COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..75380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..1170 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene cytR CDS 1367..2221 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene ftsN CDS 2314..2844 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene hslV CDS 2854..4185 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene hslU CDS 4240..5178 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene menA CDS 5271..5756 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene rraA CDS complement(5841..6080) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene zapB CDS 6512..7357 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene glpF CDS 7380..8888 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene glpK CDS 8894..10033 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene glpX CDS 10130..10876 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene fpr CDS complement(10881..11309) product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene uspD CDS complement(11336..11635) product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655986.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(11847..12287) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 12388..12987 product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 13095..13862 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene tpiA CDS complement(13917..14672) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene cdh CDS complement(14778..15767) product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene sbp CDS complement(16087..17049) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene pfkA CDS complement(17230..18132) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene fieF CDS complement(18340..18981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(19421..20584) product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(20584..21063) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(21078..23525) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(23670..23945) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(24002..24520) product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(24533..25723) product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(26054..26464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(26464..28497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(28494..29105) product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098785.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(29098..30006) product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(30011..30358) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(30355..30990) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(31057..31509) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(31502..31969) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(31932..32090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(32077..32502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(32490..32915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(32930..33427) product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229398.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(33427..33708) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(33712..33915) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(33915..34388) product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(34523..35272) product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(35276..36349) product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(36408..37262) product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 37436..39208 product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 39208..40242 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049560050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 40455..40592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 40657..41778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 41768..42757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(42765..43709) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(43911..46187) product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(46177..46452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(46449..46673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(46676..46975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(46975..47199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(47263..47763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(47760..47930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(47933..48205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 48342..48635 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815649.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 48705..49685 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(49872..50372) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene cpxP CDS 50522..51220 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene cpxR CDS 51217..52590 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene cpxA CDS complement(52696..53370) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene yiiM CDS complement(53519..54502) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene kdgT CDS complement(54762..55382) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene sodA CDS 55667..56701 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene rhaT CDS complement(56698..57636) product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene rhaR CDS complement(57620..58456) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene rhaS CDS 58744..60213 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rhaB CDS 60210..61469 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene rhaA CDS 61711..62535 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rhaD CDS 62545..62859 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rhaM CDS 63160..63606 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 63617..65068 product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 65058..66128 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 66128..67876 product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(67926..68981) product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(69134..69967) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene fdhD CDS 70161..73211 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723259.1 transl_table 11 codon_start 1 transl_except (pos:70746..70748,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_00810 gene fdnG CDS 73224..74126 product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene fdoH CDS 74123..74758 product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene fdoI sequence002 source 1..74491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(871..1809) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(1829..2593) product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 2909..3820 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284798.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(3863..5014) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(5028..6623) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805650.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(6768..7526) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860201.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene aroD CDS complement(7557..8423) product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene ydiB CDS complement(8435..9700) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(9927..11132) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039066128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(11232..11588) product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(12017..13129) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene ydiK CDS 13518..16574 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 16571..16981 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene menI CDS 17000..17269 product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 17817..18185 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene sufA CDS 18194..19681 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene sufB CDS 19691..20437 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene sufC CDS 20412..21683 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908012.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene sufD CDS 21680..22900 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene sufS CDS 22913..23329 product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene sufE CDS 23478..24482 product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene ldtE CDS complement(24545..24781) product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene lpp CDS complement(25092..26504) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene pykF CDS 27061..27270 product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528342.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene fumD CDS 27725..28351 product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 28372..30474 product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 30487..31125 product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001344535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 31303..31857 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001412436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 31854..32639 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 32691..33455 product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene ydhT CDS complement(33467..35071) product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(35197..35502) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212657.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 tRNA complement(35610..35686) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(35691..35767) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 36075..37331 product AIDA repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(37372..38745) product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene mdtK CDS 38960..39601 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene ribE CDS complement(39641..40789) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene cfa CDS complement(41080..42291) product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene punC CDS 42404..43336 product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene punR CDS complement(43333..44358) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene purR CDS 44912..46081 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(46316..46897) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene sodB CDS complement(47025..47771) product peptidoglycan DD-endopeptidase MepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene mepH CDS 47728..47898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 47940..48092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 48174..48521 product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene grxD CDS complement(48572..53188) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(53281..53928) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene rnt CDS complement(54031..54438) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene gloA CDS complement(54519..55616) product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene nemA CDS complement(55653..56252) product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene nemR CDS 56643..57539 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 57620..58141 product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene sodC CDS complement(58142..60154) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(60154..61011) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(61014..61250) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 61451..61885 product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene slyA CDS complement(61932..62399) product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene slyB CDS 62673..63782 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene anmK CDS 63886..64209 product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene mliC CDS 64268..64924 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene pdxH CDS 65053..66327 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene tyrS CDS 66389..67249 product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene pdxY CDS complement(67293..67898) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene gstA CDS complement(68004..69506) product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100932.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene dtpA CDS complement(70117..70752) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene nth CDS complement(70752..71447) product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene rsxE CDS complement(71451..72071) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene rsxG CDS complement(72075..73133) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rsxD misc_feature complement(73134..>74491) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000915678.1:electron transport complex subunit RsxC locus_tag LOCUS_01520 sequence003 source 1..68967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..685 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000584565.1:bifunctional tetrahydrofolate synthase/dihydrofolate synthase locus_tag LOCUS_01530 CDS 675..1337 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene dedD CDS 1596..2084 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene cvpA CDS 2121..3638 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene purF CDS 3733..4302 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene ubiX CDS 4568..5350 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene argT CDS 5571..5801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 note possible pseudo, frameshifted CDS 5837..6352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 note possible pseudo, frameshifted CDS 6442..7128 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene hisQ CDS 7125..7841 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 7849..8622 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene hisP CDS 9038..9514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 note possible pseudo, internal stop codon, frameshifted CDS 9547..9708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 note possible pseudo, frameshifted CDS complement(9756..10649) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(10670..11032) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene folX CDS complement(11089..11736) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene yfcG CDS 11872..12516 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene yfcF CDS 12572..13123 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene yfcE CDS 13181..13723 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437935.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene yfcD CDS complement(13756..15234) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene yfcC CDS complement(15466..17610) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene pta CDS complement(17685..18887) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene ackA CDS 19226..19681 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene yfbV CDS 19764..20258 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 20269..20919 product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene hxpA CDS 21006..22838 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(22897..23496) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene yfbR CDS complement(23580..24797) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene alaA CDS 25717..26655 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene lrhA CDS 27285..27728 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene nuoA CDS 27744..28406 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene nuoB CDS 28500..30302 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene nuoC CDS 30305..30805 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene nuoE CDS 30802..32139 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene nuoF CDS 32192..34918 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene nuoG CDS 34915..35892 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene nuoH CDS 35907..36449 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene nuoI CDS 36461..37015 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene nuoJ CDS 37012..37314 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene nuoK CDS 37311..39152 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene nuoL CDS 39316..40845 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene nuoM CDS 40852..42309 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156701.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene nuoN CDS complement(42376..42879) product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525365.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(44000..45238) product deubiquitinase ElaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317231.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene elaD CDS complement(45407..46324) product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rbn CDS 46389..46850 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 46905..47210 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene elaB CDS 47289..48584 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene menF CDS 48673..50343 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene menD CDS 50340..51098 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene menH CDS 51113..51970 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene menB CDS 51970..52932 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene menC CDS 52929..54284 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene menE CDS 54394..54660 product signal transduction protein PmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene pmrD CDS complement(54654..55040) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene arnF CDS complement(55040..55375) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene arnE CDS complement(55372..57024) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene arnT CDS complement(57024..57914) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene arnD CDS complement(57911..59893) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene arnA CDS complement(59893..60861) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene arnC CDS complement(60865..62004) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene arnB CDS 62312..62914 product lipopolysaccharide core heptose(II)-phosphate phosphatase Ais inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene ais CDS complement(62953..63378) product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene nudI CDS 63658..64200 product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 64300..65502 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 65722..66504 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 66519..67724 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene rhmD sequence004 source 1..52596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 72..905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 886..1038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 note possible pseudo, frameshifted CDS 1038..1985 product YscQ/HrcQ family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 1975..2640 product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 2650..2910 product EscS/YscS/HrcS family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 2912..3679 product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene sctT CDS 3688..4149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 note possible pseudo, frameshifted CDS 4088..4420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 note possible pseudo, frameshifted CDS 4447..4809 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(4871..5164) product invasion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060557.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(5166..5666) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 5924..7105 product PrgH/EprH family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001365813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 7119..7274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 7451..7666 product type III secretion system inner rod subunit SctI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566300.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene sctI CDS 7770..8441 product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 8457..9038 product type III secretion apparatus protein OrgA/MxiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 9304..9687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 9909..10064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 note possible pseudo, internal stop codon CDS 10095..10541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 note possible pseudo, internal stop codon CDS complement(10586..10960) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(11145..11363) product protein YgeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene ygeI CDS complement(11531..12907) product HilA family transcriptional regulator YgeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene ygeH CDS complement(13242..13733) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(14011..14448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 14642..15067 product protein YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350612.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene yqeK CDS complement(15216..15698) product protein YqeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene yqeJ CDS complement(15691..16311) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 16621..16830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(16834..17352) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(17926..19155) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065950.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 19410..20591 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 20878..21714 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene kduI CDS 21744..22505 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene kduD CDS 22880..24238 product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene araE CDS 24367..25059 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene ygeA CDS complement(25046..25981) product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741825.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene lysR CDS 26103..27365 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene lysA CDS complement(27372..28403) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene galR CDS 28989..31148 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene aas CDS 31141..32334 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene lplT CDS complement(32366..33145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 note possible pseudo, internal stop codon CDS complement(33248..33406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 note possible pseudo, internal stop codon CDS complement(33514..33732) product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene ygdR CDS complement(33870..34583) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(34652..35341) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene mutH CDS 36026..36556 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene rppH CDS 36569..38815 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene ptsP CDS 38966..39841 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene lgt CDS 39848..40642 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene thyA CDS 40827..41297 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 41288..41851 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 41848..42255 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078391.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 42240..42563 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 42576..45944 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene recC CDS 46120..49008 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene ptrA CDS 49001..52543 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene recB sequence005 source 1..45086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1017) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene thiK CDS complement(998..1639) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene lpoB CDS complement(1653..2030) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(2033..2392) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene hinT CDS 2726..4915 product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953450.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene fhuE CDS complement(4975..6408) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene ptsG CDS complement(6703..7500) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(7511..8515) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene holB CDS complement(8512..9153) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene tmk CDS complement(9143..10165) product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene yceG CDS complement(10168..10977) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene pabC CDS complement(11097..12338) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene fabF CDS complement(12426..12662) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene acpP CDS complement(12873..13607) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene fabG CDS complement(13620..14549) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene fabD CDS complement(14565..15518) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene fabH CDS complement(15586..16656) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene plsX CDS complement(16737..16910) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene rpmF CDS complement(16962..17483) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene yceD CDS 17643..18266 product 7-methyl-GTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene yceF CDS complement(18378..19337) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rluC CDS 19910..23095 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene rne CDS complement(23291..24244) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene flgL CDS complement(24256..25899) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene flgK CDS complement(25965..26906) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene flgJ CDS complement(26906..28006) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene flgI CDS complement(28015..28713) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295442.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene flgH CDS complement(28766..29548) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene flgG CDS complement(29720..30475) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene flgF CDS complement(30495..31700) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene flgE CDS complement(31725..32420) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene flgD CDS complement(32432..32836) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene flgC CDS complement(32840..33256) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene flgB CDS 33412..34071 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene flgA CDS 34147..34440 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene flgM CDS 34445..34861 product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene flgN CDS complement(34901..36436) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene murJ CDS complement(36546..37469) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(37471..38118) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(38129..38713) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene rimJ CDS 38949..40157 product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene mdtH CDS 40221..40868 product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene grxB CDS 41002..41562 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 41794..42714 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene pyrC CDS 42788..43033 product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene dinI CDS 43323..43577 product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414437.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene bssS CDS 43692..44810 product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene solA sequence006 source 1..41267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(722..1180) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(1235..2086) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene manZ CDS complement(2099..2899) product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene manY CDS complement(2962..3933) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene manX CDS 4396..5958 product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene yoaE CDS complement(5962..7560) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(7691..9055) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene sdaA CDS complement(9239..9817) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(9821..11182) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene pabB CDS 11256..11435 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(11555..11914) product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307845.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(12276..12623) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 12752..14662 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 14720..15415 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene tsaB CDS 15455..16036 product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene yeaY CDS 16175..17926 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene fadD CDS 17996..19123 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rnd CDS complement(19177..20142) product carnitine monooxygenase subunit YeaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene yeaX CDS complement(20198..21322) product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene yeaW CDS complement(21354..22964) product BCCT family transporter YeaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene yeaV CDS complement(23215..24300) product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene dmlA CDS 24403..25326 product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene dmlR CDS 25453..26091 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene leuE CDS 26264..26623 product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene yeaR CDS 26627..26809 product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 26957..27205 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(27472..28497) product diguanylate cyclase DgcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene dgcP CDS 28680..28934 product DUF333 domain-containing lipoprotein YoaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene yoaF CDS complement(28956..29303) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297652.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(29358..30539) product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene nimT CDS 31023..31457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(31414..31860) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(32135..32638) product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene yeaK CDS complement(32681..34171) product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene dgcJ CDS complement(34352..35686) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(35974..37257) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(37370..39304) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene yeaG CDS 39740..40486 product scaffolding protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene mipA sequence007 source 1..41033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 tRNA complement(1141..1214) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(1293..2048) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene actS CDS 2463..4760 product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene xdhA CDS 4771..5649 product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene xdhB CDS 5646..6125 product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene xdhC CDS complement(6165..7943) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417791.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 8422..9609 product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene ygeW CDS 9667..10863 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene dpaL CDS 10921..12132 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 12185..13570 product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264452.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene hyuA CDS 13618..14550 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene arcC CDS complement(14591..16216) product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene yqeB CDS complement(16264..16743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 17137..17715 product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene mocA CDS 18037..21135 product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene ygfK CDS 21138..22466 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene ssnA CDS 22517..23296 product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene ygfM CDS 23293..26163 product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 26328..27728 product xanthine/proton symporter XanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene xanQ CDS 27746..29062 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene guaD CDS 29098..30465 product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene ghxQ CDS complement(30501..30989) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(30989..32923) product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene ygfT CDS 33344..34792 product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene uacT CDS 35042..35590 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene idi CDS complement(35633..37150) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene lysS CDS complement(37160..38041) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001701073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene prfB note possible pseudo, frameshifted CDS complement(38349..40082) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene recJ CDS complement(40088..40798) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene dsbC sequence008 source 1..39869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 29..104 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(560..1276) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(1619..3073) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene amn CDS complement(3175..4491) product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene shiA CDS 4806..5858 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(5986..6633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 note possible pseudo, internal stop codon CDS complement(6682..7944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 note possible pseudo, internal stop codon, frameshifted CDS complement(7980..8150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 note possible pseudo, frameshifted CDS complement(8077..8805) product inverse autotransporter beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(9477..11498) product siderophore yersiniabactin receptor FyuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene fyuA CDS complement(11629..13206) product yersiniabactin biosynthesis salycil-AMP ligase YbtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene ybtE CDS complement(13210..14013) product yersiniabactin biosynthesis thioesterase YbtT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene ybtT CDS complement(14010..15110) product yersiniabactin biosynthesis oxidoreductase YbtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene ybtU CDS complement(15107..24598) product yersiniabactin polyketide synthase HMWP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212777.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene irp1 CDS complement(24686..30793) product yersiniabactin non-ribosomal peptide synthetase HMWP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene irp2 CDS complement(30984..31943) product yersiniabactin transcriptional regulator YbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene ybtA CDS 32200..33912 product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ybtP CDS 33899..35701 product yersiniabactin ABC transporter ATP-binding/permease protein YbtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene ybtQ CDS 35694..36974 product yersiniabactin-associated zinc MFS transporter YbtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene ybtX CDS 37002..38306 product yersiniabactin biosynthesis salicylate synthase Irp9/YbtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene ybtS CDS complement(38500..39543) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 39562..39789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 sequence009 source 1..37262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..1005) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene iaaA CDS 1209..2444 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene moeA CDS 2444..3193 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene moeB CDS complement(3372..4034) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene fsa CDS 4165..5064 product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 5070..7502 product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 7648..8463 product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene ybiV CDS 8615..9880 product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(10121..11713) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 11932..12852 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene ldtB CDS complement(12911..14029) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(14026..14493) product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene mntR CDS 14679..14807 product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene mntS CDS 15079..16662 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene opgE CDS complement(16711..17226) product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene ompX CDS 17579..18466 product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene rhtA CDS 18765..19268 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene dps CDS 19672..20418 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene glnH CDS 20557..21216 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene glnP CDS 21213..21935 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene glnQ CDS 22196..24421 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene ybiO CDS complement(24418..25344) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene rlmF CDS 25620..25880 product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene mcbA CDS 26145..28427 product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 28469..29146 product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene ybiX CDS 29220..29486 product C4-type zinc finger protein YbiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene ybiI CDS 29751..30011 product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene ybiJ CDS complement(30240..31325) product hydroxycarboxylate dehydrogenase HcXB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene hcxB CDS complement(31466..32428) product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene ybiB CDS complement(32456..34606) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene dinG CDS 34759..35208 product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene ybiA CDS complement(35440..36804) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rhlE sequence010 source 1..34912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..594 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066639.1:class I fumarate hydratase locus_tag LOCUS_04430 CDS 737..2140 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene fumC CDS complement(2137..3078) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene tus CDS complement(3142..4443) product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rstB CDS complement(4447..5166) product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene rstA CDS 5295..5630 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(5627..6349) product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513673.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene folM CDS complement(6386..7768) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(7954..8898) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene ydgH CDS 9422..10954 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene pntA CDS 10965..12353 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene pntB CDS complement(12378..13412) product AI-2 transporter TqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene tqsA CDS 13824..14189 product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene mdtJ CDS 14176..14505 product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene mdtI CDS complement(14544..15365) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(15641..15976) product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene asr CDS complement(16373..17626) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 17733..18626 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 18761..19981 product DNA-binding transcriptional repressor Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene mlc CDS 20106..20801 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919231.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene bioD CDS complement(20754..22010) product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene clcB CDS complement(22205..22819) product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene dmsD CDS complement(22862..23716) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526503.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(23718..24335) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene dmsB CDS complement(24346..26772) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(26830..29256) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(29455..29760) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 29832..30578 product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(30581..31141) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138584.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene speG CDS complement(31176..31517) product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 31652..31978 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 32015..32203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 32184..33398 product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rspA CDS 33410..34429 product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(34617..34760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 sequence011 source 1..33643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 46..1872 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene recD CDS complement(1934..3265) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene argA CDS 3497..4750 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene amiC tRNA complement(4824..4900) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 5139..6206 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene mltA CDS 6445..7251 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene tcdA CDS complement(7302..7745) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene csdE CDS complement(7745..8950) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene csdA CDS 9142..9369 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 9720..10637 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene gcvA CDS 10656..11051 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 11044..12144 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rlmM CDS complement(12188..12919) product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene fucR CDS complement(12977..13399) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene fucU CDS complement(13401..14819) product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene fucK CDS complement(14928..16703) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene fucI CDS complement(16736..18052) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene fucP CDS 18599..19246 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440781.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene fucA CDS 19274..20422 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene fucO CDS complement(20477..21232) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene xni CDS complement(21344..22711) product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene sdaB CDS complement(22769..24058) product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene sdaC CDS complement(24615..25979) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene ppnN CDS complement(26091..26939) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene queF CDS 27007..27552 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene syd CDS 28174..28503 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 28503..29285 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene truC CDS 29303..29752 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 30187..31539 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene gudP CDS 31541..32671 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 note possible pseudo, frameshifted CDS 32734..32880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 note possible pseudo, frameshifted sequence012 source 1..33239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001238899.1:DNA helicase Rep locus_tag LOCUS_05080 CDS complement(1097..2581) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene gppA CDS complement(2717..3982) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rhlB CDS 4113..4442 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene trxA CDS 4769..6028 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene rho CDS 6038..6256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 6268..7371 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene wecA CDS 7383..8429 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene wzzE CDS 8485..9615 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene wecB CDS 9612..10874 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene wecC CDS 10874..11941 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene rffG CDS 11960..12841 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene rfbA CDS 12819..13493 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene rffC CDS 13498..14628 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene rffA CDS 14630..15880 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene wzxE CDS 15877..16956 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene rffT CDS 16953..18305 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene wzyE CDS 18308..19048 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene wecG CDS 19239..20624 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 tRNA 20727..20803 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 20862..20937 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 20958..21044 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 21087..21163 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 21310..22545 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(22629..22790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(23469..24665) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene hemY CDS complement(24668..25873) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139013.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene hemX CDS complement(25895..26635) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene hemD CDS complement(26632..27594) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene hemC CDS 27960..30506 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene cyaA CDS complement(30546..30866) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene cyaY CDS 31329..31532 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 31569..32393 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene dapF CDS 32390..33097 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 sequence013 source 1..33156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4335..5297 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 5393..7729 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene arcB CDS 7959..8612 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene elbB CDS 8609..9337 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene mtgA CDS complement(9334..9966) product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene yrbL CDS complement(10180..10452) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene npr CDS complement(10449..11303) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rapZ CDS complement(11349..11840) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene ptsN CDS complement(11958..12245) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene hpf CDS complement(12268..13701) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rpoN CDS complement(13749..14474) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene lptB CDS complement(14481..15038) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene lptA CDS complement(15007..15582) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene lptC CDS complement(15579..16145) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene kdsC CDS complement(16166..17152) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene kdsD CDS complement(17166..18143) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 18353..19162 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene mlaF CDS 19170..19952 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene mlaE CDS 19957..20508 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene mlaD CDS 20527..21162 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene mlaC CDS 21162..21455 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene mlaB CDS 21600..21869 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ibaG CDS 21924..23183 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene murA CDS complement(23231..23509) product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene sfsB CDS complement(23737..24708) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene ispB CDS 24967..25278 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rplU CDS 25299..25556 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene rpmA CDS 25683..26648 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 26664..27836 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene cgtA CDS complement(28022..29341) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212651.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene dacB CDS 29703..30179 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene greA CDS complement(30335..30628) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene yhbY CDS 30754..31383 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene rlmE sequence014 source 1..31440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..1266) product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene frlB CDS complement(1287..2624) product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene frlA CDS complement(2920..3087) product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(3334..4707) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene cysG CDS complement(4726..5532) product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene nirC CDS complement(5659..5985) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene nirD CDS complement(5982..8525) product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene nirB CDS complement(8787..9968) product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene tsgA CDS 10239..10811 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene ppiA CDS 10916..11083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 11073..11675 product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280641.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 11707..12270 product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene pabA CDS 12356..13576 product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963819.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene argD CDS complement(13643..15646) product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(15784..16416) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene crp CDS 16718..17122 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(17177..18046) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(18100..18318) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(18312..19334) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(19334..21247) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 21251..21457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 21378..21929 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene kefG CDS 21929..23734 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene kefB CDS 23744..23944 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 24039..24629 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene slyD CDS complement(24678..24896) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 25117..25929 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene fkpA CDS 26096..26818 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 26818..27204 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene tusD CDS 27204..27563 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene tusC CDS 27571..27858 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene tusB CDS 27984..28358 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rpsL CDS 28455..28925 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene rpsG CDS 29022..31136 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene fusA sequence015 source 1..31408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..609 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001305927.1:30S ribosomal protein S12 methylthiotransferase accessory factor YcaO locus_tag LOCUS_06050 CDS 1015..1872 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642546.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene focA CDS 1927..4209 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene pflB CDS 4401..5141 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene pflA CDS complement(5223..5813) product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190363.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 5913..6821 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(6822..8252) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(8462..9610) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 9925..10551 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene ycaC CDS complement(10586..11449) product dimethyl sulfoxide reductase anchor subunit DmsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene dmsC CDS complement(11451..12068) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene dmsB CDS complement(12079..14523) product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene dmsA CDS complement(14762..16054) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene serS CDS complement(16145..17488) product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene rarA CDS complement(17499..18113) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene lolA CDS complement(18265..22269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(22404..22898) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene lrp CDS 23443..24408 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene trxB CDS 24531..26297 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene cydD CDS 26298..28019 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene cydC CDS 28061..28765 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene aat CDS 29050..29268 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene infA tRNA 29522..29609 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(29983..30969) product protein YcdU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene ycdU CDS complement(30966..31325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 sequence016 source 1..29111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..900 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene fabI CDS 1044..2171 product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335988.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 2239..4173 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484984.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene rnb CDS 4495..6393 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene pdeR CDS 6541..6714 product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene yciZ CDS 6804..7553 product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 7822..8040 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene osmB CDS complement(8166..8492) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene yciH CDS complement(8492..9229) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene pyrF CDS complement(9423..10592) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene lapB CDS complement(10599..10907) product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene lapA CDS complement(11056..11820) product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene pgpB CDS 11990..12580 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene ribA CDS complement(12644..15319) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene acnA CDS complement(15692..15859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(15862..15990) product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(16321..17295) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene cysB CDS complement(17505..20102) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene topA CDS 20482..20733 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(20769..21818) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene sohB CDS 22038..22796 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 22793..23383 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene cobO CDS complement(23423..24298) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene rluB CDS complement(24509..26404) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(26432..27052) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(27049..27930) product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene rnm sequence017 source 1..28769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..1331 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene ansA CDS complement(1637..3520) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(3755..3976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(4052..4390) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(4620..5372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 5550..5936 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(5933..6088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 6330..8009 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 8109..8588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(8729..8893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(8970..10337) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 tRNA 10901..10991 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(11081..12256) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(12354..12593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(12565..12852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(13075..13908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(13905..14927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(14908..15144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(15543..15830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(16468..16635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 17111..17383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(17323..18042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 18326..18562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(18645..19361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 19528..19770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 20027..21319 product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene ctpM CDS 21359..22117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 22196..22372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 22469..24085 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 24389..26275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(26342..27562) product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(27780..28067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(28167..28499) product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene mobC sequence018 source 1..28581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..515) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene nrdR CDS 666..1205 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 1504..2388 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene tsx CDS complement(2565..2912) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene yajD CDS complement(3041..4012) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene secF CDS complement(4023..5837) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene secD CDS complement(5898..6230) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene yajC CDS complement(6253..7380) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(7436..8506) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 8599..9180 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene acpH CDS complement(9185..11002) product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene malZ CDS complement(11158..12531) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene proY CDS complement(12607..13926) product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene brnQ CDS complement(14333..15628) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene phoR CDS complement(15686..16375) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene phoB CDS 16565..17767 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene sbcD CDS 17764..20907 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene sbcC CDS 20949..22217 product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene araJ CDS complement(22360..23268) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene mak CDS 23327..24304 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rdgC CDS complement(24462..24743) product DUF2773 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(24952..25236) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene ppnP CDS complement(25308..25985) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(26243..26434) product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene yaiA CDS complement(26484..26951) product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene aroL CDS complement(27185..27649) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 27769..28578 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene proC sequence019 source 1..27806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..486) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 657..1106 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 tRNA 1168..1243 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 1397..1648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(1637..1918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(2063..2938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(2951..4486) product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(4458..4892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(5525..7312) product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene yesM CDS complement(7333..9339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(9404..10255) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(10268..11179) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(11246..12607) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(12758..14218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 14572..15312 product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 15324..16853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 16955..17722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 17787..20804 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 20978..22456 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(22506..23306) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(23385..24080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 24250..26022 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 26019..27761 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 sequence020 source 1..27707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1720..2139) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(2160..3542) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene atpD CDS complement(3569..4432) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene atpG CDS complement(4483..6024) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene atpA CDS complement(6037..6570) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene atpH CDS complement(6585..7055) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene atpF CDS complement(7117..7356) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene atpE CDS complement(7403..8218) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene atpB CDS complement(8227..8619) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene atpI CDS complement(9224..9847) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene rsmG CDS complement(9911..11800) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene mnmG CDS complement(12179..12622) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene mioC CDS complement(12712..13170) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene asnC CDS 13322..14314 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene asnA CDS complement(14319..15770) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene viaA CDS complement(15764..17260) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene ravA CDS 17483..19351 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene kup CDS 19518..19937 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene rbsD CDS 19945..21450 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene rbsA CDS 21455..22420 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene rbsC CDS 22445..23335 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene rbsB CDS 23446..24390 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene rbsK CDS 24394..25386 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rbsR CDS complement(25352..26779) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene mdtD CDS complement(26802..27494) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 sequence021 source 1..27435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 882..3554 product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene rcsD CDS 3571..4221 product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene rcsB CDS complement(4421..7270) product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rcsC CDS 7437..9263 product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene atoS CDS 9260..10645 product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene atoC CDS 10841..11503 product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene atoD CDS 11503..12153 product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene atoA CDS 12150..13472 product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 13503..14687 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene atoB CDS complement(14761..15537) product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225879.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(15542..17191) product YfaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(17192..21586) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001442934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(21730..22353) product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(22350..23915) product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(24186..26813) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene gyrA sequence022 source 1..27257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 368..640 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacac CDS complement(737..1030) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene cas2e CDS complement(1030..1950) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene cas1e CDS complement(1947..2597) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene cas6e CDS complement(2579..3325) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085069.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene cas5e CDS complement(3336..4391) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene cas7e CDS complement(4403..4939) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029329.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene casB CDS complement(4936..5265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 note possible pseudo, internal stop codon CDS complement(5329..6498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 note possible pseudo, internal stop codon CDS complement(6596..8365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(8636..9166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 9606..11696 product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 11779..12711 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 12714..12935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 12948..13202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 13204..13485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 13482..13754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 13759..14052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 14064..14594 product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 14692..15234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323222.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 15238..15771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 15771..16286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 16290..16841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 16838..17167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 17164..17514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047371030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 17530..17838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(17800..18210) product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 18275..18787 product gp16 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 18858..19280 product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 19352..19852 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 19965..20315 product exotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 20245..20517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 20528..20755 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 20736..21047 product DUF2730 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 21040..21330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279084.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 21333..21794 product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 note possible pseudo, internal stop codon CDS 21925..22173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 22173..23837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 23828..25426 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532593.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 25410..26741 product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 sequence023 source 1..26729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..1154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 1365..2801 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 2916..3722 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene yidA CDS 3726..4625 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 4625..5464 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 5484..6362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 6377..7516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 7527..7940 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 8044..8820 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 8887..10017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 10103..11089 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 11272..12225 product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene rihB CDS 12248..13357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 13379..14212 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 14233..14862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 14877..16616 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ade CDS 16631..18145 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 18160..18819 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene fsa CDS 18845..19555 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 19578..21563 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene tkt CDS 21628..22413 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(22579..23082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(23203..23535) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890395.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(24017..25408) product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(25459..25743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(25725..26003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(26112..26444) product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene mobC sequence024 source 1..26387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(582..1946) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene mnmE CDS complement(2052..3698) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene yidC CDS complement(3922..4248) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene rnpA CDS complement(4298..4438) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene rpmH CDS 5114..6448 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene dnaA CDS 6453..7553 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene dnaN CDS 7553..8626 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene recF CDS 8655..11069 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene gyrB CDS 11309..11707 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522208.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 11822..12634 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene yidA CDS complement(12680..13336) product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene yidX CDS 13614..14303 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene dgoR CDS 14300..15178 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene dgoK CDS 15162..15779 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene dgoA CDS 15776..16924 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene dgoD CDS 17044..18336 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296574.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(18333..19397) product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene cbrA CDS 19498..20712 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(20714..20974) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 21352..21765 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene ibpA CDS 21877..22305 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene ibpB CDS 22501..24162 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279752.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(24159..24875) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 25171..25680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 note possible pseudo, internal stop codon sequence025 source 1..25033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 905..1648 product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 1678..2217 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 2322..2720 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene yciA CDS complement(2760..3479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 3703..3999 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 4299..5552 product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene kch CDS 5923..7383 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene cls CDS 7418..7747 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(7800..8804) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene oppF CDS complement(8801..9814) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene oppD CDS complement(9826..10734) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene oppC CDS complement(10749..11669) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene oppB CDS complement(11755..13386) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene oppA CDS 13805..13966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 note possible pseudo, internal stop codon CDS complement(14124..14771) product NAAT family transporter YchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene ychE CDS 15248..17923 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene adhE CDS complement(18225..18842) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene tdk CDS 19446..19859 product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene hns CDS complement(20004..20912) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene galU CDS complement(21114..22127) product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene rssB CDS complement(22219..23163) product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rssA CDS 23237..23695 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001362540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 23745..24587 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555849.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene purU tRNA 24747..24831 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 24866..24950 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence026 source 1..24915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..644) product copper resistance system metallochaperone PcoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene pcoE CDS complement(862..2262) product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene pcoS CDS complement(2259..2939) product copper response regulator transcription factor PcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene pcoR CDS complement(2994..3923) product copper resistance inner membrane protein PcoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998778.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene pcoD CDS complement(3928..4308) product copper resistance system metallochaperone PcoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene pcoC CDS complement(4348..5244) product copper resistance outer membrane transporter PcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene pcoB CDS complement(5244..7061) product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene pcoA CDS 7296..7745 product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 8034..8771 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(8805..9002) product DUF2933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(9043..11031) product Ag(+)-translocating P-type ATPase SilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129244003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene silP CDS 11221..11430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(11612..12052) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(12139..15285) product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene silA CDS complement(15296..16426) product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene silB CDS complement(16702..17055) product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene cusF CDS complement(17084..18469) product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene silC CDS 18659..19339 product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene silR CDS 19332..20813 product copper/silver sensor histidine kinase SilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene silS CDS 21058..21489 product silver-binding protein SilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene silE CDS 21637..21987 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(22156..23982) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239419.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(24545..24847) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 sequence027 source 1..24881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 564..1496 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene rfaD CDS 1506..2552 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene rfaF CDS 2556..3527 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene rfaC CDS complement(3597..4256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 4210..4347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(4896..5879) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(5964..6989) product UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(7015..7707) product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene rfaY CDS complement(7717..8712) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(8729..9745) product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene waaO CDS complement(9761..10558) product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene rfaP CDS complement(10551..11675) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(11672..12676) product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene rfaQ CDS 13143..14420 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891564.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene waaA CDS 14428..14907 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene coaD CDS complement(14946..15755) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene mutM CDS complement(15853..16020) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene rpmG CDS complement(16041..16277) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene rpmB CDS complement(16494..17162) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297375.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene radC CDS 17334..18554 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene coaBC CDS 18532..18990 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene dut CDS 19097..19693 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene slmA CDS complement(19730..20371) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene pyrE CDS complement(20437..21153) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene rph CDS 21280..22143 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 22364..22741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 note possible pseudo, internal stop codon CDS 22781..23188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 note possible pseudo, internal stop codon CDS 23479..24096 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 misc_feature complement(24093..>24881) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000870052.1:NAD-dependent DNA ligase LigB locus_tag LOCUS_09400 sequence028 source 1..24248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 428..1822 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001352260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene rsmF CDS 1940..2176 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 2197..2472 product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929530.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(2473..3129) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene pphA CDS complement(3525..3866) product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(3879..4751) product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene copD CDS complement(4755..5129) product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene yobA CDS 5268..5498 product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene holE CDS 5600..6256 product carbon-nitrogen hydrolase family protein YobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene yobB CDS 6280..6942 product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene exoX CDS complement(6939..8999) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ptrB CDS complement(9208..9867) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(10194..10550) product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene yebF CDS complement(10617..10907) product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene yebG CDS 11041..12219 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene purT CDS complement(12275..12916) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene kdgA CDS complement(12953..14764) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene edd CDS complement(14999..16474) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene zwf CDS complement(16640..16789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 16812..17681 product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056706.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene hexR CDS 17809..19251 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene pyk CDS complement(19383..20354) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene lpxM CDS complement(20474..21796) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene mepM CDS complement(21812..22759) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene znuA CDS 22823..23578 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene znuC sequence029 source 1..24206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1019..1504 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene skp CDS 1508..2533 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene lpxD CDS 2638..3093 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene fabZ CDS 3097..3885 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene lpxA CDS 3885..5033 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene lpxB CDS 5030..5626 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene rnhB CDS 5663..9145 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene dnaE CDS 9158..10117 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene accA CDS 10216..12357 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene ldcC CDS 12414..12803 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 12868..14166 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene tilS CDS complement(14215..14475) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rof CDS complement(14462..14662) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 14828..15373 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 15370..15792 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene arfB CDS 15806..16516 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239154.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene nlpE CDS complement(16671..16907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 note possible pseudo, frameshifted CDS complement(16913..17494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 note possible pseudo, frameshifted CDS complement(17547..19265) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene proS CDS complement(19377..20084) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(20081..20485) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene rcsF CDS complement(20603..21418) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene metQ CDS complement(21458..22111) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(22104..23135) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene metN CDS 23323..23898 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene gmhB sequence030 source 1..23796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..1878) product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191596.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene bcsG CDS complement(1875..2066) product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene bcsF CDS complement(2063..3622) product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene bcsE CDS 3907..4095 product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene bcsR CDS 4107..4748 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene bcsQ note possible pseudo, frameshifted CDS 4848..7466 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025914.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene bcsA CDS 7477..9816 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307454.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene bcsB CDS 9817..10830 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene bcsZ note possible pseudo, frameshifted CDS 10731..10928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 note possible pseudo, frameshifted CDS 10967..14383 product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene bcsC CDS 14504..16453 product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene hmsP CDS 16636..17922 product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene dctA CDS 18143..19639 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(19735..20664) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene kdgK CDS 21028..21663 product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene pdeH CDS 21733..23793 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 sequence031 source 1..23417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 424..1539 product putative protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene yneK CDS 1689..2879 product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene ydeA CDS complement(2904..3569) product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene marC CDS 3781..4215 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene marR CDS 4235..4618 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene marA CDS 4650..4868 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene marB CDS complement(4925..6364) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(6389..7531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 note possible pseudo, frameshifted CDS complement(7528..8061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 note possible pseudo, frameshifted CDS complement(8117..8428) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(8456..9778) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(9893..10171) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 10403..11101 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(11146..12045) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene eamA CDS 12327..13427 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene ydeE CDS complement(13868..14755) product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene dgcZ CDS complement(15010..15402) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene ydeI CDS 15678..16196 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024810.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(16241..18286) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene dcp CDS 18423..19169 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene ydfG CDS 19258..19944 product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene rspR CDS 20121..20324 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene ydfZ CDS complement(20360..21820) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(21909..23192) product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 sequence032 source 1..22756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..636 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000628222.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase locus_tag LOCUS_10330 CDS 1003..2136 product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ompN CDS 2277..2711 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene uspF CDS 2887..3822 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene ttcA CDS complement(3951..5324) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene dbpA CDS complement(5802..6785) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene zntB CDS 7039..8271 product diguanylate cyclase DgcM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene dgcM CDS complement(8292..8855) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene smrA CDS complement(9185..10093) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 10269..11579 product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene abgA CDS 11579..13024 product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene abgB CDS 13181..14587 product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene abgT CDS 14598..15113 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene ogt CDS 15308..16060 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene fnr CDS 16212..17162 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene uspE CDS complement(17212..17469) product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 17713..18744 product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene ynaI CDS complement(18795..20408) product murein tripeptide ABC transporter substrate-binding protein MppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene mppA CDS complement(20745..21644) product DNA-binding transcriptional regulator PgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene pgrR CDS 21782..22702 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 sequence033 source 1..22084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..714 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011108.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 758..1294 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1336..2388) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 2613..3533 product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene lpxL CDS 3705..4931 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene mdtG CDS 5014..5388 product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(5389..5616) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(5789..8332) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene mdoH CDS complement(8325..9878) product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene mdoG CDS 10254..11411 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene mdoC CDS complement(11419..12840) product cardiolipin synthase ClsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene clsC CDS complement(12842..13375) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene ymdB CDS complement(13470..13781) product protein YmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene ymdA CDS complement(13902..14234) product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene csgC CDS complement(14293..14748) product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene csgA CDS complement(14789..15271) product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene csgB CDS 16000..16647 product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene csgD CDS 16655..17044 product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene csgE CDS 17069..17485 product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene csgF CDS 17512..18345 product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene csgG CDS complement(18409..18930) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(19002..19556) product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene ycdY CDS complement(19580..20317) product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene ycdX CDS complement(20372..21310) product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene ghrA tRNA 21544..21631 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(21781..22083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 sequence034 source 1..22041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(456..1811) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene melA CDS 2094..3002 product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene melR CDS 3198..5468 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene adiA CDS 5793..6554 product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene adiY CDS 6691..8028 product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene adiC CDS 8162..9775 product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene eptA CDS 9772..10440 product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene basR CDS 10441..11541 product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene pmrB CDS complement(11718..13220) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296882.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene proP CDS complement(13484..14362) product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(14359..16587) product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene crfC CDS 16988..17323 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 17581..18024 product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene yjdN CDS 18157..18945 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene phnC CDS 18970..19986 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene phnD CDS 20041..20871 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene phnE CDS 20892..21617 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene phnF sequence035 source 1..21478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(808..1764) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene nrfD CDS complement(1761..2432) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene nrfC CDS complement(2429..2995) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene nrfB CDS complement(3040..4365) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene nrfA CDS 4869..6827 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene acs CDS 7027..7341 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 7338..8987 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene actP CDS 9165..10457 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(10611..12260) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(12411..13760) product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene ghxP CDS complement(14306..14770) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412428.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene soxR CDS 14856..15179 product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019358.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene soxS CDS complement(15182..16768) product c-di-GMP phosphodiesterase PdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene pdeC CDS 17198..17479 product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295689.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(17578..18114) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene ssb1 CDS 18369..21191 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene uvrA sequence036 source 1..21453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..550) product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(560..1513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1528..2643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(2858..3316) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(3319..4140) product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(4121..5617) product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(5617..7149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(7209..7754) product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124060.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(7754..8065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(8065..8391) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175097.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(8388..9038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(9022..9762) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104439.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(9765..10115) product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793146.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 10246..10722 product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149906.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(10760..11341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110593193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(11432..12418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(12415..12876) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 12927..13115 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200153.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 13168..13476 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 13487..14401 product DUF3102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 14405..16174 product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 16185..17351 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 17354..17623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 17651..18181 product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 18279..18473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 18470..18742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 18752..19048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 19063..19278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 19275..19958 product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 19955..20185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631819.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 20380..20832 product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 20804..21193 product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 sequence037 source 1..21230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000290950.1:tyrosine-type recombinase/integrase locus_tag LOCUS_11430 CDS complement(745..1281) product DNA-binding transcriptional regulator RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene rcdA CDS 1365..2573 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 2573..3388 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene ybjI CDS 3480..3758 product protein YbjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ybjH CDS complement(3799..5031) product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene mdfA CDS 5316..5912 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene ybjG CDS 5970..6728 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene deoR CDS complement(6775..7986) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene dacC CDS 8224..8850 product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene gstB CDS complement(8847..9962) product aldose sugar dehydrogenase YliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene yliI CDS complement(10073..10456) product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497137.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene bssR CDS 10669..11994 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene rimO CDS complement(12041..13369) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086904.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(13377..15674) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(15903..16814) product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene gsiD CDS complement(16817..17737) product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene gsiC CDS complement(17755..19293) product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090140.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene gsiB CDS complement(19313..21184) product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene gsiA sequence038 source 1..21122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000139614.1:ATP-dependent RNA helicase HrpA locus_tag LOCUS_11620 CDS 4062..4862 product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027967.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene ydcF CDS 5059..6498 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene aldA CDS complement(6540..7541) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene gap CDS 7730..8260 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene cybB CDS 8505..8678 product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(8750..8899) product type I toxin-antitoxin system toxin HokB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene hokB CDS 9298..10938 product methyl-accepting chemotaxis protein Trg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene trg CDS complement(10976..11818) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 12116..13459 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 13720..15339 product glucan biosynthesis protein OpgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375956.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene opgD CDS 15479..15703 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 15766..16302 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rimL CDS complement(16297..17277) product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234042.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene ydcK CDS 17401..18393 product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene tehA CDS 18390..18983 product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene tehB CDS 19286..19954 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 sequence039 source 1..20875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..983) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene nudC CDS 1078..1554 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene rsd CDS 1787..3682 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene thiC CDS 3682..4317 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene thiE CDS 4310..5065 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene thiF CDS 5049..5249 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene thiS CDS 5251..6021 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene thiG CDS 6018..7151 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847445.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene thiH CDS complement(7561..8100) product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(8313..12536) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene rpoC CDS complement(12613..16641) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263098.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene rpoB CDS complement(16961..17326) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene rplL CDS complement(17393..17890) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene rplJ CDS complement(18303..19007) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rplA CDS complement(19011..19439) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rplK CDS complement(19598..20143) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene nusG CDS complement(20145..20528) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene secE sequence040 source 1..20546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..749) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene lexA CDS complement(859..1227) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene dgkA CDS 1338..3821 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141711.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene plsB CDS complement(3976..4848) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene ubiA CDS complement(4861..5358) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305723.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene ubiC CDS complement(5581..6876) product SopA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 note possible pseudo, frameshifted CDS complement(6967..7161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(7390..8310) product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783444.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene malM CDS complement(8462..9802) product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene lamB CDS complement(9874..10989) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene malK CDS 11354..12544 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene malE CDS 12698..14242 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene malF CDS 14257..15147 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene malG CDS 15519..16994 product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene xylE CDS complement(17038..17448) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene psiE CDS complement(18043..20139) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 sequence041 source 1..20273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..496 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rpsJ CDS 529..1158 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene rplC CDS 1169..1774 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene rplD CDS 1771..2073 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene rplW CDS 2091..2912 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene rplB CDS 2929..3207 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rpsS CDS 3222..3554 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rplV CDS 3572..4273 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene rpsC CDS 4286..4696 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene rplP CDS 4696..4887 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rpmC CDS 4887..5141 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene rpsQ CDS 5306..5677 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene rplN CDS 5688..6002 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene rplX CDS 6017..6556 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene rplE CDS 6571..6876 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene rpsN CDS 6910..7302 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene rpsH CDS 7315..7848 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rplF CDS 7858..8211 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene rplR CDS 8226..8729 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene rpsE CDS 8733..8912 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene rpmD CDS 8916..9350 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rplO CDS 9358..10689 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene secY CDS 10984..11340 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene rpsM CDS 11357..11746 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rpsK CDS 11780..12400 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene rpsD CDS 12426..13415 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene rpoA CDS 13456..13839 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene rplQ CDS 13945..14313 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 14324..14749 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene zntR CDS 14805..15023 product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene arfA CDS complement(15020..15430) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene mscL CDS complement(15560..16936) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene trkA CDS complement(16958..18247) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744779.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene rsmB CDS complement(18293..19240) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004454.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene fmt CDS complement(19255..19764) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene def sequence042 source 1..19877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..501) product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001686573.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(713..1675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1694..2377) product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(2377..2643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(2606..2932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 note possible pseudo, internal stop codon CDS complement(2939..4639) product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene traD note possible pseudo, internal stop codon CDS complement(4636..5043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(5040..5573) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(5549..6199) product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(6206..6814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(6839..7270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(7391..7807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 8171..8389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(8495..8989) product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(8979..9677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 10287..13085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 13100..14764 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 14761..16314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 16311..18101 product restriction system-associated AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 18101..19189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(19279..19683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 sequence043 source 1..19752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(469..1362) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene nadC CDS 1450..2001 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene ampD CDS 1998..2852 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene ampE CDS complement(2895..4268) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene aroP CDS 4809..5573 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene pdhR CDS 5734..8397 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene aceE CDS 8412..10304 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene aceF CDS 10629..12053 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene lpdA CDS complement(12124..13881) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 14236..16833 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene acnB CDS 17008..17370 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene yacL CDS complement(17408..18202) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene speD CDS complement(18218..19084) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene speE CDS complement(19190..19537) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 sequence044 source 1..19322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..720) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907622.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene mobB CDS complement(702..1286) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene mobA CDS 1356..1625 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1702..2688 product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065516.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene srkA CDS 2705..3331 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene dsbA CDS 3486..4916 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(4957..5700) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 5735..5953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(6009..6194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 6253..9039 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene polA CDS complement(9421..10053) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene yihA CDS 10636..11145 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene yihI CDS 11334..12707 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene hemN CDS complement(13119..14528) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene glnG CDS complement(14540..15589) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene glnL CDS complement(15763..17172) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene glnA sequence045 source 1..19321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..1581) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene guaA CDS complement(1650..3116) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene guaB CDS 3278..4648 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene xseA CDS complement(4645..4860) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(4930..6402) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene der CDS complement(6520..7698) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene bamB CDS complement(7709..8329) product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene yfgM CDS complement(8347..9621) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene hisS CDS complement(9732..10850) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene ispG CDS complement(10877..11890) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene rodZ CDS complement(12175..13329) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(13479..13910) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene ndk CDS complement(14059..16236) product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene pbpC misc_feature complement(16372..>19321) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000736260.1:alpha2-macroglobulin locus_tag LOCUS_13110 sequence046 source 1..18760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1275 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001025145.1:type II secretion system protein GspE locus_tag LOCUS_13120 CDS 1265..2467 product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene hofC CDS complement(2502..3545) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene guaC CDS 3770..4390 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene coaE CDS 4390..5133 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene zapD CDS 5143..5340 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene yacG CDS complement(5556..5945) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene mutT CDS complement(6005..8710) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene secA CDS complement(8772..9359) product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene secM CDS complement(9515..10432) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene lpxC CDS complement(10533..11684) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene ftsZ CDS complement(11745..13007) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ftsA CDS complement(13004..13834) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene ftsQ CDS complement(13836..14756) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene ddlB CDS complement(14749..16224) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene murC CDS complement(16278..17345) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene murG CDS complement(17342..18586) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene ftsW sequence047 source 1..18472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(505..1287) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523845.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene nanR CDS 1676..3043 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene dcuC CDS complement(3086..3583) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene sspB CDS complement(3589..4227) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene sspA CDS complement(4622..5014) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene rpsI CDS complement(5030..5458) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene rplM CDS complement(5677..6648) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene zapE CDS 6998..7396 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene zapG CDS 7550..8917 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene degQ CDS 9007..10074 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene degS CDS complement(10137..11075) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene mdh CDS 11510..11980 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene argR CDS 12296..12610 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene yhcN CDS complement(12666..12938) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(13030..14997) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene aaeB CDS complement(15003..15935) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854033.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene aaeA CDS complement(15943..16215) product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene aaeX CDS 16329..17258 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene aaeR misc_feature complement(17386..>18472) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000055909.1:metalloprotease TldD locus_tag LOCUS_13470 sequence048 source 1..18140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..697 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064528964.1:leucine--tRNA ligase locus_tag LOCUS_13480 CDS 712..1293 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene lptE CDS 1293..2324 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620503.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene holA CDS 2326..2967 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene nadD CDS 2991..3602 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 3862..4179 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene rsfS CDS 4183..4650 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene rlmH CDS 4681..6582 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene mrdA CDS 6585..7697 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene mrdB CDS 7708..8796 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene rlpA CDS 8936..10147 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene dacA CDS 10258..10521 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene ybeD CDS 10622..11263 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284027.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene lipB CDS 11522..12475 product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 12684..13649 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene lipA CDS complement(13750..13953) product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene tatE CDS complement(14082..14870) product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 14963..15346 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene crcB CDS complement(15400..15609) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene cspE CDS complement(15784..16344) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene pagP sequence049 source 1..18129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7491..8399) product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(8387..9076) product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(9073..9510) product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(9659..9862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(9852..10367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(10376..11263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(11263..13086) product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(13073..14698) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(14792..14974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(15198..15437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(16337..17920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 sequence050 source 1..18021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1291..1422 product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene sgrT CDS 1400..1651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1542..2702 product sugar efflux transporter SetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene setA CDS complement(2751..3356) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene leuD CDS complement(3367..4767) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene leuC CDS complement(4770..5861) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene leuB CDS complement(5861..7432) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene leuA CDS 8271..9215 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene leuO CDS 9533..11257 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene ilvI CDS 11260..11751 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene ilvN CDS 11931..12935 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene cra CDS 13537..13995 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295533.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene mraZ CDS 13997..14938 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene rsmH CDS 14935..15300 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene ftsL CDS 15316..17082 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene ftsI sequence051 source 1..17977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(916..1674) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene gph CDS complement(1667..2344) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rpe CDS complement(2362..3198) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene dam CDS complement(3305..4591) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene damX CDS complement(4683..5771) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene aroB CDS complement(5828..6313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(6750..7988) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene hofQ CDS complement(7900..8304) product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene hofP CDS complement(8294..8734) product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055760.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene hofO CDS complement(8718..9257) product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene hofN CDS complement(9257..10036) product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene hofM CDS 10177..12708 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene mrcA CDS complement(12873..13433) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene nudE CDS 13753..15888 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene igaA CDS 15953..16621 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene yrfG CDS 16632..17033 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene hslR CDS 17058..17936 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene hslO sequence052 source 1..17805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2179..3129 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene tal CDS 3149..5152 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene tkt CDS complement(5247..6131) product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(6416..6991) product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193711.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene nudK CDS complement(7059..9038) product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene aegA CDS 9229..10944 product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene narQ CDS 11108..11290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 note possible pseudo, frameshifted CDS 11287..14220 product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene acrD CDS 14759..15115 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 15119..16246 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene dapE CDS 16274..16474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(16584..17282) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene ypfH sequence053 source 1..17643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(444..1211) product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene ygbI CDS 1407..2315 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 2312..3574 product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 3571..4209 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 4214..4990 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 5124..6443 product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(6483..6719) product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(6730..8157) product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(8157..8750) product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 8897..9304 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(9425..10417) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene rpoS CDS complement(10480..11619) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene nlpD CDS complement(11759..12385) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene pcm CDS complement(12379..13140) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene surE CDS complement(13121..14170) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene truD CDS complement(14167..14646) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene ispF CDS complement(14646..15356) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene ispD CDS complement(15375..15686) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene ftsB CDS complement(15674..15895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(15880..16203) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(16253..16858) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene cysC misc_feature complement(16858..>17643) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001090340.1:sulfate adenylyltransferase subunit CysN locus_tag LOCUS_14440 sequence054 source 1..17460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1001 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000083065.1:hydrogenase 2 large subunit locus_tag LOCUS_14450 CDS 1001..1495 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1488..1976 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene hybE CDS 1969..2310 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene hypA CDS 2323..2571 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene hybG CDS complement(2694..3560) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene yghU CDS 3765..5624 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene gss CDS 5916..7415 product inorganic phosphate transporter PitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene pitB CDS complement(7464..8156) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 8369..9043 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 9075..9833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339532.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 9879..11228 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896889.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 11228..12052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 12064..12624 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 12655..13725 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene lptF CDS 13722..14801 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene lptG CDS complement(14837..15391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 note possible pseudo, frameshifted CDS complement(15388..16008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 note possible pseudo, frameshifted CDS complement(16008..16256) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(16288..17202) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 sequence055 source 1..17041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(379..2952) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene clpB CDS complement(3082..3813) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene yfiH CDS complement(3810..4790) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene rluD CDS 4925..5662 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene bamD CDS 5933..6274 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene raiA CDS 6524..7684 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene pheA CDS complement(7727..8848) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene tyrA CDS complement(8859..9929) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168045.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene aroF CDS 10139..10504 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 10654..11172 product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 11162..12388 product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969032.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene dgcN CDS 12404..12886 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(12962..13309) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene rplS CDS complement(13351..14118) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene trmD CDS complement(14149..14697) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rimM CDS complement(14716..14964) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene rpsP CDS complement(15101..16462) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ffh CDS complement(16575..16811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 sequence056 source 1..17035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..938 product formate transporter FocB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene focB CDS complement(976..2037) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892044.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 2250..3713 product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene bepA CDS 3734..4093 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene arsC CDS complement(4231..4977) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(5027..6316) product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene uraA CDS complement(6402..7028) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene upp CDS 7338..8390 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene purM CDS 8390..9028 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene purN CDS 9193..11265 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ppk1 CDS 11270..12811 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene ppx CDS complement(12850..13290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 note possible pseudo, frameshifted CDS complement(13224..14924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 note possible pseudo, frameshifted CDS complement(15271..15423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 15441..15632 product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 15946..16461 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 16477..17016 product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 sequence057 source 1..16916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..606 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001273738.1:galactarate dehydratase locus_tag LOCUS_15000 CDS 755..1090 product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene prlF CDS 1090..1554 product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene yhaV CDS complement(1609..2418) product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene agaR CDS 2667..3947 product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene kbaZ CDS 3970..4443 product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene agaV CDS 4454..5233 product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene agaW CDS 5223..6101 product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene agaE CDS 6119..6553 product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene agaF CDS 6550..7683 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326138.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene nagA CDS 8034..9188 product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 9201..10061 product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene kbaY CDS 10228..10704 product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene agaB CDS 10743..11342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 note possible pseudo, frameshifted CDS 11291..11545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 note possible pseudo, frameshifted CDS 11535..12326 product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene agaD CDS 12381..13082 product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 13483..14067 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 14243..14842 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 sequence058 source 1..16850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(921..2177) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(2190..2477) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(2493..2936) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 3207..4238 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(4765..5616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 note possible pseudo, frameshifted CDS complement(5589..6035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 note possible pseudo, frameshifted CDS 6932..7258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(7468..7812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 8100..8414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(8971..9738) product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene fecE CDS complement(9739..10695) product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene fecD CDS complement(10692..11690) product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene fecC CDS complement(11687..12589) product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene fecB CDS complement(12634..14958) product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene fecA CDS complement(15045..15998) product fec operon regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene fecR CDS complement(15995..16516) product RNA polymerase sigma factor FecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene fecI sequence059 source 1..16791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..2401 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene fhuA CDS 2452..3249 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene fhuC CDS 3249..4139 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene fhuD CDS 4136..6118 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene fhuB CDS complement(6153..7433) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045290.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene hemL CDS 7658..9079 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene clcA CDS 9161..9505 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene erpA CDS complement(9552..10175) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(10213..11013) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene btuF CDS complement(11006..11704) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene mtnN CDS 11788..13305 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene dgt CDS 13435..14859 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene degP CDS 15014..16171 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene cdaR CDS complement(16260..16646) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 sequence060 source 1..16705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..1254) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151604.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene serA CDS complement(1510..2169) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene rpiA CDS complement(2225..2455) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 2597..3490 product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene argP CDS 3694..5838 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene scpA CDS 5831..6826 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene meaB CDS 6837..7622 product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene scpB CDS 7646..9124 product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449941.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene scpC CDS complement(9121..10017) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(10185..10925) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(11018..11653) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene argO CDS complement(11792..12652) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene mscS CDS complement(13010..14089) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene fbaA CDS complement(14304..15467) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene pgk CDS complement(15517..16536) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene epd sequence061 source 1..16639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2527..4812 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene nrdA CDS 4919..6088 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene nrdB CDS 6088..6342 product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135039.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene yfaE CDS complement(6396..7046) product lipopolysaccharide kinase InaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene inaA CDS 7261..7467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(7509..8585) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene glpQ CDS complement(8590..9948) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene glpT CDS 10221..11849 product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene glpA CDS 11839..13098 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene glpB CDS 13095..14285 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene glpC CDS 14479..15378 product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 15391..15576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(15617..16420) product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene yfaU sequence062 source 1..16504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..572) product putative general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461450.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene gspB CDS complement(574..2043) product type II secretion system protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene gspA CDS 2223..3038 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene gspC CDS 3010..4974 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326512.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene gspD CDS 4984..6465 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene gspE CDS 6462..7658 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene gspF CDS 7668..8105 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene gspG CDS 8113..8622 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene gspH CDS 8619..8996 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene gspI CDS 8989..9576 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene gspJ CDS 9569..10552 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene gspK CDS 10567..11730 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene gspL CDS 11727..12188 product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene gspM CDS 12188..12865 product prepilin peptidase GspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene gspO CDS complement(12894..13370) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene bfr CDS complement(13442..13636) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene bfd CDS complement(13805..16498) product bifunctional chitinase/lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene chiA sequence063 source 1..16485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(330..1430) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene chaA CDS 1700..1930 product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene chaB CDS 2088..2783 product glutathione-specific gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene chaC CDS complement(2827..3180) product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene ychN CDS 3366..4760 product inverse autotransporter invasin YchO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene ychO CDS complement(4761..5411) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene narL CDS complement(5404..7200) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene narX CDS 7226..7444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 7695..8930 product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene narK CDS 9446..13189 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 13186..14724 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene narH CDS 14721..15431 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene narJ CDS 15431..16108 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene narI sequence064 source 1..16156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(451..1629) product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene xylR CDS complement(1707..2888) product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene xylH CDS complement(2866..4407) product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene xylG CDS complement(4485..5477) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene xylF CDS 5843..7165 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene xylA CDS 7237..8691 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene xylB CDS 8860..9201 product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295228.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene yiaB CDS 9247..9684 product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene yiaA CDS complement(9726..10721) product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182650.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene wecH CDS 10896..11195 product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 11290..12201 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene glyQ CDS 12211..14280 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene glyS CDS 14580..15101 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 15098..15928 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866395.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 sequence065 source 1..15816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..429) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene minE CDS complement(433..1245) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101055.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene minD CDS complement(1269..1964) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene minC CDS 2484..2852 product YcgJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(2972..3373) product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 3615..3908 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 3980..4639 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 4716..5177 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(5383..5814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 note possible pseudo, frameshifted CDS complement(5768..6427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 note possible pseudo, frameshifted CDS 6656..7075 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 7075..8343 product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene umuC CDS complement(8389..8919) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943462.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene dsbB CDS complement(9065..10606) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene nhaB CDS 10827..11546 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene fadR CDS complement(11598..13130) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190854.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 13487..14758 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene dadA sequence066 source 1..15697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..768 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000884639.1:acetyl-CoA carboxylase biotin carboxylase subunit locus_tag LOCUS_16380 CDS 877..1119 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1109..2560 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene panF CDS 2572..3453 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene prmA CDS 3875..4747 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene dusB CDS 4773..5069 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene fis CDS 5155..6039 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene yhdJ CDS complement(6305..6967) product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129518.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene acrS CDS 7366..8523 product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene acrE CDS 8535..11639 product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene acrF CDS 11892..12113 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 12544..13569 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 13619..14818 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 sequence067 source 1..15682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..509 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001310874.1:protein YdjO locus_tag LOCUS_16510 CDS complement(534..1925) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene tcyP CDS complement(2058..2648) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295408.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(2811..3479) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene hxpB CDS 3626..4162 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(4203..5063) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(5169..5459) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene ghoS CDS complement(5560..6489) product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene pfkB CDS 6776..7534 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771396.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(7870..9768) product type III secretion system effector EspL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene espL1 CDS 10291..12219 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144202.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene thrS CDS 12331..12765 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene infC CDS 12862..13059 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene rpmI CDS 13112..13468 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rplT CDS 13918..14901 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene pheS sequence068 source 1..15682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..925) product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509902.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene mngR CDS 1094..2950 product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242633.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene mngA CDS 3027..5660 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene mngB CDS 5685..5912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 6507..8075 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene cydA CDS 8091..9230 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene cydB CDS 9358..9651 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ybgE CDS 9801..10205 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene ybgC CDS 10202..10894 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene tolQ CDS 10898..11326 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090097.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene tolR CDS 11391..12656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 12789..14081 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene tolB CDS 14116..14637 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene pal CDS 14647..15438 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene cpoB tRNA 15603..15678 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence069 source 1..15499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 362..1072 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1080..2060 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 2162..3427 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(3518..4210) product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene ompL CDS complement(4278..5681) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(5724..7109) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(7155..9191) product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene yihQ CDS complement(9390..10316) product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(10430..11671) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene yihS CDS complement(11688..12566) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene yihT CDS complement(12590..13486) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene yihU CDS 13654..14550 product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene yihV CDS 14584..15369 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 sequence070 source 1..15338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(749..1588) product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene chbR CDS complement(1599..1949) product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene chbA CDS complement(2000..3358) product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene chbC CDS complement(3443..3763) product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412169.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene chbB CDS complement(4062..4400) product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene osmE CDS 4602..5429 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175018.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene nadE CDS 5659..6546 product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene cho CDS complement(6506..6901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(7284..7769) product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene spy CDS complement(8099..9067) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene astE CDS complement(9060..10403) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene astB CDS complement(10400..11878) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene astD CDS complement(11875..12909) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene astA CDS complement(12906..14126) product succinylornithine/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene astC sequence071 source 1..15294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(6..93) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 520..1638 product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene hyaA CDS 1635..3428 product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene hyaB CDS 3447..4154 product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene hyaC CDS 4151..4738 product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003671.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 4735..5133 product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene hyaE CDS 5130..5987 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 6121..7665 product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263582.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene appC CDS 7677..8813 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene appB CDS 8998..10296 product bifunctional acid phosphatase/4-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene appA CDS complement(10411..12591) product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208650.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene etk CDS complement(12611..13069) product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene etp CDS complement(13045..14184) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 misc_feature complement(14230..>15294) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000742329.1:YjbH domain-containing protein locus_tag LOCUS_17190 sequence072 source 1..15281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..739 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572698.1:chromosome partition protein MukB locus_tag LOCUS_17200 CDS 1000..2847 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene ldtD CDS 3028..3576 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 3603..4250 product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109487.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene gloC CDS complement(4472..5662) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene aspC CDS 5649..5831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196607.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(5847..6935) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene ompF CDS complement(7538..8938) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene asnS CDS complement(9108..10310) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307697.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene pncB CDS 10576..13188 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193859.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene pepN CDS complement(13395..14162) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene ssuB CDS complement(14159..14953) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene ssuC sequence073 source 1..15158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1104..1502 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1499..2194 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 2324..3208 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene cdd CDS 3358..4077 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene sanA CDS 4080..4319 product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 4638..5876 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene preT CDS 5870..7105 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene preA CDS complement(7176..8186) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene mglC CDS complement(8202..9722) product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene mglA CDS complement(9783..10781) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene mglB CDS complement(11061..12101) product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628671.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene galS CDS complement(12243..13226) product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene yeiB note possible pseudo, internal stop codon CDS complement(13227..13400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 note possible pseudo, internal stop codon CDS complement(13417..14085) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene folE sequence074 source 1..15124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 983..1525 product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene fimA CDS 1745..2437 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene fimC CDS 2468..3283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 note possible pseudo, internal stop codon CDS 3296..5077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 note possible pseudo, internal stop codon CDS 5090..6097 product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene fimH CDS 6108..6623 product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene sfmF CDS complement(6626..7258) product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene fimZ tRNA 7501..7577 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(7623..8384) product DNA-binding transcriptional regulator EnvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene envY CDS complement(8567..9457) product DUF4434 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(9458..12430) product bacteriophage adsorption protein NfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene nfrA CDS complement(12417..13196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 note possible pseudo, frameshifted CDS complement(13240..14649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 note possible pseudo, frameshifted CDS complement(14920..15108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 sequence075 source 1..14997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(555..1415) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene cheR CDS complement(1434..3035) product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene tap CDS complement(3081..4742) product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene tar CDS complement(4887..5390) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene cheW CDS complement(5411..7369) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene cheA CDS complement(7380..8306) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene motB CDS complement(8303..9190) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene motA CDS complement(9317..9895) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene flhC CDS complement(9898..10248) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene flhD CDS 11028..11456 product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122437.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene uspC CDS complement(11463..12887) product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene otsA CDS complement(12862..13662) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene otsB CDS complement(13829..14815) product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene araH CDS complement(14830..14997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 sequence076 source 1..14946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..517 product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(508..1434) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 1524..2522 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(2519..2737) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410201.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(2739..4754) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ligA CDS complement(4825..5259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 5350..5676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 6041..6802 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene cysZ CDS 6987..7958 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene cysK CDS 8342..8599 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene ptsH CDS 8644..10371 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene ptsI CDS 10412..10921 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene crr CDS complement(10964..11815) product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene pdxK CDS 11920..12294 product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 12327..13061 product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(13250..14107) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene cysM misc_feature complement(14295..>14946) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000021036.1:sulfate/thiosulfate ABC transporter ATP-binding protein CysA locus_tag LOCUS_17890 sequence077 source 1..14704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..1094 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1117..1935 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1935..2453 product FidL-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 2973..3251 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 3269..3553 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 3568..3846 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 3900..5486 product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 5513..5770 product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599365.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 5786..6940 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 6967..10353 product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene cutC CDS 10405..11352 product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene cutD CDS 11364..11828 product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086629.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 11825..12445 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 12457..13122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 13155..13556 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 13572..13901 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(14125..14457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 sequence078 source 1..14584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 558..737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 769..1122 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1159..3237) product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene flhA CDS complement(3311..4321) product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene hypE CDS complement(4318..5439) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene hypD CDS complement(5439..5711) product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene hypC CDS complement(5702..6574) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene hypB CDS complement(6578..6928) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene hypA CDS 7140..7601 product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene hycA CDS 7726..8337 product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079186.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene hycB CDS 8334..10160 product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene hycC CDS 10163..11086 product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene hycD CDS 11104..12813 product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene hycE CDS 12823..13365 product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493785.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene hycF CDS 13365..14132 product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene hycG CDS 14129..14539 product formate hydrogenlyase assembly protein HycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene hycH sequence079 source 1..14523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1300 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001122505.1:DNA mismatch repair endonuclease MutL locus_tag LOCUS_18230 CDS 1293..2243 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 2329..2637 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene hfq CDS 2714..3994 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene hflX CDS 4080..5339 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene hflK CDS 5342..6346 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene hflC CDS 6428..6625 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 6729..8027 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene purA CDS 8232..8657 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene nsrR CDS 8696..11137 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene rnr CDS 11317..12048 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene rlmB CDS 12175..12576 product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 12595..13293 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 13344..14003 product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 14021..14419 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 sequence080 source 1..14514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 339..542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 689..1024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 1674..1865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 1889..2269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 2220..2702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 note possible pseudo, internal stop codon, frameshifted CDS 2724..3710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 note possible pseudo, internal stop codon CDS 3857..4075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 4190..4717 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722826.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 4732..5259 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 5345..6010 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene sfsA CDS 6089..6814 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(7267..8097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 8312..9700 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 9704..10459 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 10490..12415 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 13013..13342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 13365..13826 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 sequence081 source 1..14440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 495..3539 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 3533..5167 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 5160..6392 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484770.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(7098..7229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 7454..8374 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 8542..10059 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 10120..11490 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 11490..12899 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602473.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 12925..13932 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 sequence082 source 1..14435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 388..1014 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027096094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 1524..2288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 2353..2769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 2804..3262 product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 3259..5016 product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(5072..6385) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 6782..6997 product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 7209..8075 product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 8089..8454 product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 8426..10813 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 10816..12549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 12563..12829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 12819..13547 product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 13593..13928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 14014..14295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 sequence083 source 1..14410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 271..966 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene rsuA CDS 994..2184 product multidrug efflux MFS transporter Bcr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213385.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene bcr CDS 2517..2861 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(2865..4454) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene yejF CDS complement(4456..5481) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(5481..6575) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501604.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(6576..8396) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301507.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(8472..9965) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(10209..10775) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene mepS CDS complement(11187..11900) product Kdo(2)-lipid A phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene lpxT CDS complement(11939..12925) product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene yeiR misc_feature complement(13043..>14410) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001091940.1:mannitol dehydrogenase family protein locus_tag LOCUS_18900 sequence084 source 1..14407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 70..343 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacaca CDS complement(681..1352) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene queE CDS 1491..1631 product cell envelope stress response protein YqcG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288227.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene yqcG CDS 1645..2517 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268460.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(2577..3875) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene eno CDS complement(3963..5600) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210878.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene pyrG CDS complement(5828..6619) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene mazG CDS complement(6690..7025) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254738.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene mazF CDS complement(7025..7273) product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene mazE CDS complement(7351..9585) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(9633..10934) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046812.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene rlmD CDS 10991..13747 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene barA sequence085 source 1..14161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..268) product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene cspA CDS complement(549..839) product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 1273..1983 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2033..3007) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805027.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene ghrB CDS complement(3111..3770) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(3883..4032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 3977..6256 product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene bisC CDS complement(6225..6665) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(6662..7225) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene tag CDS 7383..8081 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 8310..9518 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 9842..11533 product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene eptB tRNA 11625..11701 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 12446..14053 product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene dppA sequence086 source 1..14006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(564..809) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene tusA CDS 1030..1695 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100469.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 1768..2325 product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene dcrB CDS complement(2329..3579) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 3678..4727 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 4782..5369 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene acpT CDS 5480..7054 product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953353.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene nikA CDS 7054..7998 product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene nikB CDS 7995..8828 product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene nikC CDS 8828..9592 product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene nikD CDS 9589..10395 product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene nikE CDS 10401..10802 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene nikR CDS complement(10922..11281) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(11626..12750) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 misc_feature complement(12750..>14006) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000149156.1:ribosome-associated ATPase/putative transporter RbbA locus_tag LOCUS_19300 sequence087 source 1..13986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(518..1582) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene proW CDS complement(1575..2777) product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene proV CDS complement(3132..4091) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene nrdF CDS complement(4101..6245) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene nrdE CDS complement(6218..6628) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene nrdI CDS complement(6625..6870) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene nrdH CDS complement(7118..7447) product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 7599..7943 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(7980..8429) product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene alaE CDS 9098..9502 product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene stpA CDS complement(9549..10073) product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ygaP CDS complement(10083..10388) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 10565..10723 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 10807..11256 product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene kbp CDS complement(11257..11919) product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene csiR CDS complement(11940..13340) product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295173.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene gabP sequence088 source 1..13910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 33..968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(1075..1590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 2223..2516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(2684..2938) product DUF826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(2974..3156) product DUF1378 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144787.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(3301..5355) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 5660..6181 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420351.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(6213..7094) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(7094..7654) product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301577.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(7645..8727) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(8727..9164) product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(9157..9768) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(9761..10885) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(10869..11189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 note possible pseudo, internal stop codon CDS complement(11208..12227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 note possible pseudo, internal stop codon misc_feature complement(12214..>13910) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000113525.1:tape measure protein locus_tag LOCUS_19620 sequence089 source 1..13838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(446..3151) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene malT CDS 3763..6156 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene malP CDS 6166..8250 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene malQ CDS complement(8361..9677) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene gntT CDS complement(10038..10613) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene nfuA CDS complement(10672..11355) product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene gntX CDS 11393..12163 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene bioH CDS complement(12192..13070) product recombination-promoting nuclease RpnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene rpnA CDS complement(13273..13509) product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene feoC sequence090 source 1..13809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(561..710) product multidrug efflux pump accessory protein AcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891515.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene acrZ CDS 839..1627 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene modE CDS 1695..3167 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene modF CDS 3429..4445 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265438.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene galE CDS 4455..5501 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene galT CDS 5505..6653 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene galK CDS 6647..7687 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene galM CDS 7890..8642 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene gpmA CDS complement(8809..9861) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109193.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene aroG CDS 10177..10557 product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784351.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 10671..11612 product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951276.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene zitB CDS complement(11609..12328) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene pnuC CDS complement(12366..13409) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene nadA sequence091 source 1..13621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 249..713 product Gp37 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101804.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 713..964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666499.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 954..2381 product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729834.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 2381..2902 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162832341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2905..3186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 3284..3619 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 3777..6728 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 6728..7612 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 7612..7824 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478224.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 7812..8966 product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 8963..9559 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 9614..9961 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859114.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 9952..11055 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219102.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 11048..11626 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 11629..11982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 note possible pseudo, frameshifted CDS 11988..12710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 note possible pseudo, frameshifted CDS 12713..12946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(12927..13337) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223322.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 sequence092 source 1..13326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 614..3244 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene alaS CDS 3479..3664 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene csrA tRNA 3980..4072 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 4076..4152 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(4096..4167) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 4351..4427 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 4490..4566 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 4765..4841 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 5122..5688 product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273290.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene yqaB CDS 5685..6113 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 6186..7742 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene gshA CDS 7892..8407 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene luxS CDS complement(8471..10009) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene emrB CDS complement(10026..11198) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295175.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene emrA CDS complement(11325..11855) product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene emrR CDS complement(11946..12281) product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119749.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene ygaH CDS complement(12271..13008) product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene ygaZ sequence093 source 1..13286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 365..745 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(874..2817) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589431.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene cpdB CDS 3007..3747 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene cysQ CDS complement(3737..4294) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 4619..4825 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(4887..6230) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(6553..7191) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene msrA CDS 7248..7427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 7397..9130 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene tamA CDS 9127..12906 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060946.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene tamB CDS 12909..13250 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 sequence094 source 1..13283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 521..2176 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene lldP CDS 2176..2952 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene lldR CDS 2949..4139 product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene lldD CDS 4293..4766 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932351.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene trmL CDS complement(4819..5640) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene cysE CDS complement(5720..6739) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene gpsA CDS complement(6739..7206) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003382.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene secB CDS complement(7269..7520) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene grxC CDS complement(7662..8093) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 8338..9882 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116565.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene gpmM CDS 9916..11175 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene envC CDS 11179..12138 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483860.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(12125..13159) product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene waaH sequence095 source 1..13141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1119..1682 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene srlA CDS 1679..2638 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene srlE CDS 2649..3020 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene srlB CDS 3024..3803 product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene srlD CDS 3908..4267 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene gutM CDS 4334..5107 product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene srlR CDS 5100..6065 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287420.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene gutQ CDS complement(6062..7576) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010749.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene norR CDS 7763..9202 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029605.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene norV CDS 9199..10332 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064748.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene norW CDS complement(10460..12712) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107704.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene hypF CDS complement(12865..13140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 sequence096 source 1..13116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..1357 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene dinF CDS 1473..1682 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(1724..2239) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene zur CDS 2557..2811 product protein YjbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene yjbL CDS 2835..3542 product DUF2713 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 3923..4942 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene dusA CDS 5076..5318 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene pspG CDS complement(5484..6467) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 6550..7965 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene dnaB CDS 8018..9097 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene alr CDS 9350..10543 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene tyrB CDS 10662..10841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(10765..11268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 11670..12383 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene aphA CDS 12494..12910 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270375.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 sequence097 source 1..12874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(973..1683) product fimbrial chaperone EcpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305432.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene ecpE CDS complement(1652..3295) product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310578.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene ecpD CDS complement(3285..5810) product fimbrial usher EcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene ecpC CDS complement(5836..6504) product fimbrial chaperone EcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene ecpB CDS complement(6562..7149) product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730972.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene ecpA CDS complement(7223..7765) product ECP biosynthesis operon DNA-binding transcriptional regulator EcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220247.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene ecpR CDS 8647..8814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(8849..8989) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene ykgO CDS complement(8989..9255) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803998.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 sequence098 source 1..12828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..649) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene eco CDS complement(784..948) product protein YojO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene yojO CDS 1541..1804 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene napD CDS 1801..4287 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene napA CDS 4375..4989 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene napG CDS 4976..5839 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene napH CDS 5836..6285 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene napB CDS 6295..6897 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene napC CDS 6910..7533 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene ccmA CDS 7530..8192 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene ccmB CDS 8210..8971 product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene ccmC CDS 8968..9177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 9174..9653 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene ccmE CDS 9650..11593 product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene ccmF CDS 11590..12147 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene dsbE sequence099 source 1..12801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(998..1699) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene fre CDS complement(1745..3238) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene ubiD CDS 3405..3893 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene rfaH CDS complement(3890..4672) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301305.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene tatD CDS complement(4714..5490) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene tatC CDS complement(5493..6008) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene tatB CDS complement(6012..6281) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene tatA CDS complement(6360..8000) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene ubiB CDS complement(7997..8602) product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene ubiJ CDS complement(8616..9371) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene ubiE CDS complement(9466..10893) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene rmuC CDS complement(11034..11795) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045180.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene udp sequence100 source 1..12799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(744..1829) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene ypdF CDS complement(1844..3091) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985359.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(3113..3439) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(3658..4623) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene glk CDS 4827..6083 product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903148.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 6198..6524 product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490072.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene ypeC CDS complement(6665..7840) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186369.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 8239..9441 product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene nupC CDS complement(9491..11680) product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 tRNA complement(11889..11964) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(12004..12079) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 12315..12659 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 sequence101 source 1..12799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..593) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene nrdG CDS complement(752..2890) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene nrdD CDS complement(3284..4939) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331056.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene treC CDS complement(4989..6410) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene treB CDS complement(6529..7476) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene treR CDS 7855..10551 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471866.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene mgtA CDS complement(10757..11143) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene ridA CDS complement(11216..11677) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene pyrI CDS complement(11690..12625) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene pyrB sequence102 source 1..12764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..503 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 560..2206 product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene fadK CDS complement(2263..4641) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene ppsA CDS 5055..5807 product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene ppsR CDS 5964..7010 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene aroH CDS 7115..7333 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966807.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene hemP CDS complement(7337..8773) product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175641.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene selO CDS complement(8836..9549) product anti-FlhDC factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326034.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene ydiV CDS complement(9796..10260) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(10338..11087) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene btuD CDS complement(11087..11638) product bifunctional thioredoxin/glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene btuE CDS complement(11701..12681) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene btuC sequence103 source 1..12689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(848..2143) product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627106.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2203..2493) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768384.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2752..3633) product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene yddG CDS 3865..6912 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012311994.1 transl_table 11 codon_start 1 transl_except (pos:4450..4452,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_21360 gene fdnG CDS 6925..7809 product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene fdnH CDS 7802..8455 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene fdnI CDS complement(8684..8968) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(9114..9776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 note possible pseudo, frameshifted CDS complement(9661..10116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 note possible pseudo, frameshifted CDS complement(10250..11947) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433476.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene maeA CDS complement(12104..12241) product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene sra CDS complement(12343..12558) product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene bdm sequence104 source 1..12647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(515..3838) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236847.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene mscM CDS complement(3860..4828) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene asd CDS complement(4925..5977) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene rsgA CDS 6072..6617 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene orn tRNA 6828..6903 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 7061..7136 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 7172..7247 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(7517..8656) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene queG CDS 8655..10202 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene nnr CDS 10174..10635 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene tsaE CDS 10654..11991 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene amiB sequence105 source 1..12534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..870) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene sucD CDS complement(870..2036) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene sucC CDS complement(2130..3347) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene odhB CDS complement(3362..6163) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene sucA CDS complement(6464..7180) product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene sdhB CDS complement(7196..8962) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene sdhA CDS complement(8962..9309) product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene sdhD CDS complement(9303..9707) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene sdhC CDS 10401..11684 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene gltA sequence106 source 1..12478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..945 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000646142.1:zinc-dependent alcohol dehydrogenase locus_tag LOCUS_21620 CDS complement(1176..1586) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene rnk CDS complement(1815..2621) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene rna CDS complement(2735..4198) product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene citT CDS complement(4249..5127) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062457.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene citG CDS complement(5102..5653) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene citX CDS complement(5657..7189) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene citF CDS complement(7200..8108) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622357.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene citE CDS complement(8105..8401) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700701.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene citD CDS complement(8416..9474) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene citC CDS 9854..11512 product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939767.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene dpiB CDS 11481..12161 product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene dpiA sequence107 source 1..12466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 393..1583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2997..3674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(4238..5146) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(5286..6479) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(6523..7776) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(8111..10027) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 10227..11522 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene rpoN CDS 11537..11926 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228753.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(12190..12462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 sequence108 source 1..12387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(484..3069) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(3143..3499) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 3732..4259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 4247..4786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 4783..6336 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808703.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene sdhA CDS 6333..7034 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808702.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene sdhB CDS complement(7079..7330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 7745..8659 product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 8760..9230 product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 9227..11035 product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 11047..11313 product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 11417..12280 product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 sequence109 source 1..12347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 334..1143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 1180..2928 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene msbA CDS 2925..3911 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570540.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene lpxK CDS 3948..5180 product crosslink repair DNA glycosylase YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056529.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene ycaQ CDS 5232..5414 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene ycaR CDS 5411..6157 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene kdsB CDS 6311..7204 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436922.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(7181..7960) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene elyC CDS 8096..8881 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298300.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene cmoM CDS 8878..10200 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene mukF CDS 10181..10885 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene mukE sequence110 source 1..12320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 848..1066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(1050..1565) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene sulA CDS 1778..2407 product CRP-S regulon transcriptional coactivator Sxy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839153.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene sxy CDS complement(2370..4532) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene yccS CDS complement(4542..4988) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 5111..7165 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295354.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene helD CDS complement(7197..7664) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene mgsA CDS complement(7751..8413) product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(8453..8611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 8586..8999 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(9044..9361) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene hspQ CDS complement(9419..10609) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene rlmI CDS 10704..10982 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048252.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene yccX CDS complement(10979..11308) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904442.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene tusE CDS complement(11399..12058) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene yccA sequence111 source 1..12274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1048 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001287154.1:glutamine--tRNA ligase locus_tag LOCUS_22220 CDS 1626..3032 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene chiP CDS 3082..3408 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733579.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene chiQ CDS complement(3493..3939) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene fur CDS complement(4228..4758) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene fldA CDS complement(4898..5260) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291238.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene ybfE CDS complement(5331..6095) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene ybfF CDS 6280..6825 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene seqA CDS 6851..8491 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295675.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene pgm CDS complement(9240..9890) product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017803196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(10239..11558) product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075845.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene potE misc_feature complement(11555..>12274) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000040195.1:ornithine decarboxylase SpeF locus_tag LOCUS_22330 sequence112 source 1..12237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1725 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000556469.1:autotransporter adhesin EhaB locus_tag LOCUS_22340 CDS 1813..2436 product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene iprA CDS complement(2437..3594) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene ampH CDS 3946..5166 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene sbmA CDS 5179..6273 product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092069.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene yaiW CDS complement(6332..6640) product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 6900..7112 product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(7136..8230) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene ddlA CDS 8693..8953 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene iraP CDS 9054..10283 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene phoA CDS 10308..10469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 note possible pseudo, internal stop codon CDS 10588..10908 product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene psiF CDS 11223..12125 product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene adrA sequence113 source 1..12216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(611..1426) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306952.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(1437..2696) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2706..4373) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 4690..5739 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703900.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene allD CDS 5761..6996 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306951.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene allC CDS 7007..7792 product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene allE CDS complement(8020..9165) product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706355.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene glxK CDS complement(9187..10488) product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298987.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(10545..11906) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006900.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene allB sequence114 source 1..12089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 12..749 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253450.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene fliP CDS 759..1028 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187358.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene fliQ CDS 1037..1822 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene fliR CDS 2112..2735 product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene rcsA CDS complement(2779..2967) product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene dsrB CDS 3130..3357 product peroxide/acid resistance protein YodD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844800.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene yodD CDS 3655..4470 product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491522.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(4467..6143) product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene dgcQ CDS complement(6399..6581) product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(6660..7577) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 7750..8670 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene yedA CDS complement(8659..9129) product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785996.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene vsr CDS complement(9110..10528) product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157239.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene dcm CDS complement(10595..11290) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365562.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(11330..11713) product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene drpB sequence115 source 1..12008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1135..1692) product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278727.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene puuR CDS complement(1719..2471) product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300506.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene puuD CDS 2695..4113 product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene puuA CDS 4416..5801 product putrescine/proton symporter PuuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene puuP CDS 5935..6180 product DUF2543 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 6534..8135 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250213.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene sapA CDS 8132..9097 product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene sapB CDS 9084..9974 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146163.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene sapC CDS 9974..10966 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene sapD CDS 10968..11774 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene sapF sequence116 source 1..11955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2634..4121) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene nusA CDS complement(4149..4601) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene rimP tRNA complement(4808..4884) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 5232..6575 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207685.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene argG CDS complement(6583..8100) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333576.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 tRNA complement(8667..8753) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(8768..9100) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene secG CDS complement(9328..10665) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene glmM CDS complement(10658..11506) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene folP sequence117 source 1..11888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 683..3037 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene lon CDS 3246..3518 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene hupB CDS 3710..5581 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene ppiD CDS 5732..6061 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 6167..6565 product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene fadM CDS complement(6617..7312) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene queC CDS complement(7377..9092) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238234.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 9177..9995 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene cof CDS 10148..10606 product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene decR sequence118 source 1..11860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1729..1935) product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424924.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 2337..4010 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene kdpA CDS 4033..6081 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene kdpB CDS 6090..6662 product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene kdpC CDS 6655..9339 product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309343.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene kdpD CDS 9336..10013 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186076.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene kdpE sequence119 source 1..11763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 442..807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 986..1720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 1858..1998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2262..2756 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2749..3453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 3570..4070 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905239.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 4048..4245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 4303..4713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 5154..5552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(5584..5928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 6040..7143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 7318..7512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 7502..8242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 8239..9078 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 9091..9282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 9418..11025 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 11344..11559 product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 sequence120 source 1..11667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..1225 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333512.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 1222..3222 product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 3347..3808 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295429.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(3849..4319) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295430.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(4366..5085) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598641.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene btsR CDS complement(5082..6782) product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene btsS CDS 6989..7720 product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240401.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene mlrA CDS complement(7868..8599) product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783120.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene yehW CDS complement(8604..9530) product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569352.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene yehX CDS complement(9523..10680) product glycine betaine ABC transporter permease YehY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220837.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene yehY CDS complement(10687..11604) product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131252.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene osmF sequence121 source 1..11659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 621..1937 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803190.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene ugpB CDS 2035..2922 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099276.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene ugpA CDS 2919..3764 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene ugpE CDS 3766..4836 product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene ugpC CDS 4833..5576 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073609.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene ugpQ CDS complement(5563..6003) product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 6123..7865 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ggt CDS complement(7903..8187) product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(8387..8542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(8637..9131) product protein YrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene yrhA CDS complement(9128..10306) product Hcp1 family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065894.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(10543..11031) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295206.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene yhhY CDS complement(11265..11417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 sequence122 source 1..11600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(749..1771) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(1773..3323) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830577.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(3337..3918) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene ddpX CDS complement(4176..6575) product oxygen-sensing cyclic-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307211.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene dosP CDS complement(6600..7982) product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426279.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene dosC CDS complement(8354..9508) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350395.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 9463..9639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(9804..11339) product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene gadC sequence123 source 1..11551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1710..3881) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene glcB CDS complement(3903..4307) product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(4312..5535) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene glcF CDS complement(5546..6598) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene glcE CDS complement(6598..8097) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene glcD CDS 8348..9112 product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene glcC CDS complement(9119..10261) product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene yghO sequence124 source 1..11497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1938..3371) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene glgA CDS complement(3371..4666) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene glgC CDS complement(4684..6657) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192540.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene glgX CDS complement(6654..8840) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene glgB CDS complement(9113..10216) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene asd CDS 10409..11002 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene yhgN sequence125 source 1..11469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(797..1825) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911184.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene lsrC CDS complement(1819..3354) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194860.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene lsrA CDS 3603..4556 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene lsrR CDS 4635..6227 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene lsrK sequence126 source 1..11386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..1777) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699105.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene pdxB CDS 1876..2871 product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene flk CDS complement(2868..4046) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127781.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(4355..5575) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817183.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene fabB CDS 5734..7740 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene mnmC CDS complement(7861..8139) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559764.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(8173..8721) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089222.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene epmC CDS complement(8721..9530) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(9530..10354) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043825.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene mepA misc_feature complement(10358..>11386) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000918470.1:chorismate synthase locus_tag LOCUS_23790 sequence127 source 1..11255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(615..1373) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(1510..2490) product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene ydjG CDS complement(2500..3447) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(3452..4288) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(4309..5121) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 note possible pseudo, frameshifted CDS complement(5091..5351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 note possible pseudo, frameshifted CDS complement(5368..6747) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435292.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(6774..7850) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(8220..8492) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046790.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(8534..8947) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene msrB CDS 9289..10284 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene gapA CDS 10368..11252 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 sequence128 source 1..11209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..357 product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(593..2278) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2955..3212) product glutaredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene grxA CDS 3372..3659 product DUF1418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 3643..4347 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189187.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene nfsA CDS 4426..5328 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684321.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene rimK CDS 5416..5892 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 6243..7355 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126072.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene potF CDS 7450..8583 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene potG CDS 8593..9546 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene potH CDS 9543..10388 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061657.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene potI CDS 10448..10936 product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389260.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 sequence129 source 1..11182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1945..3054 product 6-N-hydroxylaminopurine resistance protein YcbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224274.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene ycbX CDS complement(3051..3593) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295353.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene zapC CDS complement(3767..4777) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene pyrD CDS complement(4888..5568) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307090.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(5591..6106) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(6114..6566) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349463.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(6668..7738) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(7729..10329) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286318.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(10354..11055) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295349.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 sequence130 source 1..11126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1118..1855 product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene trmN CDS complement(1840..3462) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene nadB CDS 3870..4445 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rpoE CDS 4478..5128 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene rseA CDS 5128..6084 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene rseB CDS 6081..6560 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589070.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene rseC CDS 6758..8557 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene lepA CDS 8573..9547 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene lepB CDS 9820..10500 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene rnc sequence131 source 1..11118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 847..1650 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene suhB CDS 1795..2649 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2840..4120 product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982994.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene csiE CDS complement(4112..5251) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(5411..6301) product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423257.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene hcaR CDS 6437..7798 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 7795..8313 product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 8313..8633 product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 8630..9442 product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene hcaB CDS 9452..10654 product phenylpropionate dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 sequence132 source 1..10996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..428) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017106.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene ruvX CDS complement(428..991) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(1100..2050) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene gshB CDS complement(2063..2794) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene rsmE CDS complement(2874..3581) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene endA CDS complement(3676..4131) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(4250..5644) product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene galP CDS complement(6080..7234) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene metK CDS 8107..10005 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene speA sequence133 source 1..10896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..1338) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene lolC CDS 1600..2673 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 2738..6247 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115094.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene mfd CDS 6394..7353 product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098471.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene ldtC CDS complement(7436..7693) product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800153.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene bhsA CDS 7934..8566 product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179805.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene comR CDS complement(8628..9167) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(9394..10698) product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene ndh sequence134 source 1..10895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(446..1069) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene clpP CDS complement(1315..2613) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene tig CDS complement(2957..3274) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene bolA CDS 3579..4157 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 4201..5676 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene ampG CDS 6137..7084 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239441.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene cyoA CDS 7106..9097 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene cyoB CDS 9186..9701 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 9701..10030 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 sequence135 source 1..10865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2723..4192) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene rng CDS complement(4182..4775) product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene yhdE CDS complement(4784..5272) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene mreD CDS complement(5272..6375) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802516.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene mreC CDS complement(6441..7484) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene mreB CDS complement(7789..9729) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene csrD CDS 9881..10855 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 sequence136 source 1..10862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(464..1822) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409841.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 2410..4833 product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene pgaA CDS 4842..6860 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945561.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene pgaB CDS 6973..8178 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene pgaC CDS 8180..8593 product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene pgaD CDS complement(8643..9566) product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258765.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene phoH sequence137 source 1..10778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 413..736 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160737.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 733..1563 product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255167.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene amiD CDS complement(1560..2609) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069300.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(2672..4102) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(4113..5114) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene ltaE CDS complement(5151..6869) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815359.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene poxB CDS complement(7002..7970) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178677.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene hcr CDS complement(7982..9634) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458817.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene hcp CDS complement(9778..10677) product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491142.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene lysO sequence138 source 1..10707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..598 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001007421.1:bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase locus_tag LOCUS_24810 CDS 600..1544 product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene mhpB CDS 1573..2439 product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene mhpC CDS 2449..3258 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene mhpD CDS 3255..4205 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene mhpF CDS 4202..5215 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene dmpG CDS 5285..6496 product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107624.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene mhpT CDS 6747..8174 product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene mmuP CDS 8161..9093 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081352.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene mmuM CDS complement(9202..10248) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192349.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene fbpC CDS complement(10260..10622) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295711.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 sequence139 source 1..10654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(668..1495) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene dkgA CDS complement(1600..2763) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058802.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene yqhD CDS 2957..3856 product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene yqhC CDS complement(3896..4555) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene yghB CDS complement(4695..5882) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301079.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene metC CDS 6134..6868 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene exbB CDS 6875..7300 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene exbD CDS complement(7572..8456) product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene yghA CDS 8647..9141 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(9181..10221) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262150.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene gpr sequence140 source 1..10650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..1357) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597374.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(1379..2542) product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(2583..3689) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(3701..4594) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(4677..5981) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(6012..6368) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816883.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(6410..6766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(6799..8175) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234970.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene amiE CDS complement(8322..9233) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005177131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene yhfZ sequence141 source 1..10617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..2733) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene clpA CDS complement(2764..3084) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene clpS CDS 3407..3631 product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410785.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene cspD CDS complement(3704..5632) product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188136.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene macB CDS complement(5629..6726) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746460.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene macA CDS 6859..7851 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(7848..9506) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 sequence142 source 1..10551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(847..1893) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene fbpC CDS complement(1905..3983) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(4052..5083) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(5080..6384) product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene uhpC CDS complement(6469..8010) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089287.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(8010..8639) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(8922..10103) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 sequence143 source 1..10510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..1351) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(1402..2343) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091480.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(2358..3128) product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 3775..5115 product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene caiT CDS 5146..6288 product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene caiA CDS 6417..7634 product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349936.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene caiB CDS 7708..9261 product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene caiC CDS 9370..10155 product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene caiD sequence144 source 1..10504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..374) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163908.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 471..779 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094527.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 829..1806 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 1809..2171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 2171..2608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(2769..5918) product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene acrB CDS complement(5941..7026) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene acrA CDS 7276..7923 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene acrR sequence145 source 1..10429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3375..4931 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene mltF CDS complement(4928..5431) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene tadA CDS complement(5489..6124) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene yfhb CDS 6333..7181 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013779.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 7312..7497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(8192..8572) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986029.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene acpS CDS complement(8572..9303) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene pdxJ CDS complement(9315..10043) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399393.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene recO sequence146 source 1..10396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000977128.1:TVP38/TMEM64 family protein locus_tag LOCUS_25500 CDS 640..1188 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 1198..2364 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215339.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 2370..3872 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224958.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 3872..4525 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300558.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 4592..5899 product thiosulfate sulfurtransferase YnjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene ynjE CDS complement(5908..6528) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295484.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 6615..7022 product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781880.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene nudG CDS complement(6988..7260) product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085238.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 7496..8839 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373043.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene gdhA CDS complement(8956..9996) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756914.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(10124..10396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 sequence147 source 1..10396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..2047) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene cirA CDS complement(2435..3904) product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253273.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene lysP CDS complement(4109..4915) product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene yieE CDS 5089..6138 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 6212..7069 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene nfo CDS 7072..8160 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065016.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(8216..9466) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 misc_feature complement(9566..>10396) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000415455.1:ribosylpyrimidine nucleosidase locus_tag LOCUS_25690 sequence148 source 1..10395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(70..156) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(169..242) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(297..372) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(524..1072) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160187.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene pgsA CDS complement(1129..2961) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene uvrC CDS complement(2958..3614) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611335.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene uvrY CDS 4073..4297 product DUF2594 family protein YecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106474.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene yecF CDS complement(4364..5086) product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154288.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene sdiA CDS complement(5316..6068) product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene yecC CDS complement(6065..6733) product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene tcyL CDS complement(6748..7734) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene dcyD CDS complement(7839..8696) product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene tcyJ CDS complement(8883..9314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 note possible pseudo, internal stop codon CDS complement(9324..10013) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene fliA sequence149 source 1..10346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(757..1950) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 2086..3810 product NIS family aerobactin synthetase IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene iucA CDS 3811..4758 product N(6)-hydroxylysine O-acetyltransferase IucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287497.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene iucB CDS 4758..6500 product NIS family aerobactin synthetase IucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene iucC CDS 6497..7834 product NADPH-dependent L-lysine N(6)-monooxygenase IucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750139.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene iucD CDS 7837..10035 product ferric aerobactin receptor IutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene iutA sequence150 source 1..10032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..1127) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene potD CDS complement(1124..1918) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene potC CDS complement(1915..2772) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene potB CDS complement(2756..3874) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531594.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene potA CDS complement(3871..4086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 4142..5368 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359446.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene pepT CDS complement(5417..6538) product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene roxA CDS complement(6614..8074) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735412.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene phoQ CDS complement(8074..8745) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265471.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene phoP misc_feature complement(8914..>10032) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000423729.1:adenylosuccinate lyase locus_tag LOCUS_25960 sequence151 source 1..10014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..507 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001086511.1:bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL locus_tag LOCUS_25970 CDS 519..2426 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 2556..3809 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333176.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene pqiA CDS 3814..5454 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene pqiB CDS 5451..6014 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759120.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene pqiC CDS 6270..6437 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828648.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene rmf CDS complement(6507..7133) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene fabA CDS complement(7094..8854) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156518.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 9040..9492 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene matP sequence152 source 1..10003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1457..2434) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene epmA CDS 2759..4567 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192973.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene frdA CDS 4560..5294 product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene frdB CDS 5305..5700 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene frdC CDS 5711..6070 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609663.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene frdD CDS 6133..7266 product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477369.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 7355..7888 product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238369.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene blc CDS complement(7885..8202) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene sugE CDS complement(8378..8524) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene ecnB CDS complement(8812..9378) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene efp sequence153 source 1..9990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..936) product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene nlpA CDS 1158..1451 product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene yicS CDS complement(1492..2682) product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene nepI CDS complement(2893..3345) product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(3398..4732) product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403836.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene adeQ CDS 4907..6673 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene adeD CDS complement(6719..8110) product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene uhpT CDS complement(8248..9567) product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene uhpC sequence154 source 1..9952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..657 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001299828.1:trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase locus_tag LOCUS_26240 CDS complement(697..1335) product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene rutR CDS 1620..2714 product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene rutA CDS 2714..3406 product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307708.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene rutB CDS 3418..3804 product 3-aminoacrylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126780.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene rutC CDS 3812..4612 product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307099.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene rutD CDS 4622..5212 product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001165.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 5223..5717 product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene rutF CDS 5738..7066 product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326838.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene rutG CDS complement(7149..7322) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 7695..8291 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151437.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene wrbA CDS 8312..8539 product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143120.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(8577..9818) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene agp sequence155 source 1..9948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1376..2152) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(2162..3004) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(3014..3805) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 4018..4665 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(4649..5287) product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene ytfB CDS 5506..6126 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene fklB CDS 6435..7847 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene cycA CDS complement(7892..8554) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene ytfE CDS complement(8662..9627) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 sequence156 source 1..9938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(591..803) product YncH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(879..1496) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598868.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 1763..3262 product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene ansP CDS complement(3377..4438) product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550675.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 4764..6782 product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene pqqU CDS complement(6818..7483) product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene mcbR CDS complement(7681..8718) product NADPH-dependent curcumin/dihydrocurcumin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531452.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene curA CDS 8899..9417 product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027563.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene mddA CDS 9414..9863 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076535.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 sequence157 source 1..9927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 1183..1524 product endoribonuclease SymE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132614.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene symE CDS complement(1567..8970) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213431.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 sequence158 source 1..9777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..1877) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(1972..2886) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051583.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene ldcA CDS 2859..3047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 2986..3597 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295616.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene emtA CDS complement(3599..4333) product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020169.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 4534..4788 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511315.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 4966..5406 product protein YcgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615067.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene ycgY CDS complement(5485..7182) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841714.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene treA CDS complement(7502..8920) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301101.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene dhaM CDS complement(8931..9563) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059411.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene dhaL sequence159 source 1..9771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(341..1423) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene prfA CDS complement(1465..2721) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene hemA CDS 2935..3558 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene lolB CDS 3558..4409 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260323.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene ispE CDS 4494..5507 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene prs CDS 5632..7311 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033352.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene dauA CDS complement(7366..7644) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene ychH CDS 7922..8506 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152933.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene pth CDS 8623..9714 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene ychF sequence160 source 1..9716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..1321) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene ispC CDS complement(1413..1970) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene frr CDS complement(2263..2988) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene pyrH CDS complement(3135..3986) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene tsf CDS complement(4244..4969) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene rpsB CDS 5337..6131 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene map CDS 6193..8865 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene glnD sequence161 source 1..9705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..794 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000063125.1:phosphate ABC transporter ATP-binding protein PstB locus_tag LOCUS_26840 CDS 809..1534 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene phoU CDS 1820..2656 product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene bglG CDS 2790..4667 product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137296.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene bglF CDS 4686..6080 product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene bglB CDS 6166..7782 product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene bglH CDS 7809..8978 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 sequence162 source 1..9547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(358..612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 988..1230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 1227..1565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 1667..3766 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene ptsG CDS complement(4009..4572) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(4569..5156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 5408..6412 product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(6531..7667) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(7684..9039) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(9054..9545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 sequence163 source 1..9485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(276..800) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene tssJ CDS complement(797..2077) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113725.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene tagH CDS complement(2102..3184) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene tssG CDS complement(3148..4998) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393844.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene tssF CDS complement(5002..5415) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611748.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene tssE CDS complement(5422..6897) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056978.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene tssC CDS complement(6948..7172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(7207..7707) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037399.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene tssB CDS 8404..8922 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142958.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 sequence164 source 1..9484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(898..1101) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(1151..3301) product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene btsT CDS 3678..5342 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919571.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene tsr CDS complement(5391..6752) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410140.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(6967..7881) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 8020..9042 product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene lgoD sequence165 source 1..9399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..997) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350555.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(990..1652) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene ulaD CDS complement(1649..3145) product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196054.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene lyxK CDS complement(3149..4135) product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene yiaO CDS complement(4148..5425) product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279599.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene yiaN CDS complement(5428..5901) product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene yiaM CDS complement(6019..6486) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576079.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(6498..7496) product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene yiaK CDS 7697..8545 product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514240.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene yiaJ CDS 8647..9120 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296790.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 sequence166 source 1..9320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..1861) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047424.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(2106..3512) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(3591..4028) product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene hicB CDS 4511..4681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(4773..6734) product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene rlhA CDS complement(6807..7343) product DNA-binding transcriptional regulator SutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429162.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene sutR CDS 7435..8610 product BenE family transporter YdcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236265.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene ydcO misc_feature complement(8650..>9320) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000826404.1:RNA-guided endonuclease TnpB family protein locus_tag LOCUS_27330 sequence167 source 1..9310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..538 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360951.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 632..1285 product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351464.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene nfsB CDS 1393..2640 product mechanosensitive ion channel YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene ybdG CDS complement(2708..4120) product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786320.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene pheP CDS complement(4186..7329) product Cu(+)/Ag(+) efflux RND transporter permease subunit CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573945.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene cusA CDS complement(7341..8564) product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717115.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene cusB CDS complement(8580..8912) product Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709873.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene cusF sequence168 source 1..9277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(457..1989) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054872.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 2551..2673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 2978..3736 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 3748..3978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 4160..4285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 4494..5177 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 5217..6059 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 6056..6688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(6716..7846) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(7912..8844) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 sequence169 source 1..9263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(372..1268) product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene yhaJ CDS 1373..2074 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 2097..2261 product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295544.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene yhaL CDS complement(2395..3705) product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460512.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene cyuA CDS complement(3733..5064) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(5340..6704) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene tdcG CDS complement(6776..7165) product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 misc_feature complement(7179..>9263) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000861753.1:2-ketobutyrate formate-lyase/pyruvate formate-lyase locus_tag LOCUS_27580 sequence170 source 1..9215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..708) product reactive chlorine species resistance protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306921.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene rclC CDS complement(720..956) product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene rclB CDS complement(1065..2390) product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046293.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene rclA CDS 2616..3470 product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339593.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene rclR CDS 3999..4718 product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102108.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 4729..6156 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 6149..6844 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370307.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(7087..7755) product protein YkgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene ykgH misc_feature complement(7968..>9215) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001159094.1:choline dehydrogenase locus_tag LOCUS_27670 sequence171 source 1..9099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 529..2187 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994427.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene fliF CDS 2180..3175 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067950.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene fliG CDS 3168..3854 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282694.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene fliH CDS 3854..5227 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene fliI CDS 5246..5689 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807584.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene fliJ CDS 5686..6813 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620097.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 6918..7382 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133106.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene fliL CDS 7387..8391 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295641.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene fliM CDS 8388..8801 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282098.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene fliN sequence172 source 1..8981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..1060) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327311.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(1050..2399) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(2498..3931) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078436.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(4001..5011) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357967.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(5044..5931) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094544.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(5956..6834) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306655.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene yihU CDS 7058..7903 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 7943..8731 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022286.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 sequence173 source 1..8970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(561..830) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325798.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(895..1080) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(1077..3716) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900912.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 3924..4913 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762229.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene ldhA CDS 5024..5446 product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298828.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene hslJ CDS complement(5443..5709) product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 sequence174 source 1..8944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1710..2462) product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153129.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene nagD CDS complement(2510..3730) product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187594.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene nagC CDS complement(3739..4887) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271153.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene nagA CDS complement(4947..5747) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene nagB CDS 6080..8026 product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene nagE sequence175 source 1..8931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 195..1142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 note possible pseudo, frameshifted CDS 1057..1518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 note possible pseudo, frameshifted CDS complement(1515..2408) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 2575..4290 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 4287..5780 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(5827..6276) product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene yidI CDS 6385..6732 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 6722..7084 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 7081..7578 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(7586..8746) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene emrD sequence176 source 1..8917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1729..2742) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene yhjD CDS complement(2791..3672) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 4210..4812 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(4863..6512) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 6917..8314 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784815.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene ccp sequence177 source 1..8893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1203..1895 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 2094..3182 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057149.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene serC CDS 3253..4536 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene aroA CDS 4705..5469 product metallopeptidase YcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295345.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene ycaL CDS 5642..6325 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene cmk CDS 6436..8109 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene rpsA CDS 8269..8553 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene ihfB sequence178 source 1..8892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..622 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276780.1:rhomboid family intramembrane serine protease locus_tag LOCUS_28180 CDS complement(700..2238) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene lnt CDS complement(2263..3141) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278605.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene corC CDS complement(3231..3698) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene ybeY CDS complement(3695..4735) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(4888..6312) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene miaB CDS 6458..7633 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184573.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene ubiF tRNA complement(7787..7861) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(7899..7973) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(8021..8097) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(8113..8187) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(8222..8296) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(8320..8404) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(8413..8489) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 sequence179 source 1..8888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(645..1007) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 1292..1501 product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene yibT CDS complement(1513..2100) product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene mtlR CDS complement(2100..3248) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645420.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene mtlD CDS complement(3478..5391) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene mtlA CDS 5928..6290 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479624.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 6293..7429 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(7889..8326) product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(8415..8708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 sequence180 source 1..8747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..689 product DNA-binding transcriptional regulator UidR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene uidR CDS 1080..2891 product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene uidA CDS 2888..4261 product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075893.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene uidB CDS 4312..5565 product glucuronide uptake porin UidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227023.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene uidC CDS complement(5610..7118) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043342.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(7219..8394) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene manA sequence181 source 1..8744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..537 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964791.1:DUF554 domain-containing protein locus_tag LOCUS_28400 CDS 1159..1548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 1639..1977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(2030..3277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3225..3452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(3458..4039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 4280..4522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 4536..4892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(5043..5228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 tRNA complement(5750..5825) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 6107..7324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 7344..8441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 sequence182 source 1..8728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1..95) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 388..1770 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 1780..4098 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene yicI CDS complement(4151..5707) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300954.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(5970..7361) product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene xanP sequence183 source 1..8703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(697..3417) product IncI1-type relaxase NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387486.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene nikB CDS complement(3429..3761) product IncI1-type relaxosome accessory protein NikA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283947.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene nikA CDS 3992..4327 product molybdopterin-guanine dinucleotide biosynthesis protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157095.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(4412..5260) product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077053.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 5841..6092 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148285.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(6109..6303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(6365..7306) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038348.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(7371..7637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(7729..8163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218858.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(8160..8375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 sequence184 source 1..8627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1202..1621 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene trxC CDS 1858..2388 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138184.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene tapT CDS 2420..5080 product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082964.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene pat CDS 5191..6549 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene pssA CDS 6646..6918 product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(6915..8213) product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene kgtP sequence185 source 1..8529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..970) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201819.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene murI CDS complement(915..2759) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene btuB CDS 3128..4228 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene trmA CDS complement(4268..4627) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(4627..5331) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene fabR CDS 5608..7008 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene sthA CDS complement(6991..7908) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene oxyR CDS complement(8175..8528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 sequence186 source 1..8493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 22..97 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(112..1275) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051894.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(1502..1807) product protein YfdT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene yfdT CDS complement(1807..2169) product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242717.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(2160..2696) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008183.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene yfdR CDS complement(2824..3648) product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(3714..4076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 4546..5061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559928.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(5276..5833) product LexA family transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848748.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 6041..6241 product YdaS family helix-turn-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649477.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 6285..6842 product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene ymfL CDS 7018..7197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 7187..8128 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 sequence187 source 1..8471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..1301) product nucleoside permease NupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333541.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene nupG CDS complement(1503..2585) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760323.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene mltC CDS complement(2647..2922) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(2950..4002) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321419.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene mutY CDS 4163..4882 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786911.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene trmB CDS 4882..5208 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 5392..6111 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 6287..7333 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394125.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene ansB CDS 7450..8457 product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 sequence188 source 1..8436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..1967 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097356.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene dld CDS 2042..2761 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102119.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 2772..4199 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 4192..4887 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(4937..5353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 5600..6580 product IS5-like element ISKpn26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019441.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 7349..8362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 sequence189 source 1..8404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..664 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000212477.1:transcriptional regulator EbgR locus_tag LOCUS_29080 CDS 848..3940 product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene ebgA CDS 3937..4386 product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 4449..5882 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285463.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 6016..7086 product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene ygjJ sequence190 source 1..8379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..1406) product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295686.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene codA CDS complement(1396..2655) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076233.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene codB CDS complement(3080..4966) product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010288.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene prpE CDS complement(5006..6457) product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275861.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene prpD CDS complement(6491..7660) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285927.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene prpC sequence191 source 1..8359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(506..847) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617184.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 985..1779 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 1983..2462 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene ybaK CDS complement(2499..4151) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771719.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene ushA CDS 4369..5589 product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene fsr CDS 5827..7503 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546255.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene ybaL misc_feature complement(7637..>8359) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000671574.1:inosine/guanosine kinase locus_tag LOCUS_29240 sequence192 source 1..8355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..842 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001141192.1:MFS transporter locus_tag LOCUS_29250 CDS complement(855..1409) product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151855.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene kptA CDS 1647..2342 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 2339..2800 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 2813..3985 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568397.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene iadA CDS 4050..4961 product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340758.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene hypT CDS complement(4954..5205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 6018..6848 product DUF2686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062571.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(6989..7762) product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833679.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene uxuR CDS 7761..7955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 sequence193 source 1..8344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..898 product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene msyB CDS 1047..1613 product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene satP CDS complement(1648..2235) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene mog CDS complement(2350..3303) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130185.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene tal CDS 3582..5012 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112606.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 5082..5858 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene yaaA CDS complement(6007..6168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(6521..7807) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene thrC misc_feature complement(7808..>8344) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000241662.1:homoserine kinase locus_tag LOCUS_29430 sequence194 source 1..8315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 699..2042 product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558251.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene gntP CDS complement(2215..3117) product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832247.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene fimH CDS complement(3137..3640) product type 1 fimbria minor subunit FimG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene fimG CDS complement(3653..4183) product type 1 fimbria minor subunit FimF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene fimF CDS complement(4193..6829) product fimbrial usher FimD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120940.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene fimD CDS complement(6896..7621) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene fimC CDS complement(7658..8044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 sequence195 source 1..8310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 722..1651 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191077.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene paaA CDS 1663..1950 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073393.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene paaB CDS 1959..2705 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072837.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene paaC CDS 2720..3217 product phenylacetate degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene paaD CDS 3225..4295 product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206388.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene paaK CDS 4292..5059 product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292353.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 5059..5847 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene paaG CDS 5894..7276 product 3-hydroxyacyl-CoA dehydrogenase PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973360.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene paaC CDS 7266..7688 product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018413.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene paaI sequence196 source 1..8299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 22..98 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 261..1064 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997036.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene dkgB CDS complement(1061..1975) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648586.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene yafC CDS 2216..3016 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 3094..3864 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211713.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(3912..5066) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene mltD CDS complement(5342..6097) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052743.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene gloB CDS 6131..6853 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(6850..7317) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene rnhA CDS 7382..8113 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001366128.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene dnaQ sequence197 source 1..8155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(669..2147) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039688.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(2174..3451) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164544.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 3770..4555 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021321.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 4625..6079 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059312.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 6173..7510 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098105.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 sequence198 source 1..8143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(391..1338) product hydrogenase 4 subunit HyfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001459972.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene hyfC CDS complement(1349..2620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 note possible pseudo, frameshifted CDS complement(2695..3366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 note possible pseudo, frameshifted CDS complement(3366..3983) product hydrogenase 4 subunit HyfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295470.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene hyfA CDS complement(4236..4706) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene bcp CDS complement(4706..5278) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 5424..6302 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295469.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene dapA CDS 6319..7353 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297320.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene bamC sequence199 source 1..8042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3177..4040) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(4033..4932) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(4966..6300) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289133.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(6583..7542) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 sequence200 source 1..7974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(3..78) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(193..1446) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893256.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene proA CDS complement(1458..2561) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene proB CDS 2849..3904 product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749881.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene phoE CDS complement(3943..4344) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene crl CDS complement(4402..5646) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189541.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene frsA CDS complement(5738..6196) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene gpt CDS 6457..7914 product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293009.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene pepD sequence201 source 1..7933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..749 product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847902.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene yecA CDS complement(811..2022) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene tyrP CDS 2214..2453 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377223.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(2491..2988) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917208.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene ftnA CDS 3280..3456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 3947..4198 product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene yecJ CDS complement(4277..4780) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179469.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 5577..6566 product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548675.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene araF sequence202 source 1..7920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(815..1267) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852287.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene moaE CDS complement(1269..1514) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene moaD CDS complement(1507..1992) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080885.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene moaC CDS complement(1995..2507) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084639.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene moaB CDS complement(2529..3518) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene moaA CDS 3915..4823 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295302.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene yvcK CDS complement(5015..7036) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042533.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene uvrB sequence203 source 1..7885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1093..1656) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033328.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(2340..2825) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195819.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene sixA CDS complement(3028..5172) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene fadJ CDS complement(5172..6482) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531952.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene fadI CDS complement(6663..6947) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030901.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 sequence204 source 1..7783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(266..1126) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075876.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene tesB CDS 1344..1916 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779826.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(1947..2258) product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene atl CDS 2637..2990 product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(3032..4588) product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene pdeB CDS complement(4746..5216) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(5332..5883) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene maa CDS complement(6055..6273) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(6299..6673) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene tomB CDS complement(7466..7606) product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078916.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 sequence205 source 1..7778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..841 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195286.1:DNA topoisomerase IV subunit B locus_tag LOCUS_30230 CDS complement(889..1203) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(1234..1815) product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene mdaB CDS 2065..2544 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065333.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 2547..3257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 3264..3596 product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(3642..4991) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene qseC CDS complement(4988..5647) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221502.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene qseB CDS 5799..6191 product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene ygiW CDS 6244..6726 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183494.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 6931..7227 product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene mqsR CDS 7229..7624 product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene mqsA sequence206 source 1..7775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(369..1388) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene galE CDS complement(1698..2591) product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene galF CDS complement(2834..3829) product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3987..5381) product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116116.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene wcaM CDS complement(5392..6612) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862592.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene wcaL CDS complement(6609..7775) product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770864.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene wcaK sequence207 source 1..7770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(783..1019) product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088653.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(1159..1398) product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(1763..1978) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386642.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(2055..2246) product DUF1382 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548537.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(2398..3078) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(3075..3860) product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene bet CDS complement(3866..4162) product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995439.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(4238..4444) product phage encoded cell division inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233576.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(5003..5383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(5432..6124) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 6235..6462 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184665.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 6493..7032 product toxin YdaT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182881.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 sequence208 source 1..7703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..534 product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene eutS CDS 547..1026 product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene eutP CDS 1001..1702 product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733903.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene eutQ CDS 1699..2502 product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651298.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene eutT CDS 2499..3515 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene pta CDS 3554..3847 product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene eutM CDS 3954..4241 product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762193.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene eutN CDS 4253..5656 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075711.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 5667..6503 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929729.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene eutJ CDS 6493..7680 product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301866.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene eutG sequence209 source 1..7687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 844..1872 product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene torT CDS complement(1845..2537) product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120112.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene torR CDS 2667..3839 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene torC CDS 3839..6385 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063172.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene torA CDS 6382..6981 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene torD CDS complement(7074..7379) product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024560.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene cbpM sequence210 source 1..7651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..1337 product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295313.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene entC CDS 1347..2957 product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026805.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene entE CDS 2971..3828 product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007138.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene entB CDS 3828..4574 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene entA CDS 4577..4990 product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene entH CDS 5171..7276 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene cstA CDS 7452..7649 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 sequence211 source 1..7607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 526..1566 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147574.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(1771..2346) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646033.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene dolP CDS complement(2356..2946) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158035.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene diaA CDS complement(2966..3361) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246830.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(3319..5355) product penicillin-binding protein activator LpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene lpoA CDS 5420..6280 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene rsmI CDS complement(6323..7282) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 sequence212 source 1..7587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..416) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(413..736) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104350.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(739..939) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864897.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(939..1433) product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063103.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(1535..2335) product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632318.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene gpM CDS complement(2381..3433) product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055094.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(3457..4293) product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262665.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 4448..6199 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613796.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 6199..7245 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087812.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 sequence213 source 1..7542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1131..1877) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038079.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(1874..2518) product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene gfcB CDS complement(2625..2930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032438.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(3372..3584) product cold shock-like protein CspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene cspH CDS 3870..4082 product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066490.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene cspG CDS 4476..4649 product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(4697..5770) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829662.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 misc_feature complement(5842..>7542) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001300633.1:TMAO reductase system sensor histidine kinase/response regulator TorS locus_tag LOCUS_31000 sequence214 source 1..7495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 34..957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871667.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(1030..1929) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062888.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene nhaR CDS complement(1995..3161) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681368.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene nhaA CDS 3747..3899 product type I toxin-antitoxin system toxin MokC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809168.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene mokC CDS complement(4003..5133) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene dnaJ CDS complement(5222..7138) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene dnaK sequence215 source 1..7483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1748..2182) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene tssE CDS complement(2182..2718) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074160625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene tssJ CDS complement(2699..3529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(3754..5517) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene tssF misc_feature complement(6219..>7483) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705644.1:type VI secretion system protein TssA locus_tag LOCUS_31110 sequence216 source 1..7467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..742) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(1035..2021) product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene yqjG CDS complement(2091..2573) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603618.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(2669..2968) product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096086.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(2958..3362) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(3365..3670) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(3708..4076) product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297156.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene yqjC CDS complement(4223..4606) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166761.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene mzrA CDS complement(4610..5272) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene yqjA CDS complement(5617..6393) product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene exuR CDS 6767..7405 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 sequence217 source 1..7410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..1302) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene mtr CDS complement(1456..3345) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene deaD CDS complement(3525..4409) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene nlpI CDS complement(4518..6653) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295554.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene pnp CDS complement(6900..7169) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene rpsO sequence218 source 1..7401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 307..1329 product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene lsrB CDS 1356..2231 product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774178.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene lsrF CDS 2255..2545 product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene lsrG CDS 2602..3360 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene tam CDS complement(3364..4278) product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637082.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(4485..5936) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854624.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene uxaB CDS complement(6163..7110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 sequence219 source 1..7364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 1335..2870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 2885..3595 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 3592..4440 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 4437..4973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(4975..5310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(5624..6856) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(6965..7252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 sequence220 source 1..7363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(39..114) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(221..796) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(833..2530) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068978.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene dsbD CDS complement(2506..2844) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene cutA CDS complement(2960..4261) product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene dcuA CDS complement(4379..5815) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335685.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene aspA CDS 6152..6628 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene fxsA misc_feature complement(6644..>7363) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000015802.1:L-methionine/branched-chain amino acid transporter locus_tag LOCUS_31490 sequence221 source 1..7338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(551..790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(806..1774) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(1784..3166) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(3200..3592) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(3589..4650) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(4836..5963) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(6172..6420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 sequence222 source 1..7326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..496) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299676.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(673..2406) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025326.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene argS CDS 2622..3188 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326063.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 3202..3948 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185734.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene cutC CDS 4336..5151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 note possible pseudo, internal stop codon sequence223 source 1..7253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1358 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010723175.1:HlyC/CorC family transporter locus_tag LOCUS_31620 CDS complement(1413..2006) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296310.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene grpE CDS complement(2003..2197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 2129..3007 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059169.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene nadK CDS 3093..4754 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880915.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene recN CDS 4903..5244 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene bamE CDS complement(5306..5596) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(5586..6062) product type II toxin-antitoxin system toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600189.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene ratA CDS 6194..6676 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162574.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene smpB tmRNA 6891..7253 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 sequence224 source 1..7206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1202 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000628537.1:ABC transporter ATP-binding protein/permease locus_tag LOCUS_31710 CDS 1240..3612 product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 3669..6452 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723101.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 sequence225 source 1..7196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2181..3134 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene metR CDS complement(3022..3921) product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene bioP CDS complement(3997..4797) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene yigL CDS complement(4805..5827) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene pldB CDS 5938..6558 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene rhtB misc_feature complement(6620..>7196) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000928824.1:threonine export protein RhtC locus_tag LOCUS_31790 sequence226 source 1..7175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..513 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000446378.1:multidrug efflux transporter periplasmic adaptor subunit MdtN locus_tag LOCUS_31800 CDS 513..2564 product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene mdtO CDS 2561..4027 product multidrug efflux transporter outer membrane subunit MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610574.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene mdtP CDS 4225..6372 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_table 11 codon_start 1 transl_except (pos:4642..4644,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_31830 gene fdhF CDS 6466..7155 product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719886.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene yjcO sequence227 source 1..7139 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 912..4193 product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333903.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 4290..5273 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124894.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 5296..6807 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493489.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 sequence228 source 1..7127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(633..2222) product type I restriction-modification system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene hsdM CDS complement(2299..5811) product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981385.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene hsdR CDS 5999..6913 product adenine/cytosine-specific restriction endonuclease Mrr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene mrr sequence229 source 1..7099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 149..1393 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211655.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene sstT CDS complement(1398..1949) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128138.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(2032..3519) product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199352.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene uxaA CDS complement(3534..4946) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene uxaC CDS 5429..6727 product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene exuT sequence230 source 1..7057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1056) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984517.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene htpX CDS complement(1248..3296) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055778.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene prc CDS complement(3316..4014) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene proQ CDS complement(4111..4608) product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299249.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene msrC CDS 4783..6021 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207283.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene yebS sequence231 source 1..6984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4561..6291) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 sequence232 source 1..6917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 899..1381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 1606..4872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 4869..5780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 sequence233 source 1..6815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1763..2776) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene dmpG CDS complement(2773..3723) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene mhpF CDS complement(3720..4529) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160710.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene mhpD CDS complement(4539..5405) product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene mhpC CDS complement(5423..6367) product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene mhpB sequence234 source 1..6795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(653..1882) product L-sorbose 1-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene sorE CDS complement(1934..2413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 note possible pseudo, frameshifted CDS complement(2299..2757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 note possible pseudo, frameshifted CDS complement(2768..3565) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(3631..4125) product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027849.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(4125..4532) product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245650.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(4542..5348) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(5418..6365) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 sequence235 source 1..6791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..656 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene iscR CDS 768..1982 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene iscS CDS 2010..2396 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene iscU CDS 2413..2736 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene iscA CDS 2832..3347 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384411.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene hscB CDS 3364..5214 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene hscA CDS 5216..5551 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124474.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene fdx CDS 5563..5763 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene iscX sequence236 source 1..6781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..1269 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406130.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene apbE CDS complement(1391..1609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 1646..2407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 2407..3057 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884942.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene alkB CDS 3133..4776 product microcin J25 efflux ABC transporter YojI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422182.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene yojI CDS 4994..6640 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758077.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene mqo sequence237 source 1..6781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000168712.1:L-threonine dehydrogenase locus_tag LOCUS_32340 CDS 735..2273 product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183976.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene aldB CDS complement(2492..2704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 2818..3141 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478193.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 3147..4283 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(4280..5254) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 5368..6108 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906819.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 sequence238 source 1..6759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(507..2381) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene htpG CDS complement(2491..3096) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene recR CDS complement(3096..3425) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(3478..5409) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122008.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene dnaX CDS complement(5538..6089) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene apt CDS complement(6242..6619) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 sequence239 source 1..6748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 868..1527 product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658652.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene cynT CDS 1612..2028 product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616241.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene cynS CDS 2061..3215 product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene cynX CDS complement(3318..3929) product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335915.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene lacA CDS complement(3995..5248) product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291549.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene lacY CDS complement(5300..6748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 sequence240 source 1..6711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(526..1539) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264365.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene tsaD CDS 1776..1991 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene rpsU CDS 2102..3847 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene dnaG CDS 4042..5883 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene rpoD CDS complement(5962..6468) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene mug tRNA 6593..6668 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 sequence241 source 1..6705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1010..2929 product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350505.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene dhaR CDS complement(3029..5896) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358436.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 sequence242 source 1..6697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 591..1640 product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692754.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene yahK CDS 1883..2698 product protein YahL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301260.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene yahL tRNA 3041..3121 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(3373..4044) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 4191..4466 product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene yahO CDS complement(4564..6150) product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941052.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene prpR sequence243 source 1..6691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1093 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705647.1:type VI secretion system contractile sheath large subunit locus_tag LOCUS_32650 CDS 1109..2446 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211664.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene tssK CDS 2443..3096 product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210015.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene tssL CDS 3099..4829 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158270.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 4835..5326 product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene hcp sequence244 source 1..6635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 34..1485 product F-type conjugal transfer pilus assembly protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene traB CDS 1475..2041 product conjugal transfer pilus-stabilizing protein TraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene traP CDS 2028..2348 product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315561.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 2341..2592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 2589..3104 product type IV conjugative transfer system lipoprotein TraV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809888.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene traV CDS 3239..3460 product conjugal transfer protein TraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278694.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene traR CDS 3453..3689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 note possible pseudo, internal stop codon CDS 3871..6501 product type IV secretion system protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069778.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene traC sequence245 source 1..6601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 368..1065 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctgacgcggggaac CDS complement(1173..1457) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378852.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene cas2e CDS complement(1459..2328) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene cas1e CDS complement(2392..2991) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281401.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene cas6e CDS complement(3655..4746) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064450.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene cas7e CDS complement(4759..5241) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene casB CDS complement(5234..6475) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050401.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene casA sequence246 source 1..6545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..654 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000484640.1:YhaC family protein note possible pseudo, frameshifted locus_tag LOCUS_32840 CDS complement(1656..2801) product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300387.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene garK CDS complement(2898..3797) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene garR CDS complement(3818..4588) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058227.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene garL CDS complement(4604..5938) product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene garP sequence247 source 1..6540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..583) product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291268.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene yieF CDS complement(605..1354) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190670.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(1511..2479) product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748502.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene yidZ CDS complement(2445..3620) product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085995.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene mdtL CDS complement(3753..5000) product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131911.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene tnaB CDS complement(5091..6506) product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene tnaA sequence248 source 1..6516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 482..1393 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene panE CDS 1356..1946 product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276309.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene yajL CDS complement(2000..3448) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene thiI CDS 3654..3896 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene xseB CDS 3896..4795 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347217.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene ispA sequence249 source 1..6513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(13..846) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419049.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene fghA CDS complement(939..2048) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene frmA CDS complement(2083..2358) product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene frmR CDS complement(2544..3317) product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596085.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(3319..3759) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088545487.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(3878..5074) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860444.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(5084..5755) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362029.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(6193..6417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 sequence250 source 1..6438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1708 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001186481.1:phenylacetic acid degradation bifunctional protein PaaZ locus_tag LOCUS_33080 CDS 1956..4229 product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535469.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene tynA CDS complement(4288..5787) product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138615.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene feaB sequence251 source 1..6435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1180..1761) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene yqiA CDS complement(1761..2588) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene cpdA CDS complement(2613..3035) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(3036..3665) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene nudF CDS 3870..5351 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene tolC CDS 5628..6170 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 sequence252 source 1..6368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..877 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene ulaG CDS 985..1740 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene ulaR CDS complement(1737..2486) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569714.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene yjfP CDS 2728..2997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 3146..3421 product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene yjfN CDS complement(3538..5163) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350567.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 misc_feature complement(5247..>6368) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000943963.1:glutathionylspermidine synthase family protein locus_tag LOCUS_33230 sequence253 source 1..6348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(352..1554) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192185.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene ubiI CDS complement(1577..2755) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111225.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene ubiH CDS complement(2752..4077) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene pepP CDS complement(4103..4681) product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene ygfB CDS 4849..5178 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene zapA CDS 5478..6026 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 sequence254 source 1..6310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 586..903 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493756.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 962..1258 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene nadS CDS complement(1289..2632) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene envZ CDS complement(2638..3357) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene ompR CDS 3585..4061 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene greB sequence255 source 1..6282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 597..875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644414.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(889..1203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 note possible pseudo, internal stop codon, frameshifted CDS complement(1409..1681) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303397.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(1826..2434) product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702307.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(2618..2935) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene metJ CDS 3212..4372 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene metB sequence256 source 1..6262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..493 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene panD CDS complement(497..1726) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277917.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(1790..2230) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901987.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(2335..3105) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(3102..4028) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 4137..4799 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene can CDS complement(4840..5376) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene hpt sequence257 source 1..6169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1049..2596) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111784.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene fdrA CDS complement(2586..3449) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310582.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(3489..4094) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023635.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 4352..4849 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013892.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 4941..5873 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084388.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 sequence258 source 1..6105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(715..1383) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene ftsE CDS complement(1386..2882) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040684.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene ftsY CDS 3032..3628 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene rsmD CDS 3618..3887 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295207.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(3890..4249) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042900.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 4390..5016 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 sequence259 source 1..6086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..837 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000578056.1:DEAD/DEAH box helicase locus_tag LOCUS_33600 CDS 962..1246 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494183.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene rplY CDS complement(1385..2392) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050789.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene yejK CDS 2574..2801 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 2821..4581 product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene yejM tRNA 4656..4732 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 sequence260 source 1..6077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 400..1077 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157548.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene fetA CDS 1064..1843 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene fetB CDS complement(1906..2760) product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene cnoX CDS complement(2821..3630) product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene ybbO CDS complement(3620..4276) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene tesA CDS 4214..4900 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 sequence261 source 1..6024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 483..923 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325907.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 1174..2160 product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981355.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 2209..3693 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447335.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 3686..4657 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818900.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 4654..5610 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750340.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 sequence262 source 1..5937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..884 product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene yeiL CDS complement(955..2184) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353878.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(2299..3237) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene psuG CDS complement(3225..4013) product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208134.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 note possible pseudo, internal stop codon misc_feature complement(4590..>5937) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000854472.1:PTS fructose transporter subunit IIBC locus_tag LOCUS_33800 sequence263 source 1..5917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..2099) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 2330..2647 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 2663..3931 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245438.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 3971..4306 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 4290..5735 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674121.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 sequence264 source 1..5901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..1388) product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148503.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene zraR CDS complement(1385..2761) product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211931.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene zraS CDS 2999..3424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(3426..4061) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299291.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(4134..4406) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene hupA CDS complement(4593..5183) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 misc_feature complement(5226..>5901) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000362388.1:deoxyribonuclease V locus_tag LOCUS_33920 sequence265 source 1..5833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..1654 product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069229.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene puuE CDS complement(1774..2751) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852835.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene pspF CDS 2918..3586 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511025.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene pspA CDS 3640..3864 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274963.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene pspB CDS 3864..4223 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907387.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene pspC CDS 4232..4453 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene pspD CDS 4528..4842 product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473109.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene pspE sequence266 source 1..5830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence267 source 1..5822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(14..439) product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene arsC CDS complement(452..1741) product arsenite/antimonite:H(+) antiporter ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922639.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene arsB CDS complement(1795..2148) product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008957.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene arsR CDS complement(2687..2860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004976829.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 2822..2971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(3025..4377) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160808.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene gorA CDS complement(4449..5291) product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954225.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene rlmJ sequence268 source 1..5812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(499..1575) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065024.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(1694..1852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 1883..3805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 4507..4929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 4926..5264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 sequence269 source 1..5800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..2042) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene recQ CDS complement(2169..3038) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene pldA CDS 3203..3670 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene yigI CDS 3722..4612 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339104.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene rarD CDS 5101..5481 product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032581.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 sequence270 source 1..5782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(535..1410) product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852686.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene cysW CDS complement(1410..2243) product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458406.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene cysT CDS complement(2243..3259) product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290236.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene cysP CDS complement(3563..4354) product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517443.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene ucpA CDS complement(4483..5340) product HTH-type transcriptional regulator MurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966443.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene murR sequence271 source 1..5771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(783..1328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(1392..1703) product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211280.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(1708..2667) product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686540.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(2744..5566) product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123463.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 sequence272 source 1..5762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(624..791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 note possible pseudo, internal stop codon CDS 1207..2478 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295225.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(2508..3512) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107012.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene dppF CDS complement(3509..4492) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene dppD CDS complement(4503..5405) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene dppC sequence273 source 1..5754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(328..1551) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene deoB CDS complement(1603..2925) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477811.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene deoA CDS complement(3052..3831) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene deoC CDS 4089..5639 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 sequence274 source 1..5735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1129..1734) product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene ttdB CDS complement(1731..2642) product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene ttdA CDS 2849..3781 product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene ttdR CDS complement(3794..4411) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene plsY CDS 4513..4884 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene folB sequence275 source 1..5718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 456..668 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene ybcJ CDS 776..1297 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143542.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(1333..2718) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912345.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene cysS CDS 2892..3386 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255997.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene ppiB CDS 3389..4111 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212237.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene lpxH CDS 4229..4738 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene purE sequence276 source 1..5705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1314..2654) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene dcuB CDS complement(3225..3944) product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene dcuR CDS complement(3941..5479) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(5436..5591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 sequence277 source 1..5704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1211..2458) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681219.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(2668..3366) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681221.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(3367..3969) product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666370.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(4046..4660) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(4572..4763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(4950..5177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(5292..5441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 sequence278 source 1..5692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 547..1482 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207503.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene rihA CDS 1566..3236 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene hscC CDS complement(3296..4747) product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene djlC CDS complement(4744..5451) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 sequence279 source 1..5670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..1555) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130850.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(1556..4633) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene mdtC misc_feature complement(4634..>5670) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001197857.1:multidrug efflux RND transporter permease subunit MdtB locus_tag LOCUS_34640 sequence280 source 1..5633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 965..1141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 1089..2126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 note possible pseudo, frameshifted CDS 2340..2558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(2619..3119) product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117611.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 3245..3415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(3583..4179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977995.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(4176..4895) product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276270.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(4892..5326) product conjugation system SOS inhibitor PsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845936.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene psiB CDS complement(5381..5632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 sequence281 source 1..5626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..1494 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043483.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene gndA CDS 1743..2909 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704855.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene ugd CDS 3056..4033 product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001553141.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene wzzB CDS complement(4129..4740) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954872.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene hisIE CDS complement(4734..5510) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene hisF sequence282 source 1..5602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(685..1224) product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916082.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene hyfH CDS complement(1234..2901) product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102321.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene hyfG CDS complement(2891..4471) product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene hyfF CDS complement(4476..5126) product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147991.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene hyfE sequence283 source 1..5584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 587..859 product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene rcnR CDS 1082..1870 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene thiM CDS 1867..2667 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822274.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene thiD CDS 2732..3550 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297420.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 3602..4348 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434038.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(4322..5287) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012008.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 sequence284 source 1..5557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 205..1290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 note possible pseudo, frameshifted CDS 1626..2603 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993114.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene glaH CDS 2623..3891 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271909.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene lhgO CDS 3914..5362 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772689.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene gabD sequence285 source 1..5513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(253..1062) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010115.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene rlmA CDS complement(1228..1437) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene cspE CDS complement(2262..2549) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006866.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 2926..3165 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(3308..4099) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262182.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene kdgR sequence286 source 1..5506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..2432 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene parC CDS 2665..3402 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene plsC CDS 3477..4889 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059395.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene ftsP sequence287 source 1..5486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..1178 product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853351.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene frlD CDS 1278..2009 product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene frlR CDS complement(2161..3246) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(3258..4433) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366832.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(4434..4562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 note possible pseudo, internal stop codon CDS complement(4574..4927) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719728.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 misc_feature complement(4938..>5486) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000006973.1:phosphotriesterase-related protein locus_tag LOCUS_35070 sequence288 source 1..5482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 518..1519 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567490.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene add CDS complement(1554..2594) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300538.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 3235..3450 product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene ydgT CDS 3536..3976 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214176.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 4053..4634 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene rsxA CDS 4634..5212 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991809.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene rsxB sequence289 source 1..5459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..2757 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005586.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene ppc CDS 2940..4673 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556273.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 sequence290 source 1..5447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000561872.1:ABC transporter permease locus_tag LOCUS_35160 CDS complement(1464..2558) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157938.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene mnmH CDS complement(2627..3553) product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460145.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene allS CDS 3783..4265 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene allA CDS 4343..5158 product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene allR sequence291 source 1..5442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..5183 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014640143.1:autotransporter outer membrane protein locus_tag LOCUS_35210 sequence292 source 1..5431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(770..1459) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene trmH CDS complement(1466..3574) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene spoT CDS complement(3593..3868) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene rpoZ CDS complement(3923..4546) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene gmk sequence293 source 1..5426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 468..1091 product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018003.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene nfeR CDS complement(1245..2765) product aerotaxis sensor receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094721.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene aer CDS 3273..4562 product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301395.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene ygjG CDS complement(4604..4936) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450594.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 sequence294 source 1..5422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1056..1739 product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene cusR CDS 1729..3177 product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253826.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene cusS sequence295 source 1..5398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1058..1801 product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798871.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene ybgI CDS 1824..2480 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene pxpB CDS 2474..3406 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912736.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene pxpC CDS 3396..4130 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687142.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene pxpA CDS 4166..4957 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114006.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene nei sequence296 source 1..5371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(853..1914) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272420.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(1911..2642) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143529.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(2657..5116) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316936.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 sequence297 source 1..5368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 817..1017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 1142..5044 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766976.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 sequence298 source 1..5364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(443..724) product type-F conjugative transfer system pilin chaperone TraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624107.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene traQ CDS complement(849..1592) product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030371.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene traF CDS complement(1585..1842) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864353.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(1869..3677) product type-F conjugative transfer system mating-pair stabilization protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821859.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene traN CDS complement(3674..4096) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149288330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(4121..4492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(4489..5130) product type-F conjugative transfer system pilin assembly protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080256.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene trbC sequence299 source 1..5363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1175..2518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247490.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(2666..4174) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018485.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene putP CDS complement(4333..4485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 sequence300 source 1..5297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1542 product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512372.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene eutH CDS 1539..2942 product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097464.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene eutA CDS 2954..4315 product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769961.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene eutB CDS 4336..5223 product ethanolamine ammonia-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372321.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene eutC sequence301 source 1..5282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1062..1958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 note possible pseudo, frameshifted CDS complement(1958..2494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 note possible pseudo, frameshifted CDS complement(2570..3517) product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 3806..4759 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679972.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 sequence302 source 1..5256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(661..1911) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444487.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene icd CDS 2203..2736 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248691.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene rluE CDS 2746..3207 product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476093.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene nudJ CDS 3216..4367 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297484.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 4403..5044 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene hflD sequence303 source 1..5253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(799..1977) product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene hybB CDS complement(1967..2953) product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene hybA CDS complement(2956..4074) product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene hybO CDS complement(4263..4550) product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059136.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene yghW CDS complement(4669..5253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 sequence304 source 1..5188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1056 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000138717.1:YcjF family protein locus_tag LOCUS_35710 CDS 1204..2745 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300658.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene tyrR CDS complement(2789..3295) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene tpx CDS 3414..4379 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324049.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene ycjG CDS complement(4354..5010) product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219122.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene mpaA sequence305 source 1..5175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 418..846 product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278505.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene uspG CDS complement(967..2532) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887629.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene ahpF CDS complement(2777..3340) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052796.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene ahpC CDS 3712..4458 product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913829.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene dsbG sequence306 source 1..5151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..669) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene yeiP CDS 824..1078 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389030.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(1075..2256) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551977.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene setB CDS 2624..3754 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487246.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene fruB CDS 3754..4692 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091263.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene fruK sequence307 source 1..5146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1169..1810 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295424.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene udk CDS 1902..2483 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234767.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene dcd CDS 2505..4358 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene asmA sequence308 source 1..5113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..2404) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066983.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene flhA CDS complement(2397..3545) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278954.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene flhB CDS complement(3752..4396) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene cheZ CDS complement(4407..4796) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763867.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene cheY sequence309 source 1..5093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 554..994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 1142..3145 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene betT CDS 3208..4485 product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 4733..5035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 sequence310 source 1..5060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1554..2885 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene pepQ CDS 2882..3499 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 3538..4989 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene trkH sequence311 source 1..5010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..1134) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene livG CDS complement(1131..2408) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803797.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene livM CDS complement(2405..3331) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene livH CDS complement(3379..4488) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene livK sequence312 source 1..5003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1274..1960) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223164.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 2596..3312 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene arcA CDS complement(3372..4724) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920350.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene creD sequence313 source 1..4980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..3160) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195009.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene gcvP CDS complement(3279..3668) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene gcvH CDS complement(3692..4786) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene gcvT sequence314 source 1..4951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(236..577) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(579..1457) product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204139.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(1423..3720) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(3771..4091) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 misc_feature complement(4106..>4951) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001004434.1:PTS fructose transporter subunit EIIC locus_tag LOCUS_36130 sequence315 source 1..4944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 310..1368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 note possible pseudo, internal stop codon sequence316 source 1..4931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1144..1308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 note possible pseudo, frameshifted CDS complement(1420..2109) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(2109..3665) product maltose/glucose-specific PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351184.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 3832..4656 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114712.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 sequence317 source 1..4904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1480..2070) product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123464.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene paaY CDS complement(2052..3002) product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039887.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene paaX CDS complement(3103..4416) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632280.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene paaF sequence318 source 1..4894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..1040 product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene tdcA CDS 1139..2128 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene tdcB CDS 2150..3481 product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107723.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene tdcC CDS 3507..4715 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene tdcD sequence319 source 1..4893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 472..1239 product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939375.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene tauB CDS 1236..2063 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene tauC CDS 2060..2911 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004024.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene tauD CDS complement(3017..3991) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene hemB sequence320 source 1..4871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 546..1076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 note possible pseudo, frameshifted CDS 1025..1483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 note possible pseudo, frameshifted CDS complement(1725..3137) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199325.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 3314..3478 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394276.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 sequence321 source 1..4851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(236..478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(977..2626) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene pgi CDS 3151..4500 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290310.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene lysC sequence322 source 1..4850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(557..799) product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241561.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene cedA CDS 1003..3264 product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077872.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene katE CDS complement(3522..4280) product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440442.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene chbG misc_feature complement(4293..>4850) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000078722.1:6-phospho-beta-glucosidase locus_tag LOCUS_36400 sequence323 source 1..4820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..693 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350523.1:L,D-transpeptidase locus_tag LOCUS_36410 tRNA complement(749..824) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 1151..2068 product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011462.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene nac CDS 2170..3120 product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011000.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene cbl tRNA complement(3158..3233) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 sequence324 source 1..4814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(240..1376) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239941.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene hemW CDS complement(1369..1962) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(1970..2260) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994920.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene yggU CDS complement(2257..2823) product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene yggT CDS complement(2841..3545) product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene yggS CDS 3563..4543 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349546.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 sequence325 source 1..4763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2246..3091 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene sseA CDS complement(3585..4361) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene sseB sequence326 source 1..4737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..824) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367023.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 989..1966 product Sel1 family TPR-like repeat protein YbeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605311.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene ybeQ CDS complement(2036..2518) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044880.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 sequence327 source 1..4677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..591 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001034469.1:lipoprotein metalloprotease SslE locus_tag LOCUS_36550 CDS 886..1548 product prepilin peptidase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001365924.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene pppA CDS 1656..2024 product type II secretion system pilot lipoprotein GspS-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324279.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene gspS2 CDS 2183..3001 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317325.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene gspC sequence328 source 1..4669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 43..2523 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945432.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 2539..3573 product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405711.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(3655..3993) product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153067.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene rcnB CDS complement(4212..4511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 sequence329 source 1..4632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 19..873 product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301486.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene gatY CDS 902..1057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 note possible pseudo, internal stop codon CDS 1076..2164 product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853883.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene gatZ CDS 2174..2626 product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182904.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene gatA CDS 2657..2941 product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823272.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene gatB CDS 2945..4300 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490679.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 sequence330 source 1..4625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 201..1625 product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040450.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene murP CDS 1642..2934 product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene pbp4b CDS complement(2992..3891) product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084590.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene yfeX CDS complement(3987..4562) product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 sequence331 source 1..4622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1026..1859 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303819.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 1927..3018 product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307621.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene lacI sequence332 source 1..4578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence333 source 1..4564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(340..1227) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566329.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 1360..2370 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023619.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 2390..3187 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762716.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 3213..3629 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140838.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 4148..4273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314467.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 sequence334 source 1..4560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1402 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000035619.1:DNA polymerase II locus_tag LOCUS_36800 CDS 1567..4473 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene rapA sequence335 source 1..4545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..486 product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224138.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene fumE CDS 483..1196 product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687768.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(1168..1845) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956868.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(1839..2516) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256969.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(2504..3211) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553215.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(3212..3790) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124312.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(3813..4244) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988693.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 sequence336 source 1..4542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 631..1404 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295627.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene zupT CDS complement(1462..1632) product protein YqiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469266.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene yqiD CDS complement(1894..2547) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene ribB CDS 2921..3211 product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222100.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene ubiK CDS 3495..4046 product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272153.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 sequence337 source 1..4539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(454..1497) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295485.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene selD CDS complement(1614..2165) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 2326..4182 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259830.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene sppA sequence338 source 1..4512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(349..424) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(431..505) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(622..706) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(715..790) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 1176..2102 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene coaA CDS complement(2131..3096) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654614.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene birA CDS complement(3093..4121) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016672.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene murB sequence339 source 1..4497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..614 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538176.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 722..1261 product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene dnaT CDS 1264..2001 product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene dnaC CDS 2050..2544 product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001385190.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene yjjA sequence340 source 1..4495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 741..1673 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883024.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene glsA CDS 1676..2968 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982172.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 3093..3500 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene cueR CDS complement(3501..3959) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 misc_feature complement(3956..>4495) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000904502.1:SPFH domain-containing protein locus_tag LOCUS_37080 sequence341 source 1..4462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1237..2493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 2490..3839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 4052..4366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 sequence342 source 1..4460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..844 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000228535.1:DNA-protecting protein DprA locus_tag LOCUS_37120 CDS 816..1289 product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460672.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene smg CDS 1318..1860 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129723.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 1865..2437 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297709.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene tsaC CDS 2442..3260 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451211.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene aroE CDS 3257..3514 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(3490..4044) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286216.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 sequence343 source 1..4457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..1214) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene rsmC CDS 1317..1730 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204018.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene holD CDS 1699..2145 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092460.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene rimI CDS 2160..2837 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870712.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene yjjG sequence344 source 1..4456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2046..2576 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene thpR CDS 2591..3295 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene sfsA CDS 3473..3928 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene dksA sequence345 source 1..4444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1646..2224 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene lpcA CDS 2430..3197 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333379.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(3168..3908) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene dpaA CDS complement(4154..4294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 sequence346 source 1..4422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(512..922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846713.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(938..1426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(1757..2827) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102643.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(2824..3729) product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203541.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 misc_feature complement(3726..>4422) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000544732.1:dynamin family protein locus_tag LOCUS_37340 sequence347 source 1..4343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(642..1637) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 1846..2370 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 2364..2867 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(2854..3156) product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189314.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene yhbQ CDS 3207..3650 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(3630..4148) product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene yhbO sequence348 source 1..4342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..657 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295303.1:adenosylmethionine--8-amino-7-oxononanoate transaminase locus_tag LOCUS_37410 CDS 716..1192 product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767389.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 1344..2627 product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091569.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 misc_feature complement(2861..>4342) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000593938.1:hydratase locus_tag LOCUS_37440 sequence349 source 1..4321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 18..992 product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199800.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene yajO CDS complement(1046..1555) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154044.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene pgpA CDS complement(1542..2519) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene thiL CDS complement(2597..3016) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene nusB CDS complement(3036..3506) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene ribE CDS complement(3595..4320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 sequence350 source 1..4318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1163..2515) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene rseP CDS complement(2527..3384) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene cdsA CDS complement(3397..4155) product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979579.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene ispU sequence351 source 1..4312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..1094) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(1152..1292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(1413..2012) product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(2163..2864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(2861..3649) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 misc_feature complement(3734..>4312) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291702.1:class I SAM-dependent methyltransferase locus_tag LOCUS_37590 sequence352 source 1..4305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 29..139 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(257..700) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236960.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 857..1786 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122789.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene metA CDS 2055..3656 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138870.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene aceB sequence353 source 1..4285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 756..1295 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026744.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 1372..2055 product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183040.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 2134..3120 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456357.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 sequence354 source 1..4279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..2585) product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871517.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene bglX sequence355 source 1..4275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 520..1167 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene gpmB CDS complement(1164..2033) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene robA CDS 2244..2717 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene creA CDS 2730..3419 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188679.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene creB sequence356 source 1..4256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..2146) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene ilvD CDS complement(2211..3140) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene ilvE CDS complement(3160..3423) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene ilvM misc_feature complement(3420..>4256) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001012613.1:acetolactate synthase 2 catalytic subunit locus_tag LOCUS_37740 sequence357 source 1..4229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..1773) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079698.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 2039..3445 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene fliD CDS 3470..3880 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270663.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene fliS sequence358 source 1..4219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..1139) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene lptG CDS complement(1139..2218) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene lptF CDS 2506..4017 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene pepA sequence359 source 1..4185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..778) product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483371.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene hdhA CDS complement(890..1918) product mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179510.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene malI CDS 2015..3607 product PTS maltose transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125609.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene malX sequence360 source 1..4142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..1036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 1039..1572 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902877.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(1601..2131) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902877.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 misc_feature complement(2132..>4142) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000216502.1:phage tail protein locus_tag LOCUS_37870 sequence361 source 1..4113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1377..2285 product glutamate/aspartate ABC transporter substrate-binding protein GltI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene gltI CDS 2455..3195 product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020944.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene gltJ CDS 3195..3869 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene gltK sequence362 source 1..4101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1155..2132) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633238.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene gspK CDS complement(2135..2734) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255040.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene gspJ CDS complement(2731..3102) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820125.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene gspI CDS complement(3099..3662) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115129.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene gspH sequence363 source 1..4087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 64..1551 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245699.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene amyA CDS complement(1585..1998) product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295642.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene yedD CDS 2185..3390 product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118897.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene yedE CDS 3387..3620 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene yedF sequence364 source 1..4067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1101..2105 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene argC CDS 2116..2889 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene argB sequence365 source 1..4043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 366..1724 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626688.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene murF CDS 1718..2800 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene mraY sequence366 source 1..4034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(724..1233) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300367.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene nudB CDS complement(1294..3066) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258662.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene aspS CDS 3376..3942 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891610.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 sequence367 source 1..3952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..934) product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602156.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(938..1912) product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103694.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene parM CDS complement(2152..2526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176570.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(2526..3158) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176595.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 sequence368 source 1..3952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..727 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295369.1:two-component system response regulator GlrR locus_tag LOCUS_38100 CDS 788..1126 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene glnB CDS complement(1171..2361) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene hmpA CDS 2689..3942 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene glyA sequence369 source 1..3929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..1224) product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001374632.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene ascG CDS 1493..2950 product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107859.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene ascF sequence370 source 1..3869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..1534) product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene cca CDS complement(1598..2218) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 2460..3761 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046281.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene ygiF sequence371 source 1..3840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..919 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861101.1:relaxase/mobilization nuclease domain-containing protein locus_tag LOCUS_38190 CDS 1031..1927 product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194812347.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(2044..2244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(2247..3191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 misc_feature complement(3195..>3840) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861107.1:YodL domain-containing protein locus_tag LOCUS_38230 sequence372 source 1..3838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..1486 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830156.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene dacD CDS 1604..2077 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105393.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene sbmC CDS 2275..3333 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200891.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 3505..3834 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450409.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 sequence373 source 1..3824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..1186) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 1319..1729 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871982.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(1691..2797) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 misc_feature complement(2808..>3824) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000070131.1:ABC transporter permease locus_tag LOCUS_38310 sequence374 source 1..3793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..1529 product IS110-like element ISDha10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461193.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 1815..2498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 2495..2932 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 3118..3696 product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 sequence375 source 1..3783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1502..2326 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene iclR sequence376 source 1..3757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 880..2316 product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078114.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene mdtQ CDS 2369..3130 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079517.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(3260..3757) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955285.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 sequence377 source 1..3746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..2032) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211913.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene cysJ CDS 2348..2713 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987944.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene queD sequence378 source 1..3708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1141..2898) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431834.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(2914..3381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 sequence379 source 1..3694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..1467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 1958..3205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 3284..3598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 sequence380 source 1..3628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2480..3127 product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113637.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene narP sequence381 source 1..3618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2317..3207) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene metF sequence382 source 1..3617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(514..1602) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074859.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(2288..3040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 note possible pseudo, internal stop codon sequence383 source 1..3617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 951..1334 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627807.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene grcA CDS complement(1390..1977) product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189207.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene eamB CDS 2080..2961 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386989.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 sequence384 source 1..3616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..417) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene trpR CDS complement(507..2444) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene sltY sequence385 source 1..3611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 941..2188 product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678969.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene mdtA sequence386 source 1..3610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..1600 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene cueO misc_feature complement(1802..>3610) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001349940.1:quinoprotein glucose dehydrogenase locus_tag LOCUS_38580 sequence387 source 1..3586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 747..959 product hemolysin expression modulator Hha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453331.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene hha CDS 1576..2145 product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220727.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 2183..2341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 2313..2696 product putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271022.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 2812..3105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 note possible pseudo, frameshifted sequence388 source 1..3585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1223) product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265083.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(1225..1497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917803.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(1466..1648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(1599..2720) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861734.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(2731..3324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 sequence389 source 1..3584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1972..2859) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767329.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene ribF CDS 3242..3505 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene rpsT sequence390 source 1..3576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..972 product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288389.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene alkA misc_feature complement(1011..>3576) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000043761.1:diguanylate cyclase locus_tag LOCUS_38720 sequence391 source 1..3529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1331) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295314.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene fepD CDS 1442..2692 product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041788.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene entS misc_feature complement(2696..>3529) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001234333.1:Fe2+-enterobactin ABC transporter substrate-binding protein locus_tag LOCUS_38750 sequence392 source 1..3518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence393 source 1..3512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(912..1556) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 1662..2630 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene serB sequence394 source 1..3508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..721) product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS 1139..1828 product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070694.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene paoA CDS 1825..2781 product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643328.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene paoB sequence395 source 1..3493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 182..1285 product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene gldA CDS 1560..2177 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(2204..3109) product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271242.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene yijE sequence396 source 1..3485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(824..1030) product gpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198149.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(1027..2952) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027223.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(2927..3472) product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867493.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 sequence397 source 1..3480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 990..1535 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973176.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene cobU CDS 1532..2275 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295633.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene cobS CDS 2287..3366 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193776.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene cobT sequence398 source 1..3469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(266..1141) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209017.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene nanK CDS complement(1138..1827) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(1875..3365) product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108459.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene nanT sequence399 source 1..3466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..935 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 1033..2424 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene selA sequence400 source 1..3465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..2008) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089077.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene betB CDS complement(2022..2609) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295527.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene betI sequence401 source 1..3438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..828 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000699727.1:colanic acid biosynthesis fucosyltransferase WcaI locus_tag LOCUS_38970 CDS 831..2267 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079285.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene cpsB sequence402 source 1..3400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(697..1410) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215861.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene qseG CDS complement(1575..2957) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311037.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene qseE sequence403 source 1..3392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 736..2124 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296740.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene sad CDS 2188..3114 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene glsB sequence404 source 1..3381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1359..2153) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555458.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(2143..3084) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 sequence405 source 1..3376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 note possible pseudo, internal stop codon CDS 649..1440 product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene lgoD note possible pseudo, internal stop codon CDS 1529..2581 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 2704..3300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 sequence406 source 1..3374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 767..1585 product bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213425.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene ybhA CDS complement(1586..2644) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891692.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene modC CDS complement(2647..3336) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604034.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene modB sequence407 source 1..3369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..766 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096433.1:type VI secretion system ATPase TssH locus_tag LOCUS_39120 CDS 763..1329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 sequence408 source 1..3357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1282..>3357) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000040458.1:nitrate reductase Z subunit alpha locus_tag LOCUS_39140 sequence409 source 1..3354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..982 product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene lpxP CDS complement(1474..2712) product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene alaC sequence410 source 1..3334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..974 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene truA CDS 1057..1716 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364335.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 1872..2786 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene accD sequence411 source 1..3312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..598 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000775779.1:beta-phosphoglucomutase locus_tag LOCUS_39200 CDS 612..1694 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057985.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 1739..2644 product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735257.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene ompG CDS complement(2755..3312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 sequence412 source 1..3300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 22..98 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 107..182 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(278..1117) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379245.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene hdfR CDS 1236..1574 product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene maoP CDS complement(1599..3119) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058964.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 sequence413 source 1..3246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(135..641) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079505.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(687..1187) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056491.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(1273..1452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(1838..2644) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443067.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene trpA misc_feature complement(2644..>3246) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000209521.1:tryptophan synthase subunit beta locus_tag LOCUS_39310 sequence414 source 1..3243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 142..3024 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence415 source 1..3238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1591..1791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(1815..2456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 misc_feature complement(2443..>3238) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096433.1:type VI secretion system ATPase TssH locus_tag LOCUS_39340 sequence416 source 1..3221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(257..2758) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174088.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene ptsP sequence417 source 1..3205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence418 source 1..3178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(662..2584) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208722.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 sequence419 source 1..3121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 729..1022 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 1066..2712 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene groL sequence420 source 1..3110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(960..2549) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187566.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene purH sequence421 source 1..3093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence422 source 1..3073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..1590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 note possible pseudo, frameshifted CDS complement(1603..2955) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469759.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 gene yegD sequence423 source 1..3072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(616..972) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 1123..1641 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429152.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(1688..2005) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 2089..2454 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 misc_feature complement(2502..>3072) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459352.1:heavy metal translocating P-type ATPase locus_tag LOCUS_39480 sequence424 source 1..3048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..751 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137873.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene baeR CDS 942..1274 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929408.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 1528..1779 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307279.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 1781..2077 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220181.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 sequence425 source 1..3032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 453..1697 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251348.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene lolE CDS 1726..2637 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291270.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene nagK sequence426 source 1..3014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001306920.1:helix-turn-helix domain-containing protein locus_tag LOCUS_39550 misc_feature complement(701..>3014) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000092539.1:inverse autotransporter adhesin FdeC locus_tag LOCUS_39560 sequence427 source 1..2990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 487..1326 product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654503.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene wcaA CDS 1329..1817 product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888740.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene wcaB sequence428 source 1..2981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..470) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene rpmE CDS 673..2871 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene priA sequence429 source 1..2979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1103..2032) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803351.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(2078..2902) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 sequence430 source 1..2978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..546) product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842944.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(533..958) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406000.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 1172..2041 product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102891.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene amiA CDS 2045..2944 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801365.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene hemF sequence431 source 1..2964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence432 source 1..2962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..543 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000857839.1:isocitrate lyase locus_tag LOCUS_39670 CDS 824..2560 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137214.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene aceK CDS complement(2529..2738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 note possible pseudo, internal stop codon, frameshifted sequence433 source 1..2960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence434 source 1..2919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence435 source 1..2896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1188..1838 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 1850..2473 product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094869.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene bglJ sequence436 source 1..2892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(978..1415) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene dtd CDS complement(1412..2284) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(2278..2877) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene yihX sequence437 source 1..2870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 450..1415 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987283.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene glpX CDS 1437..1946 product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224131.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene fumE CDS 1943..2656 product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687705.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 sequence438 source 1..2858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..1622) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219792.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene mpl CDS 1798..2796 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene fbp sequence439 source 1..2848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(1733..2014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133414.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(2088..2630) product DNA-packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453566.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 sequence440 source 1..2845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..643 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000746151.1:LPS assembly protein LptD locus_tag LOCUS_39830 CDS 696..1982 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 gene surA sequence441 source 1..2801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1656..2471 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200579.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene djlA sequence442 source 1..2799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..257 product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(406..1260) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene kdsA CDS complement(1296..2105) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257044.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 gene sirB1 CDS complement(2109..2501) product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200378.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene sirB2 CDS complement(2498..2797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39900 sequence443 source 1..2771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..801) product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047135.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(815..1864) product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393597.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(2211..2459) product protein Rem inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980994.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene rem sequence444 source 1..2769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..983 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255030.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene gspJ CDS 980..1942 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631650.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene gspK sequence445 source 1..2767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..655) product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202371.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(658..1593) product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202372.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene traN misc_feature complement(1627..>2767) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202373.1:conjugative transposon protein TraM locus_tag LOCUS_39980 sequence446 source 1..2765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(513..2231) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772887.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(2225..2659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 sequence447 source 1..2746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 635..901 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 gene sdhE CDS 882..1289 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(1329..1850) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene fldB sequence448 source 1..2746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..655) product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202371.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(658..1593) product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202372.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene traN misc_feature complement(1627..>2746) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202373.1:conjugative transposon protein TraM locus_tag LOCUS_40060 sequence449 source 1..2743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(353..727) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059892.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(802..1857) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene dinB CDS complement(1928..2386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 note possible pseudo, internal stop codon CDS complement(2396..2698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 note possible pseudo, internal stop codon sequence450 source 1..2741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 38..1330 product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202385.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 sequence451 source 1..2741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..627 product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 627..854 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752613.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 851..1708 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 sequence452 source 1..2698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1861..2163) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281009.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 sequence453 source 1..2653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1329 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000024951.1:ketol-acid reductoisomerase locus_tag LOCUS_40160 CDS complement(1416..1697) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene ppiC sequence454 source 1..2652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1203 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000980540.1:exodeoxyribonuclease I locus_tag LOCUS_40180 CDS complement(1246..1473) product thiosulfate utilization sulfurtransferase TsuB/YeeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985273.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene tsuB CDS complement(1487..2491) product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492324.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene tsuA sequence455 source 1..2641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 581..1531 product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661672.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 sequence456 source 1..2640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2365 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001390260.1:phage tail tape measure protein locus_tag LOCUS_40220 sequence457 source 1..2623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..915) product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216223.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 sequence458 source 1..2611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..1487 product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172876.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 1598..2518 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535959.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 sequence459 source 1..2610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1647..>2610) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001207905.1:nitrate/nitrite transporter NarU locus_tag LOCUS_40260 sequence460 source 1..2605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..1889 product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817023.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 2177..2422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125506.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 sequence461 source 1..2605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..1717) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428805.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene cmtA CDS complement(1745..2188) product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene cmtB sequence462 source 1..2581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(4..79) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(84..159) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(206..281) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(326..401) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 660..2075 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695655.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene gltX CDS complement(2127..2510) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826503.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 sequence463 source 1..2575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(90..449) product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140020.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(462..1511) product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265083.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 sequence464 source 1..2569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..614 product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482901.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene wzb sequence465 source 1..2568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1168 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000028114.1:melibiose:sodium transporter MelB locus_tag LOCUS_40360 CDS complement(1307..1936) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 misc_feature complement(2059..>2568) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066699.1:class I fumarate hydratase locus_tag LOCUS_40380 sequence466 source 1..2565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..950 product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140647.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene fepC CDS complement(947..1951) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096692.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene wzz(fepE) sequence467 source 1..2556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..592 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000701842.1:metalloprotease LoiP locus_tag LOCUS_40410 CDS complement(678..2240) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442530.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 sequence468 source 1..2548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 919..2196 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 sequence469 source 1..2547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..556 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000948348.1:conjugative transfer relaxase/helicase TraI locus_tag LOCUS_40440 CDS 576..1322 product conjugal transfer pilus acetylase TraX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205762.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene traX CDS 1381..2241 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704522.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 sequence470 source 1..2537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 545..1459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 sequence471 source 1..2524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 873..2099 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090644.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 sequence472 source 1..2513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(384..1229) product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187905.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene nhoA CDS 1402..1971 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085899.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(1968..2201) product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene pptA sequence473 source 1..2480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..1330) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835799.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene gltP CDS complement(1672..2268) product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812982.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene nrfG sequence474 source 1..2476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..712 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000183107.1:UDP-glucose--undecaprenyl-phosphate glucose-1-phosphate transferase locus_tag LOCUS_40550 CDS 714..2192 product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058456.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene wzxC sequence475 source 1..2471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1354..1581 product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450520.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene vapB CDS 1581..1979 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 sequence476 source 1..2470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1463..2341) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 gene glxR sequence477 source 1..2469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1050 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295426.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(1132..2031) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807362.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene yegS sequence478 source 1..2461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 31..474 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene holC sequence479 source 1..2460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(162..>2460) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000918155.1:bifunctional glycosyl transferase/transpeptidase locus_tag LOCUS_40630 sequence480 source 1..2457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1285..>2457) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000131044.1:choline BCCT transporter BetT locus_tag LOCUS_40640 sequence481 source 1..2457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence482 source 1..2454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..486 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839179.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 483..830 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612626.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 gene tnpB CDS 879..2417 product IS66-like element ISEc8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998048.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 sequence483 source 1..2447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1372 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001290706.1:assimilatory sulfite reductase (NADPH) hemoprotein subunit locus_tag LOCUS_40680 CDS 1447..2181 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039850.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene cysH sequence484 source 1..2433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(573..1070) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098939.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene tssB CDS 1577..1789 product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287796.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(1809..2042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124181.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 sequence485 source 1..2423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(527..1357) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928731.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene glpG CDS complement(1402..1728) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene glpE sequence486 source 1..2421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1276..>2421) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000096011.1:methionine synthase locus_tag LOCUS_40750 sequence487 source 1..2419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..1292) product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 sequence488 source 1..2401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..466) product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178671.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(478..819) product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190772.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(829..1869) product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228111.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 sequence489 source 1..2399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 420..659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 701..898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 825..1271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 1301..1759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 sequence490 source 1..2395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 833..1792 product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801832.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene aes misc_feature complement(1789..>2395) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250132.1:ferrochelatase locus_tag LOCUS_40850 sequence491 source 1..2394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1138 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000973083.1:acyl-CoA dehydrogenase FadE locus_tag LOCUS_40860 CDS complement(1181..1654) product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 gene ivy sequence492 source 1..2391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence493 source 1..2384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(688..885) product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772029.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(896..1387) product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976839.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(1384..1758) product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094433.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(1848..2216) product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012908802.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 sequence494 source 1..2382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..607 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250088.1:ferrochelatase locus_tag LOCUS_40920 CDS complement(582..1550) product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene aes sequence495 source 1..2379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2047 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000955860.1:phosphoenolpyruvate--protein phosphotransferase locus_tag LOCUS_40940 sequence496 source 1..2359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 80..961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(1054..1695) product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135066.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 misc_feature complement(1706..>2359) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001170162.1:asparaginase locus_tag LOCUS_40970 sequence497 source 1..2326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 959..1837 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300811.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene araC sequence498 source 1..2325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..1071) product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148641.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(1515..1727) product hemolysin expression modulator Hha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453331.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 gene hha sequence499 source 1..2319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 829..2025 product IS110-like element ISSfl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069413.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 sequence500 source 1..2313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..529) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126294.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(526..837) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(1011..1772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005000912.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(1797..2267) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132961.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 gene hycI sequence501 source 1..2311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(32..2044) product DNA-binding transcriptional regulator HyfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251508.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 gene hyfR sequence502 source 1..2310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..729 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000130686.1:tyrosine recombinase XerC locus_tag LOCUS_41070 CDS 729..1445 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene yigB sequence503 source 1..2301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..2059) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene ade sequence504 source 1..2297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1834..2061) product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene feoA sequence505 source 1..2296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(428..1384) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045450.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 misc_feature complement(1384..>2296) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000650337.1:cardiolipin synthase ClsB locus_tag LOCUS_41120 sequence506 source 1..2293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1255..2292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 sequence507 source 1..2272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence508 source 1..2271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 511..633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 657..2180 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189111.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 gene ltrA sequence509 source 1..2265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 552..1157 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295410.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene osmY CDS 1284..1445 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 sequence510 source 1..2259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1537..>2259) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000695479.1:alpha-glucosidase locus_tag LOCUS_41180 sequence511 source 1..2249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(464..1219) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201219.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene bioC misc_feature complement(1206..>2249) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000118818.1:8-amino-7-oxononanoate synthase locus_tag LOCUS_41200 sequence512 source 1..2208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1065 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350335.1:histidinol dehydrogenase locus_tag LOCUS_41210 CDS 1062..2132 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108941.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene hisC sequence513 source 1..2208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence514 source 1..2204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..1135 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 gene pstS CDS 1221..2180 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene pstC sequence515 source 1..2201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence516 source 1..2196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence517 source 1..2194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..956 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 sequence518 source 1..2191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..1201 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene rpoH sequence519 source 1..2186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..925 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000438591.1:mannonate dehydratase locus_tag LOCUS_41270 sequence520 source 1..2183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence521 source 1..2167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(329..706) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072317.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(709..984) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226307.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(974..1363) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096310.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 tRNA complement(1831..1905) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(1909..1984) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(1987..2063) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(2065..2140) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 sequence522 source 1..2162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence523 source 1..2153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..503) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene rplI CDS complement(545..772) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 gene rpsR CDS complement(1098..1493) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene rpsF CDS 1820..2095 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 sequence524 source 1..2152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(702..1292) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 gene hisH misc_feature complement(1292..>2152) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000080068.1:bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB locus_tag LOCUS_41370 sequence525 source 1..2128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(603..1133) product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene kefF CDS complement(1244..2128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 sequence526 source 1..2125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1176..2006) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497942.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 sequence527 source 1..2118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557473.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS complement(638..2044) product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096327.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 sequence528 source 1..2108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 707..1018 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182957.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene yqfB CDS 1182..1841 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 sequence529 source 1..2105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1337) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105504.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene rtcB sequence530 source 1..2104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249348.1:type II secretion system ATPase GspE locus_tag LOCUS_41460 sequence531 source 1..2102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence532 source 1..2068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 467..964 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene pncC sequence533 source 1..2063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..1201 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene carA sequence534 source 1..2062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 811..1047 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958091.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(1258..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 sequence535 source 1..2061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1030..1344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(1332..1892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41540 sequence536 source 1..2054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1301..>2054) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001194635.1:anthranilate synthase component I locus_tag LOCUS_41550 sequence537 source 1..2037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 41..469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 462..1784 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291471.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 sequence538 source 1..2026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..1599 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983893.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene trpCF sequence539 source 1..2010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(265..996) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756569.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene artJ CDS complement(1014..1814) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027205.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene artP sequence540 source 1..2004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..516 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000168475.1:acetolactate synthase large subunit locus_tag LOCUS_41610 CDS 520..810 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene ilvN CDS 885..1475 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 gene uhpA sequence541 source 1..2000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..559 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000952737.1:NAD-dependent protein deacylase locus_tag LOCUS_41640 CDS complement(678..1466) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713462.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(1463..1924) product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076376.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660