCUS_25310 87114 87554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 88175 87558 gene locus_tag LOCUS_25320 88175 87558 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_25320 90071 88233 gene locus_tag LOCUS_25330 gene mutL 90071 88233 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_25330 91045 90101 gene locus_tag LOCUS_25340 gene ftsY 91045 90101 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931894.1 protein_id gnl|my_center|LOCUS_25340 92573 91428 gene locus_tag LOCUS_25350 92573 91428 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_25350 93349 92771 gene locus_tag LOCUS_25360 gene pyrE 93349 92771 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926797.1 protein_id gnl|my_center|LOCUS_25360 94192 93380 gene locus_tag LOCUS_25370 gene murI 94192 93380 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_25370 94327 96411 gene locus_tag LOCUS_25380 94327 96411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 96666 99815 gene locus_tag LOCUS_25390 96666 99815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 102800 99954 gene locus_tag LOCUS_25400 102800 99954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 106131 102913 gene locus_tag LOCUS_25410 106131 102913 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950392.1 protein_id gnl|my_center|LOCUS_25410 109078 106229 gene locus_tag LOCUS_25420 109078 106229 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950392.1 protein_id gnl|my_center|LOCUS_25420 111235 109088 gene locus_tag LOCUS_25430 111235 109088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25430 112062 111208 gene locus_tag LOCUS_25440 112062 111208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25440 112369 114528 gene locus_tag LOCUS_25450 112369 114528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 114797 115165 gene locus_tag LOCUS_25460 114797 115165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 115273 116082 gene locus_tag LOCUS_25470 115273 116082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 116141 118426 gene locus_tag LOCUS_25480 116141 118426 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_25480 118717 122445 gene locus_tag LOCUS_25490 118717 122445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 124780 123254 gene locus_tag LOCUS_25500 124780 123254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 125257 125448 gene locus_tag LOCUS_25510 125257 125448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 125455 125709 gene locus_tag LOCUS_25520 125455 125709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 129007 125819 gene locus_tag LOCUS_25530 129007 125819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 129159 130490 gene locus_tag LOCUS_25540 129159 130490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 131197 132519 gene locus_tag LOCUS_25550 131197 132519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 132864 133781 gene locus_tag LOCUS_25560 132864 133781 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 protein_id gnl|my_center|LOCUS_25560 134388 136529 gene locus_tag LOCUS_25570 134388 136529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 136921 139053 gene locus_tag LOCUS_25580 136921 139053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 139430 141565 gene locus_tag LOCUS_25590 139430 141565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 142077 141622 gene locus_tag LOCUS_25600 142077 141622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 143089 142064 gene locus_tag LOCUS_25610 gene tsaD 143089 142064 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546527.1 protein_id gnl|my_center|LOCUS_25610 143282 144466 gene locus_tag LOCUS_25620 143282 144466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_25620 144521 145435 gene locus_tag LOCUS_25630 144521 145435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_25630 145772 145518 gene locus_tag LOCUS_25640 145772 145518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 146660 146073 gene locus_tag LOCUS_25650 146660 146073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 147243 149009 gene locus_tag LOCUS_25660 147243 149009 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932655.1 protein_id gnl|my_center|LOCUS_25660 149405 149857 gene locus_tag LOCUS_25670 gene bcp 149405 149857 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220392.1 protein_id gnl|my_center|LOCUS_25670 149870 151003 gene locus_tag LOCUS_25680 149870 151003 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_25680 151726 151953 gene locus_tag LOCUS_25690 151726 151953 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_25690 151953 152300 gene locus_tag LOCUS_25700 151953 152300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 153143 152385 gene locus_tag LOCUS_25710 153143 152385 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_25710 154002 154214 gene locus_tag LOCUS_25720 154002 154214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 154581 154880 gene locus_tag LOCUS_25730 154581 154880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 156050 155028 gene locus_tag LOCUS_25740 156050 155028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 156543 156010 gene locus_tag LOCUS_25750 156543 156010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 157499 157146 gene locus_tag LOCUS_25760 157499 157146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 158608 157514 gene locus_tag LOCUS_25770 158608 157514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 159219 158695 gene locus_tag LOCUS_25780 159219 158695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 159422 159231 gene locus_tag LOCUS_25790 159422 159231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 160789 160205 gene locus_tag LOCUS_25800 160789 160205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 161667 160960 gene locus_tag LOCUS_25810 161667 160960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 162598 161798 gene locus_tag LOCUS_25820 162598 161798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25820 164105 162834 gene locus_tag LOCUS_25830 164105 162834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 164484 164062 gene locus_tag LOCUS_25840 164484 164062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 166484 164946 gene locus_tag LOCUS_25850 166484 164946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 167399 166956 gene locus_tag LOCUS_25860 167399 166956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 167870 169192 gene locus_tag LOCUS_25870 167870 169192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 169200 170813 gene locus_tag LOCUS_25880 169200 170813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 170841 172211 gene locus_tag LOCUS_25890 170841 172211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 172356 173654 gene locus_tag LOCUS_25900 172356 173654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 174107 175027 gene locus_tag LOCUS_25910 174107 175027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 175567 175070 gene locus_tag LOCUS_25920 175567 175070 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_25920 176025 177749 gene locus_tag LOCUS_25930 176025 177749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 178041 179090 gene locus_tag LOCUS_25940 178041 179090 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_25940 179514 179840 gene locus_tag LOCUS_25950 179514 179840 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_25950 180326 181300 gene locus_tag LOCUS_25960 180326 181300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 181325 181978 gene locus_tag LOCUS_25970 gene rpe 181325 181978 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_25970 181997 183547 gene locus_tag LOCUS_25980 181997 183547 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_25980 183537 184358 gene locus_tag LOCUS_25990 183537 184358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 184363 184938 gene locus_tag LOCUS_26000 184363 184938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26000 184925 185800 gene locus_tag LOCUS_26010 184925 185800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 185802 186893 gene locus_tag LOCUS_26020 185802 186893 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_26020 186989 187777 gene locus_tag LOCUS_26030 186989 187777 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933461.1 protein_id gnl|my_center|LOCUS_26030 187782 188627 gene locus_tag LOCUS_26040 187782 188627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 188646 189059 gene locus_tag LOCUS_26050 188646 189059 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_26050 189900 189070 gene locus_tag LOCUS_26060 189900 189070 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403948.1 protein_id gnl|my_center|LOCUS_26060 189978 190430 gene locus_tag LOCUS_26070 189978 190430 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_26070 190835 191614 gene locus_tag LOCUS_26080 gene paaG 190835 191614 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528139.1 protein_id gnl|my_center|LOCUS_26080 191720 192574 gene locus_tag LOCUS_26090 191720 192574 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489429.1 protein_id gnl|my_center|LOCUS_26090 192602 193123 gene locus_tag LOCUS_26100 192602 193123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 193800 193144 gene locus_tag LOCUS_26110 193800 193144 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_26110 193855 194304 gene locus_tag LOCUS_26120 gene smpB 193855 194304 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_26120 194304 195512 gene locus_tag LOCUS_26130 gene tyrS 194304 195512 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_26130 195550 196095 gene locus_tag LOCUS_26140 195550 196095 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_26140 196118 196480 gene locus_tag LOCUS_26150 196118 196480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 196594 197271 gene locus_tag LOCUS_26160 196594 197271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 197405 198406 gene locus_tag LOCUS_26170 197405 198406 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_26170 198504 201404 gene locus_tag LOCUS_26180 gene gcvP 198504 201404 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_26180 201516 202205 gene locus_tag LOCUS_26190 201516 202205 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883398.1 protein_id gnl|my_center|LOCUS_26190 202268 202687 gene locus_tag LOCUS_26200 202268 202687 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365680.1 protein_id gnl|my_center|LOCUS_26200 202707 204635 gene locus_tag LOCUS_26210 202707 204635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 204645 206054 gene locus_tag LOCUS_26220 204645 206054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 206057 206785 gene locus_tag LOCUS_26230 206057 206785 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_26230 206801 207709 gene locus_tag LOCUS_26240 206801 207709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 207759 208568 gene locus_tag LOCUS_26250 207759 208568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 208672 209406 gene locus_tag LOCUS_26260 208672 209406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 211391 209478 gene locus_tag LOCUS_26270 gene nuoL 211391 209478 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_26270 211731 211429 gene locus_tag LOCUS_26280 gene nuoK 211731 211429 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_26280 212707 212096 gene locus_tag LOCUS_26290 212707 212096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 212867 213835 gene locus_tag LOCUS_26300 212867 213835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 214183 213839 gene locus_tag LOCUS_26310 214183 213839 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_26310 214347 215270 gene locus_tag LOCUS_26320 214347 215270 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_26320 215302 216000 gene locus_tag LOCUS_26330 215302 216000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 216040 217545 gene locus_tag LOCUS_26340 216040 217545 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_26340 217647 218042 gene locus_tag LOCUS_26350 217647 218042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 218075 218965 gene locus_tag LOCUS_26360 218075 218965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 220488 218992 gene locus_tag LOCUS_26370 220488 218992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 220930 220490 gene locus_tag LOCUS_26380 220930 220490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 221032 221967 gene locus_tag LOCUS_26390 gene rocF 221032 221967 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_26390 224646 221992 gene locus_tag LOCUS_26400 224646 221992 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583452.1 protein_id gnl|my_center|LOCUS_26400 225432 224647 gene locus_tag LOCUS_26410 225432 224647 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_26410 226742 225459 gene locus_tag LOCUS_26420 226742 225459 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_26420 227675 226755 gene locus_tag LOCUS_26430 227675 226755 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_26430 228447 227680 gene locus_tag LOCUS_26440 228447 227680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_26440 229782 228511 gene locus_tag LOCUS_26450 229782 228511 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_26450 230607 229942 gene locus_tag LOCUS_26460 230607 229942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 231109 230618 gene locus_tag LOCUS_26470 231109 230618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 231999 231250 gene locus_tag LOCUS_26480 231999 231250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 232562 232008 gene locus_tag LOCUS_26490 232562 232008 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_26490 232696 233412 gene locus_tag LOCUS_26500 232696 233412 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_26500 233422 234192 gene locus_tag LOCUS_26510 233422 234192 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_26510 234441 234833 gene locus_tag LOCUS_26520 234441 234833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 234898 235341 gene locus_tag LOCUS_26530 gene dut 234898 235341 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_26530 235397 236074 gene locus_tag LOCUS_26540 gene rsmI 235397 236074 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_26540 236067 236702 gene locus_tag LOCUS_26550 236067 236702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26550 236741 237052 gene locus_tag LOCUS_26560 236741 237052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26560 237954 237049 gene locus_tag LOCUS_26570 237954 237049 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_26570 238193 240439 gene locus_tag LOCUS_26580 238193 240439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 241505 240456 gene locus_tag LOCUS_26590 241505 240456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 242265 241546 gene locus_tag LOCUS_26600 242265 241546 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_26600 243637 243002 gene locus_tag LOCUS_26610 243637 243002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 244707 243616 gene locus_tag LOCUS_26620 244707 243616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 245246 244704 gene locus_tag LOCUS_26630 245246 244704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 246881 246036 gene locus_tag LOCUS_26640 246881 246036 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_26640 248343 246871 gene locus_tag LOCUS_26650 gene crtI 248343 246871 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061143.1 protein_id gnl|my_center|LOCUS_26650 249182 248340 gene locus_tag LOCUS_26660 249182 248340 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_26660 249579 250574 gene locus_tag LOCUS_26670 gene purM 249579 250574 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931788.1 protein_id gnl|my_center|LOCUS_26670 250655 252034 gene locus_tag LOCUS_26680 gene lat 250655 252034 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_26680 252089 252547 gene locus_tag LOCUS_26690 252089 252547 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_26690 252591 252809 gene locus_tag LOCUS_26700 252591 252809 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668304.1 protein_id gnl|my_center|LOCUS_26700 252806 254845 gene locus_tag LOCUS_26710 gene feoB 252806 254845 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_26710 255949 254846 gene locus_tag LOCUS_26720 gene ychF 255949 254846 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_26720 256594 255965 gene locus_tag LOCUS_26730 256594 255965 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933377.1 protein_id gnl|my_center|LOCUS_26730 258675 256648 gene locus_tag LOCUS_26740 gene ftsH 258675 256648 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_26740 259231 258692 gene locus_tag LOCUS_26750 gene hpt 259231 258692 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_26750 259525 259328 gene locus_tag LOCUS_26760 gene rpsU 259525 259328 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933577.1 protein_id gnl|my_center|LOCUS_26760 259842 260561 gene locus_tag LOCUS_26770 259842 260561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 261393 260650 gene locus_tag LOCUS_26780 261393 260650 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422110.1 protein_id gnl|my_center|LOCUS_26780 263543 261435 gene locus_tag LOCUS_26790 gene fusA 263543 261435 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931838.1 protein_id gnl|my_center|LOCUS_26790 264464 263601 gene locus_tag LOCUS_26800 264464 263601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 264592 265161 gene locus_tag LOCUS_26810 gene def 264592 265161 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933121.1 protein_id gnl|my_center|LOCUS_26810 265222 266145 gene locus_tag LOCUS_26820 gene fmt 265222 266145 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_26820 268531 266186 gene locus_tag LOCUS_26830 268531 266186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 269963 268569 gene locus_tag LOCUS_26840 269963 268569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 273197 270093 gene locus_tag LOCUS_26850 273197 270093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 273469 274941 gene locus_tag LOCUS_26860 273469 274941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 276338 274959 gene locus_tag LOCUS_26870 276338 274959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 278640 276472 gene locus_tag LOCUS_26880 278640 276472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 279814 278957 gene locus_tag LOCUS_26890 279814 278957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 282451 280007 gene locus_tag LOCUS_26900 282451 280007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 284606 282711 gene locus_tag LOCUS_26910 284606 282711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 284935 286395 gene locus_tag LOCUS_26920 284935 286395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 286582 287403 gene locus_tag LOCUS_26930 286582 287403 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_26930 287403 288143 gene locus_tag LOCUS_26940 287403 288143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 288151 289023 gene locus_tag LOCUS_26950 288151 289023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 289020 290114 gene locus_tag LOCUS_26960 gene nirJ1 289020 290114 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966081.1 protein_id gnl|my_center|LOCUS_26960 290121 290762 gene locus_tag LOCUS_26970 290121 290762 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_26970 291598 290765 gene locus_tag LOCUS_26980 291598 290765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 293677 291887 gene locus_tag LOCUS_26990 293677 291887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 294767 294102 gene locus_tag LOCUS_27000 294767 294102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27000 297786 294916 gene locus_tag LOCUS_27010 297786 294916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 298420 298238 gene locus_tag LOCUS_27020 298420 298238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 298332 301106 gene locus_tag LOCUS_27030 298332 301106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 301446 303188 gene locus_tag LOCUS_27040 301446 303188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 303315 304481 gene locus_tag LOCUS_27050 303315 304481 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_27050 304503 305006 gene locus_tag LOCUS_27060 304503 305006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 304988 305392 gene locus_tag LOCUS_27070 304988 305392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 305396 306952 gene locus_tag LOCUS_27080 gene pruA 305396 306952 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259555.1 protein_id gnl|my_center|LOCUS_27080 306933 307223 gene locus_tag LOCUS_27090 306933 307223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 307245 307538 gene locus_tag LOCUS_27100 307245 307538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 307552 308772 gene locus_tag LOCUS_27110 gene sucC 307552 308772 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_27110 308896 309981 gene locus_tag LOCUS_27120 308896 309981 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183240.1 protein_id gnl|my_center|LOCUS_27120 309981 311429 gene locus_tag LOCUS_27130 309981 311429 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958052.1 protein_id gnl|my_center|LOCUS_27130 311494 312912 gene locus_tag LOCUS_27140 gene gatB 311494 312912 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_27140 312921 313691 gene locus_tag LOCUS_27150 gene tpiA 312921 313691 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_27150 313729 314904 gene locus_tag LOCUS_27160 313729 314904 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_27160 314934 315785 gene locus_tag LOCUS_27170 314934 315785 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_27170 315810 316952 gene locus_tag LOCUS_27180 315810 316952 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_27180 317661 316954 gene locus_tag LOCUS_27190 317661 316954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 319147 317672 gene locus_tag LOCUS_27200 gene hslU 319147 317672 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404390.1 protein_id gnl|my_center|LOCUS_27200 319714 319166 gene locus_tag LOCUS_27210 gene hslV 319714 319166 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_27210 321225 319735 gene locus_tag LOCUS_27220 gene rpoN 321225 319735 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_27220 321778 321227 gene locus_tag LOCUS_27230 321778 321227 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_27230 322905 321778 gene locus_tag LOCUS_27240 gene dprA 322905 321778 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_27240 324696 323068 gene locus_tag LOCUS_27250 324696 323068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 327755 325194 gene locus_tag LOCUS_27260 327755 325194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 327947 329419 gene locus_tag LOCUS_27270 327947 329419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 330332 330721 gene locus_tag LOCUS_27280 330332 330721 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_27280 333902 330807 gene locus_tag LOCUS_27290 333902 330807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 337317 334309 gene locus_tag LOCUS_27300 337317 334309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 339999 337351 gene locus_tag LOCUS_27310 339999 337351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 343475 340191 gene locus_tag LOCUS_27320 343475 340191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 345185 344502 gene locus_tag LOCUS_27330 345185 344502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 347349 345115 gene locus_tag LOCUS_27340 347349 345115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 350277 347467 gene locus_tag LOCUS_27350 350277 347467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 354699 350437 gene locus_tag LOCUS_27360 354699 350437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 355179 356459 gene locus_tag LOCUS_27370 355179 356459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 357293 356583 gene locus_tag LOCUS_27380 357293 356583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 359324 357366 gene locus_tag LOCUS_27390 359324 357366 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_27390 359867 361126 gene locus_tag LOCUS_27400 359867 361126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 361938 361279 gene locus_tag LOCUS_27410 361938 361279 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_27410 362533 361961 gene locus_tag LOCUS_27420 362533 361961 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963990.1 protein_id gnl|my_center|LOCUS_27420 363936 362533 gene locus_tag LOCUS_27430 gene fumC 363936 362533 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 protein_id gnl|my_center|LOCUS_27430 365147 364035 gene locus_tag LOCUS_27440 365147 364035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 368235 365185 gene locus_tag LOCUS_27450 368235 365185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 369141 370109 gene locus_tag LOCUS_27460 369141 370109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_27460 370152 371408 gene locus_tag LOCUS_27470 gene fahA 370152 371408 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405078.1 protein_id gnl|my_center|LOCUS_27470 371422 372285 gene locus_tag LOCUS_27480 371422 372285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 372292 373362 gene locus_tag LOCUS_27490 gene selD 372292 373362 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077699367.1 protein_id gnl|my_center|LOCUS_27490 373398 374576 gene locus_tag LOCUS_27500 gene mnmH 373398 374576 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858496.1 protein_id gnl|my_center|LOCUS_27500 377273 374622 gene locus_tag LOCUS_27510 377273 374622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27510 378264 377230 gene locus_tag LOCUS_27520 378264 377230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27520 378901 378419 gene locus_tag LOCUS_27530 gene paaJ 378901 378419 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177939.1 protein_id gnl|my_center|LOCUS_27530 379718 378948 gene locus_tag LOCUS_27540 gene paaC 379718 378948 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_27540 380094 379729 gene locus_tag LOCUS_27550 380094 379729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 381115 380129 gene locus_tag LOCUS_27560 gene paaA 381115 380129 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_27560 382414 381287 gene locus_tag LOCUS_27570 382414 381287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 385935 382660 gene locus_tag LOCUS_27580 385935 382660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 389425 386075 gene locus_tag LOCUS_27590 389425 386075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 389748 391535 gene locus_tag LOCUS_27600 389748 391535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_27600 392813 391779 gene locus_tag LOCUS_27610 392813 391779 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_27610 394228 393008 gene locus_tag LOCUS_27620 394228 393008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 395534 394269 gene locus_tag LOCUS_27630 395534 394269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 398141 395643 gene locus_tag LOCUS_27640 398141 395643 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_27640 398496 398230 gene locus_tag LOCUS_27650 398496 398230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_27650 399071 398628 gene locus_tag LOCUS_27660 399071 398628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 400357 399095 gene locus_tag LOCUS_27670 400357 399095 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404055.1 protein_id gnl|my_center|LOCUS_27670 400887 400360 gene locus_tag LOCUS_27680 400887 400360 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_27680 401465 400884 gene locus_tag LOCUS_27690 gene pgsA 401465 400884 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_27690 402780 401575 gene locus_tag LOCUS_27700 402780 401575 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_27700 403439 402840 gene locus_tag LOCUS_27710 403439 402840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 404239 403604 gene locus_tag LOCUS_27720 404239 403604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 407006 404487 gene locus_tag LOCUS_27730 407006 404487 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_27730 408208 407213 gene locus_tag LOCUS_27740 408208 407213 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_27740 408645 409289 gene locus_tag LOCUS_27750 408645 409289 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_27750 410324 409290 gene locus_tag LOCUS_27760 410324 409290 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_27760 411030 410404 gene locus_tag LOCUS_27770 411030 410404 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404316.1 protein_id gnl|my_center|LOCUS_27770 411846 411094 gene locus_tag LOCUS_27780 411846 411094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 412741 411932 gene locus_tag LOCUS_27790 412741 411932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 414374 412749 gene locus_tag LOCUS_27800 414374 412749 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_27800 414582 415610 gene locus_tag LOCUS_27810 414582 415610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838453.1 protein_id gnl|my_center|LOCUS_27810 415687 416652 gene locus_tag LOCUS_27820 gene iaaA 415687 416652 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097437.1 protein_id gnl|my_center|LOCUS_27820 416705 418870 gene locus_tag LOCUS_27830 416705 418870 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_27830 418908 419411 gene locus_tag LOCUS_27840 418908 419411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 419483 420862 gene locus_tag LOCUS_27850 419483 420862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 422158 420866 gene locus_tag LOCUS_27860 422158 420866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 422250 423260 gene locus_tag LOCUS_27870 422250 423260 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_27870 423335 424264 gene locus_tag LOCUS_27880 423335 424264 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_27880 425418 424288 gene locus_tag LOCUS_27890 425418 424288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_27890 426545 425415 gene locus_tag LOCUS_27900 426545 425415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_27900 427488 426535 gene locus_tag LOCUS_27910 427488 426535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_27910 428844 427519 gene locus_tag LOCUS_27920 428844 427519 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_27920 429769 428846 gene locus_tag LOCUS_27930 429769 428846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_27930 430742 429771 gene locus_tag LOCUS_27940 430742 429771 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_27940 431776 430880 gene locus_tag LOCUS_27950 431776 430880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 432194 433039 gene locus_tag LOCUS_27960 432194 433039 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_27960 433098 435974 gene locus_tag LOCUS_27970 gene polA 433098 435974 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_27970 436013 436483 gene locus_tag LOCUS_27980 436013 436483 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261949.1 protein_id gnl|my_center|LOCUS_27980 436525 436809 gene locus_tag LOCUS_27990 436525 436809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 436899 437729 gene locus_tag LOCUS_28000 gene rfaD 436899 437729 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28000 437908 439635 gene locus_tag LOCUS_28010 437908 439635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 440196 441554 gene locus_tag LOCUS_28020 440196 441554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 441698 441889 gene locus_tag LOCUS_28030 441698 441889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence06 1099 371 gene locus_tag LOCUS_28040 1099 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28040 2511 1141 gene locus_tag LOCUS_28050 2511 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28050 3466 2483 gene locus_tag LOCUS_28060 3466 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 7247 4458 gene locus_tag LOCUS_28070 7247 4458 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_28070 12317 7248 gene locus_tag LOCUS_28080 12317 7248 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_28080 13024 18327 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaattccactatggttcgattcaaat 18344 24576 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaattccactatggttcgattcaaat 26709 24757 gene locus_tag LOCUS_28090 26709 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 28255 27179 gene locus_tag LOCUS_28100 gene cas1b 28255 27179 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_28100 29438 28455 gene locus_tag LOCUS_28110 29438 28455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 30078 29470 gene locus_tag LOCUS_28120 30078 29470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 30635 30285 gene locus_tag LOCUS_28130 30635 30285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 31536 31165 gene locus_tag LOCUS_28140 31536 31165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 32038 31646 gene locus_tag LOCUS_28150 32038 31646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 32835 32392 gene locus_tag LOCUS_28160 32835 32392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 33240 32917 gene locus_tag LOCUS_28170 33240 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 34394 34056 gene locus_tag LOCUS_28180 34394 34056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 34799 34551 gene locus_tag LOCUS_28190 34799 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 35362 35090 gene locus_tag LOCUS_28200 35362 35090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 35900 35460 gene locus_tag LOCUS_28210 35900 35460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 36518 36144 gene locus_tag LOCUS_28220 36518 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 36877 38596 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccacaatggttcgattcaatt 39655 38945 gene locus_tag LOCUS_28230 39655 38945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 40715 39633 gene locus_tag LOCUS_28240 40715 39633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 41267 40809 gene locus_tag LOCUS_28250 41267 40809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 42179 41286 gene locus_tag LOCUS_28260 42179 41286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 42798 42181 gene locus_tag LOCUS_28270 gene tmk 42798 42181 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496455.1 protein_id gnl|my_center|LOCUS_28270 43921 43538 gene locus_tag LOCUS_28280 43921 43538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 46436 44700 gene locus_tag LOCUS_28290 46436 44700 CDS product TIGR03986 family CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258140.1 protein_id gnl|my_center|LOCUS_28290 46584 46363 gene locus_tag LOCUS_28300 46584 46363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 47155 46556 gene locus_tag LOCUS_28310 47155 46556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 47904 47176 gene locus_tag LOCUS_28320 47904 47176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28320 48065 47889 gene locus_tag LOCUS_28330 48065 47889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 48473 48087 gene locus_tag LOCUS_28340 48473 48087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 49323 48466 gene locus_tag LOCUS_28350 49323 48466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 50019 49570 gene locus_tag LOCUS_28360 50019 49570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 50669 50007 gene locus_tag LOCUS_28370 50669 50007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 50962 50666 gene locus_tag LOCUS_28380 50962 50666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 52175 51018 gene locus_tag LOCUS_28390 52175 51018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258135.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28390 52519 52175 gene locus_tag LOCUS_28400 52519 52175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 53441 52557 gene locus_tag LOCUS_28410 53441 52557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28410 54609 53728 gene locus_tag LOCUS_28420 54609 53728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 55604 55903 gene locus_tag LOCUS_28430 55604 55903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 57407 56580 gene locus_tag LOCUS_28440 57407 56580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 57893 57696 gene locus_tag LOCUS_28450 57893 57696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 58666 59661 gene locus_tag LOCUS_28460 58666 59661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 59919 60239 gene locus_tag LOCUS_28470 59919 60239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 60254 61849 gene locus_tag LOCUS_28480 60254 61849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 62941 61856 gene locus_tag LOCUS_28490 62941 61856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 63537 67343 gene locus_tag LOCUS_28500 63537 67343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 67636 68001 gene locus_tag LOCUS_28510 67636 68001 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529654.1 protein_id gnl|my_center|LOCUS_28510 69584 68112 gene locus_tag LOCUS_28520 69584 68112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 69826 70050 gene locus_tag LOCUS_28530 69826 70050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 70113 71477 gene locus_tag LOCUS_28540 70113 71477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 71489 72916 gene locus_tag LOCUS_28550 71489 72916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 72913 74352 gene locus_tag LOCUS_28560 72913 74352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 74423 75319 gene locus_tag LOCUS_28570 74423 75319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 75312 75533 gene locus_tag LOCUS_28580 75312 75533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 75595 76785 gene locus_tag LOCUS_28590 75595 76785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 76782 77507 gene locus_tag LOCUS_28600 76782 77507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 79036 77597 gene locus_tag LOCUS_28610 79036 77597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 79324 81471 gene locus_tag LOCUS_28620 79324 81471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 92913 81625 gene locus_tag LOCUS_28630 92913 81625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 94040 93291 gene locus_tag LOCUS_28640 gene fnr 94040 93291 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194557.1 protein_id gnl|my_center|LOCUS_28640 95765 94275 gene locus_tag LOCUS_28650 95765 94275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 95937 97859 gene locus_tag LOCUS_28660 95937 97859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 102065 98163 gene locus_tag LOCUS_28670 102065 98163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 102222 103679 gene locus_tag LOCUS_28680 102222 103679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 104102 105541 gene locus_tag LOCUS_28690 104102 105541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 107215 105773 gene locus_tag LOCUS_28700 107215 105773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 107733 109250 gene locus_tag LOCUS_28710 107733 109250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 110554 109337 gene locus_tag LOCUS_28720 110554 109337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 112519 110909 gene locus_tag LOCUS_28730 112519 110909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 112789 113448 gene locus_tag LOCUS_28740 112789 113448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 117268 113720 gene locus_tag LOCUS_28750 117268 113720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 118509 117646 gene locus_tag LOCUS_28760 118509 117646 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680802.1 protein_id gnl|my_center|LOCUS_28760 120115 118934 gene locus_tag LOCUS_28770 120115 118934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 121714 120437 gene locus_tag LOCUS_28780 121714 120437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 123799 122456 gene locus_tag LOCUS_28790 123799 122456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 123995 124177 gene locus_tag LOCUS_28800 123995 124177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 126295 124217 gene locus_tag LOCUS_28810 126295 124217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 129673 126449 gene locus_tag LOCUS_28820 129673 126449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 131932 129803 gene locus_tag LOCUS_28830 131932 129803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 132954 132430 gene locus_tag LOCUS_28840 132954 132430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 133562 133152 gene locus_tag LOCUS_28850 133562 133152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 133926 135389 gene locus_tag LOCUS_28860 133926 135389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 137373 136036 gene locus_tag LOCUS_28870 137373 136036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 137639 139129 gene locus_tag LOCUS_28880 137639 139129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 140873 139299 gene locus_tag LOCUS_28890 140873 139299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28890 141258 140815 gene locus_tag LOCUS_28900 141258 140815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28900 142507 141251 gene locus_tag LOCUS_28910 142507 141251 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773754.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28910 143575 142583 gene locus_tag LOCUS_28920 143575 142583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 144195 143572 gene locus_tag LOCUS_28930 144195 143572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28930 144574 144299 gene locus_tag LOCUS_28940 144574 144299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 144882 145436 gene locus_tag LOCUS_28950 144882 145436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 145433 146317 gene locus_tag LOCUS_28960 145433 146317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 147038 146532 gene locus_tag LOCUS_28970 147038 146532 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_28970 147611 147399 gene locus_tag LOCUS_28980 147611 147399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 148541 147747 gene locus_tag LOCUS_28990 148541 147747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28990 149155 148538 gene locus_tag LOCUS_29000 149155 148538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29000 149717 149190 gene locus_tag LOCUS_29010 149717 149190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 150331 149714 gene locus_tag LOCUS_29020 150331 149714 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_29020 151131 150328 gene locus_tag LOCUS_29030 151131 150328 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_29030 151460 151128 gene locus_tag LOCUS_29040 151460 151128 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306389.1 protein_id gnl|my_center|LOCUS_29040 152145 152843 gene locus_tag LOCUS_29050 152145 152843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 154576 153011 gene locus_tag LOCUS_29060 154576 153011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 154996 157326 gene locus_tag LOCUS_29070 154996 157326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 157742 160120 gene locus_tag LOCUS_29080 157742 160120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 160367 160762 gene locus_tag LOCUS_29090 160367 160762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 161395 161033 gene locus_tag LOCUS_29100 161395 161033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 166947 161629 gene locus_tag LOCUS_29110 166947 161629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 167370 168851 gene locus_tag LOCUS_29120 167370 168851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 169623 169228 gene locus_tag LOCUS_29130 169623 169228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 174046 170084 gene locus_tag LOCUS_29140 174046 170084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 178291 174611 gene locus_tag LOCUS_29150 178291 174611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 180230 178788 gene locus_tag LOCUS_29160 180230 178788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 180849 180574 gene locus_tag LOCUS_29170 180849 180574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 184703 180858 gene locus_tag LOCUS_29180 184703 180858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 189881 185535 gene locus_tag LOCUS_29190 189881 185535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 192172 190262 gene locus_tag LOCUS_29200 192172 190262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 196799 192942 gene locus_tag LOCUS_29210 196799 192942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 196967 198424 gene locus_tag LOCUS_29220 196967 198424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 200246 198651 gene locus_tag LOCUS_29230 200246 198651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 202714 200642 gene locus_tag LOCUS_29240 202714 200642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 203132 203839 gene locus_tag LOCUS_29250 203132 203839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 205212 203884 gene locus_tag LOCUS_29260 205212 203884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 208398 205678 gene locus_tag LOCUS_29270 208398 205678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 208668 208997 gene locus_tag LOCUS_29280 208668 208997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 211104 209209 gene locus_tag LOCUS_29290 211104 209209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 211334 211101 gene locus_tag LOCUS_29300 211334 211101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 215735 211563 gene locus_tag LOCUS_29310 215735 211563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 215915 216127 gene locus_tag LOCUS_29320 215915 216127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 218315 216324 gene locus_tag LOCUS_29330 218315 216324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 220308 218647 gene locus_tag LOCUS_29340 220308 218647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 222616 220538 gene locus_tag LOCUS_29350 222616 220538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 224822 222855 gene locus_tag LOCUS_29360 224822 222855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 225805 225392 gene locus_tag LOCUS_29370 225805 225392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 227272 225884 gene locus_tag LOCUS_29380 227272 225884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 229428 227782 gene locus_tag LOCUS_29390 229428 227782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 230745 229513 gene locus_tag LOCUS_29400 230745 229513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 231417 230986 gene locus_tag LOCUS_29410 231417 230986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29410 231820 231554 gene locus_tag LOCUS_29420 231820 231554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29420 232845 231835 gene locus_tag LOCUS_29430 232845 231835 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_29430 234040 233156 gene locus_tag LOCUS_29440 234040 233156 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_29440 234540 234040 gene locus_tag LOCUS_29450 234540 234040 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_29450 236644 234647 gene locus_tag LOCUS_29460 236644 234647 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_29460 237568 236657 gene locus_tag LOCUS_29470 237568 236657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 238200 237565 gene locus_tag LOCUS_29480 238200 237565 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_29480 238774 240210 gene locus_tag LOCUS_29490 gene sthA 238774 240210 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393365.1 protein_id gnl|my_center|LOCUS_29490 240995 240423 gene locus_tag LOCUS_29500 240995 240423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 241211 241699 gene locus_tag LOCUS_29510 241211 241699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 241811 242293 gene locus_tag LOCUS_29520 241811 242293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 242511 243569 gene locus_tag LOCUS_29530 242511 243569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 243830 245611 gene locus_tag LOCUS_29540 243830 245611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 246020 246553 gene locus_tag LOCUS_29550 246020 246553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 246611 247702 gene locus_tag LOCUS_29560 246611 247702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 247874 248542 gene locus_tag LOCUS_29570 247874 248542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 248544 248969 gene locus_tag LOCUS_29580 248544 248969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 249018 249680 gene locus_tag LOCUS_29590 249018 249680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 252367 249932 gene locus_tag LOCUS_29600 252367 249932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 254768 252798 gene locus_tag LOCUS_29610 254768 252798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 254951 256411 gene locus_tag LOCUS_29620 254951 256411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 256530 257144 gene locus_tag LOCUS_29630 256530 257144 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529665.1 protein_id gnl|my_center|LOCUS_29630 257256 259523 gene locus_tag LOCUS_29640 257256 259523 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_29640 261406 259748 gene locus_tag LOCUS_29650 261406 259748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 263458 261809 gene locus_tag LOCUS_29660 263458 261809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 267510 263935 gene locus_tag LOCUS_29670 267510 263935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 267767 267507 gene locus_tag LOCUS_29680 267767 267507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 267972 269402 gene locus_tag LOCUS_29690 267972 269402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 270681 269620 gene locus_tag LOCUS_29700 270681 269620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 270934 272409 gene locus_tag LOCUS_29710 270934 272409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 276133 272639 gene locus_tag LOCUS_29720 276133 272639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 276501 277904 gene locus_tag LOCUS_29730 276501 277904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 283233 278086 gene locus_tag LOCUS_29740 283233 278086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 283422 284897 gene locus_tag LOCUS_29750 283422 284897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 286771 285548 gene locus_tag LOCUS_29760 286771 285548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 288052 286847 gene locus_tag LOCUS_29770 288052 286847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 288388 289041 gene locus_tag LOCUS_29780 288388 289041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 293882 289380 gene locus_tag LOCUS_29790 293882 289380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 297485 293988 gene locus_tag LOCUS_29800 297485 293988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 298506 297643 gene locus_tag LOCUS_29810 298506 297643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 298948 298724 gene locus_tag LOCUS_29820 298948 298724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 299751 300143 gene locus_tag LOCUS_29830 299751 300143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 300532 300756 gene locus_tag LOCUS_29840 300532 300756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 300859 301068 gene locus_tag LOCUS_29850 300859 301068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 302592 301417 gene locus_tag LOCUS_29860 302592 301417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 303473 302499 gene locus_tag LOCUS_29870 303473 302499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 304663 303932 gene locus_tag LOCUS_29880 304663 303932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 306623 304671 gene locus_tag LOCUS_29890 306623 304671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 308392 306929 gene locus_tag LOCUS_29900 308392 306929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 310878 308434 gene locus_tag LOCUS_29910 310878 308434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 314959 311093 gene locus_tag LOCUS_29920 314959 311093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 318339 315274 gene locus_tag LOCUS_29930 318339 315274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 322612 318896 gene locus_tag LOCUS_29940 322612 318896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 326443 322967 gene locus_tag LOCUS_29950 326443 322967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 330505 326570 gene locus_tag LOCUS_29960 330505 326570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 332435 330657 gene locus_tag LOCUS_29970 332435 330657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29970 334611 332449 gene locus_tag LOCUS_29980 334611 332449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 334991 334764 gene locus_tag LOCUS_29990 334991 334764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 335299 335099 gene locus_tag LOCUS_30000 335299 335099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 337040 335367 gene locus_tag LOCUS_30010 337040 335367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 337991 338212 gene locus_tag LOCUS_30020 337991 338212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 338440 339108 gene locus_tag LOCUS_30030 338440 339108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 339117 339440 gene locus_tag LOCUS_30040 339117 339440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 339659 340162 gene locus_tag LOCUS_30050 339659 340162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 340117 341127 gene locus_tag LOCUS_30060 340117 341127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 341441 341214 gene locus_tag LOCUS_30070 341441 341214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 342061 341498 gene locus_tag LOCUS_30080 342061 341498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 342546 342268 gene locus_tag LOCUS_30090 342546 342268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 346919 343338 gene locus_tag LOCUS_30100 346919 343338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 349298 347271 gene locus_tag LOCUS_30110 349298 347271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 350483 349722 gene locus_tag LOCUS_30120 gene pstB 350483 349722 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073952.1 protein_id gnl|my_center|LOCUS_30120 351424 350564 gene locus_tag LOCUS_30130 gene pstA 351424 350564 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925923.1 protein_id gnl|my_center|LOCUS_30130 352307 351417 gene locus_tag LOCUS_30140 gene pstC 352307 351417 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937619.1 protein_id gnl|my_center|LOCUS_30140 352844 352365 gene locus_tag LOCUS_30150 352844 352365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 353313 352924 gene locus_tag LOCUS_30160 353313 352924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 353834 355465 gene locus_tag LOCUS_30170 353834 355465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 355513 357045 gene locus_tag LOCUS_30180 355513 357045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 357134 357286 gene locus_tag LOCUS_30190 357134 357286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 357710 357402 gene locus_tag LOCUS_30200 357710 357402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 358597 357707 gene locus_tag LOCUS_30210 358597 357707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 359251 358784 gene locus_tag LOCUS_30220 359251 358784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 360636 359260 gene locus_tag LOCUS_30230 360636 359260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 361009 360842 gene locus_tag LOCUS_30240 361009 360842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 361215 360991 gene locus_tag LOCUS_30250 361215 360991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 361506 361240 gene locus_tag LOCUS_30260 361506 361240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 362484 362071 gene locus_tag LOCUS_30270 362484 362071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 363480 363803 gene locus_tag LOCUS_30280 363480 363803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence07 2037 1354 gene locus_tag LOCUS_30290 2037 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3223 2360 gene locus_tag LOCUS_30300 3223 2360 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_30300 4376 3477 gene locus_tag LOCUS_30310 4376 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 4809 4519 gene locus_tag LOCUS_30320 4809 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 5046 4855 gene locus_tag LOCUS_30330 5046 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 6215 5415 gene locus_tag LOCUS_30340 6215 5415 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_30340 6772 6401 gene locus_tag LOCUS_30350 6772 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 9297 6796 gene locus_tag LOCUS_30360 9297 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 10310 9903 gene locus_tag LOCUS_30370 10310 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 11916 13913 gene locus_tag LOCUS_30380 gene tkt 11916 13913 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_30380 14090 15823 gene locus_tag LOCUS_30390 14090 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 15854 16750 gene locus_tag LOCUS_30400 gene gnd 15854 16750 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402865.1 protein_id gnl|my_center|LOCUS_30400 17221 18039 gene locus_tag LOCUS_30410 17221 18039 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_30410 18026 19069 gene locus_tag LOCUS_30420 18026 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 19110 20618 gene locus_tag LOCUS_30430 19110 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 20862 21161 gene locus_tag LOCUS_30440 20862 21161 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_30440 21154 21603 gene locus_tag LOCUS_30450 21154 21603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 21609 23174 gene locus_tag LOCUS_30460 gene lysS 21609 23174 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_30460 23369 24727 gene locus_tag LOCUS_30470 23369 24727 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_30470 24762 25901 gene locus_tag LOCUS_30480 24762 25901 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 protein_id gnl|my_center|LOCUS_30480 27603 25957 gene locus_tag LOCUS_30490 27603 25957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 28442 29272 gene locus_tag LOCUS_30500 28442 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 30000 29269 gene locus_tag LOCUS_30510 30000 29269 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_30510 30906 30082 gene locus_tag LOCUS_30520 30906 30082 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_30520 31951 30938 gene locus_tag LOCUS_30530 31951 30938 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345564.1 protein_id gnl|my_center|LOCUS_30530 32589 31948 gene locus_tag LOCUS_30540 32589 31948 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195230.1 protein_id gnl|my_center|LOCUS_30540 33186 32671 gene locus_tag LOCUS_30550 33186 32671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 33758 33240 gene locus_tag LOCUS_30560 33758 33240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 34489 33863 gene locus_tag LOCUS_30570 34489 33863 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_30570 35066 34695 gene locus_tag LOCUS_30580 35066 34695 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_30580 36306 35122 gene locus_tag LOCUS_30590 36306 35122 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_30590 36729 36328 gene locus_tag LOCUS_30600 36729 36328 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808457.1 protein_id gnl|my_center|LOCUS_30600 36881 36809 gene locus_tag LOCUS_t00380 36881 36809 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 39935 37503 gene locus_tag LOCUS_30610 39935 37503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 41691 40165 gene locus_tag LOCUS_30620 41691 40165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 43932 41908 gene locus_tag LOCUS_30630 43932 41908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 44076 45359 gene locus_tag LOCUS_30640 44076 45359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 45719 47056 gene locus_tag LOCUS_30650 gene asnS 45719 47056 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_30650 47068 47532 gene locus_tag LOCUS_30660 47068 47532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 47607 47924 gene locus_tag LOCUS_30670 47607 47924 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438666.1 protein_id gnl|my_center|LOCUS_30670 48055 49086 gene locus_tag LOCUS_30680 gene fbp 48055 49086 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_30680 50209 49127 gene locus_tag LOCUS_30690 50209 49127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 51027 50212 gene locus_tag LOCUS_30700 51027 50212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 51955 51029 gene locus_tag LOCUS_30710 51955 51029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_30710 52523 51969 gene locus_tag LOCUS_30720 52523 51969 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_30720 53039 52575 gene locus_tag LOCUS_30730 53039 52575 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_30730 53876 53118 gene locus_tag LOCUS_30740 53876 53118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 54541 54014 gene locus_tag LOCUS_30750 54541 54014 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933248.1 protein_id gnl|my_center|LOCUS_30750 55172 54585 gene locus_tag LOCUS_30760 55172 54585 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_30760 55983 55216 gene locus_tag LOCUS_30770 55983 55216 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933250.1 protein_id gnl|my_center|LOCUS_30770 56415 56068 gene locus_tag LOCUS_30780 56415 56068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 57072 56524 gene locus_tag LOCUS_30790 57072 56524 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125842.1 protein_id gnl|my_center|LOCUS_30790 58216 57092 gene locus_tag LOCUS_30800 gene rlmN 58216 57092 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_30800 58395 59006 gene locus_tag LOCUS_30810 gene sigW 58395 59006 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_30810 59048 61660 gene locus_tag LOCUS_30820 gene mutS 59048 61660 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_30820 62108 63388 gene locus_tag LOCUS_30830 62108 63388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 64085 63546 gene locus_tag LOCUS_30840 64085 63546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 64154 64672 gene locus_tag LOCUS_30850 64154 64672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_30850 64709 65704 gene locus_tag LOCUS_30860 64709 65704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 65712 66032 gene locus_tag LOCUS_30870 65712 66032 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_30870 66035 66415 gene locus_tag LOCUS_30880 66035 66415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 66508 66855 gene locus_tag LOCUS_30890 66508 66855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 66919 68073 gene locus_tag LOCUS_30900 66919 68073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 68123 68737 gene locus_tag LOCUS_30910 68123 68737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 69299 68748 gene locus_tag LOCUS_30920 69299 68748 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_30920 70744 69323 gene locus_tag LOCUS_30930 70744 69323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 71277 70747 gene locus_tag LOCUS_30940 gene lptC 71277 70747 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986830.1 protein_id gnl|my_center|LOCUS_30940 72274 71279 gene locus_tag LOCUS_30950 72274 71279 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946576.1 protein_id gnl|my_center|LOCUS_30950 72542 73969 gene locus_tag LOCUS_30960 gene rlmD 72542 73969 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_30960 74011 75354 gene locus_tag LOCUS_30970 74011 75354 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963804.1 protein_id gnl|my_center|LOCUS_30970 75583 75756 gene locus_tag LOCUS_30980 75583 75756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 75948 77660 gene locus_tag LOCUS_30990 gene kdpA 75948 77660 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963802.1 protein_id gnl|my_center|LOCUS_30990 77670 79721 gene locus_tag LOCUS_31000 gene kdpB 77670 79721 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_31000 79724 80287 gene locus_tag LOCUS_31010 79724 80287 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963800.1 protein_id gnl|my_center|LOCUS_31010 80306 80518 gene locus_tag LOCUS_31020 80306 80518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 80736 81788 gene locus_tag LOCUS_31030 80736 81788 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_31030 81930 83063 gene locus_tag LOCUS_31040 81930 83063 CDS product two-component system sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963798.1 protein_id gnl|my_center|LOCUS_31040 83067 84899 gene locus_tag LOCUS_31050 83067 84899 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_31050 85575 85147 gene locus_tag LOCUS_31060 85575 85147 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_31060 86045 86695 gene locus_tag LOCUS_31070 86045 86695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275165.1 protein_id gnl|my_center|LOCUS_31070 86946 88049 gene locus_tag LOCUS_31080 gene hflX 86946 88049 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933052.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31080 88058 88231 gene locus_tag LOCUS_31090 88058 88231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 88276 89454 gene locus_tag LOCUS_31100 88276 89454 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_31100 89576 90796 gene locus_tag LOCUS_31110 89576 90796 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_31110 90822 91037 gene locus_tag LOCUS_31120 90822 91037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31120 91127 91777 gene locus_tag LOCUS_31130 91127 91777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31130 91784 92140 gene locus_tag LOCUS_31140 91784 92140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 93102 92065 gene locus_tag LOCUS_31150 93102 92065 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_31150 95088 93220 gene locus_tag LOCUS_31160 95088 93220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 95710 95261 gene locus_tag LOCUS_31170 95710 95261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 95973 95710 gene locus_tag LOCUS_31180 95973 95710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 96212 95940 gene locus_tag LOCUS_31190 96212 95940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 97229 96261 gene locus_tag LOCUS_31200 97229 96261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 98208 97231 gene locus_tag LOCUS_31210 98208 97231 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_31210 98951 98208 gene locus_tag LOCUS_31220 98951 98208 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_31220 99823 98963 gene locus_tag LOCUS_31230 99823 98963 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227952.1 protein_id gnl|my_center|LOCUS_31230 101136 99847 gene locus_tag LOCUS_31240 101136 99847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31240 101663 101277 gene locus_tag LOCUS_31250 101663 101277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31250 102071 103204 gene locus_tag LOCUS_31260 102071 103204 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_31260 103264 104028 gene locus_tag LOCUS_31270 gene lpxA 103264 104028 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_31270 104034 104540 gene locus_tag LOCUS_31280 gene cyaB 104034 104540 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868087.1 protein_id gnl|my_center|LOCUS_31280 104541 105362 gene locus_tag LOCUS_31290 gene panB 104541 105362 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933009.1 protein_id gnl|my_center|LOCUS_31290 106096 105389 gene locus_tag LOCUS_31300 106096 105389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 106230 107990 gene locus_tag LOCUS_31310 106230 107990 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_31310 108031 112335 gene locus_tag LOCUS_31320 108031 112335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 112687 112415 gene locus_tag LOCUS_31330 112687 112415 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_31330 112891 112804 gene locus_tag LOCUS_t00390 112891 112804 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 114814 113033 gene locus_tag LOCUS_31340 114814 113033 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_31340 115310 115984 gene locus_tag LOCUS_31350 115310 115984 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_31350 116021 116491 gene locus_tag LOCUS_31360 gene nuoE 116021 116491 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_31360 116534 117703 gene locus_tag LOCUS_31370 116534 117703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 117725 119521 gene locus_tag LOCUS_31380 117725 119521 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_31380 119709 121187 gene locus_tag LOCUS_31390 119709 121187 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_31390 121221 121805 gene locus_tag LOCUS_31400 121221 121805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 121836 123035 gene locus_tag LOCUS_31410 121836 123035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 123035 124291 gene locus_tag LOCUS_31420 123035 124291 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_31420 124333 125649 gene locus_tag LOCUS_31430 124333 125649 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933254.1 protein_id gnl|my_center|LOCUS_31430 125670 126434 gene locus_tag LOCUS_31440 gene tatC 125670 126434 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927002.1 protein_id gnl|my_center|LOCUS_31440 126473 127441 gene locus_tag LOCUS_31450 126473 127441 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_31450 129785 127512 gene locus_tag LOCUS_31460 gene ccsA 129785 127512 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_31460 130190 129789 gene locus_tag LOCUS_31470 130190 129789 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_31470 130406 130272 gene locus_tag LOCUS_31480 130406 130272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 131071 130406 gene locus_tag LOCUS_31490 131071 130406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 131598 131149 gene locus_tag LOCUS_31500 131598 131149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 132352 131678 gene locus_tag LOCUS_31510 132352 131678 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_31510 132990 132349 gene locus_tag LOCUS_31520 132990 132349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 133512 133030 gene locus_tag LOCUS_31530 133512 133030 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_31530 134304 133516 gene locus_tag LOCUS_31540 gene bamD 134304 133516 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_31540 134957 134322 gene locus_tag LOCUS_31550 134957 134322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 136243 134960 gene locus_tag LOCUS_31560 136243 134960 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_31560 136623 138287 gene locus_tag LOCUS_31570 gene sulP 136623 138287 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_31570 138478 139803 gene locus_tag LOCUS_31580 gene rimO 138478 139803 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_31580 139837 141159 gene locus_tag LOCUS_31590 139837 141159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 142149 141160 gene locus_tag LOCUS_31600 142149 141160 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_31600 142743 142153 gene locus_tag LOCUS_31610 142743 142153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 142929 144329 gene locus_tag LOCUS_31620 142929 144329 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_31620 145109 144339 gene locus_tag LOCUS_31630 145109 144339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 protein_id gnl|my_center|LOCUS_31630 145834 145106 gene locus_tag LOCUS_31640 145834 145106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 147074 145821 gene locus_tag LOCUS_31650 147074 145821 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_31650 147436 147107 gene locus_tag LOCUS_31660 147436 147107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 148124 147543 gene locus_tag LOCUS_31670 148124 147543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_31670 150150 148177 gene locus_tag LOCUS_31680 gene nosZ 150150 148177 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_31680 150638 150219 gene locus_tag LOCUS_31690 150638 150219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 151380 150655 gene locus_tag LOCUS_31700 gene ric 151380 150655 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_31700 152286 151588 gene locus_tag LOCUS_31710 152286 151588 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 protein_id gnl|my_center|LOCUS_31710 152533 152279 gene locus_tag LOCUS_31720 152533 152279 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 protein_id gnl|my_center|LOCUS_31720 153909 152530 gene locus_tag LOCUS_31730 153909 152530 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_31730 155100 154138 gene locus_tag LOCUS_31740 155100 154138 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_31740 155591 155235 gene locus_tag LOCUS_31750 155591 155235 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_31750 157180 155753 gene locus_tag LOCUS_31760 157180 155753 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_31760 157760 157440 gene locus_tag LOCUS_31770 157760 157440 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216764.1 protein_id gnl|my_center|LOCUS_31770 158396 158806 gene locus_tag LOCUS_31780 158396 158806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 158813 159424 gene locus_tag LOCUS_31790 158813 159424 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_31790 162492 159619 gene locus_tag LOCUS_31800 162492 159619 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_31800 162826 163191 gene locus_tag LOCUS_31810 162826 163191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 163389 163817 gene locus_tag LOCUS_31820 163389 163817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 164379 165023 gene locus_tag LOCUS_31830 gene rsmG 164379 165023 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_31830 165033 167435 gene locus_tag LOCUS_31840 165033 167435 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_31840 168060 168701 gene locus_tag LOCUS_31850 168060 168701 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761997.1 protein_id gnl|my_center|LOCUS_31850 168715 170322 gene locus_tag LOCUS_31860 168715 170322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 170334 171944 gene locus_tag LOCUS_31870 170334 171944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 172014 173126 gene locus_tag LOCUS_31880 172014 173126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 173153 174394 gene locus_tag LOCUS_31890 173153 174394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 174394 175818 gene locus_tag LOCUS_31900 174394 175818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 175837 177300 gene locus_tag LOCUS_31910 175837 177300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 177506 178399 gene locus_tag LOCUS_31920 177506 178399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 178427 178678 gene locus_tag LOCUS_31930 178427 178678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 178679 179230 gene locus_tag LOCUS_31940 178679 179230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 179250 180725 gene locus_tag LOCUS_31950 179250 180725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 180792 181532 gene locus_tag LOCUS_31960 180792 181532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31960 181526 181864 gene locus_tag LOCUS_31970 181526 181864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31970 181921 182100 gene locus_tag LOCUS_31980 181921 182100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 182773 183519 gene locus_tag LOCUS_31990 182773 183519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 183639 184232 gene locus_tag LOCUS_32000 183639 184232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 184229 185104 gene locus_tag LOCUS_32010 184229 185104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 185413 185613 gene locus_tag LOCUS_32020 185413 185613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 185684 187144 gene locus_tag LOCUS_32030 185684 187144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 187134 187700 gene locus_tag LOCUS_32040 187134 187700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 187703 188665 gene locus_tag LOCUS_32050 187703 188665 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944036.1 protein_id gnl|my_center|LOCUS_32050 188711 189178 gene locus_tag LOCUS_32060 188711 189178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 189182 190624 gene locus_tag LOCUS_32070 189182 190624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 190624 192144 gene locus_tag LOCUS_32080 190624 192144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 192128 193015 gene locus_tag LOCUS_32090 192128 193015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141355.1 protein_id gnl|my_center|LOCUS_32090 193029 194561 gene locus_tag LOCUS_32100 193029 194561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 194549 195760 gene locus_tag LOCUS_32110 194549 195760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 195804 196532 gene locus_tag LOCUS_32120 195804 196532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 196576 198078 gene locus_tag LOCUS_32130 196576 198078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 198247 198717 gene locus_tag LOCUS_32140 198247 198717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 198788 201037 gene locus_tag LOCUS_32150 198788 201037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 201038 202711 gene locus_tag LOCUS_32160 201038 202711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 202762 203235 gene locus_tag LOCUS_32170 202762 203235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 203403 203573 gene locus_tag LOCUS_32180 203403 203573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 203652 203867 gene locus_tag LOCUS_32190 203652 203867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 203842 203970 gene locus_tag LOCUS_32200 203842 203970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 204431 204592 gene locus_tag LOCUS_32210 204431 204592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 204670 206400 gene locus_tag LOCUS_32220 204670 206400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32220 206550 207119 gene locus_tag LOCUS_32230 206550 207119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 207407 208999 gene locus_tag LOCUS_32240 207407 208999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32240 209191 210228 gene locus_tag LOCUS_32250 209191 210228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 210426 211301 gene locus_tag LOCUS_32260 210426 211301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 211539 212339 gene locus_tag LOCUS_32270 211539 212339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 212391 212747 gene locus_tag LOCUS_32280 212391 212747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 213073 214257 gene locus_tag LOCUS_32290 213073 214257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 214259 215077 gene locus_tag LOCUS_32300 214259 215077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 216480 215581 gene locus_tag LOCUS_32310 216480 215581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 216655 216470 gene locus_tag LOCUS_32320 216655 216470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 217362 216673 gene locus_tag LOCUS_32330 217362 216673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 217715 217335 gene locus_tag LOCUS_32340 217715 217335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 218606 217761 gene locus_tag LOCUS_32350 218606 217761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32350 219553 218579 gene locus_tag LOCUS_32360 219553 218579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 220133 219606 gene locus_tag LOCUS_32370 220133 219606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 220741 220956 gene locus_tag LOCUS_32380 220741 220956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 221015 221308 gene locus_tag LOCUS_32390 221015 221308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 221301 221591 gene locus_tag LOCUS_32400 221301 221591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 221633 221830 gene locus_tag LOCUS_32410 221633 221830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 221916 222206 gene locus_tag LOCUS_32420 221916 222206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 222151 222429 gene locus_tag LOCUS_32430 222151 222429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 222494 223936 gene locus_tag LOCUS_32440 222494 223936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 224020 225465 gene locus_tag LOCUS_32450 224020 225465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 226763 226047 gene locus_tag LOCUS_32460 226763 226047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 227130 226906 gene locus_tag LOCUS_32470 227130 226906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 228289 228897 gene locus_tag LOCUS_32480 228289 228897 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_32480 228890 229678 gene locus_tag LOCUS_32490 228890 229678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 231154 230078 gene locus_tag LOCUS_32500 231154 230078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32500 232758 231172 gene locus_tag LOCUS_32510 232758 231172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32510 233706 232762 gene locus_tag LOCUS_32520 233706 232762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 235006 234773 gene locus_tag LOCUS_32530 235006 234773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 235622 235197 gene locus_tag LOCUS_32540 235622 235197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 236216 235680 gene locus_tag LOCUS_32550 236216 235680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 237040 236267 gene locus_tag LOCUS_32560 237040 236267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32560 237900 237013 gene locus_tag LOCUS_32570 237900 237013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 238810 238382 gene locus_tag LOCUS_32580 238810 238382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32580 239588 238812 gene locus_tag LOCUS_32590 239588 238812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 242467 239744 gene locus_tag LOCUS_32600 gene ligD 242467 239744 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395526.1 protein_id gnl|my_center|LOCUS_32600 243083 243646 gene locus_tag LOCUS_32610 243083 243646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 243711 244394 gene locus_tag LOCUS_32620 243711 244394 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_32620 244375 245694 gene locus_tag LOCUS_32630 244375 245694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 246257 247237 gene locus_tag LOCUS_32640 246257 247237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_32640 247260 248090 gene locus_tag LOCUS_32650 247260 248090 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 protein_id gnl|my_center|LOCUS_32650 248364 249221 gene locus_tag LOCUS_32660 248364 249221 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_32660 249261 250157 gene locus_tag LOCUS_32670 249261 250157 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501205.1 protein_id gnl|my_center|LOCUS_32670 250366 250599 gene locus_tag LOCUS_32680 250366 250599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 250619 251959 gene locus_tag LOCUS_32690 250619 251959 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_32690 252002 252880 gene locus_tag LOCUS_32700 252002 252880 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_32700 253122 252937 gene locus_tag LOCUS_32710 253122 252937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 253152 253931 gene locus_tag LOCUS_32720 253152 253931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 255760 253928 gene locus_tag LOCUS_32730 255760 253928 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882974.1 protein_id gnl|my_center|LOCUS_32730 257343 255769 gene locus_tag LOCUS_32740 257343 255769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 258215 257988 gene locus_tag LOCUS_32750 258215 257988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 260931 258433 gene locus_tag LOCUS_32760 260931 258433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 261719 263536 gene locus_tag LOCUS_32770 261719 263536 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_32770 263585 264688 gene locus_tag LOCUS_32780 gene carA 263585 264688 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_32780 264702 265586 gene locus_tag LOCUS_32790 gene folD 264702 265586 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_32790 265576 266430 gene locus_tag LOCUS_32800 gene prmA 265576 266430 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023220.1 protein_id gnl|my_center|LOCUS_32800 266411 267334 gene locus_tag LOCUS_32810 266411 267334 CDS product bifunctional 3-dehydroquinate synthase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545527.1 protein_id gnl|my_center|LOCUS_32810 267390 267758 gene locus_tag LOCUS_32820 gene mscL 267390 267758 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701438.1 protein_id gnl|my_center|LOCUS_32820 267829 268482 gene locus_tag LOCUS_32830 267829 268482 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_32830 268516 268851 gene locus_tag LOCUS_32840 268516 268851 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073565.1 protein_id gnl|my_center|LOCUS_32840 268861 269361 gene locus_tag LOCUS_32850 268861 269361 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_32850 269376 269810 gene locus_tag LOCUS_32860 269376 269810 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_32860 269953 271260 gene locus_tag LOCUS_32870 269953 271260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_32870 271268 272680 gene locus_tag LOCUS_32880 gene cysS 271268 272680 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_32880 273208 272720 gene locus_tag LOCUS_32890 273208 272720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 273709 273215 gene locus_tag LOCUS_32900 273709 273215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 273893 274198 gene locus_tag LOCUS_32910 273893 274198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 274242 275381 gene locus_tag LOCUS_32920 gene dnaN 274242 275381 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_32920 275525 276730 gene locus_tag LOCUS_32930 gene recF 275525 276730 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475454.1 protein_id gnl|my_center|LOCUS_32930 276727 277038 gene locus_tag LOCUS_32940 276727 277038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 277050 279035 gene locus_tag LOCUS_32950 gene gyrB 277050 279035 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_32950 279060 279890 gene locus_tag LOCUS_32960 279060 279890 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_32960 280459 280845 gene locus_tag LOCUS_32970 280459 280845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 281386 280901 gene locus_tag LOCUS_32980 gene coaD 281386 280901 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_32980 281917 281390 gene locus_tag LOCUS_32990 281917 281390 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_32990 282811 281921 gene locus_tag LOCUS_33000 282811 281921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 283350 282820 gene locus_tag LOCUS_33010 283350 282820 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583465.1 protein_id gnl|my_center|LOCUS_33010 284181 283522 gene locus_tag LOCUS_33020 284181 283522 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768246.1 protein_id gnl|my_center|LOCUS_33020 284993 284196 gene locus_tag LOCUS_33030 284993 284196 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932049.1 protein_id gnl|my_center|LOCUS_33030 285440 285024 gene locus_tag LOCUS_33040 285440 285024 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927170.1 protein_id gnl|my_center|LOCUS_33040 286086 286817 gene locus_tag LOCUS_33050 286086 286817 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866314.1 protein_id gnl|my_center|LOCUS_33050 287132 288493 gene locus_tag LOCUS_33060 gene der 287132 288493 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_33060 288581 290107 gene locus_tag LOCUS_33070 288581 290107 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_33070 291314 290184 gene locus_tag LOCUS_33080 gene asnA 291314 290184 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_33080 291930 291511 gene locus_tag LOCUS_33090 291930 291511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 292939 291986 gene locus_tag LOCUS_33100 292939 291986 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_33100 293758 292967 gene locus_tag LOCUS_33110 293758 292967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 294467 295189 gene locus_tag LOCUS_33120 294467 295189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 296801 295200 gene locus_tag LOCUS_33130 296801 295200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 297161 298666 gene locus_tag LOCUS_33140 297161 298666 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168007557.1 protein_id gnl|my_center|LOCUS_33140 298810 299796 gene locus_tag LOCUS_33150 298810 299796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 299836 303132 gene locus_tag LOCUS_33160 299836 303132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 303254 304975 gene locus_tag LOCUS_33170 303254 304975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 305100 306569 gene locus_tag LOCUS_33180 305100 306569 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_33180 306575 306955 gene locus_tag LOCUS_33190 306575 306955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 306940 307320 gene locus_tag LOCUS_33200 306940 307320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 307405 308034 gene locus_tag LOCUS_33210 307405 308034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 308118 308555 gene locus_tag LOCUS_33220 308118 308555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 308785 309306 gene locus_tag LOCUS_33230 308785 309306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 309916 309371 gene locus_tag LOCUS_33240 309916 309371 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946945.1 protein_id gnl|my_center|LOCUS_33240 310458 310901 gene locus_tag LOCUS_33250 310458 310901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33250 312431 312988 gene locus_tag LOCUS_33260 312431 312988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33260 313115 313270 gene locus_tag LOCUS_33270 313115 313270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 314341 314006 gene locus_tag LOCUS_33280 314341 314006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 315308 314376 gene locus_tag LOCUS_33290 315308 314376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 316719 315289 gene locus_tag LOCUS_33300 316719 315289 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067929.1 protein_id gnl|my_center|LOCUS_33300 317248 318108 gene locus_tag LOCUS_33310 317248 318108 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704940.1 protein_id gnl|my_center|LOCUS_33310 318112 318462 gene locus_tag LOCUS_33320 318112 318462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 318614 319030 gene locus_tag LOCUS_33330 318614 319030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 319201 319695 gene locus_tag LOCUS_33340 319201 319695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 320122 320421 gene locus_tag LOCUS_33350 320122 320421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence08 1431 1940 gene locus_tag LOCUS_33360 1431 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 3184 2084 gene locus_tag LOCUS_33370 3184 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3644 3324 gene locus_tag LOCUS_33380 3644 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 4969 3620 gene locus_tag LOCUS_33390 4969 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33390 5316 4978 gene locus_tag LOCUS_33400 5316 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 6337 5732 gene locus_tag LOCUS_33410 6337 5732 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719850.1 protein_id gnl|my_center|LOCUS_33410 6622 7641 gene locus_tag LOCUS_33420 6622 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 7672 9039 gene locus_tag LOCUS_33430 7672 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 9032 10354 gene locus_tag LOCUS_33440 9032 10354 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_33440 10390 11595 gene locus_tag LOCUS_33450 10390 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 11632 12756 gene locus_tag LOCUS_33460 11632 12756 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_33460 14223 13090 gene locus_tag LOCUS_33470 14223 13090 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_33470 16763 14220 gene locus_tag LOCUS_33480 16763 14220 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_33480 17439 16756 gene locus_tag LOCUS_33490 17439 16756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_33490 19067 17565 gene locus_tag LOCUS_33500 19067 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 19437 20720 gene locus_tag LOCUS_33510 19437 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 20892 21167 gene locus_tag LOCUS_33520 20892 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 21218 22408 gene locus_tag LOCUS_33530 21218 22408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 22488 23477 gene locus_tag LOCUS_33540 gene glsA 22488 23477 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816578.1 protein_id gnl|my_center|LOCUS_33540 23740 24567 gene locus_tag LOCUS_33550 23740 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 24609 25055 gene locus_tag LOCUS_33560 24609 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 25145 26233 gene locus_tag LOCUS_33570 25145 26233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 26791 27507 gene locus_tag LOCUS_33580 gene bshB1 26791 27507 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_33580 27886 27656 gene locus_tag LOCUS_33590 27886 27656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 29855 28359 gene locus_tag LOCUS_33600 29855 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 30219 31409 gene locus_tag LOCUS_33610 30219 31409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 31489 32211 gene locus_tag LOCUS_33620 31489 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33620 32247 32477 gene locus_tag LOCUS_33630 32247 32477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33630 32700 33965 gene locus_tag LOCUS_33640 32700 33965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 34098 35186 gene locus_tag LOCUS_33650 34098 35186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 35649 36071 gene locus_tag LOCUS_33660 35649 36071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 36192 36635 gene locus_tag LOCUS_33670 36192 36635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 36610 38406 gene locus_tag LOCUS_33680 36610 38406 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33680 38850 41291 gene locus_tag LOCUS_33690 38850 41291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 41379 42029 gene locus_tag LOCUS_33700 41379 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 42157 42531 gene locus_tag LOCUS_33710 42157 42531 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_33710 42601 43740 gene locus_tag LOCUS_33720 42601 43740 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_33720 45921 44005 gene locus_tag LOCUS_33730 45921 44005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 46288 46758 gene locus_tag LOCUS_33740 46288 46758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 46818 47372 gene locus_tag LOCUS_33750 46818 47372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 47443 47781 gene locus_tag LOCUS_33760 47443 47781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 48021 49115 gene locus_tag LOCUS_33770 48021 49115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 49271 49768 gene locus_tag LOCUS_33780 49271 49768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072209.1 protein_id gnl|my_center|LOCUS_33780 49791 50162 gene locus_tag LOCUS_33790 49791 50162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 50231 51040 gene locus_tag LOCUS_33800 50231 51040 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 protein_id gnl|my_center|LOCUS_33800 51413 52972 gene locus_tag LOCUS_33810 51413 52972 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_33810 52991 53761 gene locus_tag LOCUS_33820 52991 53761 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350445.1 protein_id gnl|my_center|LOCUS_33820 55083 54205 gene locus_tag LOCUS_33830 55083 54205 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_33830 56651 55131 gene locus_tag LOCUS_33840 gene atpA 56651 55131 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_33840 57258 56707 gene locus_tag LOCUS_33850 57258 56707 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966152.1 protein_id gnl|my_center|LOCUS_33850 57853 57290 gene locus_tag LOCUS_33860 57853 57290 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931713.1 protein_id gnl|my_center|LOCUS_33860 58157 57936 gene locus_tag LOCUS_33870 gene atpE 58157 57936 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931714.1 protein_id gnl|my_center|LOCUS_33870 59204 58254 gene locus_tag LOCUS_33880 59204 58254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 59589 59263 gene locus_tag LOCUS_33890 59589 59263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 59960 59655 gene locus_tag LOCUS_33900 59960 59655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 62028 60481 gene locus_tag LOCUS_33910 62028 60481 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_33910 63712 62402 gene locus_tag LOCUS_33920 gene murA 63712 62402 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399439.1 protein_id gnl|my_center|LOCUS_33920 64806 63853 gene locus_tag LOCUS_33930 64806 63853 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931855.1 protein_id gnl|my_center|LOCUS_33930 66759 64819 gene locus_tag LOCUS_33940 66759 64819 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_33940 67490 66768 gene locus_tag LOCUS_33950 67490 66768 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_33950 68782 67493 gene locus_tag LOCUS_33960 68782 67493 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_33960 69656 68937 gene locus_tag LOCUS_33970 69656 68937 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986655.1 protein_id gnl|my_center|LOCUS_33970 70262 69687 gene locus_tag LOCUS_33980 70262 69687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 70859 70263 gene locus_tag LOCUS_33990 70859 70263 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_33990 71574 70864 gene locus_tag LOCUS_34000 gene hddC 71574 70864 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_34000 72575 71592 gene locus_tag LOCUS_34010 72575 71592 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_34010 73555 72572 gene locus_tag LOCUS_34020 73555 72572 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877868.1 protein_id gnl|my_center|LOCUS_34020 74401 73559 gene locus_tag LOCUS_34030 74401 73559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 75414 74899 gene locus_tag LOCUS_34040 75414 74899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 75751 75530 gene locus_tag LOCUS_34050 75751 75530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence09 1326 841 gene locus_tag LOCUS_34060 1326 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3720 3905 gene locus_tag LOCUS_34070 3720 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 5545 5348 gene locus_tag LOCUS_34080 5545 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 6334 6050 gene locus_tag LOCUS_34090 6334 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34090 7290 7003 gene locus_tag LOCUS_34100 7290 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34100 7603 7415 gene locus_tag LOCUS_34110 7603 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 7787 7581 gene locus_tag LOCUS_34120 7787 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34120 8062 7910 gene locus_tag LOCUS_34130 8062 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 8674 8270 gene locus_tag LOCUS_34140 8674 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34140 8856 8671 gene locus_tag LOCUS_34150 8856 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 9031 8843 gene locus_tag LOCUS_34160 9031 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34160 9772 9395 gene locus_tag LOCUS_34170 9772 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34170 10676 10041 gene locus_tag LOCUS_34180 gene tsaB 10676 10041 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_34180 11137 10694 gene locus_tag LOCUS_34190 gene tsaE 11137 10694 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_34190 12117 11134 gene locus_tag LOCUS_34200 12117 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34200 12727 12083 gene locus_tag LOCUS_34210 12727 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34210 13748 14557 gene locus_tag LOCUS_34220 13748 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 15258 14737 gene locus_tag LOCUS_34230 15258 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 15680 17005 gene locus_tag LOCUS_34240 gene mtaB 15680 17005 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_34240 17033 18373 gene locus_tag LOCUS_34250 gene preA 17033 18373 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_34250 18491 18622 gene locus_tag LOCUS_34260 18491 18622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 18793 19350 gene locus_tag LOCUS_34270 18793 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 19347 20087 gene locus_tag LOCUS_34280 19347 20087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 20128 21744 gene locus_tag LOCUS_34290 20128 21744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 23104 21791 gene locus_tag LOCUS_34300 23104 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 24327 23101 gene locus_tag LOCUS_34310 24327 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 24521 24339 gene locus_tag LOCUS_34320 24521 24339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 24979 24632 gene locus_tag LOCUS_34330 24979 24632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 26284 25001 gene locus_tag LOCUS_34340 26284 25001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34340 28146 26419 gene locus_tag LOCUS_34350 28146 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 29283 32036 gene locus_tag LOCUS_34360 29283 32036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 32046 34064 gene locus_tag LOCUS_34370 32046 34064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 34225 36786 gene locus_tag LOCUS_34380 34225 36786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 37048 39711 gene locus_tag LOCUS_34390 37048 39711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 40250 39903 gene locus_tag LOCUS_34400 40250 39903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 40398 41030 gene locus_tag LOCUS_34410 gene tmk 40398 41030 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583153.1 protein_id gnl|my_center|LOCUS_34410 41040 41354 gene locus_tag LOCUS_34420 41040 41354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34420 41390 42703 gene locus_tag LOCUS_34430 41390 42703 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34430 42764 43885 gene locus_tag LOCUS_34440 42764 43885 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909198.1 protein_id gnl|my_center|LOCUS_34440 43916 44857 gene locus_tag LOCUS_34450 43916 44857 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence10 262 74 gene locus_tag LOCUS_34460 262 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 519 238 gene locus_tag LOCUS_34470 519 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 1705 1250 gene locus_tag LOCUS_34480 1705 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 2031 1816 gene locus_tag LOCUS_34490 2031 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34490 3080 2055 gene locus_tag LOCUS_34500 3080 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 10342 3149 gene locus_tag LOCUS_34510 10342 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 11152 10424 gene locus_tag LOCUS_34520 11152 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34520 11377 11165 gene locus_tag LOCUS_34530 11377 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34530 12100 11402 gene locus_tag LOCUS_34540 12100 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 13104 12118 gene locus_tag LOCUS_34550 13104 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 13805 13101 gene locus_tag LOCUS_34560 13805 13101 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_34560 14189 16492 gene locus_tag LOCUS_34570 14189 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 17316 16504 gene locus_tag LOCUS_34580 17316 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 18973 17426 gene locus_tag LOCUS_34590 18973 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 20286 19027 gene locus_tag LOCUS_34600 20286 19027 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_34600 21216 20311 gene locus_tag LOCUS_34610 gene cysD 21216 20311 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_34610 21824 21228 gene locus_tag LOCUS_34620 gene cysC 21824 21228 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_34620 22670 22158 gene locus_tag LOCUS_34630 22670 22158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34630 22874 22680 gene locus_tag LOCUS_34640 22874 22680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 23780 23944 gene locus_tag LOCUS_34650 23780 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 23874 24122 gene locus_tag LOCUS_34660 23874 24122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 24868 25623 gene locus_tag LOCUS_34670 24868 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 25937 26176 gene locus_tag LOCUS_34680 25937 26176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 27015 26830 gene locus_tag LOCUS_34690 27015 26830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 27855 27550 gene locus_tag LOCUS_34700 27855 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 27991 27842 gene locus_tag LOCUS_34710 27991 27842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 29407 29264 gene locus_tag LOCUS_34720 29407 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence11 217 498 gene locus_tag LOCUS_34730 217 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 589 855 gene locus_tag LOCUS_34740 589 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 1033 1887 gene locus_tag LOCUS_34750 1033 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34750 2564 2136 gene locus_tag LOCUS_34760 2564 2136 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_34760 3424 3690 gene locus_tag LOCUS_34770 3424 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 4114 4902 gene locus_tag LOCUS_34780 4114 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34780 4947 5213 gene locus_tag LOCUS_34790 4947 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 5263 6441 gene locus_tag LOCUS_34800 5263 6441 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_34800 6564 7784 gene locus_tag LOCUS_34810 6564 7784 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_34810 7810 8766 gene locus_tag LOCUS_34820 7810 8766 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_34820 10096 9215 gene locus_tag LOCUS_34830 10096 9215 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34830 12123 10276 gene locus_tag LOCUS_34840 12123 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 13744 12242 gene locus_tag LOCUS_34850 13744 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 15353 13896 gene locus_tag LOCUS_34860 15353 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34860 15861 15556 gene locus_tag LOCUS_34870 15861 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34870 16148 15858 gene locus_tag LOCUS_34880 16148 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 16581 16033 gene locus_tag LOCUS_34890 16581 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34890 17586 16843 gene locus_tag LOCUS_34900 17586 16843 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_34900 18458 17598 gene locus_tag LOCUS_34910 18458 17598 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227952.1 protein_id gnl|my_center|LOCUS_34910 19381 18482 gene locus_tag LOCUS_34920 19381 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34920 20018 19353 gene locus_tag LOCUS_34930 20018 19353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34930 20706 21062 gene locus_tag LOCUS_34940 20706 21062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 21185 21838 gene locus_tag LOCUS_34950 21185 21838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34950 21981 22664 gene locus_tag LOCUS_34960 gene lpxA 21981 22664 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_34960 22670 23176 gene locus_tag LOCUS_34970 22670 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 23177 24001 gene locus_tag LOCUS_34980 gene panB 23177 24001 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933009.1 protein_id gnl|my_center|LOCUS_34980 24230 24024 gene locus_tag LOCUS_34990 24230 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 24609 24157 gene locus_tag LOCUS_35000 24609 24157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 24866 25597 gene locus_tag LOCUS_35010 24866 25597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35010 25811 26284 gene locus_tag LOCUS_35020 25811 26284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35020 27328 27687 gene locus_tag LOCUS_35030 27328 27687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence12 812 30 gene locus_tag LOCUS_35040 812 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 1141 809 gene locus_tag LOCUS_35050 1141 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1500 1144 gene locus_tag LOCUS_35060 1500 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 2636 1737 gene locus_tag LOCUS_35070 2636 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3121 2708 gene locus_tag LOCUS_35080 3121 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3313 3143 gene locus_tag LOCUS_35090 3313 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 3494 3300 gene locus_tag LOCUS_35100 3494 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4255 4025 gene locus_tag LOCUS_35110 4255 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 5369 4932 gene locus_tag LOCUS_35120 5369 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 6512 5385 gene locus_tag LOCUS_35130 6512 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 7062 6505 gene locus_tag LOCUS_35140 7062 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 7404 7129 gene locus_tag LOCUS_35150 7404 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 7855 7502 gene locus_tag LOCUS_35160 7855 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 9712 8546 gene locus_tag LOCUS_35170 9712 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 10224 9724 gene locus_tag LOCUS_35180 10224 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 10403 10221 gene locus_tag LOCUS_35190 10403 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 10690 10490 gene locus_tag LOCUS_35200 10690 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 11861 10926 gene locus_tag LOCUS_35210 11861 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 13378 11858 gene locus_tag LOCUS_35220 13378 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 13574 13353 gene locus_tag LOCUS_35230 13574 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 14131 13574 gene locus_tag LOCUS_35240 14131 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 14310 14131 gene locus_tag LOCUS_35250 14310 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 14741 14337 gene locus_tag LOCUS_35260 14741 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 15009 14821 gene locus_tag LOCUS_35270 15009 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 15361 15038 gene locus_tag LOCUS_35280 15361 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 15620 15348 gene locus_tag LOCUS_35290 15620 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 16570 15605 gene locus_tag LOCUS_35300 16570 15605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 16932 16678 gene locus_tag LOCUS_35310 16932 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 17941 16937 gene locus_tag LOCUS_35320 17941 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 18573 18280 gene locus_tag LOCUS_35330 18573 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 19058 18570 gene locus_tag LOCUS_35340 19058 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 19744 19055 gene locus_tag LOCUS_35350 19744 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 20174 19794 gene locus_tag LOCUS_35360 20174 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 21168 20209 gene locus_tag LOCUS_35370 21168 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956896.1 protein_id gnl|my_center|LOCUS_35370 21409 21185 gene locus_tag LOCUS_35380 21409 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 21743 21372 gene locus_tag LOCUS_35390 21743 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 22022 21762 gene locus_tag LOCUS_35400 22022 21762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 23463 21955 gene locus_tag LOCUS_35410 23463 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence13 216 37 gene locus_tag LOCUS_35420 216 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 728 243 gene locus_tag LOCUS_35430 728 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 1258 935 gene locus_tag LOCUS_35440 1258 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 2464 1940 gene locus_tag LOCUS_35450 2464 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 3255 2461 gene locus_tag LOCUS_35460 3255 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 3790 3509 gene locus_tag LOCUS_35470 3790 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 4450 3866 gene locus_tag LOCUS_35480 4450 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 4791 4447 gene locus_tag LOCUS_35490 4791 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 5620 4931 gene locus_tag LOCUS_35500 5620 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 5979 5626 gene locus_tag LOCUS_35510 5979 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 6446 6000 gene locus_tag LOCUS_35520 6446 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 7492 6473 gene locus_tag LOCUS_35530 7492 6473 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101749.1 protein_id gnl|my_center|LOCUS_35530 8110 7517 gene locus_tag LOCUS_35540 8110 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 8448 8257 gene locus_tag LOCUS_35550 8448 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 9997 8480 gene locus_tag LOCUS_35560 9997 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 10830 10063 gene locus_tag LOCUS_35570 10830 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 11420 10830 gene locus_tag LOCUS_35580 11420 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 11941 11423 gene locus_tag LOCUS_35590 11941 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 12065 11931 gene locus_tag LOCUS_35600 12065 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 12726 12517 gene locus_tag LOCUS_35610 12726 12517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 12913 12719 gene locus_tag LOCUS_35620 12913 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 13694 12930 gene locus_tag LOCUS_35630 13694 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054994499.1 protein_id gnl|my_center|LOCUS_35630 13882 13694 gene locus_tag LOCUS_35640 13882 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 14082 13879 gene locus_tag LOCUS_35650 14082 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 14472 14182 gene locus_tag LOCUS_35660 14472 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 14703 14515 gene locus_tag LOCUS_35670 14703 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 15121 14927 gene locus_tag LOCUS_35680 15121 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 15628 15143 gene locus_tag LOCUS_35690 15628 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 15810 15625 gene locus_tag LOCUS_35700 15810 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 17017 16040 gene locus_tag LOCUS_35710 17017 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 17880 17017 gene locus_tag LOCUS_35720 17880 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 18139 17864 gene locus_tag LOCUS_35730 18139 17864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 18496 18278 gene locus_tag LOCUS_35740 18496 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 20858 18627 gene locus_tag LOCUS_35750 20858 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 21158 20922 gene locus_tag LOCUS_35760 21158 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 21439 21155 gene locus_tag LOCUS_35770 21439 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 21638 21447 gene locus_tag LOCUS_35780 21638 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 22108 21635 gene locus_tag LOCUS_35790 22108 21635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 22350 22105 gene locus_tag LOCUS_35800 22350 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 22886 22335 gene locus_tag LOCUS_35810 22886 22335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 23265 22879 gene locus_tag LOCUS_35820 23265 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 23457 23281 gene locus_tag LOCUS_35830 23457 23281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence14 9961 5300 gene locus_tag LOCUS_35840 9961 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 11552 10254 gene locus_tag LOCUS_35850 11552 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 12298 11588 gene locus_tag LOCUS_35860 12298 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence15 246 401 gene locus_tag LOCUS_35870 246 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 520 1185 gene locus_tag LOCUS_35880 520 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1139 1585 gene locus_tag LOCUS_35890 1139 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 1878 2060 gene locus_tag LOCUS_35900 1878 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 2057 2557 gene locus_tag LOCUS_35910 2057 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2568 3734 gene locus_tag LOCUS_35920 2568 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3887 4255 gene locus_tag LOCUS_35930 3887 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4850 5125 gene locus_tag LOCUS_35940 4850 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 5115 5456 gene locus_tag LOCUS_35950 5115 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 5425 6222 gene locus_tag LOCUS_35960 5425 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 6223 6675 gene locus_tag LOCUS_35970 6223 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 6668 6862 gene locus_tag LOCUS_35980 6668 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 6855 7412 gene locus_tag LOCUS_35990 6855 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 7405 7626 gene locus_tag LOCUS_36000 7405 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence16 658 149 gene locus_tag LOCUS_36010 658 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 893 675 gene locus_tag LOCUS_36020 893 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1867 890 gene locus_tag LOCUS_36030 1867 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 2649 1867 gene locus_tag LOCUS_36040 2649 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3257 2820 gene locus_tag LOCUS_36050 3257 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3442 3230 gene locus_tag LOCUS_36060 3442 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3949 3464 gene locus_tag LOCUS_36070 3949 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 4238 3942 gene locus_tag LOCUS_36080 4238 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 5182 4376 gene locus_tag LOCUS_36090 5182 4376 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793656.1 protein_id gnl|my_center|LOCUS_36090 5406 5179 gene locus_tag LOCUS_36100 5406 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100