>Feature sequence001 145 1170 gene locus_tag LOCUS_00010 gene cytR 145 1170 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 protein_id gnl|my_center|LOCUS_00010 1367 2221 gene locus_tag LOCUS_00020 gene ftsN 1367 2221 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068828.1 protein_id gnl|my_center|LOCUS_00020 2314 2844 gene locus_tag LOCUS_00030 gene hslV 2314 2844 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 protein_id gnl|my_center|LOCUS_00030 2854 4185 gene locus_tag LOCUS_00040 gene hslU 2854 4185 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293341.1 protein_id gnl|my_center|LOCUS_00040 4240 5178 gene locus_tag LOCUS_00050 gene menA 4240 5178 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 protein_id gnl|my_center|LOCUS_00050 5271 5756 gene locus_tag LOCUS_00060 gene rraA 5271 5756 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 protein_id gnl|my_center|LOCUS_00060 6080 5841 gene locus_tag LOCUS_00070 gene zapB 6080 5841 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 protein_id gnl|my_center|LOCUS_00070 6512 7357 gene locus_tag LOCUS_00080 gene glpF 6512 7357 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 protein_id gnl|my_center|LOCUS_00080 7380 8888 gene locus_tag LOCUS_00090 gene glpK 7380 8888 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 protein_id gnl|my_center|LOCUS_00090 8894 10033 gene locus_tag LOCUS_00100 gene glpX 8894 10033 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 protein_id gnl|my_center|LOCUS_00100 10130 10876 gene locus_tag LOCUS_00110 gene fpr 10130 10876 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796332.1 protein_id gnl|my_center|LOCUS_00110 11309 10881 gene locus_tag LOCUS_00120 gene uspD 11309 10881 CDS product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 protein_id gnl|my_center|LOCUS_00120 11635 11336 gene locus_tag LOCUS_00130 11635 11336 CDS product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655986.1 protein_id gnl|my_center|LOCUS_00130 12287 11847 gene locus_tag LOCUS_00140 12287 11847 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 protein_id gnl|my_center|LOCUS_00140 12388 12987 gene locus_tag LOCUS_00150 12388 12987 CDS product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802226.1 protein_id gnl|my_center|LOCUS_00150 13095 13862 gene locus_tag LOCUS_00160 gene tpiA 13095 13862 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 protein_id gnl|my_center|LOCUS_00160 14672 13917 gene locus_tag LOCUS_00170 gene cdh 14672 13917 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708998.1 protein_id gnl|my_center|LOCUS_00170 15767 14778 gene locus_tag LOCUS_00180 gene sbp 15767 14778 CDS product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 protein_id gnl|my_center|LOCUS_00180 17049 16087 gene locus_tag LOCUS_00190 gene pfkA 17049 16087 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 protein_id gnl|my_center|LOCUS_00190 18132 17230 gene locus_tag LOCUS_00200 gene fieF 18132 17230 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076748.1 protein_id gnl|my_center|LOCUS_00200 18981 18340 gene locus_tag LOCUS_00210 18981 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20584 19421 gene locus_tag LOCUS_00220 20584 19421 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011760.1 protein_id gnl|my_center|LOCUS_00220 21063 20584 gene locus_tag LOCUS_00230 21063 20584 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980413.1 protein_id gnl|my_center|LOCUS_00230 23525 21078 gene locus_tag LOCUS_00240 23525 21078 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 protein_id gnl|my_center|LOCUS_00240 23945 23670 gene locus_tag LOCUS_00250 23945 23670 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619990.1 protein_id gnl|my_center|LOCUS_00250 24520 24002 gene locus_tag LOCUS_00260 24520 24002 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848874.1 protein_id gnl|my_center|LOCUS_00260 25723 24533 gene locus_tag LOCUS_00270 25723 24533 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046120.1 protein_id gnl|my_center|LOCUS_00270 26464 26054 gene locus_tag LOCUS_00280 26464 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28497 26464 gene locus_tag LOCUS_00290 28497 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29105 28494 gene locus_tag LOCUS_00300 29105 28494 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098785.1 protein_id gnl|my_center|LOCUS_00300 30006 29098 gene locus_tag LOCUS_00310 30006 29098 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 protein_id gnl|my_center|LOCUS_00310 30358 30011 gene locus_tag LOCUS_00320 30358 30011 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098787.1 protein_id gnl|my_center|LOCUS_00320 30990 30355 gene locus_tag LOCUS_00330 30990 30355 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619997.1 protein_id gnl|my_center|LOCUS_00330 31509 31057 gene locus_tag LOCUS_00340 31509 31057 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038100.1 protein_id gnl|my_center|LOCUS_00340 31969 31502 gene locus_tag LOCUS_00350 31969 31502 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 protein_id gnl|my_center|LOCUS_00350 32090 31932 gene locus_tag LOCUS_00360 32090 31932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32502 32077 gene locus_tag LOCUS_00370 32502 32077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 32915 32490 gene locus_tag LOCUS_00380 32915 32490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33427 32930 gene locus_tag LOCUS_00390 33427 32930 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229398.1 protein_id gnl|my_center|LOCUS_00390 33708 33427 gene locus_tag LOCUS_00400 33708 33427 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155240.1 protein_id gnl|my_center|LOCUS_00400 33915 33712 gene locus_tag LOCUS_00410 33915 33712 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868175.1 protein_id gnl|my_center|LOCUS_00410 34388 33915 gene locus_tag LOCUS_00420 34388 33915 CDS product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673523.1 protein_id gnl|my_center|LOCUS_00420 35272 34523 gene locus_tag LOCUS_00430 35272 34523 CDS product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059191.1 protein_id gnl|my_center|LOCUS_00430 36349 35276 gene locus_tag LOCUS_00440 36349 35276 CDS product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 protein_id gnl|my_center|LOCUS_00440 37262 36408 gene locus_tag LOCUS_00450 37262 36408 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216244.1 protein_id gnl|my_center|LOCUS_00450 37436 39208 gene locus_tag LOCUS_00460 37436 39208 CDS product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098422.1 protein_id gnl|my_center|LOCUS_00460 39208 40242 gene locus_tag LOCUS_00470 39208 40242 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049560050.1 protein_id gnl|my_center|LOCUS_00470 40455 40592 gene locus_tag LOCUS_00480 40455 40592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 40657 41778 gene locus_tag LOCUS_00490 40657 41778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 41768 42757 gene locus_tag LOCUS_00500 41768 42757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 43709 42765 gene locus_tag LOCUS_00510 43709 42765 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 protein_id gnl|my_center|LOCUS_00510 46187 43911 gene locus_tag LOCUS_00520 46187 43911 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816116.1 protein_id gnl|my_center|LOCUS_00520 46452 46177 gene locus_tag LOCUS_00530 46452 46177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 46673 46449 gene locus_tag LOCUS_00540 46673 46449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 46975 46676 gene locus_tag LOCUS_00550 46975 46676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 47199 46975 gene locus_tag LOCUS_00560 47199 46975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 47763 47263 gene locus_tag LOCUS_00570 47763 47263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 47930 47760 gene locus_tag LOCUS_00580 47930 47760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 48205 47933 gene locus_tag LOCUS_00590 48205 47933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 48342 48635 gene locus_tag LOCUS_00600 48342 48635 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815649.1 protein_id gnl|my_center|LOCUS_00600 48705 49685 gene locus_tag LOCUS_00610 48705 49685 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 protein_id gnl|my_center|LOCUS_00610 50372 49872 gene locus_tag LOCUS_00620 gene cpxP 50372 49872 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 protein_id gnl|my_center|LOCUS_00620 50522 51220 gene locus_tag LOCUS_00630 gene cpxR 50522 51220 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 protein_id gnl|my_center|LOCUS_00630 51217 52590 gene locus_tag LOCUS_00640 gene cpxA 51217 52590 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 protein_id gnl|my_center|LOCUS_00640 53370 52696 gene locus_tag LOCUS_00650 gene yiiM 53370 52696 CDS product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270260.1 protein_id gnl|my_center|LOCUS_00650 54502 53519 gene locus_tag LOCUS_00660 gene kdgT 54502 53519 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 protein_id gnl|my_center|LOCUS_00660 55382 54762 gene locus_tag LOCUS_00670 gene sodA 55382 54762 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 protein_id gnl|my_center|LOCUS_00670 55667 56701 gene locus_tag LOCUS_00680 gene rhaT 55667 56701 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063507.1 protein_id gnl|my_center|LOCUS_00680 57636 56698 gene locus_tag LOCUS_00690 gene rhaR 57636 56698 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297062.1 protein_id gnl|my_center|LOCUS_00690 58456 57620 gene locus_tag LOCUS_00700 gene rhaS 58456 57620 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 protein_id gnl|my_center|LOCUS_00700 58744 60213 gene locus_tag LOCUS_00710 gene rhaB 58744 60213 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144081.1 protein_id gnl|my_center|LOCUS_00710 60210 61469 gene locus_tag LOCUS_00720 gene rhaA 60210 61469 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325794.1 protein_id gnl|my_center|LOCUS_00720 61711 62535 gene locus_tag LOCUS_00730 gene rhaD 61711 62535 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 protein_id gnl|my_center|LOCUS_00730 62545 62859 gene locus_tag LOCUS_00740 gene rhaM 62545 62859 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619511.1 protein_id gnl|my_center|LOCUS_00740 63160 63606 gene locus_tag LOCUS_00750 63160 63606 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729595.1 protein_id gnl|my_center|LOCUS_00750 63617 65068 gene locus_tag LOCUS_00760 63617 65068 CDS product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 protein_id gnl|my_center|LOCUS_00760 65058 66128 gene locus_tag LOCUS_00770 65058 66128 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019472.1 protein_id gnl|my_center|LOCUS_00770 66128 67876 gene locus_tag LOCUS_00780 66128 67876 CDS product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931299.1 protein_id gnl|my_center|LOCUS_00780 68981 67926 gene locus_tag LOCUS_00790 68981 67926 CDS product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295677.1 protein_id gnl|my_center|LOCUS_00790 69967 69134 gene locus_tag LOCUS_00800 gene fdhD 69967 69134 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753617.1 protein_id gnl|my_center|LOCUS_00800 70161 73211 gene locus_tag LOCUS_00810 gene fdnG 70161 73211 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723259.1 transl_except (pos:70746..70748,aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_00810 73224 74126 gene locus_tag LOCUS_00820 gene fdoH 73224 74126 CDS product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 protein_id gnl|my_center|LOCUS_00820 74123 74758 gene locus_tag LOCUS_00830 gene fdoI 74123 74758 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence002 1809 871 gene locus_tag LOCUS_00840 1809 871 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080722.1 protein_id gnl|my_center|LOCUS_00840 2593 1829 gene locus_tag LOCUS_00850 2593 1829 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692123.1 protein_id gnl|my_center|LOCUS_00850 2909 3820 gene locus_tag LOCUS_00860 2909 3820 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284798.1 protein_id gnl|my_center|LOCUS_00860 5014 3863 gene locus_tag LOCUS_00870 5014 3863 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 protein_id gnl|my_center|LOCUS_00870 6623 5028 gene locus_tag LOCUS_00880 6623 5028 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805650.1 protein_id gnl|my_center|LOCUS_00880 7526 6768 gene locus_tag LOCUS_00890 gene aroD 7526 6768 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860201.1 protein_id gnl|my_center|LOCUS_00890 8423 7557 gene locus_tag LOCUS_00900 gene ydiB 8423 7557 CDS product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383469.1 protein_id gnl|my_center|LOCUS_00900 9700 8435 gene locus_tag LOCUS_00910 9700 8435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296106.1 protein_id gnl|my_center|LOCUS_00910 11132 9927 gene locus_tag LOCUS_00920 11132 9927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039066128.1 protein_id gnl|my_center|LOCUS_00920 11588 11232 gene locus_tag LOCUS_00930 11588 11232 CDS product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310864.1 protein_id gnl|my_center|LOCUS_00930 13129 12017 gene locus_tag LOCUS_00940 gene ydiK 13129 12017 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248636.1 protein_id gnl|my_center|LOCUS_00940 13518 16574 gene locus_tag LOCUS_00950 13518 16574 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612968.1 protein_id gnl|my_center|LOCUS_00950 16571 16981 gene locus_tag LOCUS_00960 gene menI 16571 16981 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637982.1 protein_id gnl|my_center|LOCUS_00960 17000 17269 gene locus_tag LOCUS_00970 17000 17269 CDS product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148762.1 protein_id gnl|my_center|LOCUS_00970 17817 18185 gene locus_tag LOCUS_00980 gene sufA 17817 18185 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367160.1 protein_id gnl|my_center|LOCUS_00980 18194 19681 gene locus_tag LOCUS_00990 gene sufB 18194 19681 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089364.1 protein_id gnl|my_center|LOCUS_00990 19691 20437 gene locus_tag LOCUS_01000 gene sufC 19691 20437 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948872.1 protein_id gnl|my_center|LOCUS_01000 20412 21683 gene locus_tag LOCUS_01010 gene sufD 20412 21683 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908012.1 protein_id gnl|my_center|LOCUS_01010 21680 22900 gene locus_tag LOCUS_01020 gene sufS 21680 22900 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144575.1 protein_id gnl|my_center|LOCUS_01020 22913 23329 gene locus_tag LOCUS_01030 gene sufE 22913 23329 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196530.1 protein_id gnl|my_center|LOCUS_01030 23478 24482 gene locus_tag LOCUS_01040 gene ldtE 23478 24482 CDS product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817098.1 protein_id gnl|my_center|LOCUS_01040 24781 24545 gene locus_tag LOCUS_01050 gene lpp 24781 24545 CDS product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648420.1 protein_id gnl|my_center|LOCUS_01050 26504 25092 gene locus_tag LOCUS_01060 gene pykF 26504 25092 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295403.1 protein_id gnl|my_center|LOCUS_01060 27061 27270 gene locus_tag LOCUS_01070 gene fumD 27061 27270 CDS product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528342.1 protein_id gnl|my_center|LOCUS_01070 27725 28351 gene locus_tag LOCUS_01080 27725 28351 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070230.1 protein_id gnl|my_center|LOCUS_01080 28372 30474 gene locus_tag LOCUS_01090 28372 30474 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 protein_id gnl|my_center|LOCUS_01090 30487 31125 gene locus_tag LOCUS_01100 30487 31125 CDS product YdhW family putative oxidoreductase system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001344535.1 protein_id gnl|my_center|LOCUS_01100 31303 31857 gene locus_tag LOCUS_01110 31303 31857 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001412436.1 protein_id gnl|my_center|LOCUS_01110 31854 32639 gene locus_tag LOCUS_01120 31854 32639 CDS product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069979.1 protein_id gnl|my_center|LOCUS_01120 32691 33455 gene locus_tag LOCUS_01130 gene ydhT 32691 33455 CDS product protein YdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587525.1 protein_id gnl|my_center|LOCUS_01130 35071 33467 gene locus_tag LOCUS_01140 35071 33467 CDS product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716922.1 protein_id gnl|my_center|LOCUS_01140 35502 35197 gene locus_tag LOCUS_01150 35502 35197 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212657.1 protein_id gnl|my_center|LOCUS_01150 35686 35610 gene locus_tag LOCUS_t00010 35686 35610 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 35767 35691 gene locus_tag LOCUS_t00020 35767 35691 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 36075 37331 gene locus_tag LOCUS_01160 36075 37331 CDS product AIDA repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534275.1 protein_id gnl|my_center|LOCUS_01160 38745 37372 gene locus_tag LOCUS_01170 gene mdtK 38745 37372 CDS product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174942.1 protein_id gnl|my_center|LOCUS_01170 38960 39601 gene locus_tag LOCUS_01180 gene ribE 38960 39601 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493947.1 protein_id gnl|my_center|LOCUS_01180 40789 39641 gene locus_tag LOCUS_01190 gene cfa 40789 39641 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098896.1 protein_id gnl|my_center|LOCUS_01190 42291 41080 gene locus_tag LOCUS_01200 gene punC 42291 41080 CDS product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182363.1 protein_id gnl|my_center|LOCUS_01200 42404 43336 gene locus_tag LOCUS_01210 gene punR 42404 43336 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269501.1 protein_id gnl|my_center|LOCUS_01210 44358 43333 gene locus_tag LOCUS_01220 gene purR 44358 43333 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 protein_id gnl|my_center|LOCUS_01220 44912 46081 gene locus_tag LOCUS_01230 44912 46081 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701040.1 protein_id gnl|my_center|LOCUS_01230 46897 46316 gene locus_tag LOCUS_01240 gene sodB 46897 46316 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 protein_id gnl|my_center|LOCUS_01240 47771 47025 gene locus_tag LOCUS_01250 gene mepH 47771 47025 CDS product peptidoglycan DD-endopeptidase MepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101193.1 protein_id gnl|my_center|LOCUS_01250 47728 47898 gene locus_tag LOCUS_01260 47728 47898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 47940 48092 gene locus_tag LOCUS_01270 47940 48092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 48174 48521 gene locus_tag LOCUS_01280 gene grxD 48174 48521 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 protein_id gnl|my_center|LOCUS_01280 53188 48572 gene locus_tag LOCUS_01290 53188 48572 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310858.1 protein_id gnl|my_center|LOCUS_01290 53928 53281 gene locus_tag LOCUS_01300 gene rnt 53928 53281 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282281.1 protein_id gnl|my_center|LOCUS_01300 54438 54031 gene locus_tag LOCUS_01310 gene gloA 54438 54031 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 protein_id gnl|my_center|LOCUS_01310 55616 54519 gene locus_tag LOCUS_01320 gene nemA 55616 54519 CDS product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 protein_id gnl|my_center|LOCUS_01320 56252 55653 gene locus_tag LOCUS_01330 gene nemR 56252 55653 CDS product DNA-binding transcriptional regulator NemR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032936.1 protein_id gnl|my_center|LOCUS_01330 56643 57539 gene locus_tag LOCUS_01340 56643 57539 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 protein_id gnl|my_center|LOCUS_01340 57620 58141 gene locus_tag LOCUS_01350 gene sodC 57620 58141 CDS product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296937.1 protein_id gnl|my_center|LOCUS_01350 60154 58142 gene locus_tag LOCUS_01360 60154 58142 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994280.1 protein_id gnl|my_center|LOCUS_01360 61011 60154 gene locus_tag LOCUS_01370 61011 60154 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296942.1 protein_id gnl|my_center|LOCUS_01370 61250 61014 gene locus_tag LOCUS_01380 61250 61014 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670998.1 protein_id gnl|my_center|LOCUS_01380 61451 61885 gene locus_tag LOCUS_01390 gene slyA 61451 61885 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296943.1 protein_id gnl|my_center|LOCUS_01390 62399 61932 gene locus_tag LOCUS_01400 gene slyB 62399 61932 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597196.1 protein_id gnl|my_center|LOCUS_01400 62673 63782 gene locus_tag LOCUS_01410 gene anmK 62673 63782 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835077.1 protein_id gnl|my_center|LOCUS_01410 63886 64209 gene locus_tag LOCUS_01420 gene mliC 63886 64209 CDS product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061968.1 protein_id gnl|my_center|LOCUS_01420 64268 64924 gene locus_tag LOCUS_01430 gene pdxH 64268 64924 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282313.1 protein_id gnl|my_center|LOCUS_01430 65053 66327 gene locus_tag LOCUS_01440 gene tyrS 65053 66327 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295400.1 protein_id gnl|my_center|LOCUS_01440 66389 67249 gene locus_tag LOCUS_01450 gene pdxY 66389 67249 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307229.1 protein_id gnl|my_center|LOCUS_01450 67898 67293 gene locus_tag LOCUS_01460 gene gstA 67898 67293 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765749.1 protein_id gnl|my_center|LOCUS_01460 69506 68004 gene locus_tag LOCUS_01470 gene dtpA 69506 68004 CDS product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100932.1 protein_id gnl|my_center|LOCUS_01470 70752 70117 gene locus_tag LOCUS_01480 gene nth 70752 70117 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 protein_id gnl|my_center|LOCUS_01480 71447 70752 gene locus_tag LOCUS_01490 gene rsxE 71447 70752 CDS product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289652.1 protein_id gnl|my_center|LOCUS_01490 72071 71451 gene locus_tag LOCUS_01500 gene rsxG 72071 71451 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920784.1 protein_id gnl|my_center|LOCUS_01500 73133 72075 gene locus_tag LOCUS_01510 gene rsxD 73133 72075 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231922.1 protein_id gnl|my_center|LOCUS_01510 <74491 73134 gene locus_tag LOCUS_01520 <74491 73134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000915678.1:electron transport complex subunit RsxC >Feature sequence003 <1 685 gene locus_tag LOCUS_01530 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000584565.1:bifunctional tetrahydrofolate synthase/dihydrofolate synthase 675 1337 gene locus_tag LOCUS_01540 gene dedD 675 1337 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146992.1 protein_id gnl|my_center|LOCUS_01540 1596 2084 gene locus_tag LOCUS_01550 gene cvpA 1596 2084 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262113.1 protein_id gnl|my_center|LOCUS_01550 2121 3638 gene locus_tag LOCUS_01560 gene purF 2121 3638 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334220.1 protein_id gnl|my_center|LOCUS_01560 3733 4302 gene locus_tag LOCUS_01570 gene ubiX 3733 4302 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825700.1 protein_id gnl|my_center|LOCUS_01570 4568 5350 gene locus_tag LOCUS_01580 gene argT 4568 5350 CDS product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748271.1 protein_id gnl|my_center|LOCUS_01580 5571 5801 gene locus_tag LOCUS_01590 5571 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01590 5837 6352 gene locus_tag LOCUS_01600 5837 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 6442 7128 gene locus_tag LOCUS_01610 gene hisQ 6442 7128 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965518.1 protein_id gnl|my_center|LOCUS_01610 7125 7841 gene locus_tag LOCUS_01620 7125 7841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569958.1 protein_id gnl|my_center|LOCUS_01620 7849 8622 gene locus_tag LOCUS_01630 gene hisP 7849 8622 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293612.1 protein_id gnl|my_center|LOCUS_01630 9038 9514 gene locus_tag LOCUS_01640 9038 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01640 9547 9708 gene locus_tag LOCUS_01650 9547 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01650 10649 9756 gene locus_tag LOCUS_01660 10649 9756 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 protein_id gnl|my_center|LOCUS_01660 11032 10670 gene locus_tag LOCUS_01670 gene folX 11032 10670 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 protein_id gnl|my_center|LOCUS_01670 11736 11089 gene locus_tag LOCUS_01680 gene yfcG 11736 11089 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566471.1 protein_id gnl|my_center|LOCUS_01680 11872 12516 gene locus_tag LOCUS_01690 gene yfcF 11872 12516 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042442.1 protein_id gnl|my_center|LOCUS_01690 12572 13123 gene locus_tag LOCUS_01700 gene yfcE 12572 13123 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 protein_id gnl|my_center|LOCUS_01700 13181 13723 gene locus_tag LOCUS_01710 gene yfcD 13181 13723 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437935.1 protein_id gnl|my_center|LOCUS_01710 15234 13756 gene locus_tag LOCUS_01720 gene yfcC 15234 13756 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274493.1 protein_id gnl|my_center|LOCUS_01720 17610 15466 gene locus_tag LOCUS_01730 gene pta 17610 15466 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086722.1 protein_id gnl|my_center|LOCUS_01730 18887 17685 gene locus_tag LOCUS_01740 gene ackA 18887 17685 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095707.1 protein_id gnl|my_center|LOCUS_01740 19226 19681 gene locus_tag LOCUS_01750 gene yfbV 19226 19681 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106627.1 protein_id gnl|my_center|LOCUS_01750 19764 20258 gene locus_tag LOCUS_01760 19764 20258 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426124.1 protein_id gnl|my_center|LOCUS_01760 20269 20919 gene locus_tag LOCUS_01770 gene hxpA 20269 20919 CDS product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203392.1 protein_id gnl|my_center|LOCUS_01770 21006 22838 gene locus_tag LOCUS_01780 21006 22838 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012899.1 protein_id gnl|my_center|LOCUS_01780 23496 22897 gene locus_tag LOCUS_01790 gene yfbR 23496 22897 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813859.1 protein_id gnl|my_center|LOCUS_01790 24797 23580 gene locus_tag LOCUS_01800 gene alaA 24797 23580 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074527.1 protein_id gnl|my_center|LOCUS_01800 25717 26655 gene locus_tag LOCUS_01810 gene lrhA 25717 26655 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622290.1 protein_id gnl|my_center|LOCUS_01810 27285 27728 gene locus_tag LOCUS_01820 gene nuoA 27285 27728 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062997.1 protein_id gnl|my_center|LOCUS_01820 27744 28406 gene locus_tag LOCUS_01830 gene nuoB 27744 28406 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386733.1 protein_id gnl|my_center|LOCUS_01830 28500 30302 gene locus_tag LOCUS_01840 gene nuoC 28500 30302 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247878.1 protein_id gnl|my_center|LOCUS_01840 30305 30805 gene locus_tag LOCUS_01850 gene nuoE 30305 30805 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545042.1 protein_id gnl|my_center|LOCUS_01850 30802 32139 gene locus_tag LOCUS_01860 gene nuoF 30802 32139 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789502.1 protein_id gnl|my_center|LOCUS_01860 32192 34918 gene locus_tag LOCUS_01870 gene nuoG 32192 34918 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640181.1 protein_id gnl|my_center|LOCUS_01870 34915 35892 gene locus_tag LOCUS_01880 gene nuoH 34915 35892 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118512.1 protein_id gnl|my_center|LOCUS_01880 35907 36449 gene locus_tag LOCUS_01890 gene nuoI 35907 36449 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 protein_id gnl|my_center|LOCUS_01890 36461 37015 gene locus_tag LOCUS_01900 gene nuoJ 36461 37015 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393511.1 protein_id gnl|my_center|LOCUS_01900 37012 37314 gene locus_tag LOCUS_01910 gene nuoK 37012 37314 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 protein_id gnl|my_center|LOCUS_01910 37311 39152 gene locus_tag LOCUS_01920 gene nuoL 37311 39152 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056618.1 protein_id gnl|my_center|LOCUS_01920 39316 40845 gene locus_tag LOCUS_01930 gene nuoM 39316 40845 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926441.1 protein_id gnl|my_center|LOCUS_01930 40852 42309 gene locus_tag LOCUS_01940 gene nuoN 40852 42309 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156701.1 protein_id gnl|my_center|LOCUS_01940 42879 42376 gene locus_tag LOCUS_01950 42879 42376 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525365.1 protein_id gnl|my_center|LOCUS_01950 45238 44000 gene locus_tag LOCUS_01960 gene elaD 45238 44000 CDS product deubiquitinase ElaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317231.1 protein_id gnl|my_center|LOCUS_01960 46324 45407 gene locus_tag LOCUS_01970 gene rbn 46324 45407 CDS product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817396.1 protein_id gnl|my_center|LOCUS_01970 46389 46850 gene locus_tag LOCUS_01980 46389 46850 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574091.1 protein_id gnl|my_center|LOCUS_01980 46905 47210 gene locus_tag LOCUS_01990 gene elaB 46905 47210 CDS product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070621.1 protein_id gnl|my_center|LOCUS_01990 47289 48584 gene locus_tag LOCUS_02000 gene menF 47289 48584 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191419.1 protein_id gnl|my_center|LOCUS_02000 48673 50343 gene locus_tag LOCUS_02010 gene menD 48673 50343 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295284.1 protein_id gnl|my_center|LOCUS_02010 50340 51098 gene locus_tag LOCUS_02020 gene menH 50340 51098 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600496.1 protein_id gnl|my_center|LOCUS_02020 51113 51970 gene locus_tag LOCUS_02030 gene menB 51113 51970 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639996.1 protein_id gnl|my_center|LOCUS_02030 51970 52932 gene locus_tag LOCUS_02040 gene menC 51970 52932 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255609.1 protein_id gnl|my_center|LOCUS_02040 52929 54284 gene locus_tag LOCUS_02050 gene menE 52929 54284 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577553.1 protein_id gnl|my_center|LOCUS_02050 54394 54660 gene locus_tag LOCUS_02060 gene pmrD 54394 54660 CDS product signal transduction protein PmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295285.1 protein_id gnl|my_center|LOCUS_02060 55040 54654 gene locus_tag LOCUS_02070 gene arnF 55040 54654 CDS product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523879.1 protein_id gnl|my_center|LOCUS_02070 55375 55040 gene locus_tag LOCUS_02080 gene arnE 55375 55040 CDS product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638031.1 protein_id gnl|my_center|LOCUS_02080 57024 55372 gene locus_tag LOCUS_02090 gene arnT 57024 55372 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844057.1 protein_id gnl|my_center|LOCUS_02090 57914 57024 gene locus_tag LOCUS_02100 gene arnD 57914 57024 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169728.1 protein_id gnl|my_center|LOCUS_02100 59893 57911 gene locus_tag LOCUS_02110 gene arnA 59893 57911 CDS product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860282.1 protein_id gnl|my_center|LOCUS_02110 60861 59893 gene locus_tag LOCUS_02120 gene arnC 60861 59893 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461657.1 protein_id gnl|my_center|LOCUS_02120 62004 60865 gene locus_tag LOCUS_02130 gene arnB 62004 60865 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807509.1 protein_id gnl|my_center|LOCUS_02130 62312 62914 gene locus_tag LOCUS_02140 gene ais 62312 62914 CDS product lipopolysaccharide core heptose(II)-phosphate phosphatase Ais inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306469.1 protein_id gnl|my_center|LOCUS_02140 63378 62953 gene locus_tag LOCUS_02150 gene nudI 63378 62953 CDS product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249884.1 protein_id gnl|my_center|LOCUS_02150 63658 64200 gene locus_tag LOCUS_02160 63658 64200 CDS product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717009.1 protein_id gnl|my_center|LOCUS_02160 64300 65502 gene locus_tag LOCUS_02170 64300 65502 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921621.1 protein_id gnl|my_center|LOCUS_02170 65722 66504 gene locus_tag LOCUS_02180 65722 66504 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894185.1 protein_id gnl|my_center|LOCUS_02180 66519 67724 gene locus_tag LOCUS_02190 gene rhmD 66519 67724 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319848.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence004 72 905 gene locus_tag LOCUS_02200 72 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 886 1038 gene locus_tag LOCUS_02210 886 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02210 1038 1985 gene locus_tag LOCUS_02220 1038 1985 CDS product YscQ/HrcQ family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303644.1 protein_id gnl|my_center|LOCUS_02220 1975 2640 gene locus_tag LOCUS_02230 1975 2640 CDS product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071545.1 protein_id gnl|my_center|LOCUS_02230 2650 2910 gene locus_tag LOCUS_02240 2650 2910 CDS product EscS/YscS/HrcS family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998122.1 protein_id gnl|my_center|LOCUS_02240 2912 3679 gene locus_tag LOCUS_02250 gene sctT 2912 3679 CDS product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390568.1 protein_id gnl|my_center|LOCUS_02250 3688 4149 gene locus_tag LOCUS_02260 3688 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02260 4088 4420 gene locus_tag LOCUS_02270 4088 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02270 4447 4809 gene locus_tag LOCUS_02280 4447 4809 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834139.1 protein_id gnl|my_center|LOCUS_02280 5164 4871 gene locus_tag LOCUS_02290 5164 4871 CDS product invasion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060557.1 protein_id gnl|my_center|LOCUS_02290 5666 5166 gene locus_tag LOCUS_02300 5666 5166 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195871.1 protein_id gnl|my_center|LOCUS_02300 5924 7105 gene locus_tag LOCUS_02310 5924 7105 CDS product PrgH/EprH family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001365813.1 protein_id gnl|my_center|LOCUS_02310 7119 7274 gene locus_tag LOCUS_02320 7119 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307375.1 protein_id gnl|my_center|LOCUS_02320 7451 7666 gene locus_tag LOCUS_02330 gene sctI 7451 7666 CDS product type III secretion system inner rod subunit SctI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566300.1 protein_id gnl|my_center|LOCUS_02330 7770 8441 gene locus_tag LOCUS_02340 7770 8441 CDS product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875234.1 protein_id gnl|my_center|LOCUS_02340 8457 9038 gene locus_tag LOCUS_02350 8457 9038 CDS product type III secretion apparatus protein OrgA/MxiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341846.1 protein_id gnl|my_center|LOCUS_02350 9304 9687 gene locus_tag LOCUS_02360 9304 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299900.1 protein_id gnl|my_center|LOCUS_02360 9909 10064 gene locus_tag LOCUS_02370 9909 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02370 10095 10541 gene locus_tag LOCUS_02380 10095 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 10960 10586 gene locus_tag LOCUS_02390 10960 10586 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315817.1 protein_id gnl|my_center|LOCUS_02390 11363 11145 gene locus_tag LOCUS_02400 gene ygeI 11363 11145 CDS product protein YgeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184091.1 protein_id gnl|my_center|LOCUS_02400 12907 11531 gene locus_tag LOCUS_02410 gene ygeH 12907 11531 CDS product HilA family transcriptional regulator YgeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362702.1 protein_id gnl|my_center|LOCUS_02410 13733 13242 gene locus_tag LOCUS_02420 13733 13242 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102786.1 protein_id gnl|my_center|LOCUS_02420 14448 14011 gene locus_tag LOCUS_02430 14448 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804528.1 protein_id gnl|my_center|LOCUS_02430 14642 15067 gene locus_tag LOCUS_02440 gene yqeK 14642 15067 CDS product protein YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350612.1 protein_id gnl|my_center|LOCUS_02440 15698 15216 gene locus_tag LOCUS_02450 gene yqeJ 15698 15216 CDS product protein YqeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568339.1 protein_id gnl|my_center|LOCUS_02450 16311 15691 gene locus_tag LOCUS_02460 16311 15691 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345937.1 protein_id gnl|my_center|LOCUS_02460 16621 16830 gene locus_tag LOCUS_02470 16621 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 17352 16834 gene locus_tag LOCUS_02480 17352 16834 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305805.1 protein_id gnl|my_center|LOCUS_02480 19155 17926 gene locus_tag LOCUS_02490 19155 17926 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065950.1 protein_id gnl|my_center|LOCUS_02490 19410 20591 gene locus_tag LOCUS_02500 19410 20591 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656030.1 protein_id gnl|my_center|LOCUS_02500 20878 21714 gene locus_tag LOCUS_02510 gene kduI 20878 21714 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_02510 21744 22505 gene locus_tag LOCUS_02520 gene kduD 21744 22505 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603518.1 protein_id gnl|my_center|LOCUS_02520 22880 24238 gene locus_tag LOCUS_02530 gene araE 22880 24238 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 protein_id gnl|my_center|LOCUS_02530 24367 25059 gene locus_tag LOCUS_02540 gene ygeA 24367 25059 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848664.1 protein_id gnl|my_center|LOCUS_02540 25981 25046 gene locus_tag LOCUS_02550 gene lysR 25981 25046 CDS product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741825.1 protein_id gnl|my_center|LOCUS_02550 26103 27365 gene locus_tag LOCUS_02560 gene lysA 26103 27365 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120711.1 protein_id gnl|my_center|LOCUS_02560 28403 27372 gene locus_tag LOCUS_02570 gene galR 28403 27372 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201048.1 protein_id gnl|my_center|LOCUS_02570 28989 31148 gene locus_tag LOCUS_02580 gene aas 28989 31148 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 protein_id gnl|my_center|LOCUS_02580 31141 32334 gene locus_tag LOCUS_02590 gene lplT 31141 32334 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004616.1 protein_id gnl|my_center|LOCUS_02590 33145 32366 gene locus_tag LOCUS_02600 33145 32366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02600 33406 33248 gene locus_tag LOCUS_02610 33406 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02610 33732 33514 gene locus_tag LOCUS_02620 gene ygdR 33732 33514 CDS product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 protein_id gnl|my_center|LOCUS_02620 34583 33870 gene locus_tag LOCUS_02630 34583 33870 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 protein_id gnl|my_center|LOCUS_02630 35341 34652 gene locus_tag LOCUS_02640 gene mutH 35341 34652 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082188.1 protein_id gnl|my_center|LOCUS_02640 36026 36556 gene locus_tag LOCUS_02650 gene rppH 36026 36556 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 protein_id gnl|my_center|LOCUS_02650 36569 38815 gene locus_tag LOCUS_02660 gene ptsP 36569 38815 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957914.1 protein_id gnl|my_center|LOCUS_02660 38966 39841 gene locus_tag LOCUS_02670 gene lgt 38966 39841 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 protein_id gnl|my_center|LOCUS_02670 39848 40642 gene locus_tag LOCUS_02680 gene thyA 39848 40642 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816253.1 protein_id gnl|my_center|LOCUS_02680 40827 41297 gene locus_tag LOCUS_02690 40827 41297 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_02690 41288 41851 gene locus_tag LOCUS_02700 41288 41851 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 protein_id gnl|my_center|LOCUS_02700 41848 42255 gene locus_tag LOCUS_02710 41848 42255 CDS product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078391.1 protein_id gnl|my_center|LOCUS_02710 42240 42563 gene locus_tag LOCUS_02720 42240 42563 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276476.1 protein_id gnl|my_center|LOCUS_02720 42576 45944 gene locus_tag LOCUS_02730 gene recC 42576 45944 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946938.1 protein_id gnl|my_center|LOCUS_02730 46120 49008 gene locus_tag LOCUS_02740 gene ptrA 46120 49008 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138152.1 protein_id gnl|my_center|LOCUS_02740 49001 52543 gene locus_tag LOCUS_02750 gene recB 49001 52543 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322794.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence005 1017 193 gene locus_tag LOCUS_02760 gene thiK 1017 193 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116580.1 protein_id gnl|my_center|LOCUS_02760 1639 998 gene locus_tag LOCUS_02770 gene lpoB 1639 998 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164439.1 protein_id gnl|my_center|LOCUS_02770 2030 1653 gene locus_tag LOCUS_02780 2030 1653 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225281.1 protein_id gnl|my_center|LOCUS_02780 2392 2033 gene locus_tag LOCUS_02790 gene hinT 2392 2033 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807125.1 protein_id gnl|my_center|LOCUS_02790 2726 4915 gene locus_tag LOCUS_02800 gene fhuE 2726 4915 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953450.1 protein_id gnl|my_center|LOCUS_02800 6408 4975 gene locus_tag LOCUS_02810 gene ptsG 6408 4975 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 protein_id gnl|my_center|LOCUS_02810 7500 6703 gene locus_tag LOCUS_02820 7500 6703 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 protein_id gnl|my_center|LOCUS_02820 8515 7511 gene locus_tag LOCUS_02830 gene holB 8515 7511 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267941.1 protein_id gnl|my_center|LOCUS_02830 9153 8512 gene locus_tag LOCUS_02840 gene tmk 9153 8512 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257000.1 protein_id gnl|my_center|LOCUS_02840 10165 9143 gene locus_tag LOCUS_02850 gene yceG 10165 9143 CDS product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756838.1 protein_id gnl|my_center|LOCUS_02850 10977 10168 gene locus_tag LOCUS_02860 gene pabC 10977 10168 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478702.1 protein_id gnl|my_center|LOCUS_02860 12338 11097 gene locus_tag LOCUS_02870 gene fabF 12338 11097 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044679.1 protein_id gnl|my_center|LOCUS_02870 12662 12426 gene locus_tag LOCUS_02880 gene acpP 12662 12426 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 protein_id gnl|my_center|LOCUS_02880 13607 12873 gene locus_tag LOCUS_02890 gene fabG 13607 12873 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 protein_id gnl|my_center|LOCUS_02890 14549 13620 gene locus_tag LOCUS_02900 gene fabD 14549 13620 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 protein_id gnl|my_center|LOCUS_02900 15518 14565 gene locus_tag LOCUS_02910 gene fabH 15518 14565 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 protein_id gnl|my_center|LOCUS_02910 16656 15586 gene locus_tag LOCUS_02920 gene plsX 16656 15586 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197578.1 protein_id gnl|my_center|LOCUS_02920 16910 16737 gene locus_tag LOCUS_02930 gene rpmF 16910 16737 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 protein_id gnl|my_center|LOCUS_02930 17483 16962 gene locus_tag LOCUS_02940 gene yceD 17483 16962 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 protein_id gnl|my_center|LOCUS_02940 17643 18266 gene locus_tag LOCUS_02950 gene yceF 17643 18266 CDS product 7-methyl-GTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974786.1 protein_id gnl|my_center|LOCUS_02950 19337 18378 gene locus_tag LOCUS_02960 gene rluC 19337 18378 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846343.1 protein_id gnl|my_center|LOCUS_02960 19910 23095 gene locus_tag LOCUS_02970 gene rne 19910 23095 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827370.1 protein_id gnl|my_center|LOCUS_02970 24244 23291 gene locus_tag LOCUS_02980 gene flgL 24244 23291 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212782.1 protein_id gnl|my_center|LOCUS_02980 25899 24256 gene locus_tag LOCUS_02990 gene flgK 25899 24256 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096479.1 protein_id gnl|my_center|LOCUS_02990 26906 25965 gene locus_tag LOCUS_03000 gene flgJ 26906 25965 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295441.1 protein_id gnl|my_center|LOCUS_03000 28006 26906 gene locus_tag LOCUS_03010 gene flgI 28006 26906 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589326.1 protein_id gnl|my_center|LOCUS_03010 28713 28015 gene locus_tag LOCUS_03020 gene flgH 28713 28015 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295442.1 protein_id gnl|my_center|LOCUS_03020 29548 28766 gene locus_tag LOCUS_03030 gene flgG 29548 28766 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_03030 30475 29720 gene locus_tag LOCUS_03040 gene flgF 30475 29720 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349316.1 protein_id gnl|my_center|LOCUS_03040 31700 30495 gene locus_tag LOCUS_03050 gene flgE 31700 30495 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885878.1 protein_id gnl|my_center|LOCUS_03050 32420 31725 gene locus_tag LOCUS_03060 gene flgD 32420 31725 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020486.1 protein_id gnl|my_center|LOCUS_03060 32836 32432 gene locus_tag LOCUS_03070 gene flgC 32836 32432 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196460.1 protein_id gnl|my_center|LOCUS_03070 33256 32840 gene locus_tag LOCUS_03080 gene flgB 33256 32840 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884702.1 protein_id gnl|my_center|LOCUS_03080 33412 34071 gene locus_tag LOCUS_03090 gene flgA 33412 34071 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955720.1 protein_id gnl|my_center|LOCUS_03090 34147 34440 gene locus_tag LOCUS_03100 gene flgM 34147 34440 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 protein_id gnl|my_center|LOCUS_03100 34445 34861 gene locus_tag LOCUS_03110 gene flgN 34445 34861 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197363.1 protein_id gnl|my_center|LOCUS_03110 36436 34901 gene locus_tag LOCUS_03120 gene murJ 36436 34901 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050672.1 protein_id gnl|my_center|LOCUS_03120 37469 36546 gene locus_tag LOCUS_03130 37469 36546 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 protein_id gnl|my_center|LOCUS_03130 38118 37471 gene locus_tag LOCUS_03140 38118 37471 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877116.1 protein_id gnl|my_center|LOCUS_03140 38713 38129 gene locus_tag LOCUS_03150 gene rimJ 38713 38129 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 protein_id gnl|my_center|LOCUS_03150 38949 40157 gene locus_tag LOCUS_03160 gene mdtH 38949 40157 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092206.1 protein_id gnl|my_center|LOCUS_03160 40221 40868 gene locus_tag LOCUS_03170 gene grxB 40221 40868 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780912.1 protein_id gnl|my_center|LOCUS_03170 41002 41562 gene locus_tag LOCUS_03180 41002 41562 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295443.1 protein_id gnl|my_center|LOCUS_03180 41794 42714 gene locus_tag LOCUS_03190 gene pyrC 41794 42714 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126564.1 protein_id gnl|my_center|LOCUS_03190 42788 43033 gene locus_tag LOCUS_03200 gene dinI 42788 43033 CDS product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217754.1 protein_id gnl|my_center|LOCUS_03200 43323 43577 gene locus_tag LOCUS_03210 gene bssS 43323 43577 CDS product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414437.1 protein_id gnl|my_center|LOCUS_03210 43692 44810 gene locus_tag LOCUS_03220 gene solA 43692 44810 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872815.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence006 1180 722 gene locus_tag LOCUS_03230 1180 722 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156255.1 protein_id gnl|my_center|LOCUS_03230 2086 1235 gene locus_tag LOCUS_03240 gene manZ 2086 1235 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228655.1 protein_id gnl|my_center|LOCUS_03240 2899 2099 gene locus_tag LOCUS_03250 gene manY 2899 2099 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 protein_id gnl|my_center|LOCUS_03250 3933 2962 gene locus_tag LOCUS_03260 gene manX 3933 2962 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 protein_id gnl|my_center|LOCUS_03260 4396 5958 gene locus_tag LOCUS_03270 gene yoaE 4396 5958 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 protein_id gnl|my_center|LOCUS_03270 7560 5962 gene locus_tag LOCUS_03280 7560 5962 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295494.1 protein_id gnl|my_center|LOCUS_03280 9055 7691 gene locus_tag LOCUS_03290 gene sdaA 9055 7691 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624298.1 protein_id gnl|my_center|LOCUS_03290 9817 9239 gene locus_tag LOCUS_03300 9817 9239 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456715.1 protein_id gnl|my_center|LOCUS_03300 11182 9821 gene locus_tag LOCUS_03310 gene pabB 11182 9821 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854972.1 protein_id gnl|my_center|LOCUS_03310 11256 11435 gene locus_tag LOCUS_03320 11256 11435 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 protein_id gnl|my_center|LOCUS_03320 11914 11555 gene locus_tag LOCUS_03330 11914 11555 CDS product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307845.1 protein_id gnl|my_center|LOCUS_03330 12623 12276 gene locus_tag LOCUS_03340 12623 12276 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310311.1 protein_id gnl|my_center|LOCUS_03340 12752 14662 gene locus_tag LOCUS_03350 12752 14662 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 protein_id gnl|my_center|LOCUS_03350 14720 15415 gene locus_tag LOCUS_03360 gene tsaB 14720 15415 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220966.1 protein_id gnl|my_center|LOCUS_03360 15455 16036 gene locus_tag LOCUS_03370 gene yeaY 15455 16036 CDS product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 protein_id gnl|my_center|LOCUS_03370 16175 17926 gene locus_tag LOCUS_03380 gene fadD 16175 17926 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954305.1 protein_id gnl|my_center|LOCUS_03380 17996 19123 gene locus_tag LOCUS_03390 gene rnd 17996 19123 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 protein_id gnl|my_center|LOCUS_03390 20142 19177 gene locus_tag LOCUS_03400 gene yeaX 20142 19177 CDS product carnitine monooxygenase subunit YeaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287026.1 protein_id gnl|my_center|LOCUS_03400 21322 20198 gene locus_tag LOCUS_03410 gene yeaW 21322 20198 CDS product carnitine monooxygenase subunit YeaW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067822.1 protein_id gnl|my_center|LOCUS_03410 22964 21354 gene locus_tag LOCUS_03420 gene yeaV 22964 21354 CDS product BCCT family transporter YeaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987525.1 protein_id gnl|my_center|LOCUS_03420 24300 23215 gene locus_tag LOCUS_03430 gene dmlA 24300 23215 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978495.1 protein_id gnl|my_center|LOCUS_03430 24403 25326 gene locus_tag LOCUS_03440 gene dmlR 24403 25326 CDS product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061575.1 protein_id gnl|my_center|LOCUS_03440 25453 26091 gene locus_tag LOCUS_03450 gene leuE 25453 26091 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457207.1 protein_id gnl|my_center|LOCUS_03450 26264 26623 gene locus_tag LOCUS_03460 gene yeaR 26264 26623 CDS product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939317.1 protein_id gnl|my_center|LOCUS_03460 26627 26809 gene locus_tag LOCUS_03470 26627 26809 CDS product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 protein_id gnl|my_center|LOCUS_03470 26957 27205 gene locus_tag LOCUS_03480 26957 27205 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 protein_id gnl|my_center|LOCUS_03480 28497 27472 gene locus_tag LOCUS_03490 gene dgcP 28497 27472 CDS product diguanylate cyclase DgcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306169.1 protein_id gnl|my_center|LOCUS_03490 28680 28934 gene locus_tag LOCUS_03500 gene yoaF 28680 28934 CDS product DUF333 domain-containing lipoprotein YoaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691930.1 protein_id gnl|my_center|LOCUS_03500 29303 28956 gene locus_tag LOCUS_03510 29303 28956 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297652.1 protein_id gnl|my_center|LOCUS_03510 30539 29358 gene locus_tag LOCUS_03520 gene nimT 30539 29358 CDS product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128490.1 protein_id gnl|my_center|LOCUS_03520 31023 31457 gene locus_tag LOCUS_03530 31023 31457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 31860 31414 gene locus_tag LOCUS_03540 31860 31414 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460707.1 protein_id gnl|my_center|LOCUS_03540 32638 32135 gene locus_tag LOCUS_03550 gene yeaK 32638 32135 CDS product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138052.1 protein_id gnl|my_center|LOCUS_03550 34171 32681 gene locus_tag LOCUS_03560 gene dgcJ 34171 32681 CDS product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766132.1 protein_id gnl|my_center|LOCUS_03560 35686 34352 gene locus_tag LOCUS_03570 35686 34352 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616411.1 protein_id gnl|my_center|LOCUS_03570 37257 35974 gene locus_tag LOCUS_03580 37257 35974 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219686.1 protein_id gnl|my_center|LOCUS_03580 39304 37370 gene locus_tag LOCUS_03590 gene yeaG 39304 37370 CDS product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019882.1 protein_id gnl|my_center|LOCUS_03590 39740 40486 gene locus_tag LOCUS_03600 gene mipA 39740 40486 CDS product scaffolding protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163771.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence007 829 83 gene locus_tag LOCUS_03610 829 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1214 1141 gene locus_tag LOCUS_t00030 1214 1141 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2048 1293 gene locus_tag LOCUS_03620 gene actS 2048 1293 CDS product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272558.1 protein_id gnl|my_center|LOCUS_03620 2463 4760 gene locus_tag LOCUS_03630 gene xdhA 2463 4760 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388150.1 protein_id gnl|my_center|LOCUS_03630 4771 5649 gene locus_tag LOCUS_03640 gene xdhB 4771 5649 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 protein_id gnl|my_center|LOCUS_03640 5646 6125 gene locus_tag LOCUS_03650 gene xdhC 5646 6125 CDS product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016605.1 protein_id gnl|my_center|LOCUS_03650 7943 6165 gene locus_tag LOCUS_03660 7943 6165 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417791.1 protein_id gnl|my_center|LOCUS_03660 8422 9609 gene locus_tag LOCUS_03670 gene ygeW 8422 9609 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 protein_id gnl|my_center|LOCUS_03670 9667 10863 gene locus_tag LOCUS_03680 gene dpaL 9667 10863 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 protein_id gnl|my_center|LOCUS_03680 10921 12132 gene locus_tag LOCUS_03690 10921 12132 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107125.1 protein_id gnl|my_center|LOCUS_03690 12185 13570 gene locus_tag LOCUS_03700 gene hyuA 12185 13570 CDS product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264452.1 protein_id gnl|my_center|LOCUS_03700 13618 14550 gene locus_tag LOCUS_03710 gene arcC 13618 14550 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_03710 16216 14591 gene locus_tag LOCUS_03720 gene yqeB 16216 14591 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020381.1 protein_id gnl|my_center|LOCUS_03720 16743 16264 gene locus_tag LOCUS_03730 16743 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 17137 17715 gene locus_tag LOCUS_03740 gene mocA 17137 17715 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272856.1 protein_id gnl|my_center|LOCUS_03740 18037 21135 gene locus_tag LOCUS_03750 gene ygfK 18037 21135 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 protein_id gnl|my_center|LOCUS_03750 21138 22466 gene locus_tag LOCUS_03760 gene ssnA 21138 22466 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906252.1 protein_id gnl|my_center|LOCUS_03760 22517 23296 gene locus_tag LOCUS_03770 gene ygfM 22517 23296 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 protein_id gnl|my_center|LOCUS_03770 23293 26163 gene locus_tag LOCUS_03780 23293 26163 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583611.1 protein_id gnl|my_center|LOCUS_03780 26328 27728 gene locus_tag LOCUS_03790 gene xanQ 26328 27728 CDS product xanthine/proton symporter XanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280192.1 protein_id gnl|my_center|LOCUS_03790 27746 29062 gene locus_tag LOCUS_03800 gene guaD 27746 29062 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295158.1 protein_id gnl|my_center|LOCUS_03800 29098 30465 gene locus_tag LOCUS_03810 gene ghxQ 29098 30465 CDS product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 protein_id gnl|my_center|LOCUS_03810 30989 30501 gene locus_tag LOCUS_03820 30989 30501 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 protein_id gnl|my_center|LOCUS_03820 32923 30989 gene locus_tag LOCUS_03830 gene ygfT 32923 30989 CDS product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322328.1 protein_id gnl|my_center|LOCUS_03830 33344 34792 gene locus_tag LOCUS_03840 gene uacT 33344 34792 CDS product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 protein_id gnl|my_center|LOCUS_03840 35042 35590 gene locus_tag LOCUS_03850 gene idi 35042 35590 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192814.1 protein_id gnl|my_center|LOCUS_03850 37150 35633 gene locus_tag LOCUS_03860 gene lysS 37150 35633 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 protein_id gnl|my_center|LOCUS_03860 38041 37160 gene locus_tag LOCUS_03870 gene prfB 38041 37160 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001701073.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03870 40082 38349 gene locus_tag LOCUS_03880 gene recJ 40082 38349 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813200.1 protein_id gnl|my_center|LOCUS_03880 40798 40088 gene locus_tag LOCUS_03890 gene dsbC 40798 40088 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715214.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence008 29 104 gene locus_tag LOCUS_t00040 29 104 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1276 560 gene locus_tag LOCUS_03900 1276 560 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532923.1 protein_id gnl|my_center|LOCUS_03900 3073 1619 gene locus_tag LOCUS_03910 gene amn 3073 1619 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060244.1 protein_id gnl|my_center|LOCUS_03910 4491 3175 gene locus_tag LOCUS_03920 gene shiA 4491 3175 CDS product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378575.1 protein_id gnl|my_center|LOCUS_03920 4806 5858 gene locus_tag LOCUS_03930 4806 5858 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480487.1 protein_id gnl|my_center|LOCUS_03930 6633 5986 gene locus_tag LOCUS_03940 6633 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03940 7944 6682 gene locus_tag LOCUS_03950 7944 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03950 8150 7980 gene locus_tag LOCUS_03960 8150 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03960 8805 8077 gene locus_tag LOCUS_03970 8805 8077 CDS product inverse autotransporter beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039786.1 protein_id gnl|my_center|LOCUS_03970 11498 9477 gene locus_tag LOCUS_03980 gene fyuA 11498 9477 CDS product siderophore yersiniabactin receptor FyuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784549.1 protein_id gnl|my_center|LOCUS_03980 13206 11629 gene locus_tag LOCUS_03990 gene ybtE 13206 11629 CDS product yersiniabactin biosynthesis salycil-AMP ligase YbtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088819.1 protein_id gnl|my_center|LOCUS_03990 14013 13210 gene locus_tag LOCUS_04000 gene ybtT 14013 13210 CDS product yersiniabactin biosynthesis thioesterase YbtT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194283.1 protein_id gnl|my_center|LOCUS_04000 15110 14010 gene locus_tag LOCUS_04010 gene ybtU 15110 14010 CDS product yersiniabactin biosynthesis oxidoreductase YbtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982870.1 protein_id gnl|my_center|LOCUS_04010 24598 15107 gene locus_tag LOCUS_04020 gene irp1 24598 15107 CDS product yersiniabactin polyketide synthase HMWP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212777.1 protein_id gnl|my_center|LOCUS_04020 30793 24686 gene locus_tag LOCUS_04030 gene irp2 30793 24686 CDS product yersiniabactin non-ribosomal peptide synthetase HMWP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212775.1 protein_id gnl|my_center|LOCUS_04030 31943 30984 gene locus_tag LOCUS_04040 gene ybtA 31943 30984 CDS product yersiniabactin transcriptional regulator YbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970688.1 protein_id gnl|my_center|LOCUS_04040 32200 33912 gene locus_tag LOCUS_04050 gene ybtP 32200 33912 CDS product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327262.1 protein_id gnl|my_center|LOCUS_04050 33899 35701 gene locus_tag LOCUS_04060 gene ybtQ 33899 35701 CDS product yersiniabactin ABC transporter ATP-binding/permease protein YbtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212761.1 protein_id gnl|my_center|LOCUS_04060 35694 36974 gene locus_tag LOCUS_04070 gene ybtX 35694 36974 CDS product yersiniabactin-associated zinc MFS transporter YbtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286281.1 protein_id gnl|my_center|LOCUS_04070 37002 38306 gene locus_tag LOCUS_04080 gene ybtS 37002 38306 CDS product yersiniabactin biosynthesis salicylate synthase Irp9/YbtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703042.1 protein_id gnl|my_center|LOCUS_04080 39543 38500 gene locus_tag LOCUS_04090 39543 38500 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060158.1 protein_id gnl|my_center|LOCUS_04090 39562 39789 gene locus_tag LOCUS_04100 39562 39789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence009 1005 40 gene locus_tag LOCUS_04110 gene iaaA 1005 40 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513761.1 protein_id gnl|my_center|LOCUS_04110 1209 2444 gene locus_tag LOCUS_04120 gene moeA 1209 2444 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397381.1 protein_id gnl|my_center|LOCUS_04120 2444 3193 gene locus_tag LOCUS_04130 gene moeB 2444 3193 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829250.1 protein_id gnl|my_center|LOCUS_04130 4034 3372 gene locus_tag LOCUS_04140 gene fsa 4034 3372 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336208.1 protein_id gnl|my_center|LOCUS_04140 4165 5064 gene locus_tag LOCUS_04150 4165 5064 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295295.1 protein_id gnl|my_center|LOCUS_04150 5070 7502 gene locus_tag LOCUS_04160 5070 7502 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209309.1 protein_id gnl|my_center|LOCUS_04160 7648 8463 gene locus_tag LOCUS_04170 gene ybiV 7648 8463 CDS product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114272.1 protein_id gnl|my_center|LOCUS_04170 8615 9880 gene locus_tag LOCUS_04180 8615 9880 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 protein_id gnl|my_center|LOCUS_04180 11713 10121 gene locus_tag LOCUS_04190 11713 10121 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961458.1 protein_id gnl|my_center|LOCUS_04190 11932 12852 gene locus_tag LOCUS_04200 gene ldtB 11932 12852 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056384.1 protein_id gnl|my_center|LOCUS_04200 14029 12911 gene locus_tag LOCUS_04210 14029 12911 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056442.1 protein_id gnl|my_center|LOCUS_04210 14493 14026 gene locus_tag LOCUS_04220 gene mntR 14493 14026 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 protein_id gnl|my_center|LOCUS_04220 14679 14807 gene locus_tag LOCUS_04230 gene mntS 14679 14807 CDS product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 protein_id gnl|my_center|LOCUS_04230 15079 16662 gene locus_tag LOCUS_04240 gene opgE 15079 16662 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054678.1 protein_id gnl|my_center|LOCUS_04240 17226 16711 gene locus_tag LOCUS_04250 gene ompX 17226 16711 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295296.1 protein_id gnl|my_center|LOCUS_04250 17579 18466 gene locus_tag LOCUS_04260 gene rhtA 17579 18466 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295297.1 protein_id gnl|my_center|LOCUS_04260 18765 19268 gene locus_tag LOCUS_04270 gene dps 18765 19268 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100800.1 protein_id gnl|my_center|LOCUS_04270 19672 20418 gene locus_tag LOCUS_04280 gene glnH 19672 20418 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 protein_id gnl|my_center|LOCUS_04280 20557 21216 gene locus_tag LOCUS_04290 gene glnP 20557 21216 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159065.1 protein_id gnl|my_center|LOCUS_04290 21213 21935 gene locus_tag LOCUS_04300 gene glnQ 21213 21935 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569083.1 protein_id gnl|my_center|LOCUS_04300 22196 24421 gene locus_tag LOCUS_04310 gene ybiO 22196 24421 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267253.1 protein_id gnl|my_center|LOCUS_04310 25344 24418 gene locus_tag LOCUS_04320 gene rlmF 25344 24418 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295299.1 protein_id gnl|my_center|LOCUS_04320 25620 25880 gene locus_tag LOCUS_04330 gene mcbA 25620 25880 CDS product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 protein_id gnl|my_center|LOCUS_04330 26145 28427 gene locus_tag LOCUS_04340 26145 28427 CDS product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000430057.1 protein_id gnl|my_center|LOCUS_04340 28469 29146 gene locus_tag LOCUS_04350 gene ybiX 28469 29146 CDS product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990177.1 protein_id gnl|my_center|LOCUS_04350 29220 29486 gene locus_tag LOCUS_04360 gene ybiI 29220 29486 CDS product C4-type zinc finger protein YbiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146343.1 protein_id gnl|my_center|LOCUS_04360 29751 30011 gene locus_tag LOCUS_04370 gene ybiJ 29751 30011 CDS product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849301.1 protein_id gnl|my_center|LOCUS_04370 31325 30240 gene locus_tag LOCUS_04380 gene hcxB 31325 30240 CDS product hydroxycarboxylate dehydrogenase HcXB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443530.1 protein_id gnl|my_center|LOCUS_04380 32428 31466 gene locus_tag LOCUS_04390 gene ybiB 32428 31466 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 protein_id gnl|my_center|LOCUS_04390 34606 32456 gene locus_tag LOCUS_04400 gene dinG 34606 32456 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340191.1 protein_id gnl|my_center|LOCUS_04400 34759 35208 gene locus_tag LOCUS_04410 gene ybiA 34759 35208 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145126.1 protein_id gnl|my_center|LOCUS_04410 36804 35440 gene locus_tag LOCUS_04420 gene rhlE 36804 35440 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007101.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence010 <1 594 gene locus_tag LOCUS_04430 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066639.1:class I fumarate hydratase 737 2140 gene locus_tag LOCUS_04440 gene fumC 737 2140 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099102.1 protein_id gnl|my_center|LOCUS_04440 3078 2137 gene locus_tag LOCUS_04450 gene tus 3078 2137 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135186.1 protein_id gnl|my_center|LOCUS_04450 4443 3142 gene locus_tag LOCUS_04460 gene rstB 4443 3142 CDS product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732487.1 protein_id gnl|my_center|LOCUS_04460 5166 4447 gene locus_tag LOCUS_04470 gene rstA 5166 4447 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092508.1 protein_id gnl|my_center|LOCUS_04470 5295 5630 gene locus_tag LOCUS_04480 5295 5630 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524868.1 protein_id gnl|my_center|LOCUS_04480 6349 5627 gene locus_tag LOCUS_04490 gene folM 6349 5627 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513673.1 protein_id gnl|my_center|LOCUS_04490 7768 6386 gene locus_tag LOCUS_04500 7768 6386 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412379.1 protein_id gnl|my_center|LOCUS_04500 8898 7954 gene locus_tag LOCUS_04510 gene ydgH 8898 7954 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769322.1 protein_id gnl|my_center|LOCUS_04510 9422 10954 gene locus_tag LOCUS_04520 gene pntA 9422 10954 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295398.1 protein_id gnl|my_center|LOCUS_04520 10965 12353 gene locus_tag LOCUS_04530 gene pntB 10965 12353 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014036.1 protein_id gnl|my_center|LOCUS_04530 13412 12378 gene locus_tag LOCUS_04540 gene tqsA 13412 12378 CDS product AI-2 transporter TqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118241.1 protein_id gnl|my_center|LOCUS_04540 13824 14189 gene locus_tag LOCUS_04550 gene mdtJ 13824 14189 CDS product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276149.1 protein_id gnl|my_center|LOCUS_04550 14176 14505 gene locus_tag LOCUS_04560 gene mdtI 14176 14505 CDS product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 protein_id gnl|my_center|LOCUS_04560 15365 14544 gene locus_tag LOCUS_04570 15365 14544 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260841.1 protein_id gnl|my_center|LOCUS_04570 15976 15641 gene locus_tag LOCUS_04580 gene asr 15976 15641 CDS product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743951.1 protein_id gnl|my_center|LOCUS_04580 17626 16373 gene locus_tag LOCUS_04590 17626 16373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091840.1 protein_id gnl|my_center|LOCUS_04590 17733 18626 gene locus_tag LOCUS_04600 17733 18626 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019530.1 protein_id gnl|my_center|LOCUS_04600 18761 19981 gene locus_tag LOCUS_04610 gene mlc 18761 19981 CDS product DNA-binding transcriptional repressor Mlc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225276.1 protein_id gnl|my_center|LOCUS_04610 20106 20801 gene locus_tag LOCUS_04620 gene bioD 20106 20801 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919231.1 protein_id gnl|my_center|LOCUS_04620 22010 20754 gene locus_tag LOCUS_04630 gene clcB 22010 20754 CDS product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302066.1 protein_id gnl|my_center|LOCUS_04630 22819 22205 gene locus_tag LOCUS_04640 gene dmsD 22819 22205 CDS product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148710.1 protein_id gnl|my_center|LOCUS_04640 23716 22862 gene locus_tag LOCUS_04650 23716 22862 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526503.1 protein_id gnl|my_center|LOCUS_04650 24335 23718 gene locus_tag LOCUS_04660 gene dmsB 24335 23718 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213028.1 protein_id gnl|my_center|LOCUS_04660 26772 24346 gene locus_tag LOCUS_04670 26772 24346 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340362.1 protein_id gnl|my_center|LOCUS_04670 29256 26830 gene locus_tag LOCUS_04680 29256 26830 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041650.1 protein_id gnl|my_center|LOCUS_04680 29760 29455 gene locus_tag LOCUS_04690 29760 29455 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295396.1 protein_id gnl|my_center|LOCUS_04690 29832 30578 gene locus_tag LOCUS_04700 29832 30578 CDS product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571976.1 protein_id gnl|my_center|LOCUS_04700 31141 30581 gene locus_tag LOCUS_04710 gene speG 31141 30581 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138584.1 protein_id gnl|my_center|LOCUS_04710 31517 31176 gene locus_tag LOCUS_04720 31517 31176 CDS product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705197.1 protein_id gnl|my_center|LOCUS_04720 31652 31978 gene locus_tag LOCUS_04730 31652 31978 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295395.1 protein_id gnl|my_center|LOCUS_04730 32015 32203 gene locus_tag LOCUS_04740 32015 32203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 32184 33398 gene locus_tag LOCUS_04750 gene rspA 32184 33398 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295394.1 protein_id gnl|my_center|LOCUS_04750 33410 34429 gene locus_tag LOCUS_04760 33410 34429 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836066.1 protein_id gnl|my_center|LOCUS_04760 34760 34617 gene locus_tag LOCUS_04770 34760 34617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence011 46 1872 gene locus_tag LOCUS_04780 gene recD 46 1872 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775955.1 protein_id gnl|my_center|LOCUS_04780 3265 1934 gene locus_tag LOCUS_04790 gene argA 3265 1934 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 protein_id gnl|my_center|LOCUS_04790 3497 4750 gene locus_tag LOCUS_04800 gene amiC 3497 4750 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 protein_id gnl|my_center|LOCUS_04800 4900 4824 gene locus_tag LOCUS_t00050 4900 4824 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5139 6206 gene locus_tag LOCUS_04810 gene mltA 5139 6206 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 protein_id gnl|my_center|LOCUS_04810 6445 7251 gene locus_tag LOCUS_04820 gene tcdA 6445 7251 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 protein_id gnl|my_center|LOCUS_04820 7745 7302 gene locus_tag LOCUS_04830 gene csdE 7745 7302 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184261.1 protein_id gnl|my_center|LOCUS_04830 8950 7745 gene locus_tag LOCUS_04840 gene csdA 8950 7745 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 protein_id gnl|my_center|LOCUS_04840 9142 9369 gene locus_tag LOCUS_04850 9142 9369 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 protein_id gnl|my_center|LOCUS_04850 9720 10637 gene locus_tag LOCUS_04860 gene gcvA 9720 10637 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 protein_id gnl|my_center|LOCUS_04860 10656 11051 gene locus_tag LOCUS_04870 10656 11051 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 protein_id gnl|my_center|LOCUS_04870 11044 12144 gene locus_tag LOCUS_04880 gene rlmM 11044 12144 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045525.1 protein_id gnl|my_center|LOCUS_04880 12919 12188 gene locus_tag LOCUS_04890 gene fucR 12919 12188 CDS product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 protein_id gnl|my_center|LOCUS_04890 13399 12977 gene locus_tag LOCUS_04900 gene fucU 13399 12977 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 protein_id gnl|my_center|LOCUS_04900 14819 13401 gene locus_tag LOCUS_04910 gene fucK 14819 13401 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 protein_id gnl|my_center|LOCUS_04910 16703 14928 gene locus_tag LOCUS_04920 gene fucI 16703 14928 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 protein_id gnl|my_center|LOCUS_04920 18052 16736 gene locus_tag LOCUS_04930 gene fucP 18052 16736 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528603.1 protein_id gnl|my_center|LOCUS_04930 18599 19246 gene locus_tag LOCUS_04940 gene fucA 18599 19246 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440781.1 protein_id gnl|my_center|LOCUS_04940 19274 20422 gene locus_tag LOCUS_04950 gene fucO 19274 20422 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_04950 21232 20477 gene locus_tag LOCUS_04960 gene xni 21232 20477 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 protein_id gnl|my_center|LOCUS_04960 22711 21344 gene locus_tag LOCUS_04970 gene sdaB 22711 21344 CDS product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626410.1 protein_id gnl|my_center|LOCUS_04970 24058 22769 gene locus_tag LOCUS_04980 gene sdaC 24058 22769 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 protein_id gnl|my_center|LOCUS_04980 25979 24615 gene locus_tag LOCUS_04990 gene ppnN 25979 24615 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 protein_id gnl|my_center|LOCUS_04990 26939 26091 gene locus_tag LOCUS_05000 gene queF 26939 26091 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100421.1 protein_id gnl|my_center|LOCUS_05000 27007 27552 gene locus_tag LOCUS_05010 gene syd 27007 27552 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 protein_id gnl|my_center|LOCUS_05010 28174 28503 gene locus_tag LOCUS_05020 28174 28503 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206995.1 protein_id gnl|my_center|LOCUS_05020 28503 29285 gene locus_tag LOCUS_05030 gene truC 28503 29285 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 protein_id gnl|my_center|LOCUS_05030 29303 29752 gene locus_tag LOCUS_05040 29303 29752 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807756.1 protein_id gnl|my_center|LOCUS_05040 30187 31539 gene locus_tag LOCUS_05050 gene gudP 30187 31539 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 protein_id gnl|my_center|LOCUS_05050 31541 32671 gene locus_tag LOCUS_05060 31541 32671 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05060 32734 32880 gene locus_tag LOCUS_05070 32734 32880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05070 >Feature sequence012 <1 1050 gene locus_tag LOCUS_05080 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001238899.1:DNA helicase Rep 2581 1097 gene locus_tag LOCUS_05090 gene gppA 2581 1097 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295254.1 protein_id gnl|my_center|LOCUS_05090 3982 2717 gene locus_tag LOCUS_05100 gene rhlB 3982 2717 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 protein_id gnl|my_center|LOCUS_05100 4113 4442 gene locus_tag LOCUS_05110 gene trxA 4113 4442 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 protein_id gnl|my_center|LOCUS_05110 4769 6028 gene locus_tag LOCUS_05120 gene rho 4769 6028 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 protein_id gnl|my_center|LOCUS_05120 6038 6256 gene locus_tag LOCUS_05130 6038 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127081.1 protein_id gnl|my_center|LOCUS_05130 6268 7371 gene locus_tag LOCUS_05140 gene wecA 6268 7371 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 protein_id gnl|my_center|LOCUS_05140 7383 8429 gene locus_tag LOCUS_05150 gene wzzE 7383 8429 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 protein_id gnl|my_center|LOCUS_05150 8485 9615 gene locus_tag LOCUS_05160 gene wecB 8485 9615 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866670.1 protein_id gnl|my_center|LOCUS_05160 9612 10874 gene locus_tag LOCUS_05170 gene wecC 9612 10874 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 protein_id gnl|my_center|LOCUS_05170 10874 11941 gene locus_tag LOCUS_05180 gene rffG 10874 11941 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226604.1 protein_id gnl|my_center|LOCUS_05180 11960 12841 gene locus_tag LOCUS_05190 gene rfbA 11960 12841 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676056.1 protein_id gnl|my_center|LOCUS_05190 12819 13493 gene locus_tag LOCUS_05200 gene rffC 12819 13493 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145183.1 protein_id gnl|my_center|LOCUS_05200 13498 14628 gene locus_tag LOCUS_05210 gene rffA 13498 14628 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612043.1 protein_id gnl|my_center|LOCUS_05210 14630 15880 gene locus_tag LOCUS_05220 gene wzxE 14630 15880 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050260.1 protein_id gnl|my_center|LOCUS_05220 15877 16956 gene locus_tag LOCUS_05230 gene rffT 15877 16956 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217240.1 protein_id gnl|my_center|LOCUS_05230 16953 18305 gene locus_tag LOCUS_05240 gene wzyE 16953 18305 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055129.1 protein_id gnl|my_center|LOCUS_05240 18308 19048 gene locus_tag LOCUS_05250 gene wecG 18308 19048 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 protein_id gnl|my_center|LOCUS_05250 19239 20624 gene locus_tag LOCUS_05260 19239 20624 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 protein_id gnl|my_center|LOCUS_05260 20727 20803 gene locus_tag LOCUS_t00060 20727 20803 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20862 20937 gene locus_tag LOCUS_t00070 20862 20937 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 20958 21044 gene locus_tag LOCUS_t00080 20958 21044 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21087 21163 gene locus_tag LOCUS_t00090 21087 21163 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21310 22545 gene locus_tag LOCUS_05270 21310 22545 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941543.1 protein_id gnl|my_center|LOCUS_05270 22790 22629 gene locus_tag LOCUS_05280 22790 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395859.1 protein_id gnl|my_center|LOCUS_05280 24665 23469 gene locus_tag LOCUS_05290 gene hemY 24665 23469 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 protein_id gnl|my_center|LOCUS_05290 25873 24668 gene locus_tag LOCUS_05300 gene hemX 25873 24668 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139013.1 protein_id gnl|my_center|LOCUS_05300 26635 25895 gene locus_tag LOCUS_05310 gene hemD 26635 25895 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026061.1 protein_id gnl|my_center|LOCUS_05310 27594 26632 gene locus_tag LOCUS_05320 gene hemC 27594 26632 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 protein_id gnl|my_center|LOCUS_05320 27960 30506 gene locus_tag LOCUS_05330 gene cyaA 27960 30506 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281680.1 protein_id gnl|my_center|LOCUS_05330 30866 30546 gene locus_tag LOCUS_05340 gene cyaY 30866 30546 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 protein_id gnl|my_center|LOCUS_05340 31329 31532 gene locus_tag LOCUS_05350 31329 31532 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799889.1 protein_id gnl|my_center|LOCUS_05350 31569 32393 gene locus_tag LOCUS_05360 gene dapF 31569 32393 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 protein_id gnl|my_center|LOCUS_05360 32390 33097 gene locus_tag LOCUS_05370 32390 33097 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812796.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence013 4335 5297 gene locus_tag LOCUS_05380 4335 5297 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 protein_id gnl|my_center|LOCUS_05380 5393 7729 gene locus_tag LOCUS_05390 gene arcB 5393 7729 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 protein_id gnl|my_center|LOCUS_05390 7959 8612 gene locus_tag LOCUS_05400 gene elbB 7959 8612 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299134.1 protein_id gnl|my_center|LOCUS_05400 8609 9337 gene locus_tag LOCUS_05410 gene mtgA 8609 9337 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 protein_id gnl|my_center|LOCUS_05410 9966 9334 gene locus_tag LOCUS_05420 gene yrbL 9966 9334 CDS product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 protein_id gnl|my_center|LOCUS_05420 10452 10180 gene locus_tag LOCUS_05430 gene npr 10452 10180 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 protein_id gnl|my_center|LOCUS_05430 11303 10449 gene locus_tag LOCUS_05440 gene rapZ 11303 10449 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 protein_id gnl|my_center|LOCUS_05440 11840 11349 gene locus_tag LOCUS_05450 gene ptsN 11840 11349 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 protein_id gnl|my_center|LOCUS_05450 12245 11958 gene locus_tag LOCUS_05460 gene hpf 12245 11958 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 protein_id gnl|my_center|LOCUS_05460 13701 12268 gene locus_tag LOCUS_05470 gene rpoN 13701 12268 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 protein_id gnl|my_center|LOCUS_05470 14474 13749 gene locus_tag LOCUS_05480 gene lptB 14474 13749 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 protein_id gnl|my_center|LOCUS_05480 15038 14481 gene locus_tag LOCUS_05490 gene lptA 15038 14481 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_05490 15582 15007 gene locus_tag LOCUS_05500 gene lptC 15582 15007 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 protein_id gnl|my_center|LOCUS_05500 16145 15579 gene locus_tag LOCUS_05510 gene kdsC 16145 15579 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030016.1 protein_id gnl|my_center|LOCUS_05510 17152 16166 gene locus_tag LOCUS_05520 gene kdsD 17152 16166 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 protein_id gnl|my_center|LOCUS_05520 18143 17166 gene locus_tag LOCUS_05530 18143 17166 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 protein_id gnl|my_center|LOCUS_05530 18353 19162 gene locus_tag LOCUS_05540 gene mlaF 18353 19162 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 protein_id gnl|my_center|LOCUS_05540 19170 19952 gene locus_tag LOCUS_05550 gene mlaE 19170 19952 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 protein_id gnl|my_center|LOCUS_05550 19957 20508 gene locus_tag LOCUS_05560 gene mlaD 19957 20508 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 protein_id gnl|my_center|LOCUS_05560 20527 21162 gene locus_tag LOCUS_05570 gene mlaC 20527 21162 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 protein_id gnl|my_center|LOCUS_05570 21162 21455 gene locus_tag LOCUS_05580 gene mlaB 21162 21455 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 protein_id gnl|my_center|LOCUS_05580 21600 21869 gene locus_tag LOCUS_05590 gene ibaG 21600 21869 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 protein_id gnl|my_center|LOCUS_05590 21924 23183 gene locus_tag LOCUS_05600 gene murA 21924 23183 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 protein_id gnl|my_center|LOCUS_05600 23509 23231 gene locus_tag LOCUS_05610 gene sfsB 23509 23231 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 protein_id gnl|my_center|LOCUS_05610 24708 23737 gene locus_tag LOCUS_05620 gene ispB 24708 23737 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 protein_id gnl|my_center|LOCUS_05620 24967 25278 gene locus_tag LOCUS_05630 gene rplU 24967 25278 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 protein_id gnl|my_center|LOCUS_05630 25299 25556 gene locus_tag LOCUS_05640 gene rpmA 25299 25556 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 protein_id gnl|my_center|LOCUS_05640 25683 26648 gene locus_tag LOCUS_05650 25683 26648 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 protein_id gnl|my_center|LOCUS_05650 26664 27836 gene locus_tag LOCUS_05660 gene cgtA 26664 27836 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673561.1 protein_id gnl|my_center|LOCUS_05660 29341 28022 gene locus_tag LOCUS_05670 gene dacB 29341 28022 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212651.1 protein_id gnl|my_center|LOCUS_05670 29703 30179 gene locus_tag LOCUS_05680 gene greA 29703 30179 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 protein_id gnl|my_center|LOCUS_05680 30628 30335 gene locus_tag LOCUS_05690 gene yhbY 30628 30335 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 protein_id gnl|my_center|LOCUS_05690 30754 31383 gene locus_tag LOCUS_05700 gene rlmE 30754 31383 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence014 1266 244 gene locus_tag LOCUS_05710 gene frlB 1266 244 CDS product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 protein_id gnl|my_center|LOCUS_05710 2624 1287 gene locus_tag LOCUS_05720 gene frlA 2624 1287 CDS product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 protein_id gnl|my_center|LOCUS_05720 3087 2920 gene locus_tag LOCUS_05730 3087 2920 CDS product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 protein_id gnl|my_center|LOCUS_05730 4707 3334 gene locus_tag LOCUS_05740 gene cysG 4707 3334 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 protein_id gnl|my_center|LOCUS_05740 5532 4726 gene locus_tag LOCUS_05750 gene nirC 5532 4726 CDS product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 protein_id gnl|my_center|LOCUS_05750 5985 5659 gene locus_tag LOCUS_05760 gene nirD 5985 5659 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 protein_id gnl|my_center|LOCUS_05760 8525 5982 gene locus_tag LOCUS_05770 gene nirB 8525 5982 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049213.1 protein_id gnl|my_center|LOCUS_05770 9968 8787 gene locus_tag LOCUS_05780 gene tsgA 9968 8787 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185232.1 protein_id gnl|my_center|LOCUS_05780 10239 10811 gene locus_tag LOCUS_05790 gene ppiA 10239 10811 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 protein_id gnl|my_center|LOCUS_05790 10916 11083 gene locus_tag LOCUS_05800 10916 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11073 11675 gene locus_tag LOCUS_05810 11073 11675 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280641.1 protein_id gnl|my_center|LOCUS_05810 11707 12270 gene locus_tag LOCUS_05820 gene pabA 11707 12270 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601848.1 protein_id gnl|my_center|LOCUS_05820 12356 13576 gene locus_tag LOCUS_05830 gene argD 12356 13576 CDS product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963819.1 protein_id gnl|my_center|LOCUS_05830 15646 13643 gene locus_tag LOCUS_05840 15646 13643 CDS product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 protein_id gnl|my_center|LOCUS_05840 16416 15784 gene locus_tag LOCUS_05850 gene crp 16416 15784 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 protein_id gnl|my_center|LOCUS_05850 16718 17122 gene locus_tag LOCUS_05860 16718 17122 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 protein_id gnl|my_center|LOCUS_05860 18046 17177 gene locus_tag LOCUS_05870 18046 17177 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 protein_id gnl|my_center|LOCUS_05870 18318 18100 gene locus_tag LOCUS_05880 18318 18100 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 protein_id gnl|my_center|LOCUS_05880 19334 18312 gene locus_tag LOCUS_05890 19334 18312 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057356.1 protein_id gnl|my_center|LOCUS_05890 21247 19334 gene locus_tag LOCUS_05900 21247 19334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 protein_id gnl|my_center|LOCUS_05900 21251 21457 gene locus_tag LOCUS_05910 21251 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 21378 21929 gene locus_tag LOCUS_05920 gene kefG 21378 21929 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 protein_id gnl|my_center|LOCUS_05920 21929 23734 gene locus_tag LOCUS_05930 gene kefB 21929 23734 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399122.1 protein_id gnl|my_center|LOCUS_05930 23744 23944 gene locus_tag LOCUS_05940 23744 23944 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 protein_id gnl|my_center|LOCUS_05940 24039 24629 gene locus_tag LOCUS_05950 gene slyD 24039 24629 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 protein_id gnl|my_center|LOCUS_05950 24896 24678 gene locus_tag LOCUS_05960 24896 24678 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 protein_id gnl|my_center|LOCUS_05960 25117 25929 gene locus_tag LOCUS_05970 gene fkpA 25117 25929 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838250.1 protein_id gnl|my_center|LOCUS_05970 26096 26818 gene locus_tag LOCUS_05980 26096 26818 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 protein_id gnl|my_center|LOCUS_05980 26818 27204 gene locus_tag LOCUS_05990 gene tusD 26818 27204 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209680.1 protein_id gnl|my_center|LOCUS_05990 27204 27563 gene locus_tag LOCUS_06000 gene tusC 27204 27563 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820714.1 protein_id gnl|my_center|LOCUS_06000 27571 27858 gene locus_tag LOCUS_06010 gene tusB 27571 27858 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 protein_id gnl|my_center|LOCUS_06010 27984 28358 gene locus_tag LOCUS_06020 gene rpsL 27984 28358 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 protein_id gnl|my_center|LOCUS_06020 28455 28925 gene locus_tag LOCUS_06030 gene rpsG 28455 28925 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 protein_id gnl|my_center|LOCUS_06030 29022 31136 gene locus_tag LOCUS_06040 gene fusA 29022 31136 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence015 <1 609 gene locus_tag LOCUS_06050 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001305927.1:30S ribosomal protein S12 methylthiotransferase accessory factor YcaO 1015 1872 gene locus_tag LOCUS_06060 gene focA 1015 1872 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642546.1 protein_id gnl|my_center|LOCUS_06060 1927 4209 gene locus_tag LOCUS_06070 gene pflB 1927 4209 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292822.1 protein_id gnl|my_center|LOCUS_06070 4401 5141 gene locus_tag LOCUS_06080 gene pflA 4401 5141 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111043.1 protein_id gnl|my_center|LOCUS_06080 5813 5223 gene locus_tag LOCUS_06090 5813 5223 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190363.1 protein_id gnl|my_center|LOCUS_06090 5913 6821 gene locus_tag LOCUS_06100 5913 6821 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242681.1 protein_id gnl|my_center|LOCUS_06100 8252 6822 gene locus_tag LOCUS_06110 8252 6822 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918506.1 protein_id gnl|my_center|LOCUS_06110 9610 8462 gene locus_tag LOCUS_06120 9610 8462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109295.1 protein_id gnl|my_center|LOCUS_06120 9925 10551 gene locus_tag LOCUS_06130 gene ycaC 9925 10551 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_06130 11449 10586 gene locus_tag LOCUS_06140 gene dmsC 11449 10586 CDS product dimethyl sulfoxide reductase anchor subunit DmsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534637.1 protein_id gnl|my_center|LOCUS_06140 12068 11451 gene locus_tag LOCUS_06150 gene dmsB 12068 11451 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 protein_id gnl|my_center|LOCUS_06150 14523 12079 gene locus_tag LOCUS_06160 gene dmsA 14523 12079 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850303.1 protein_id gnl|my_center|LOCUS_06160 16054 14762 gene locus_tag LOCUS_06170 gene serS 16054 14762 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886683.1 protein_id gnl|my_center|LOCUS_06170 17488 16145 gene locus_tag LOCUS_06180 gene rarA 17488 16145 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067740.1 protein_id gnl|my_center|LOCUS_06180 18113 17499 gene locus_tag LOCUS_06190 gene lolA 18113 17499 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 protein_id gnl|my_center|LOCUS_06190 22269 18265 gene locus_tag LOCUS_06200 22269 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 22898 22404 gene locus_tag LOCUS_06210 gene lrp 22898 22404 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 protein_id gnl|my_center|LOCUS_06210 23443 24408 gene locus_tag LOCUS_06220 gene trxB 23443 24408 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537418.1 protein_id gnl|my_center|LOCUS_06220 24531 26297 gene locus_tag LOCUS_06230 gene cydD 24531 26297 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043574.1 protein_id gnl|my_center|LOCUS_06230 26298 28019 gene locus_tag LOCUS_06240 gene cydC 26298 28019 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202195.1 protein_id gnl|my_center|LOCUS_06240 28061 28765 gene locus_tag LOCUS_06250 gene aat 28061 28765 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241678.1 protein_id gnl|my_center|LOCUS_06250 29050 29268 gene locus_tag LOCUS_06260 gene infA 29050 29268 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_06260 29522 29609 gene locus_tag LOCUS_t00100 29522 29609 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30969 29983 gene locus_tag LOCUS_06270 gene ycdU 30969 29983 CDS product protein YcdU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611859.1 protein_id gnl|my_center|LOCUS_06270 31325 30966 gene locus_tag LOCUS_06280 31325 30966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence016 112 900 gene locus_tag LOCUS_06290 gene fabI 112 900 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 protein_id gnl|my_center|LOCUS_06290 1044 2171 gene locus_tag LOCUS_06300 1044 2171 CDS product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335988.1 protein_id gnl|my_center|LOCUS_06300 2239 4173 gene locus_tag LOCUS_06310 gene rnb 2239 4173 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484984.1 protein_id gnl|my_center|LOCUS_06310 4495 6393 gene locus_tag LOCUS_06320 gene pdeR 4495 6393 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859953.1 protein_id gnl|my_center|LOCUS_06320 6541 6714 gene locus_tag LOCUS_06330 gene yciZ 6541 6714 CDS product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288368.1 protein_id gnl|my_center|LOCUS_06330 6804 7553 gene locus_tag LOCUS_06340 6804 7553 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088621.1 protein_id gnl|my_center|LOCUS_06340 7822 8040 gene locus_tag LOCUS_06350 gene osmB 7822 8040 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 protein_id gnl|my_center|LOCUS_06350 8492 8166 gene locus_tag LOCUS_06360 gene yciH 8492 8166 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 protein_id gnl|my_center|LOCUS_06360 9229 8492 gene locus_tag LOCUS_06370 gene pyrF 9229 8492 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176270.1 protein_id gnl|my_center|LOCUS_06370 10592 9423 gene locus_tag LOCUS_06380 gene lapB 10592 9423 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891353.1 protein_id gnl|my_center|LOCUS_06380 10907 10599 gene locus_tag LOCUS_06390 gene lapA 10907 10599 CDS product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876286.1 protein_id gnl|my_center|LOCUS_06390 11820 11056 gene locus_tag LOCUS_06400 gene pgpB 11820 11056 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256538.1 protein_id gnl|my_center|LOCUS_06400 11990 12580 gene locus_tag LOCUS_06410 gene ribA 11990 12580 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 protein_id gnl|my_center|LOCUS_06410 15319 12644 gene locus_tag LOCUS_06420 gene acnA 15319 12644 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099535.1 protein_id gnl|my_center|LOCUS_06420 15859 15692 gene locus_tag LOCUS_06430 15859 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446540.1 protein_id gnl|my_center|LOCUS_06430 15990 15862 gene locus_tag LOCUS_06440 15990 15862 CDS product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 protein_id gnl|my_center|LOCUS_06440 17295 16321 gene locus_tag LOCUS_06450 gene cysB 17295 16321 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776253.1 protein_id gnl|my_center|LOCUS_06450 20102 17505 gene locus_tag LOCUS_06460 gene topA 20102 17505 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295576.1 protein_id gnl|my_center|LOCUS_06460 20482 20733 gene locus_tag LOCUS_06470 20482 20733 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031530.1 protein_id gnl|my_center|LOCUS_06470 21818 20769 gene locus_tag LOCUS_06480 gene sohB 21818 20769 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422045.1 protein_id gnl|my_center|LOCUS_06480 22038 22796 gene locus_tag LOCUS_06490 22038 22796 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559268.1 protein_id gnl|my_center|LOCUS_06490 22793 23383 gene locus_tag LOCUS_06500 gene cobO 22793 23383 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 protein_id gnl|my_center|LOCUS_06500 24298 23423 gene locus_tag LOCUS_06510 gene rluB 24298 23423 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291216.1 protein_id gnl|my_center|LOCUS_06510 26404 24509 gene locus_tag LOCUS_06520 26404 24509 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326916.1 protein_id gnl|my_center|LOCUS_06520 27052 26432 gene locus_tag LOCUS_06530 27052 26432 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 protein_id gnl|my_center|LOCUS_06530 27930 27049 gene locus_tag LOCUS_06540 gene rnm 27930 27049 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285661.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence017 321 1331 gene locus_tag LOCUS_06550 gene ansA 321 1331 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_06550 3520 1637 gene locus_tag LOCUS_06560 3520 1637 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_06560 3976 3755 gene locus_tag LOCUS_06570 3976 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4390 4052 gene locus_tag LOCUS_06580 4390 4052 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_06580 5372 4620 gene locus_tag LOCUS_06590 5372 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5550 5936 gene locus_tag LOCUS_06600 5550 5936 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_06600 6088 5933 gene locus_tag LOCUS_06610 6088 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 6330 8009 gene locus_tag LOCUS_06620 6330 8009 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_06620 8109 8588 gene locus_tag LOCUS_06630 8109 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 8893 8729 gene locus_tag LOCUS_06640 8893 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 10337 8970 gene locus_tag LOCUS_06650 10337 8970 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_06650 10901 10991 gene locus_tag LOCUS_t00110 10901 10991 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12256 11081 gene locus_tag LOCUS_06660 12256 11081 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_06660 12593 12354 gene locus_tag LOCUS_06670 12593 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12852 12565 gene locus_tag LOCUS_06680 12852 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 13908 13075 gene locus_tag LOCUS_06690 13908 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 14927 13905 gene locus_tag LOCUS_06700 14927 13905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 15144 14908 gene locus_tag LOCUS_06710 15144 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 15830 15543 gene locus_tag LOCUS_06720 15830 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 16635 16468 gene locus_tag LOCUS_06730 16635 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 17111 17383 gene locus_tag LOCUS_06740 17111 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 18042 17323 gene locus_tag LOCUS_06750 18042 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 18326 18562 gene locus_tag LOCUS_06760 18326 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 19361 18645 gene locus_tag LOCUS_06770 19361 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 19528 19770 gene locus_tag LOCUS_06780 19528 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 20027 21319 gene locus_tag LOCUS_06790 gene ctpM 20027 21319 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_06790 21359 22117 gene locus_tag LOCUS_06800 21359 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 22196 22372 gene locus_tag LOCUS_06810 22196 22372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 22469 24085 gene locus_tag LOCUS_06820 22469 24085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673980.1 protein_id gnl|my_center|LOCUS_06820 24389 26275 gene locus_tag LOCUS_06830 24389 26275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 27562 26342 gene locus_tag LOCUS_06840 27562 26342 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_06840 28067 27780 gene locus_tag LOCUS_06850 28067 27780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 28499 28167 gene locus_tag LOCUS_06860 gene mobC 28499 28167 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence018 515 66 gene locus_tag LOCUS_06870 gene nrdR 515 66 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 protein_id gnl|my_center|LOCUS_06870 666 1205 gene locus_tag LOCUS_06880 666 1205 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314529.1 protein_id gnl|my_center|LOCUS_06880 1504 2388 gene locus_tag LOCUS_06890 gene tsx 1504 2388 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 protein_id gnl|my_center|LOCUS_06890 2912 2565 gene locus_tag LOCUS_06900 gene yajD 2912 2565 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 protein_id gnl|my_center|LOCUS_06900 4012 3041 gene locus_tag LOCUS_06910 gene secF 4012 3041 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 protein_id gnl|my_center|LOCUS_06910 5837 4023 gene locus_tag LOCUS_06920 gene secD 5837 4023 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 protein_id gnl|my_center|LOCUS_06920 6230 5898 gene locus_tag LOCUS_06930 gene yajC 6230 5898 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 protein_id gnl|my_center|LOCUS_06930 7380 6253 gene locus_tag LOCUS_06940 7380 6253 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 protein_id gnl|my_center|LOCUS_06940 8506 7436 gene locus_tag LOCUS_06950 8506 7436 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 protein_id gnl|my_center|LOCUS_06950 8599 9180 gene locus_tag LOCUS_06960 gene acpH 8599 9180 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009885.1 protein_id gnl|my_center|LOCUS_06960 11002 9185 gene locus_tag LOCUS_06970 gene malZ 11002 9185 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930752.1 protein_id gnl|my_center|LOCUS_06970 12531 11158 gene locus_tag LOCUS_06980 gene proY 12531 11158 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 protein_id gnl|my_center|LOCUS_06980 13926 12607 gene locus_tag LOCUS_06990 gene brnQ 13926 12607 CDS product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 protein_id gnl|my_center|LOCUS_06990 15628 14333 gene locus_tag LOCUS_07000 gene phoR 15628 14333 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893611.1 protein_id gnl|my_center|LOCUS_07000 16375 15686 gene locus_tag LOCUS_07010 gene phoB 16375 15686 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_07010 16565 17767 gene locus_tag LOCUS_07020 gene sbcD 16565 17767 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221319.1 protein_id gnl|my_center|LOCUS_07020 17764 20907 gene locus_tag LOCUS_07030 gene sbcC 17764 20907 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 protein_id gnl|my_center|LOCUS_07030 20949 22217 gene locus_tag LOCUS_07040 gene araJ 20949 22217 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 protein_id gnl|my_center|LOCUS_07040 23268 22360 gene locus_tag LOCUS_07050 gene mak 23268 22360 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 protein_id gnl|my_center|LOCUS_07050 23327 24304 gene locus_tag LOCUS_07060 gene rdgC 23327 24304 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298537.1 protein_id gnl|my_center|LOCUS_07060 24743 24462 gene locus_tag LOCUS_07070 24743 24462 CDS product DUF2773 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942006.1 protein_id gnl|my_center|LOCUS_07070 25236 24952 gene locus_tag LOCUS_07080 gene ppnP 25236 24952 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941942.1 protein_id gnl|my_center|LOCUS_07080 25985 25308 gene locus_tag LOCUS_07090 25985 25308 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 protein_id gnl|my_center|LOCUS_07090 26434 26243 gene locus_tag LOCUS_07100 gene yaiA 26434 26243 CDS product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 protein_id gnl|my_center|LOCUS_07100 26951 26484 gene locus_tag LOCUS_07110 gene aroL 26951 26484 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 protein_id gnl|my_center|LOCUS_07110 27649 27185 gene locus_tag LOCUS_07120 27649 27185 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 protein_id gnl|my_center|LOCUS_07120 27769 28578 gene locus_tag LOCUS_07130 gene proC 27769 28578 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence019 486 163 gene locus_tag LOCUS_07140 486 163 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_07140 657 1106 gene locus_tag LOCUS_07150 657 1106 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_07150 1168 1243 gene locus_tag LOCUS_t00120 1168 1243 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1397 1648 gene locus_tag LOCUS_07160 1397 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1918 1637 gene locus_tag LOCUS_07170 1918 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2938 2063 gene locus_tag LOCUS_07180 2938 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4486 2951 gene locus_tag LOCUS_07190 4486 2951 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_07190 4892 4458 gene locus_tag LOCUS_07200 4892 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7312 5525 gene locus_tag LOCUS_07210 gene yesM 7312 5525 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_07210 9339 7333 gene locus_tag LOCUS_07220 9339 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10255 9404 gene locus_tag LOCUS_07230 10255 9404 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 protein_id gnl|my_center|LOCUS_07230 11179 10268 gene locus_tag LOCUS_07240 11179 10268 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_07240 12607 11246 gene locus_tag LOCUS_07250 12607 11246 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_07250 14218 12758 gene locus_tag LOCUS_07260 14218 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 14572 15312 gene locus_tag LOCUS_07270 14572 15312 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963850.1 protein_id gnl|my_center|LOCUS_07270 15324 16853 gene locus_tag LOCUS_07280 15324 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 16955 17722 gene locus_tag LOCUS_07290 16955 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 17787 20804 gene locus_tag LOCUS_07300 17787 20804 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_07300 20978 22456 gene locus_tag LOCUS_07310 20978 22456 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_07310 23306 22506 gene locus_tag LOCUS_07320 23306 22506 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027182.1 protein_id gnl|my_center|LOCUS_07320 24080 23385 gene locus_tag LOCUS_07330 24080 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 24250 26022 gene locus_tag LOCUS_07340 24250 26022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949135.1 protein_id gnl|my_center|LOCUS_07340 26019 27761 gene locus_tag LOCUS_07350 26019 27761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949136.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence020 2139 1720 gene locus_tag LOCUS_07360 2139 1720 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 protein_id gnl|my_center|LOCUS_07360 3542 2160 gene locus_tag LOCUS_07370 gene atpD 3542 2160 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 protein_id gnl|my_center|LOCUS_07370 4432 3569 gene locus_tag LOCUS_07380 gene atpG 4432 3569 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 protein_id gnl|my_center|LOCUS_07380 6024 4483 gene locus_tag LOCUS_07390 gene atpA 6024 4483 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 protein_id gnl|my_center|LOCUS_07390 6570 6037 gene locus_tag LOCUS_07400 gene atpH 6570 6037 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 protein_id gnl|my_center|LOCUS_07400 7055 6585 gene locus_tag LOCUS_07410 gene atpF 7055 6585 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 protein_id gnl|my_center|LOCUS_07410 7356 7117 gene locus_tag LOCUS_07420 gene atpE 7356 7117 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_07420 8218 7403 gene locus_tag LOCUS_07430 gene atpB 8218 7403 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 protein_id gnl|my_center|LOCUS_07430 8619 8227 gene locus_tag LOCUS_07440 gene atpI 8619 8227 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 protein_id gnl|my_center|LOCUS_07440 9847 9224 gene locus_tag LOCUS_07450 gene rsmG 9847 9224 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 protein_id gnl|my_center|LOCUS_07450 11800 9911 gene locus_tag LOCUS_07460 gene mnmG 11800 9911 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 protein_id gnl|my_center|LOCUS_07460 12622 12179 gene locus_tag LOCUS_07470 gene mioC 12622 12179 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763724.1 protein_id gnl|my_center|LOCUS_07470 13170 12712 gene locus_tag LOCUS_07480 gene asnC 13170 12712 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 protein_id gnl|my_center|LOCUS_07480 13322 14314 gene locus_tag LOCUS_07490 gene asnA 13322 14314 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845104.1 protein_id gnl|my_center|LOCUS_07490 15770 14319 gene locus_tag LOCUS_07500 gene viaA 15770 14319 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956642.1 protein_id gnl|my_center|LOCUS_07500 17260 15764 gene locus_tag LOCUS_07510 gene ravA 17260 15764 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299914.1 protein_id gnl|my_center|LOCUS_07510 17483 19351 gene locus_tag LOCUS_07520 gene kup 17483 19351 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 protein_id gnl|my_center|LOCUS_07520 19518 19937 gene locus_tag LOCUS_07530 gene rbsD 19518 19937 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 protein_id gnl|my_center|LOCUS_07530 19945 21450 gene locus_tag LOCUS_07540 gene rbsA 19945 21450 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387770.1 protein_id gnl|my_center|LOCUS_07540 21455 22420 gene locus_tag LOCUS_07550 gene rbsC 21455 22420 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 protein_id gnl|my_center|LOCUS_07550 22445 23335 gene locus_tag LOCUS_07560 gene rbsB 22445 23335 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 protein_id gnl|my_center|LOCUS_07560 23446 24390 gene locus_tag LOCUS_07570 gene rbsK 23446 24390 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 protein_id gnl|my_center|LOCUS_07570 24394 25386 gene locus_tag LOCUS_07580 gene rbsR 24394 25386 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224470.1 protein_id gnl|my_center|LOCUS_07580 26779 25352 gene locus_tag LOCUS_07590 gene mdtD 26779 25352 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280837.1 protein_id gnl|my_center|LOCUS_07590 27494 26802 gene locus_tag LOCUS_07600 27494 26802 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131164.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence021 882 3554 gene locus_tag LOCUS_07610 gene rcsD 882 3554 CDS product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249081.1 protein_id gnl|my_center|LOCUS_07610 3571 4221 gene locus_tag LOCUS_07620 gene rcsB 3571 4221 CDS product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061917.1 protein_id gnl|my_center|LOCUS_07620 7270 4421 gene locus_tag LOCUS_07630 gene rcsC 7270 4421 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876014.1 protein_id gnl|my_center|LOCUS_07630 7437 9263 gene locus_tag LOCUS_07640 gene atoS 7437 9263 CDS product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 protein_id gnl|my_center|LOCUS_07640 9260 10645 gene locus_tag LOCUS_07650 gene atoC 9260 10645 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_07650 10841 11503 gene locus_tag LOCUS_07660 gene atoD 10841 11503 CDS product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 protein_id gnl|my_center|LOCUS_07660 11503 12153 gene locus_tag LOCUS_07670 gene atoA 11503 12153 CDS product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339065.1 protein_id gnl|my_center|LOCUS_07670 12150 13472 gene locus_tag LOCUS_07680 12150 13472 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 protein_id gnl|my_center|LOCUS_07680 13503 14687 gene locus_tag LOCUS_07690 gene atoB 13503 14687 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786547.1 protein_id gnl|my_center|LOCUS_07690 15537 14761 gene locus_tag LOCUS_07700 15537 14761 CDS product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225879.1 protein_id gnl|my_center|LOCUS_07700 17191 15542 gene locus_tag LOCUS_07710 17191 15542 CDS product YfaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104541.1 protein_id gnl|my_center|LOCUS_07710 21586 17192 gene locus_tag LOCUS_07720 21586 17192 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001442934.1 protein_id gnl|my_center|LOCUS_07720 22353 21730 gene locus_tag LOCUS_07730 22353 21730 CDS product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295211.1 protein_id gnl|my_center|LOCUS_07730 23915 22350 gene locus_tag LOCUS_07740 23915 22350 CDS product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012305.1 protein_id gnl|my_center|LOCUS_07740 26813 24186 gene locus_tag LOCUS_07750 gene gyrA 26813 24186 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281242.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence022 368 640 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacac 1030 737 gene locus_tag LOCUS_07760 gene cas2e 1030 737 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 protein_id gnl|my_center|LOCUS_07760 1950 1030 gene locus_tag LOCUS_07770 gene cas1e 1950 1030 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 protein_id gnl|my_center|LOCUS_07770 2597 1947 gene locus_tag LOCUS_07780 gene cas6e 2597 1947 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 protein_id gnl|my_center|LOCUS_07780 3325 2579 gene locus_tag LOCUS_07790 gene cas5e 3325 2579 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085069.1 protein_id gnl|my_center|LOCUS_07790 4391 3336 gene locus_tag LOCUS_07800 gene cas7e 4391 3336 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206435.1 protein_id gnl|my_center|LOCUS_07800 4939 4403 gene locus_tag LOCUS_07810 gene casB 4939 4403 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029329.1 protein_id gnl|my_center|LOCUS_07810 5265 4936 gene locus_tag LOCUS_07820 5265 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07820 6498 5329 gene locus_tag LOCUS_07830 6498 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07830 8365 6596 gene locus_tag LOCUS_07840 8365 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9166 8636 gene locus_tag LOCUS_07850 9166 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077537.1 protein_id gnl|my_center|LOCUS_07850 9606 11696 gene locus_tag LOCUS_07860 9606 11696 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289290.1 protein_id gnl|my_center|LOCUS_07860 11779 12711 gene locus_tag LOCUS_07870 11779 12711 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129790.1 protein_id gnl|my_center|LOCUS_07870 12714 12935 gene locus_tag LOCUS_07880 12714 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268103.1 protein_id gnl|my_center|LOCUS_07880 12948 13202 gene locus_tag LOCUS_07890 12948 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057199.1 protein_id gnl|my_center|LOCUS_07890 13204 13485 gene locus_tag LOCUS_07900 13204 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739863.1 protein_id gnl|my_center|LOCUS_07900 13482 13754 gene locus_tag LOCUS_07910 13482 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049432.1 protein_id gnl|my_center|LOCUS_07910 13759 14052 gene locus_tag LOCUS_07920 13759 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049304.1 protein_id gnl|my_center|LOCUS_07920 14064 14594 gene locus_tag LOCUS_07930 14064 14594 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129553.1 protein_id gnl|my_center|LOCUS_07930 14692 15234 gene locus_tag LOCUS_07940 14692 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323222.1 protein_id gnl|my_center|LOCUS_07940 15238 15771 gene locus_tag LOCUS_07950 15238 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564280.1 protein_id gnl|my_center|LOCUS_07950 15771 16286 gene locus_tag LOCUS_07960 15771 16286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465559.1 protein_id gnl|my_center|LOCUS_07960 16290 16841 gene locus_tag LOCUS_07970 16290 16841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977060.1 protein_id gnl|my_center|LOCUS_07970 16838 17167 gene locus_tag LOCUS_07980 16838 17167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 17164 17514 gene locus_tag LOCUS_07990 17164 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047371030.1 protein_id gnl|my_center|LOCUS_07990 17530 17838 gene locus_tag LOCUS_08000 17530 17838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021235.1 protein_id gnl|my_center|LOCUS_08000 18210 17800 gene locus_tag LOCUS_08010 18210 17800 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816459.1 protein_id gnl|my_center|LOCUS_08010 18275 18787 gene locus_tag LOCUS_08020 18275 18787 CDS product gp16 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214362.1 protein_id gnl|my_center|LOCUS_08020 18858 19280 gene locus_tag LOCUS_08030 18858 19280 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852377.1 protein_id gnl|my_center|LOCUS_08030 19352 19852 gene locus_tag LOCUS_08040 19352 19852 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125304.1 protein_id gnl|my_center|LOCUS_08040 19965 20315 gene locus_tag LOCUS_08050 19965 20315 CDS product exotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816483.1 protein_id gnl|my_center|LOCUS_08050 20245 20517 gene locus_tag LOCUS_08060 20245 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 20528 20755 gene locus_tag LOCUS_08070 20528 20755 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342746.1 protein_id gnl|my_center|LOCUS_08070 20736 21047 gene locus_tag LOCUS_08080 20736 21047 CDS product DUF2730 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270159.1 protein_id gnl|my_center|LOCUS_08080 21040 21330 gene locus_tag LOCUS_08090 21040 21330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279084.1 protein_id gnl|my_center|LOCUS_08090 21333 21794 gene locus_tag LOCUS_08100 21333 21794 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360581.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08100 21925 22173 gene locus_tag LOCUS_08110 21925 22173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 22173 23837 gene locus_tag LOCUS_08120 22173 23837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057672.1 protein_id gnl|my_center|LOCUS_08120 23828 25426 gene locus_tag LOCUS_08130 23828 25426 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532593.1 protein_id gnl|my_center|LOCUS_08130 25410 26741 gene locus_tag LOCUS_08140 25410 26741 CDS product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046893.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence023 384 1154 gene locus_tag LOCUS_08150 384 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1365 2801 gene locus_tag LOCUS_08160 1365 2801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_08160 2916 3722 gene locus_tag LOCUS_08170 gene yidA 2916 3722 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 protein_id gnl|my_center|LOCUS_08170 3726 4625 gene locus_tag LOCUS_08180 3726 4625 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_08180 4625 5464 gene locus_tag LOCUS_08190 4625 5464 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_08190 5484 6362 gene locus_tag LOCUS_08200 5484 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 6377 7516 gene locus_tag LOCUS_08210 6377 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 7527 7940 gene locus_tag LOCUS_08220 7527 7940 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_08220 8044 8820 gene locus_tag LOCUS_08230 8044 8820 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940940.1 protein_id gnl|my_center|LOCUS_08230 8887 10017 gene locus_tag LOCUS_08240 8887 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 10103 11089 gene locus_tag LOCUS_08250 10103 11089 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584091.1 protein_id gnl|my_center|LOCUS_08250 11272 12225 gene locus_tag LOCUS_08260 gene rihB 11272 12225 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415429.1 protein_id gnl|my_center|LOCUS_08260 12248 13357 gene locus_tag LOCUS_08270 12248 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 13379 14212 gene locus_tag LOCUS_08280 13379 14212 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_08280 14233 14862 gene locus_tag LOCUS_08290 14233 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 14877 16616 gene locus_tag LOCUS_08300 gene ade 14877 16616 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286185.1 protein_id gnl|my_center|LOCUS_08300 16631 18145 gene locus_tag LOCUS_08310 16631 18145 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_08310 18160 18819 gene locus_tag LOCUS_08320 gene fsa 18160 18819 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_08320 18845 19555 gene locus_tag LOCUS_08330 18845 19555 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_08330 19578 21563 gene locus_tag LOCUS_08340 gene tkt 19578 21563 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_08340 21628 22413 gene locus_tag LOCUS_08350 21628 22413 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831870.1 protein_id gnl|my_center|LOCUS_08350 23082 22579 gene locus_tag LOCUS_08360 23082 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 23535 23203 gene locus_tag LOCUS_08370 23535 23203 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890395.1 protein_id gnl|my_center|LOCUS_08370 25408 24017 gene locus_tag LOCUS_08380 25408 24017 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_08380 25743 25459 gene locus_tag LOCUS_08390 25743 25459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 26003 25725 gene locus_tag LOCUS_08400 26003 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 26444 26112 gene locus_tag LOCUS_08410 gene mobC 26444 26112 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence024 1946 582 gene locus_tag LOCUS_08420 gene mnmE 1946 582 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282346.1 protein_id gnl|my_center|LOCUS_08420 3698 2052 gene locus_tag LOCUS_08430 gene yidC 3698 2052 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378250.1 protein_id gnl|my_center|LOCUS_08430 4248 3922 gene locus_tag LOCUS_08440 gene rnpA 4248 3922 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 protein_id gnl|my_center|LOCUS_08440 4438 4298 gene locus_tag LOCUS_08450 gene rpmH 4438 4298 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 protein_id gnl|my_center|LOCUS_08450 5114 6448 gene locus_tag LOCUS_08460 gene dnaA 5114 6448 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 protein_id gnl|my_center|LOCUS_08460 6453 7553 gene locus_tag LOCUS_08470 gene dnaN 6453 7553 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 protein_id gnl|my_center|LOCUS_08470 7553 8626 gene locus_tag LOCUS_08480 gene recF 7553 8626 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 protein_id gnl|my_center|LOCUS_08480 8655 11069 gene locus_tag LOCUS_08490 gene gyrB 8655 11069 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 protein_id gnl|my_center|LOCUS_08490 11309 11707 gene locus_tag LOCUS_08500 11309 11707 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522208.1 protein_id gnl|my_center|LOCUS_08500 11822 12634 gene locus_tag LOCUS_08510 gene yidA 11822 12634 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 protein_id gnl|my_center|LOCUS_08510 13336 12680 gene locus_tag LOCUS_08520 gene yidX 13336 12680 CDS product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 protein_id gnl|my_center|LOCUS_08520 13614 14303 gene locus_tag LOCUS_08530 gene dgoR 13614 14303 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 protein_id gnl|my_center|LOCUS_08530 14300 15178 gene locus_tag LOCUS_08540 gene dgoK 14300 15178 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127112.1 protein_id gnl|my_center|LOCUS_08540 15162 15779 gene locus_tag LOCUS_08550 gene dgoA 15162 15779 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 protein_id gnl|my_center|LOCUS_08550 15776 16924 gene locus_tag LOCUS_08560 gene dgoD 15776 16924 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 protein_id gnl|my_center|LOCUS_08560 17044 18336 gene locus_tag LOCUS_08570 17044 18336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296574.1 protein_id gnl|my_center|LOCUS_08570 19397 18333 gene locus_tag LOCUS_08580 gene cbrA 19397 18333 CDS product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052030.1 protein_id gnl|my_center|LOCUS_08580 19498 20712 gene locus_tag LOCUS_08590 19498 20712 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295245.1 protein_id gnl|my_center|LOCUS_08590 20974 20714 gene locus_tag LOCUS_08600 20974 20714 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 protein_id gnl|my_center|LOCUS_08600 21352 21765 gene locus_tag LOCUS_08610 gene ibpA 21352 21765 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 protein_id gnl|my_center|LOCUS_08610 21877 22305 gene locus_tag LOCUS_08620 gene ibpB 21877 22305 CDS product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 protein_id gnl|my_center|LOCUS_08620 22501 24162 gene locus_tag LOCUS_08630 22501 24162 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279752.1 protein_id gnl|my_center|LOCUS_08630 24875 24159 gene locus_tag LOCUS_08640 24875 24159 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300779.1 protein_id gnl|my_center|LOCUS_08640 25171 25680 gene locus_tag LOCUS_08650 25171 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08650 >Feature sequence025 905 1648 gene locus_tag LOCUS_08660 905 1648 CDS product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028545.1 protein_id gnl|my_center|LOCUS_08660 1678 2217 gene locus_tag LOCUS_08670 1678 2217 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808667.1 protein_id gnl|my_center|LOCUS_08670 2322 2720 gene locus_tag LOCUS_08680 gene yciA 2322 2720 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108160.1 protein_id gnl|my_center|LOCUS_08680 3479 2760 gene locus_tag LOCUS_08690 3479 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3703 3999 gene locus_tag LOCUS_08700 3703 3999 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 protein_id gnl|my_center|LOCUS_08700 4299 5552 gene locus_tag LOCUS_08710 gene kch 4299 5552 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295624.1 protein_id gnl|my_center|LOCUS_08710 5923 7383 gene locus_tag LOCUS_08720 gene cls 5923 7383 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214516.1 protein_id gnl|my_center|LOCUS_08720 7418 7747 gene locus_tag LOCUS_08730 7418 7747 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366959.1 protein_id gnl|my_center|LOCUS_08730 8804 7800 gene locus_tag LOCUS_08740 gene oppF 8804 7800 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994905.1 protein_id gnl|my_center|LOCUS_08740 9814 8801 gene locus_tag LOCUS_08750 gene oppD 9814 8801 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110954.1 protein_id gnl|my_center|LOCUS_08750 10734 9826 gene locus_tag LOCUS_08760 gene oppC 10734 9826 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 protein_id gnl|my_center|LOCUS_08760 11669 10749 gene locus_tag LOCUS_08770 gene oppB 11669 10749 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 protein_id gnl|my_center|LOCUS_08770 13386 11755 gene locus_tag LOCUS_08780 gene oppA 13386 11755 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295623.1 protein_id gnl|my_center|LOCUS_08780 13805 13966 gene locus_tag LOCUS_08790 13805 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08790 14771 14124 gene locus_tag LOCUS_08800 gene ychE 14771 14124 CDS product NAAT family transporter YchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616773.1 protein_id gnl|my_center|LOCUS_08800 15248 17923 gene locus_tag LOCUS_08810 gene adhE 15248 17923 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301653.1 protein_id gnl|my_center|LOCUS_08810 18842 18225 gene locus_tag LOCUS_08820 gene tdk 18842 18225 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068079.1 protein_id gnl|my_center|LOCUS_08820 19446 19859 gene locus_tag LOCUS_08830 gene hns 19446 19859 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287378.1 protein_id gnl|my_center|LOCUS_08830 20912 20004 gene locus_tag LOCUS_08840 gene galU 20912 20004 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 protein_id gnl|my_center|LOCUS_08840 22127 21114 gene locus_tag LOCUS_08850 gene rssB 22127 21114 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193447.1 protein_id gnl|my_center|LOCUS_08850 23163 22219 gene locus_tag LOCUS_08860 gene rssA 23163 22219 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190792.1 protein_id gnl|my_center|LOCUS_08860 23237 23695 gene locus_tag LOCUS_08870 23237 23695 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001362540.1 protein_id gnl|my_center|LOCUS_08870 23745 24587 gene locus_tag LOCUS_08880 gene purU 23745 24587 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555849.1 protein_id gnl|my_center|LOCUS_08880 24747 24831 gene locus_tag LOCUS_t00130 24747 24831 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 24866 24950 gene locus_tag LOCUS_t00140 24866 24950 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence026 644 210 gene locus_tag LOCUS_08890 gene pcoE 644 210 CDS product copper resistance system metallochaperone PcoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723069.1 protein_id gnl|my_center|LOCUS_08890 2262 862 gene locus_tag LOCUS_08900 gene pcoS 2262 862 CDS product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211180.1 protein_id gnl|my_center|LOCUS_08900 2939 2259 gene locus_tag LOCUS_08910 gene pcoR 2939 2259 CDS product copper response regulator transcription factor PcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188930.1 protein_id gnl|my_center|LOCUS_08910 3923 2994 gene locus_tag LOCUS_08920 gene pcoD 3923 2994 CDS product copper resistance inner membrane protein PcoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998778.1 protein_id gnl|my_center|LOCUS_08920 4308 3928 gene locus_tag LOCUS_08930 gene pcoC 4308 3928 CDS product copper resistance system metallochaperone PcoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025662.1 protein_id gnl|my_center|LOCUS_08930 5244 4348 gene locus_tag LOCUS_08940 gene pcoB 5244 4348 CDS product copper resistance outer membrane transporter PcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378118.1 protein_id gnl|my_center|LOCUS_08940 7061 5244 gene locus_tag LOCUS_08950 gene pcoA 7061 5244 CDS product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925242.1 protein_id gnl|my_center|LOCUS_08950 7296 7745 gene locus_tag LOCUS_08960 7296 7745 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023257.1 protein_id gnl|my_center|LOCUS_08960 8034 8771 gene locus_tag LOCUS_08970 8034 8771 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287501.1 protein_id gnl|my_center|LOCUS_08970 9002 8805 gene locus_tag LOCUS_08980 9002 8805 CDS product DUF2933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843497.1 protein_id gnl|my_center|LOCUS_08980 11031 9043 gene locus_tag LOCUS_08990 gene silP 11031 9043 CDS product Ag(+)-translocating P-type ATPase SilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129244003.1 protein_id gnl|my_center|LOCUS_08990 11221 11430 gene locus_tag LOCUS_09000 11221 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 12052 11612 gene locus_tag LOCUS_09010 12052 11612 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436620.1 protein_id gnl|my_center|LOCUS_09010 15285 12139 gene locus_tag LOCUS_09020 gene silA 15285 12139 CDS product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087115.1 protein_id gnl|my_center|LOCUS_09020 16426 15296 gene locus_tag LOCUS_09030 gene silB 16426 15296 CDS product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 protein_id gnl|my_center|LOCUS_09030 17055 16702 gene locus_tag LOCUS_09040 gene cusF 17055 16702 CDS product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246153.1 protein_id gnl|my_center|LOCUS_09040 18469 17084 gene locus_tag LOCUS_09050 gene silC 18469 17084 CDS product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475506.1 protein_id gnl|my_center|LOCUS_09050 18659 19339 gene locus_tag LOCUS_09060 gene silR 18659 19339 CDS product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 protein_id gnl|my_center|LOCUS_09060 19332 20813 gene locus_tag LOCUS_09070 gene silS 19332 20813 CDS product copper/silver sensor histidine kinase SilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555736.1 protein_id gnl|my_center|LOCUS_09070 21058 21489 gene locus_tag LOCUS_09080 gene silE 21058 21489 CDS product silver-binding protein SilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790485.1 protein_id gnl|my_center|LOCUS_09080 21637 21987 gene locus_tag LOCUS_09090 21637 21987 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647571.1 protein_id gnl|my_center|LOCUS_09090 23982 22156 gene locus_tag LOCUS_09100 23982 22156 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239419.1 protein_id gnl|my_center|LOCUS_09100 24847 24545 gene locus_tag LOCUS_09110 24847 24545 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097216.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence027 564 1496 gene locus_tag LOCUS_09120 gene rfaD 564 1496 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587750.1 protein_id gnl|my_center|LOCUS_09120 1506 2552 gene locus_tag LOCUS_09130 gene rfaF 1506 2552 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699232.1 protein_id gnl|my_center|LOCUS_09130 2556 3527 gene locus_tag LOCUS_09140 gene rfaC 2556 3527 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264544.1 protein_id gnl|my_center|LOCUS_09140 4256 3597 gene locus_tag LOCUS_09150 4256 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4210 4347 gene locus_tag LOCUS_09160 4210 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5879 4896 gene locus_tag LOCUS_09170 5879 4896 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064007.1 protein_id gnl|my_center|LOCUS_09170 6989 5964 gene locus_tag LOCUS_09180 6989 5964 CDS product UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364799.1 protein_id gnl|my_center|LOCUS_09180 7707 7015 gene locus_tag LOCUS_09190 gene rfaY 7707 7015 CDS product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633087.1 protein_id gnl|my_center|LOCUS_09190 8712 7717 gene locus_tag LOCUS_09200 8712 7717 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001732.1 protein_id gnl|my_center|LOCUS_09200 9745 8729 gene locus_tag LOCUS_09210 gene waaO 9745 8729 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272734.1 protein_id gnl|my_center|LOCUS_09210 10558 9761 gene locus_tag LOCUS_09220 gene rfaP 10558 9761 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262247.1 protein_id gnl|my_center|LOCUS_09220 11675 10551 gene locus_tag LOCUS_09230 11675 10551 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634246.1 protein_id gnl|my_center|LOCUS_09230 12676 11672 gene locus_tag LOCUS_09240 gene rfaQ 12676 11672 CDS product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360402.1 protein_id gnl|my_center|LOCUS_09240 13143 14420 gene locus_tag LOCUS_09250 gene waaA 13143 14420 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891564.1 protein_id gnl|my_center|LOCUS_09250 14428 14907 gene locus_tag LOCUS_09260 gene coaD 14428 14907 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 protein_id gnl|my_center|LOCUS_09260 15755 14946 gene locus_tag LOCUS_09270 gene mutM 15755 14946 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 protein_id gnl|my_center|LOCUS_09270 16020 15853 gene locus_tag LOCUS_09280 gene rpmG 16020 15853 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 protein_id gnl|my_center|LOCUS_09280 16277 16041 gene locus_tag LOCUS_09290 gene rpmB 16277 16041 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 protein_id gnl|my_center|LOCUS_09290 17162 16494 gene locus_tag LOCUS_09300 gene radC 17162 16494 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297375.1 protein_id gnl|my_center|LOCUS_09300 17334 18554 gene locus_tag LOCUS_09310 gene coaBC 17334 18554 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 protein_id gnl|my_center|LOCUS_09310 18532 18990 gene locus_tag LOCUS_09320 gene dut 18532 18990 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 protein_id gnl|my_center|LOCUS_09320 19097 19693 gene locus_tag LOCUS_09330 gene slmA 19097 19693 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 protein_id gnl|my_center|LOCUS_09330 20371 19730 gene locus_tag LOCUS_09340 gene pyrE 20371 19730 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806161.1 protein_id gnl|my_center|LOCUS_09340 21153 20437 gene locus_tag LOCUS_09350 gene rph 21153 20437 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 protein_id gnl|my_center|LOCUS_09350 21280 22143 gene locus_tag LOCUS_09360 21280 22143 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 protein_id gnl|my_center|LOCUS_09360 22364 22741 gene locus_tag LOCUS_09370 22364 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09370 22781 23188 gene locus_tag LOCUS_09380 22781 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09380 23479 24096 gene locus_tag LOCUS_09390 23479 24096 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 protein_id gnl|my_center|LOCUS_09390 <24881 24093 gene locus_tag LOCUS_09400 <24881 24093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000870052.1:NAD-dependent DNA ligase LigB >Feature sequence028 547 338 gene locus_tag LOCUS_09410 547 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 428 1822 gene locus_tag LOCUS_09420 gene rsmF 428 1822 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001352260.1 protein_id gnl|my_center|LOCUS_09420 1940 2176 gene locus_tag LOCUS_09430 1940 2176 CDS product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295499.1 protein_id gnl|my_center|LOCUS_09430 2197 2472 gene locus_tag LOCUS_09440 2197 2472 CDS product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929530.1 protein_id gnl|my_center|LOCUS_09440 3129 2473 gene locus_tag LOCUS_09450 gene pphA 3129 2473 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812736.1 protein_id gnl|my_center|LOCUS_09450 3866 3525 gene locus_tag LOCUS_09460 3866 3525 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976472.1 protein_id gnl|my_center|LOCUS_09460 4751 3879 gene locus_tag LOCUS_09470 gene copD 4751 3879 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879289.1 protein_id gnl|my_center|LOCUS_09470 5129 4755 gene locus_tag LOCUS_09480 gene yobA 5129 4755 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168745.1 protein_id gnl|my_center|LOCUS_09480 5268 5498 gene locus_tag LOCUS_09490 gene holE 5268 5498 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916763.1 protein_id gnl|my_center|LOCUS_09490 5600 6256 gene locus_tag LOCUS_09500 gene yobB 5600 6256 CDS product carbon-nitrogen hydrolase family protein YobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011658.1 protein_id gnl|my_center|LOCUS_09500 6280 6942 gene locus_tag LOCUS_09510 gene exoX 6280 6942 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 protein_id gnl|my_center|LOCUS_09510 8999 6939 gene locus_tag LOCUS_09520 gene ptrB 8999 6939 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936951.1 protein_id gnl|my_center|LOCUS_09520 9867 9208 gene locus_tag LOCUS_09530 9867 9208 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024745.1 protein_id gnl|my_center|LOCUS_09530 10550 10194 gene locus_tag LOCUS_09540 gene yebF 10550 10194 CDS product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295500.1 protein_id gnl|my_center|LOCUS_09540 10907 10617 gene locus_tag LOCUS_09550 gene yebG 10907 10617 CDS product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257738.1 protein_id gnl|my_center|LOCUS_09550 11041 12219 gene locus_tag LOCUS_09560 gene purT 11041 12219 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173474.1 protein_id gnl|my_center|LOCUS_09560 12916 12275 gene locus_tag LOCUS_09570 gene kdgA 12916 12275 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800512.1 protein_id gnl|my_center|LOCUS_09570 14764 12953 gene locus_tag LOCUS_09580 gene edd 14764 12953 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069467.1 protein_id gnl|my_center|LOCUS_09580 16474 14999 gene locus_tag LOCUS_09590 gene zwf 16474 14999 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301727.1 protein_id gnl|my_center|LOCUS_09590 16789 16640 gene locus_tag LOCUS_09600 16789 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155622.1 protein_id gnl|my_center|LOCUS_09600 16812 17681 gene locus_tag LOCUS_09610 gene hexR 16812 17681 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056706.1 protein_id gnl|my_center|LOCUS_09610 17809 19251 gene locus_tag LOCUS_09620 gene pyk 17809 19251 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091148.1 protein_id gnl|my_center|LOCUS_09620 20354 19383 gene locus_tag LOCUS_09630 gene lpxM 20354 19383 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448381.1 protein_id gnl|my_center|LOCUS_09630 21796 20474 gene locus_tag LOCUS_09640 gene mepM 21796 20474 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184045.1 protein_id gnl|my_center|LOCUS_09640 22759 21812 gene locus_tag LOCUS_09650 gene znuA 22759 21812 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069410.1 protein_id gnl|my_center|LOCUS_09650 22823 23578 gene locus_tag LOCUS_09660 gene znuC 22823 23578 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202986.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence029 1 897 gene locus_tag LOCUS_09670 1 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1019 1504 gene locus_tag LOCUS_09680 gene skp 1019 1504 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 protein_id gnl|my_center|LOCUS_09680 1508 2533 gene locus_tag LOCUS_09690 gene lpxD 1508 2533 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 protein_id gnl|my_center|LOCUS_09690 2638 3093 gene locus_tag LOCUS_09700 gene fabZ 2638 3093 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 protein_id gnl|my_center|LOCUS_09700 3097 3885 gene locus_tag LOCUS_09710 gene lpxA 3097 3885 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 protein_id gnl|my_center|LOCUS_09710 3885 5033 gene locus_tag LOCUS_09720 gene lpxB 3885 5033 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132065.1 protein_id gnl|my_center|LOCUS_09720 5030 5626 gene locus_tag LOCUS_09730 gene rnhB 5030 5626 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569423.1 protein_id gnl|my_center|LOCUS_09730 5663 9145 gene locus_tag LOCUS_09740 gene dnaE 5663 9145 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294769.1 protein_id gnl|my_center|LOCUS_09740 9158 10117 gene locus_tag LOCUS_09750 gene accA 9158 10117 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055746.1 protein_id gnl|my_center|LOCUS_09750 10216 12357 gene locus_tag LOCUS_09760 gene ldcC 10216 12357 CDS product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 protein_id gnl|my_center|LOCUS_09760 12414 12803 gene locus_tag LOCUS_09770 12414 12803 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901098.1 protein_id gnl|my_center|LOCUS_09770 12868 14166 gene locus_tag LOCUS_09780 gene tilS 12868 14166 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602174.1 protein_id gnl|my_center|LOCUS_09780 14475 14215 gene locus_tag LOCUS_09790 gene rof 14475 14215 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062312.1 protein_id gnl|my_center|LOCUS_09790 14662 14462 gene locus_tag LOCUS_09800 14662 14462 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 protein_id gnl|my_center|LOCUS_09800 14828 15373 gene locus_tag LOCUS_09810 14828 15373 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 protein_id gnl|my_center|LOCUS_09810 15370 15792 gene locus_tag LOCUS_09820 gene arfB 15370 15792 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635545.1 protein_id gnl|my_center|LOCUS_09820 15806 16516 gene locus_tag LOCUS_09830 gene nlpE 15806 16516 CDS product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239154.1 protein_id gnl|my_center|LOCUS_09830 16907 16671 gene locus_tag LOCUS_09840 16907 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09840 17494 16913 gene locus_tag LOCUS_09850 17494 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09850 19265 17547 gene locus_tag LOCUS_09860 gene proS 19265 17547 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 protein_id gnl|my_center|LOCUS_09860 20084 19377 gene locus_tag LOCUS_09870 20084 19377 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 protein_id gnl|my_center|LOCUS_09870 20485 20081 gene locus_tag LOCUS_09880 gene rcsF 20485 20081 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 protein_id gnl|my_center|LOCUS_09880 21418 20603 gene locus_tag LOCUS_09890 gene metQ 21418 20603 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_09890 22111 21458 gene locus_tag LOCUS_09900 22111 21458 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 protein_id gnl|my_center|LOCUS_09900 23135 22104 gene locus_tag LOCUS_09910 gene metN 23135 22104 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593994.1 protein_id gnl|my_center|LOCUS_09910 23323 23898 gene locus_tag LOCUS_09920 gene gmhB 23323 23898 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140187.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence030 1878 199 gene locus_tag LOCUS_09930 gene bcsG 1878 199 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191596.1 protein_id gnl|my_center|LOCUS_09930 2066 1875 gene locus_tag LOCUS_09940 gene bcsF 2066 1875 CDS product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 protein_id gnl|my_center|LOCUS_09940 3622 2063 gene locus_tag LOCUS_09950 gene bcsE 3622 2063 CDS product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204920.1 protein_id gnl|my_center|LOCUS_09950 3907 4095 gene locus_tag LOCUS_09960 gene bcsR 3907 4095 CDS product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 protein_id gnl|my_center|LOCUS_09960 4107 4748 gene locus_tag LOCUS_09970 gene bcsQ 4107 4748 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09970 4848 7466 gene locus_tag LOCUS_09980 gene bcsA 4848 7466 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025914.1 protein_id gnl|my_center|LOCUS_09980 7477 9816 gene locus_tag LOCUS_09990 gene bcsB 7477 9816 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307454.1 protein_id gnl|my_center|LOCUS_09990 9817 10830 gene locus_tag LOCUS_10000 gene bcsZ 9817 10830 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302749.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 10731 10928 gene locus_tag LOCUS_10010 10731 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 10967 14383 gene locus_tag LOCUS_10020 gene bcsC 10967 14383 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 protein_id gnl|my_center|LOCUS_10020 14504 16453 gene locus_tag LOCUS_10030 gene hmsP 14504 16453 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266306.1 protein_id gnl|my_center|LOCUS_10030 16636 17922 gene locus_tag LOCUS_10040 gene dctA 16636 17922 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 protein_id gnl|my_center|LOCUS_10040 18143 19639 gene locus_tag LOCUS_10050 18143 19639 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163135.1 protein_id gnl|my_center|LOCUS_10050 20664 19735 gene locus_tag LOCUS_10060 gene kdgK 20664 19735 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 protein_id gnl|my_center|LOCUS_10060 21028 21663 gene locus_tag LOCUS_10070 gene pdeH 21028 21663 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 protein_id gnl|my_center|LOCUS_10070 21733 23793 gene locus_tag LOCUS_10080 21733 23793 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence031 424 1539 gene locus_tag LOCUS_10090 gene yneK 424 1539 CDS product putative protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258599.1 protein_id gnl|my_center|LOCUS_10090 1689 2879 gene locus_tag LOCUS_10100 gene ydeA 1689 2879 CDS product L-arabinose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210785.1 protein_id gnl|my_center|LOCUS_10100 3569 2904 gene locus_tag LOCUS_10110 gene marC 3569 2904 CDS product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 protein_id gnl|my_center|LOCUS_10110 3781 4215 gene locus_tag LOCUS_10120 gene marR 3781 4215 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843419.1 protein_id gnl|my_center|LOCUS_10120 4235 4618 gene locus_tag LOCUS_10130 gene marA 4235 4618 CDS product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091199.1 protein_id gnl|my_center|LOCUS_10130 4650 4868 gene locus_tag LOCUS_10140 gene marB 4650 4868 CDS product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803659.1 protein_id gnl|my_center|LOCUS_10140 6364 4925 gene locus_tag LOCUS_10150 6364 4925 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012618.1 protein_id gnl|my_center|LOCUS_10150 7531 6389 gene locus_tag LOCUS_10160 7531 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10160 8061 7528 gene locus_tag LOCUS_10170 8061 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10170 8428 8117 gene locus_tag LOCUS_10180 8428 8117 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296721.1 protein_id gnl|my_center|LOCUS_10180 9778 8456 gene locus_tag LOCUS_10190 9778 8456 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355834.1 protein_id gnl|my_center|LOCUS_10190 10171 9893 gene locus_tag LOCUS_10200 10171 9893 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722571.1 protein_id gnl|my_center|LOCUS_10200 10403 11101 gene locus_tag LOCUS_10210 10403 11101 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577184.1 protein_id gnl|my_center|LOCUS_10210 12045 11146 gene locus_tag LOCUS_10220 gene eamA 12045 11146 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087205.1 protein_id gnl|my_center|LOCUS_10220 12327 13427 gene locus_tag LOCUS_10230 gene ydeE 12327 13427 CDS product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054189.1 protein_id gnl|my_center|LOCUS_10230 14755 13868 gene locus_tag LOCUS_10240 gene dgcZ 14755 13868 CDS product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592814.1 protein_id gnl|my_center|LOCUS_10240 15402 15010 gene locus_tag LOCUS_10250 gene ydeI 15402 15010 CDS product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671737.1 protein_id gnl|my_center|LOCUS_10250 15678 16196 gene locus_tag LOCUS_10260 15678 16196 CDS product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024810.1 protein_id gnl|my_center|LOCUS_10260 18286 16241 gene locus_tag LOCUS_10270 gene dcp 18286 16241 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295662.1 protein_id gnl|my_center|LOCUS_10270 18423 19169 gene locus_tag LOCUS_10280 gene ydfG 18423 19169 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636575.1 protein_id gnl|my_center|LOCUS_10280 19258 19944 gene locus_tag LOCUS_10290 gene rspR 19258 19944 CDS product DNA-binding transcriptional regulator rspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215549.1 protein_id gnl|my_center|LOCUS_10290 20121 20324 gene locus_tag LOCUS_10300 gene ydfZ 20121 20324 CDS product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214712.1 protein_id gnl|my_center|LOCUS_10300 21820 20360 gene locus_tag LOCUS_10310 21820 20360 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527804.1 protein_id gnl|my_center|LOCUS_10310 23192 21909 gene locus_tag LOCUS_10320 23192 21909 CDS product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347482.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence032 <1 636 gene locus_tag LOCUS_10330 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000628222.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1003 2136 gene locus_tag LOCUS_10340 gene ompN 1003 2136 CDS product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837902.1 protein_id gnl|my_center|LOCUS_10340 2277 2711 gene locus_tag LOCUS_10350 gene uspF 2277 2711 CDS product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089584.1 protein_id gnl|my_center|LOCUS_10350 2887 3822 gene locus_tag LOCUS_10360 gene ttcA 2887 3822 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081418.1 protein_id gnl|my_center|LOCUS_10360 5324 3951 gene locus_tag LOCUS_10370 gene dbpA 5324 3951 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123746.1 protein_id gnl|my_center|LOCUS_10370 6785 5802 gene locus_tag LOCUS_10380 gene zntB 6785 5802 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387388.1 protein_id gnl|my_center|LOCUS_10380 7039 8271 gene locus_tag LOCUS_10390 gene dgcM 7039 8271 CDS product diguanylate cyclase DgcM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628058.1 protein_id gnl|my_center|LOCUS_10390 8855 8292 gene locus_tag LOCUS_10400 gene smrA 8855 8292 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046829.1 protein_id gnl|my_center|LOCUS_10400 10093 9185 gene locus_tag LOCUS_10410 10093 9185 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885454.1 protein_id gnl|my_center|LOCUS_10410 10269 11579 gene locus_tag LOCUS_10420 gene abgA 10269 11579 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444946.1 protein_id gnl|my_center|LOCUS_10420 11579 13024 gene locus_tag LOCUS_10430 gene abgB 11579 13024 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 protein_id gnl|my_center|LOCUS_10430 13181 14587 gene locus_tag LOCUS_10440 gene abgT 13181 14587 CDS product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062967.1 protein_id gnl|my_center|LOCUS_10440 14598 15113 gene locus_tag LOCUS_10450 gene ogt 14598 15113 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945011.1 protein_id gnl|my_center|LOCUS_10450 15308 16060 gene locus_tag LOCUS_10460 gene fnr 15308 16060 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_10460 16212 17162 gene locus_tag LOCUS_10470 gene uspE 16212 17162 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262123.1 protein_id gnl|my_center|LOCUS_10470 17469 17212 gene locus_tag LOCUS_10480 17469 17212 CDS product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605090.1 protein_id gnl|my_center|LOCUS_10480 17713 18744 gene locus_tag LOCUS_10490 gene ynaI 17713 18744 CDS product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559900.1 protein_id gnl|my_center|LOCUS_10490 20408 18795 gene locus_tag LOCUS_10500 gene mppA 20408 18795 CDS product murein tripeptide ABC transporter substrate-binding protein MppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683020.1 protein_id gnl|my_center|LOCUS_10500 21644 20745 gene locus_tag LOCUS_10510 gene pgrR 21644 20745 CDS product DNA-binding transcriptional regulator PgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817708.1 protein_id gnl|my_center|LOCUS_10510 21782 22702 gene locus_tag LOCUS_10520 21782 22702 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345592.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence033 148 714 gene locus_tag LOCUS_10530 148 714 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011108.1 protein_id gnl|my_center|LOCUS_10530 758 1294 gene locus_tag LOCUS_10540 758 1294 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749261.1 protein_id gnl|my_center|LOCUS_10540 2388 1336 gene locus_tag LOCUS_10550 2388 1336 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301877.1 protein_id gnl|my_center|LOCUS_10550 2613 3533 gene locus_tag LOCUS_10560 gene lpxL 2613 3533 CDS product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183364.1 protein_id gnl|my_center|LOCUS_10560 3705 4931 gene locus_tag LOCUS_10570 gene mdtG 3705 4931 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074172.1 protein_id gnl|my_center|LOCUS_10570 5014 5388 gene locus_tag LOCUS_10580 5014 5388 CDS product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180056.1 protein_id gnl|my_center|LOCUS_10580 5616 5389 gene locus_tag LOCUS_10590 5616 5389 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 protein_id gnl|my_center|LOCUS_10590 8332 5789 gene locus_tag LOCUS_10600 gene mdoH 8332 5789 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295445.1 protein_id gnl|my_center|LOCUS_10600 9878 8325 gene locus_tag LOCUS_10610 gene mdoG 9878 8325 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300662.1 protein_id gnl|my_center|LOCUS_10610 10254 11411 gene locus_tag LOCUS_10620 gene mdoC 10254 11411 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070350.1 protein_id gnl|my_center|LOCUS_10620 12840 11419 gene locus_tag LOCUS_10630 gene clsC 12840 11419 CDS product cardiolipin synthase ClsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299031.1 protein_id gnl|my_center|LOCUS_10630 13375 12842 gene locus_tag LOCUS_10640 gene ymdB 13375 12842 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 protein_id gnl|my_center|LOCUS_10640 13781 13470 gene locus_tag LOCUS_10650 gene ymdA 13781 13470 CDS product protein YmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489587.1 protein_id gnl|my_center|LOCUS_10650 14234 13902 gene locus_tag LOCUS_10660 gene csgC 14234 13902 CDS product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094300.1 protein_id gnl|my_center|LOCUS_10660 14748 14293 gene locus_tag LOCUS_10670 gene csgA 14748 14293 CDS product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771437.1 protein_id gnl|my_center|LOCUS_10670 15271 14789 gene locus_tag LOCUS_10680 gene csgB 15271 14789 CDS product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791650.1 protein_id gnl|my_center|LOCUS_10680 16000 16647 gene locus_tag LOCUS_10690 gene csgD 16000 16647 CDS product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481500.1 protein_id gnl|my_center|LOCUS_10690 16655 17044 gene locus_tag LOCUS_10700 gene csgE 16655 17044 CDS product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 protein_id gnl|my_center|LOCUS_10700 17069 17485 gene locus_tag LOCUS_10710 gene csgF 17069 17485 CDS product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 protein_id gnl|my_center|LOCUS_10710 17512 18345 gene locus_tag LOCUS_10720 gene csgG 17512 18345 CDS product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189321.1 protein_id gnl|my_center|LOCUS_10720 18930 18409 gene locus_tag LOCUS_10730 18930 18409 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307110.1 protein_id gnl|my_center|LOCUS_10730 19556 19002 gene locus_tag LOCUS_10740 gene ycdY 19556 19002 CDS product molecular chaperone YcdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001902.1 protein_id gnl|my_center|LOCUS_10740 20317 19580 gene locus_tag LOCUS_10750 gene ycdX 20317 19580 CDS product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283667.1 protein_id gnl|my_center|LOCUS_10750 21310 20372 gene locus_tag LOCUS_10760 gene ghrA 21310 20372 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351317.1 protein_id gnl|my_center|LOCUS_10760 21544 21631 gene locus_tag LOCUS_t00150 21544 21631 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22083 21781 gene locus_tag LOCUS_10770 22083 21781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence034 1811 456 gene locus_tag LOCUS_10780 gene melA 1811 456 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 protein_id gnl|my_center|LOCUS_10780 2094 3002 gene locus_tag LOCUS_10790 gene melR 2094 3002 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 protein_id gnl|my_center|LOCUS_10790 3198 5468 gene locus_tag LOCUS_10800 gene adiA 3198 5468 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001381593.1 protein_id gnl|my_center|LOCUS_10800 5793 6554 gene locus_tag LOCUS_10810 gene adiY 5793 6554 CDS product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217059.1 protein_id gnl|my_center|LOCUS_10810 6691 8028 gene locus_tag LOCUS_10820 gene adiC 6691 8028 CDS product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 protein_id gnl|my_center|LOCUS_10820 8162 9775 gene locus_tag LOCUS_10830 gene eptA 8162 9775 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919792.1 protein_id gnl|my_center|LOCUS_10830 9772 10440 gene locus_tag LOCUS_10840 gene basR 9772 10440 CDS product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697915.1 protein_id gnl|my_center|LOCUS_10840 10441 11541 gene locus_tag LOCUS_10850 gene pmrB 10441 11541 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052123.1 protein_id gnl|my_center|LOCUS_10850 13220 11718 gene locus_tag LOCUS_10860 gene proP 13220 11718 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296882.1 protein_id gnl|my_center|LOCUS_10860 14362 13484 gene locus_tag LOCUS_10870 14362 13484 CDS product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169175.1 protein_id gnl|my_center|LOCUS_10870 16587 14359 gene locus_tag LOCUS_10880 gene crfC 16587 14359 CDS product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288603.1 protein_id gnl|my_center|LOCUS_10880 16988 17323 gene locus_tag LOCUS_10890 16988 17323 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 protein_id gnl|my_center|LOCUS_10890 17581 18024 gene locus_tag LOCUS_10900 gene yjdN 17581 18024 CDS product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131339.1 protein_id gnl|my_center|LOCUS_10900 18157 18945 gene locus_tag LOCUS_10910 gene phnC 18157 18945 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193391.1 protein_id gnl|my_center|LOCUS_10910 18970 19986 gene locus_tag LOCUS_10920 gene phnD 18970 19986 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992002.1 protein_id gnl|my_center|LOCUS_10920 20041 20871 gene locus_tag LOCUS_10930 gene phnE 20041 20871 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193500.1 protein_id gnl|my_center|LOCUS_10930 20892 21617 gene locus_tag LOCUS_10940 gene phnF 20892 21617 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295387.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence035 1764 808 gene locus_tag LOCUS_10950 gene nrfD 1764 808 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195192.1 protein_id gnl|my_center|LOCUS_10950 2432 1761 gene locus_tag LOCUS_10960 gene nrfC 2432 1761 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 protein_id gnl|my_center|LOCUS_10960 2995 2429 gene locus_tag LOCUS_10970 gene nrfB 2995 2429 CDS product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295391.1 protein_id gnl|my_center|LOCUS_10970 4365 3040 gene locus_tag LOCUS_10980 gene nrfA 4365 3040 CDS product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640252.1 protein_id gnl|my_center|LOCUS_10980 4869 6827 gene locus_tag LOCUS_10990 gene acs 4869 6827 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078239.1 protein_id gnl|my_center|LOCUS_10990 7027 7341 gene locus_tag LOCUS_11000 7027 7341 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296646.1 protein_id gnl|my_center|LOCUS_11000 7338 8987 gene locus_tag LOCUS_11010 gene actP 7338 8987 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 protein_id gnl|my_center|LOCUS_11010 9165 10457 gene locus_tag LOCUS_11020 9165 10457 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270143.1 protein_id gnl|my_center|LOCUS_11020 12260 10611 gene locus_tag LOCUS_11030 12260 10611 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 protein_id gnl|my_center|LOCUS_11030 13760 12411 gene locus_tag LOCUS_11040 gene ghxP 13760 12411 CDS product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106882.1 protein_id gnl|my_center|LOCUS_11040 14770 14306 gene locus_tag LOCUS_11050 gene soxR 14770 14306 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412428.1 protein_id gnl|my_center|LOCUS_11050 14856 15179 gene locus_tag LOCUS_11060 gene soxS 14856 15179 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019358.1 protein_id gnl|my_center|LOCUS_11060 16768 15182 gene locus_tag LOCUS_11070 gene pdeC 16768 15182 CDS product c-di-GMP phosphodiesterase PdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019548.1 protein_id gnl|my_center|LOCUS_11070 17198 17479 gene locus_tag LOCUS_11080 17198 17479 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295689.1 protein_id gnl|my_center|LOCUS_11080 18114 17578 gene locus_tag LOCUS_11090 gene ssb1 18114 17578 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 protein_id gnl|my_center|LOCUS_11090 18369 21191 gene locus_tag LOCUS_11100 gene uvrA 18369 21191 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence036 550 212 gene locus_tag LOCUS_11110 550 212 CDS product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537457.1 protein_id gnl|my_center|LOCUS_11110 1513 560 gene locus_tag LOCUS_11120 1513 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286902.1 protein_id gnl|my_center|LOCUS_11120 2643 1528 gene locus_tag LOCUS_11130 2643 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273067.1 protein_id gnl|my_center|LOCUS_11130 3316 2858 gene locus_tag LOCUS_11140 3316 2858 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135514.1 protein_id gnl|my_center|LOCUS_11140 4140 3319 gene locus_tag LOCUS_11150 4140 3319 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117548.1 protein_id gnl|my_center|LOCUS_11150 5617 4121 gene locus_tag LOCUS_11160 5617 4121 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 protein_id gnl|my_center|LOCUS_11160 7149 5617 gene locus_tag LOCUS_11170 7149 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_11170 7754 7209 gene locus_tag LOCUS_11180 7754 7209 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124060.1 protein_id gnl|my_center|LOCUS_11180 8065 7754 gene locus_tag LOCUS_11190 8065 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 protein_id gnl|my_center|LOCUS_11190 8391 8065 gene locus_tag LOCUS_11200 8391 8065 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175097.1 protein_id gnl|my_center|LOCUS_11200 9038 8388 gene locus_tag LOCUS_11210 9038 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264661.1 protein_id gnl|my_center|LOCUS_11210 9762 9022 gene locus_tag LOCUS_11220 9762 9022 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104439.1 protein_id gnl|my_center|LOCUS_11220 10115 9765 gene locus_tag LOCUS_11230 10115 9765 CDS product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793146.1 protein_id gnl|my_center|LOCUS_11230 10246 10722 gene locus_tag LOCUS_11240 10246 10722 CDS product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149906.1 protein_id gnl|my_center|LOCUS_11240 11341 10760 gene locus_tag LOCUS_11250 11341 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110593193.1 protein_id gnl|my_center|LOCUS_11250 12418 11432 gene locus_tag LOCUS_11260 12418 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031883.1 protein_id gnl|my_center|LOCUS_11260 12876 12415 gene locus_tag LOCUS_11270 12876 12415 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259268.1 protein_id gnl|my_center|LOCUS_11270 12927 13115 gene locus_tag LOCUS_11280 12927 13115 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200153.1 protein_id gnl|my_center|LOCUS_11280 13168 13476 gene locus_tag LOCUS_11290 13168 13476 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049025.1 protein_id gnl|my_center|LOCUS_11290 13487 14401 gene locus_tag LOCUS_11300 13487 14401 CDS product DUF3102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533821.1 protein_id gnl|my_center|LOCUS_11300 14405 16174 gene locus_tag LOCUS_11310 14405 16174 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 protein_id gnl|my_center|LOCUS_11310 16185 17351 gene locus_tag LOCUS_11320 16185 17351 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960679.1 protein_id gnl|my_center|LOCUS_11320 17354 17623 gene locus_tag LOCUS_11330 17354 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 17651 18181 gene locus_tag LOCUS_11340 17651 18181 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 protein_id gnl|my_center|LOCUS_11340 18279 18473 gene locus_tag LOCUS_11350 18279 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 18470 18742 gene locus_tag LOCUS_11360 18470 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632580.1 protein_id gnl|my_center|LOCUS_11360 18752 19048 gene locus_tag LOCUS_11370 18752 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299260.1 protein_id gnl|my_center|LOCUS_11370 19063 19278 gene locus_tag LOCUS_11380 19063 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763554.1 protein_id gnl|my_center|LOCUS_11380 19275 19958 gene locus_tag LOCUS_11390 19275 19958 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132039.1 protein_id gnl|my_center|LOCUS_11390 19955 20185 gene locus_tag LOCUS_11400 19955 20185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631819.1 protein_id gnl|my_center|LOCUS_11400 20380 20832 gene locus_tag LOCUS_11410 20380 20832 CDS product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170114.1 protein_id gnl|my_center|LOCUS_11410 20804 21193 gene locus_tag LOCUS_11420 20804 21193 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281695.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence037 <1 640 gene locus_tag LOCUS_11430 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000290950.1:tyrosine-type recombinase/integrase 1281 745 gene locus_tag LOCUS_11440 gene rcdA 1281 745 CDS product DNA-binding transcriptional regulator RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295289.1 protein_id gnl|my_center|LOCUS_11440 1365 2573 gene locus_tag LOCUS_11450 1365 2573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217859.1 protein_id gnl|my_center|LOCUS_11450 2573 3388 gene locus_tag LOCUS_11460 gene ybjI 2573 3388 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023565.1 protein_id gnl|my_center|LOCUS_11460 3480 3758 gene locus_tag LOCUS_11470 gene ybjH 3480 3758 CDS product protein YbjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605480.1 protein_id gnl|my_center|LOCUS_11470 5031 3799 gene locus_tag LOCUS_11480 gene mdfA 5031 3799 CDS product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180089.1 protein_id gnl|my_center|LOCUS_11480 5316 5912 gene locus_tag LOCUS_11490 gene ybjG 5316 5912 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 protein_id gnl|my_center|LOCUS_11490 5970 6728 gene locus_tag LOCUS_11500 gene deoR 5970 6728 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450121.1 protein_id gnl|my_center|LOCUS_11500 7986 6775 gene locus_tag LOCUS_11510 gene dacC 7986 6775 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195961.1 protein_id gnl|my_center|LOCUS_11510 8224 8850 gene locus_tag LOCUS_11520 gene gstB 8224 8850 CDS product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061831.1 protein_id gnl|my_center|LOCUS_11520 9962 8847 gene locus_tag LOCUS_11530 gene yliI 9962 8847 CDS product aldose sugar dehydrogenase YliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554959.1 protein_id gnl|my_center|LOCUS_11530 10456 10073 gene locus_tag LOCUS_11540 gene bssR 10456 10073 CDS product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497137.1 protein_id gnl|my_center|LOCUS_11540 10669 11994 gene locus_tag LOCUS_11550 gene rimO 10669 11994 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 protein_id gnl|my_center|LOCUS_11550 13369 12041 gene locus_tag LOCUS_11560 13369 12041 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086904.1 protein_id gnl|my_center|LOCUS_11560 15674 13377 gene locus_tag LOCUS_11570 15674 13377 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307078.1 protein_id gnl|my_center|LOCUS_11570 16814 15903 gene locus_tag LOCUS_11580 gene gsiD 16814 15903 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236044.1 protein_id gnl|my_center|LOCUS_11580 17737 16817 gene locus_tag LOCUS_11590 gene gsiC 17737 16817 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 protein_id gnl|my_center|LOCUS_11590 19293 17755 gene locus_tag LOCUS_11600 gene gsiB 19293 17755 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090140.1 protein_id gnl|my_center|LOCUS_11600 21184 19313 gene locus_tag LOCUS_11610 gene gsiA 21184 19313 CDS product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296993.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence038 <1 3790 gene locus_tag LOCUS_11620 <1 3790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000139614.1:ATP-dependent RNA helicase HrpA 4062 4862 gene locus_tag LOCUS_11630 gene ydcF 4062 4862 CDS product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027967.1 protein_id gnl|my_center|LOCUS_11630 5059 6498 gene locus_tag LOCUS_11640 gene aldA 5059 6498 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 protein_id gnl|my_center|LOCUS_11640 7541 6540 gene locus_tag LOCUS_11650 gene gap 7541 6540 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048667.1 protein_id gnl|my_center|LOCUS_11650 7730 8260 gene locus_tag LOCUS_11660 gene cybB 7730 8260 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428998.1 protein_id gnl|my_center|LOCUS_11660 8505 8678 gene locus_tag LOCUS_11670 8505 8678 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731833.1 protein_id gnl|my_center|LOCUS_11670 8899 8750 gene locus_tag LOCUS_11680 gene hokB 8899 8750 CDS product type I toxin-antitoxin system toxin HokB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517637.1 protein_id gnl|my_center|LOCUS_11680 9298 10938 gene locus_tag LOCUS_11690 gene trg 9298 10938 CDS product methyl-accepting chemotaxis protein Trg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098571.1 protein_id gnl|my_center|LOCUS_11690 11818 10976 gene locus_tag LOCUS_11700 11818 10976 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309485.1 protein_id gnl|my_center|LOCUS_11700 12116 13459 gene locus_tag LOCUS_11710 12116 13459 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013762.1 protein_id gnl|my_center|LOCUS_11710 13720 15339 gene locus_tag LOCUS_11720 gene opgD 13720 15339 CDS product glucan biosynthesis protein OpgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375956.1 protein_id gnl|my_center|LOCUS_11720 15479 15703 gene locus_tag LOCUS_11730 15479 15703 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 protein_id gnl|my_center|LOCUS_11730 15766 16302 gene locus_tag LOCUS_11740 gene rimL 15766 16302 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140884.1 protein_id gnl|my_center|LOCUS_11740 17277 16297 gene locus_tag LOCUS_11750 gene ydcK 17277 16297 CDS product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234042.1 protein_id gnl|my_center|LOCUS_11750 17401 18393 gene locus_tag LOCUS_11760 gene tehA 17401 18393 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047890.1 protein_id gnl|my_center|LOCUS_11760 18390 18983 gene locus_tag LOCUS_11770 gene tehB 18390 18983 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586714.1 protein_id gnl|my_center|LOCUS_11770 19286 19954 gene locus_tag LOCUS_11780 19286 19954 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence039 983 210 gene locus_tag LOCUS_11790 gene nudC 983 210 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373929.1 protein_id gnl|my_center|LOCUS_11790 1078 1554 gene locus_tag LOCUS_11800 gene rsd 1078 1554 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 protein_id gnl|my_center|LOCUS_11800 1787 3682 gene locus_tag LOCUS_11810 gene thiC 1787 3682 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276928.1 protein_id gnl|my_center|LOCUS_11810 3682 4317 gene locus_tag LOCUS_11820 gene thiE 3682 4317 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284600.1 protein_id gnl|my_center|LOCUS_11820 4310 5065 gene locus_tag LOCUS_11830 gene thiF 4310 5065 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 protein_id gnl|my_center|LOCUS_11830 5049 5249 gene locus_tag LOCUS_11840 gene thiS 5049 5249 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166230.1 protein_id gnl|my_center|LOCUS_11840 5251 6021 gene locus_tag LOCUS_11850 gene thiG 5251 6021 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944114.1 protein_id gnl|my_center|LOCUS_11850 6018 7151 gene locus_tag LOCUS_11860 gene thiH 6018 7151 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847445.1 protein_id gnl|my_center|LOCUS_11860 8100 7561 gene locus_tag LOCUS_11870 8100 7561 CDS product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 protein_id gnl|my_center|LOCUS_11870 12536 8313 gene locus_tag LOCUS_11880 gene rpoC 12536 8313 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 protein_id gnl|my_center|LOCUS_11880 16641 12613 gene locus_tag LOCUS_11890 gene rpoB 16641 12613 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263098.1 protein_id gnl|my_center|LOCUS_11890 17326 16961 gene locus_tag LOCUS_11900 gene rplL 17326 16961 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 protein_id gnl|my_center|LOCUS_11900 17890 17393 gene locus_tag LOCUS_11910 gene rplJ 17890 17393 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207201.1 protein_id gnl|my_center|LOCUS_11910 19007 18303 gene locus_tag LOCUS_11920 gene rplA 19007 18303 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 protein_id gnl|my_center|LOCUS_11920 19439 19011 gene locus_tag LOCUS_11930 gene rplK 19439 19011 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 protein_id gnl|my_center|LOCUS_11930 20143 19598 gene locus_tag LOCUS_11940 gene nusG 20143 19598 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 protein_id gnl|my_center|LOCUS_11940 20528 20145 gene locus_tag LOCUS_11950 gene secE 20528 20145 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence040 749 141 gene locus_tag LOCUS_11960 gene lexA 749 141 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_11960 1227 859 gene locus_tag LOCUS_11970 gene dgkA 1227 859 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 protein_id gnl|my_center|LOCUS_11970 1338 3821 gene locus_tag LOCUS_11980 gene plsB 1338 3821 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141711.1 protein_id gnl|my_center|LOCUS_11980 4848 3976 gene locus_tag LOCUS_11990 gene ubiA 4848 3976 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455227.1 protein_id gnl|my_center|LOCUS_11990 5358 4861 gene locus_tag LOCUS_12000 gene ubiC 5358 4861 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305723.1 protein_id gnl|my_center|LOCUS_12000 6876 5581 gene locus_tag LOCUS_12010 6876 5581 CDS product SopA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900547.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12010 7161 6967 gene locus_tag LOCUS_12020 7161 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623309.1 protein_id gnl|my_center|LOCUS_12020 8310 7390 gene locus_tag LOCUS_12030 gene malM 8310 7390 CDS product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783444.1 protein_id gnl|my_center|LOCUS_12030 9802 8462 gene locus_tag LOCUS_12040 gene lamB 9802 8462 CDS product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973658.1 protein_id gnl|my_center|LOCUS_12040 10989 9874 gene locus_tag LOCUS_12050 gene malK 10989 9874 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 protein_id gnl|my_center|LOCUS_12050 11354 12544 gene locus_tag LOCUS_12060 gene malE 11354 12544 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 protein_id gnl|my_center|LOCUS_12060 12698 14242 gene locus_tag LOCUS_12070 gene malF 12698 14242 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 protein_id gnl|my_center|LOCUS_12070 14257 15147 gene locus_tag LOCUS_12080 gene malG 14257 15147 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 protein_id gnl|my_center|LOCUS_12080 15519 16994 gene locus_tag LOCUS_12090 gene xylE 15519 16994 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 protein_id gnl|my_center|LOCUS_12090 17448 17038 gene locus_tag LOCUS_12100 gene psiE 17448 17038 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 protein_id gnl|my_center|LOCUS_12100 20139 18043 gene locus_tag LOCUS_12110 20139 18043 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence041 185 496 gene locus_tag LOCUS_12120 gene rpsJ 185 496 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181004.1 protein_id gnl|my_center|LOCUS_12120 529 1158 gene locus_tag LOCUS_12130 gene rplC 529 1158 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 protein_id gnl|my_center|LOCUS_12130 1169 1774 gene locus_tag LOCUS_12140 gene rplD 1169 1774 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 protein_id gnl|my_center|LOCUS_12140 1771 2073 gene locus_tag LOCUS_12150 gene rplW 1771 2073 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 protein_id gnl|my_center|LOCUS_12150 2091 2912 gene locus_tag LOCUS_12160 gene rplB 2091 2912 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301864.1 protein_id gnl|my_center|LOCUS_12160 2929 3207 gene locus_tag LOCUS_12170 gene rpsS 2929 3207 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 protein_id gnl|my_center|LOCUS_12170 3222 3554 gene locus_tag LOCUS_12180 gene rplV 3222 3554 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 protein_id gnl|my_center|LOCUS_12180 3572 4273 gene locus_tag LOCUS_12190 gene rpsC 3572 4273 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 protein_id gnl|my_center|LOCUS_12190 4286 4696 gene locus_tag LOCUS_12200 gene rplP 4286 4696 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941212.1 protein_id gnl|my_center|LOCUS_12200 4696 4887 gene locus_tag LOCUS_12210 gene rpmC 4696 4887 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 protein_id gnl|my_center|LOCUS_12210 4887 5141 gene locus_tag LOCUS_12220 gene rpsQ 4887 5141 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 protein_id gnl|my_center|LOCUS_12220 5306 5677 gene locus_tag LOCUS_12230 gene rplN 5306 5677 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 protein_id gnl|my_center|LOCUS_12230 5688 6002 gene locus_tag LOCUS_12240 gene rplX 5688 6002 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 protein_id gnl|my_center|LOCUS_12240 6017 6556 gene locus_tag LOCUS_12250 gene rplE 6017 6556 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 protein_id gnl|my_center|LOCUS_12250 6571 6876 gene locus_tag LOCUS_12260 gene rpsN 6571 6876 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 protein_id gnl|my_center|LOCUS_12260 6910 7302 gene locus_tag LOCUS_12270 gene rpsH 6910 7302 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 protein_id gnl|my_center|LOCUS_12270 7315 7848 gene locus_tag LOCUS_12280 gene rplF 7315 7848 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 protein_id gnl|my_center|LOCUS_12280 7858 8211 gene locus_tag LOCUS_12290 gene rplR 7858 8211 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 protein_id gnl|my_center|LOCUS_12290 8226 8729 gene locus_tag LOCUS_12300 gene rpsE 8226 8729 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 protein_id gnl|my_center|LOCUS_12300 8733 8912 gene locus_tag LOCUS_12310 gene rpmD 8733 8912 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 protein_id gnl|my_center|LOCUS_12310 8916 9350 gene locus_tag LOCUS_12320 gene rplO 8916 9350 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 protein_id gnl|my_center|LOCUS_12320 9358 10689 gene locus_tag LOCUS_12330 gene secY 9358 10689 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 protein_id gnl|my_center|LOCUS_12330 10984 11340 gene locus_tag LOCUS_12340 gene rpsM 10984 11340 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 protein_id gnl|my_center|LOCUS_12340 11357 11746 gene locus_tag LOCUS_12350 gene rpsK 11357 11746 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 protein_id gnl|my_center|LOCUS_12350 11780 12400 gene locus_tag LOCUS_12360 gene rpsD 11780 12400 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 protein_id gnl|my_center|LOCUS_12360 12426 13415 gene locus_tag LOCUS_12370 gene rpoA 12426 13415 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 protein_id gnl|my_center|LOCUS_12370 13456 13839 gene locus_tag LOCUS_12380 gene rplQ 13456 13839 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 protein_id gnl|my_center|LOCUS_12380 13945 14313 gene locus_tag LOCUS_12390 13945 14313 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266488.1 protein_id gnl|my_center|LOCUS_12390 14324 14749 gene locus_tag LOCUS_12400 gene zntR 14324 14749 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 protein_id gnl|my_center|LOCUS_12400 14805 15023 gene locus_tag LOCUS_12410 gene arfA 14805 15023 CDS product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 protein_id gnl|my_center|LOCUS_12410 15430 15020 gene locus_tag LOCUS_12420 gene mscL 15430 15020 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022442.1 protein_id gnl|my_center|LOCUS_12420 16936 15560 gene locus_tag LOCUS_12430 gene trkA 16936 15560 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 protein_id gnl|my_center|LOCUS_12430 18247 16958 gene locus_tag LOCUS_12440 gene rsmB 18247 16958 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744779.1 protein_id gnl|my_center|LOCUS_12440 19240 18293 gene locus_tag LOCUS_12450 gene fmt 19240 18293 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004454.1 protein_id gnl|my_center|LOCUS_12450 19764 19255 gene locus_tag LOCUS_12460 gene def 19764 19255 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114984.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence042 501 217 gene locus_tag LOCUS_12470 501 217 CDS product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001686573.1 protein_id gnl|my_center|LOCUS_12470 1675 713 gene locus_tag LOCUS_12480 1675 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2377 1694 gene locus_tag LOCUS_12490 2377 1694 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372609.1 protein_id gnl|my_center|LOCUS_12490 2643 2377 gene locus_tag LOCUS_12500 2643 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2932 2606 gene locus_tag LOCUS_12510 2932 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12510 4639 2939 gene locus_tag LOCUS_12520 gene traD 4639 2939 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12520 5043 4636 gene locus_tag LOCUS_12530 5043 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5573 5040 gene locus_tag LOCUS_12540 5573 5040 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741281.1 protein_id gnl|my_center|LOCUS_12540 6199 5549 gene locus_tag LOCUS_12550 6199 5549 CDS product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734461.1 protein_id gnl|my_center|LOCUS_12550 6814 6206 gene locus_tag LOCUS_12560 6814 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 7270 6839 gene locus_tag LOCUS_12570 7270 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7807 7391 gene locus_tag LOCUS_12580 7807 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8171 8389 gene locus_tag LOCUS_12590 8171 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 8989 8495 gene locus_tag LOCUS_12600 8989 8495 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_12600 9677 8979 gene locus_tag LOCUS_12610 9677 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 10287 13085 gene locus_tag LOCUS_12620 10287 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 13100 14764 gene locus_tag LOCUS_12630 13100 14764 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_12630 14761 16314 gene locus_tag LOCUS_12640 14761 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 16311 18101 gene locus_tag LOCUS_12650 16311 18101 CDS product restriction system-associated AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 protein_id gnl|my_center|LOCUS_12650 18101 19189 gene locus_tag LOCUS_12660 18101 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 protein_id gnl|my_center|LOCUS_12660 19683 19279 gene locus_tag LOCUS_12670 19683 19279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence043 1362 469 gene locus_tag LOCUS_12680 gene nadC 1362 469 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135168.1 protein_id gnl|my_center|LOCUS_12680 1450 2001 gene locus_tag LOCUS_12690 gene ampD 1450 2001 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923726.1 protein_id gnl|my_center|LOCUS_12690 1998 2852 gene locus_tag LOCUS_12700 gene ampE 1998 2852 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 protein_id gnl|my_center|LOCUS_12700 4268 2895 gene locus_tag LOCUS_12710 gene aroP 4268 2895 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 protein_id gnl|my_center|LOCUS_12710 4809 5573 gene locus_tag LOCUS_12720 gene pdhR 4809 5573 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 protein_id gnl|my_center|LOCUS_12720 5734 8397 gene locus_tag LOCUS_12730 gene aceE 5734 8397 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 protein_id gnl|my_center|LOCUS_12730 8412 10304 gene locus_tag LOCUS_12740 gene aceF 8412 10304 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 protein_id gnl|my_center|LOCUS_12740 10629 12053 gene locus_tag LOCUS_12750 gene lpdA 10629 12053 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 protein_id gnl|my_center|LOCUS_12750 13881 12124 gene locus_tag LOCUS_12760 13881 12124 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784502.1 protein_id gnl|my_center|LOCUS_12760 14236 16833 gene locus_tag LOCUS_12770 gene acnB 14236 16833 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 protein_id gnl|my_center|LOCUS_12770 17008 17370 gene locus_tag LOCUS_12780 gene yacL 17008 17370 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 protein_id gnl|my_center|LOCUS_12780 18202 17408 gene locus_tag LOCUS_12790 gene speD 18202 17408 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 protein_id gnl|my_center|LOCUS_12790 19084 18218 gene locus_tag LOCUS_12800 gene speE 19084 18218 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 protein_id gnl|my_center|LOCUS_12800 19537 19190 gene locus_tag LOCUS_12810 19537 19190 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence044 720 193 gene locus_tag LOCUS_12820 gene mobB 720 193 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907622.1 protein_id gnl|my_center|LOCUS_12820 1286 702 gene locus_tag LOCUS_12830 gene mobA 1286 702 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 protein_id gnl|my_center|LOCUS_12830 1356 1625 gene locus_tag LOCUS_12840 1356 1625 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 protein_id gnl|my_center|LOCUS_12840 1702 2688 gene locus_tag LOCUS_12850 gene srkA 1702 2688 CDS product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065516.1 protein_id gnl|my_center|LOCUS_12850 2705 3331 gene locus_tag LOCUS_12860 gene dsbA 2705 3331 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 protein_id gnl|my_center|LOCUS_12860 3486 4916 gene locus_tag LOCUS_12870 3486 4916 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354487.1 protein_id gnl|my_center|LOCUS_12870 5700 4957 gene locus_tag LOCUS_12880 5700 4957 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311257.1 protein_id gnl|my_center|LOCUS_12880 5735 5953 gene locus_tag LOCUS_12890 5735 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 6194 6009 gene locus_tag LOCUS_12900 6194 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010556.1 protein_id gnl|my_center|LOCUS_12900 6253 9039 gene locus_tag LOCUS_12910 gene polA 6253 9039 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 protein_id gnl|my_center|LOCUS_12910 10053 9421 gene locus_tag LOCUS_12920 gene yihA 10053 9421 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 protein_id gnl|my_center|LOCUS_12920 10636 11145 gene locus_tag LOCUS_12930 gene yihI 10636 11145 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 protein_id gnl|my_center|LOCUS_12930 11334 12707 gene locus_tag LOCUS_12940 gene hemN 11334 12707 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 protein_id gnl|my_center|LOCUS_12940 14528 13119 gene locus_tag LOCUS_12950 gene glnG 14528 13119 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188776.1 protein_id gnl|my_center|LOCUS_12950 15589 14540 gene locus_tag LOCUS_12960 gene glnL 15589 14540 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 protein_id gnl|my_center|LOCUS_12960 17172 15763 gene locus_tag LOCUS_12970 gene glnA 17172 15763 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence045 1581 4 gene locus_tag LOCUS_12980 gene guaA 1581 4 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138282.1 protein_id gnl|my_center|LOCUS_12980 3116 1650 gene locus_tag LOCUS_12990 gene guaB 3116 1650 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 protein_id gnl|my_center|LOCUS_12990 3278 4648 gene locus_tag LOCUS_13000 gene xseA 3278 4648 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937933.1 protein_id gnl|my_center|LOCUS_13000 4860 4645 gene locus_tag LOCUS_13010 4860 4645 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100125.1 protein_id gnl|my_center|LOCUS_13010 6402 4930 gene locus_tag LOCUS_13020 gene der 6402 4930 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 protein_id gnl|my_center|LOCUS_13020 7698 6520 gene locus_tag LOCUS_13030 gene bamB 7698 6520 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177048.1 protein_id gnl|my_center|LOCUS_13030 8329 7709 gene locus_tag LOCUS_13040 gene yfgM 8329 7709 CDS product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 protein_id gnl|my_center|LOCUS_13040 9621 8347 gene locus_tag LOCUS_13050 gene hisS 9621 8347 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 protein_id gnl|my_center|LOCUS_13050 10850 9732 gene locus_tag LOCUS_13060 gene ispG 10850 9732 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 protein_id gnl|my_center|LOCUS_13060 11890 10877 gene locus_tag LOCUS_13070 gene rodZ 11890 10877 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090850.1 protein_id gnl|my_center|LOCUS_13070 13329 12175 gene locus_tag LOCUS_13080 13329 12175 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 protein_id gnl|my_center|LOCUS_13080 13910 13479 gene locus_tag LOCUS_13090 gene ndk 13910 13479 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 protein_id gnl|my_center|LOCUS_13090 16236 14059 gene locus_tag LOCUS_13100 gene pbpC 16236 14059 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137711.1 protein_id gnl|my_center|LOCUS_13100 <19321 16372 gene locus_tag LOCUS_13110 <19321 16372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000736260.1:alpha2-macroglobulin >Feature sequence046 <1 1275 gene locus_tag LOCUS_13120 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001025145.1:type II secretion system protein GspE 1265 2467 gene locus_tag LOCUS_13130 gene hofC 1265 2467 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157266.1 protein_id gnl|my_center|LOCUS_13130 3545 2502 gene locus_tag LOCUS_13140 gene guaC 3545 2502 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 protein_id gnl|my_center|LOCUS_13140 3770 4390 gene locus_tag LOCUS_13150 gene coaE 3770 4390 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 protein_id gnl|my_center|LOCUS_13150 4390 5133 gene locus_tag LOCUS_13160 gene zapD 4390 5133 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 protein_id gnl|my_center|LOCUS_13160 5143 5340 gene locus_tag LOCUS_13170 gene yacG 5143 5340 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 protein_id gnl|my_center|LOCUS_13170 5945 5556 gene locus_tag LOCUS_13180 gene mutT 5945 5556 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736007.1 protein_id gnl|my_center|LOCUS_13180 8710 6005 gene locus_tag LOCUS_13190 gene secA 8710 6005 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905780.1 protein_id gnl|my_center|LOCUS_13190 9359 8772 gene locus_tag LOCUS_13200 gene secM 9359 8772 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 protein_id gnl|my_center|LOCUS_13200 10432 9515 gene locus_tag LOCUS_13210 gene lpxC 10432 9515 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 protein_id gnl|my_center|LOCUS_13210 11684 10533 gene locus_tag LOCUS_13220 gene ftsZ 11684 10533 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 protein_id gnl|my_center|LOCUS_13220 13007 11745 gene locus_tag LOCUS_13230 gene ftsA 13007 11745 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 protein_id gnl|my_center|LOCUS_13230 13834 13004 gene locus_tag LOCUS_13240 gene ftsQ 13834 13004 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075744.1 protein_id gnl|my_center|LOCUS_13240 14756 13836 gene locus_tag LOCUS_13250 gene ddlB 14756 13836 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 protein_id gnl|my_center|LOCUS_13250 16224 14749 gene locus_tag LOCUS_13260 gene murC 16224 14749 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096049.1 protein_id gnl|my_center|LOCUS_13260 17345 16278 gene locus_tag LOCUS_13270 gene murG 17345 16278 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016560.1 protein_id gnl|my_center|LOCUS_13270 18586 17342 gene locus_tag LOCUS_13280 gene ftsW 18586 17342 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence047 1287 505 gene locus_tag LOCUS_13290 gene nanR 1287 505 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523845.1 protein_id gnl|my_center|LOCUS_13290 1676 3043 gene locus_tag LOCUS_13300 gene dcuC 1676 3043 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 protein_id gnl|my_center|LOCUS_13300 3583 3086 gene locus_tag LOCUS_13310 gene sspB 3583 3086 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 protein_id gnl|my_center|LOCUS_13310 4227 3589 gene locus_tag LOCUS_13320 gene sspA 4227 3589 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 protein_id gnl|my_center|LOCUS_13320 5014 4622 gene locus_tag LOCUS_13330 gene rpsI 5014 4622 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_13330 5458 5030 gene locus_tag LOCUS_13340 gene rplM 5458 5030 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_13340 6648 5677 gene locus_tag LOCUS_13350 gene zapE 6648 5677 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192344.1 protein_id gnl|my_center|LOCUS_13350 6998 7396 gene locus_tag LOCUS_13360 gene zapG 6998 7396 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 protein_id gnl|my_center|LOCUS_13360 7550 8917 gene locus_tag LOCUS_13370 gene degQ 7550 8917 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 protein_id gnl|my_center|LOCUS_13370 9007 10074 gene locus_tag LOCUS_13380 gene degS 9007 10074 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497723.1 protein_id gnl|my_center|LOCUS_13380 11075 10137 gene locus_tag LOCUS_13390 gene mdh 11075 10137 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 protein_id gnl|my_center|LOCUS_13390 11510 11980 gene locus_tag LOCUS_13400 gene argR 11510 11980 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 protein_id gnl|my_center|LOCUS_13400 12296 12610 gene locus_tag LOCUS_13410 gene yhcN 12296 12610 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 protein_id gnl|my_center|LOCUS_13410 12938 12666 gene locus_tag LOCUS_13420 12938 12666 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029005.1 protein_id gnl|my_center|LOCUS_13420 14997 13030 gene locus_tag LOCUS_13430 gene aaeB 14997 13030 CDS product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 protein_id gnl|my_center|LOCUS_13430 15935 15003 gene locus_tag LOCUS_13440 gene aaeA 15935 15003 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854033.1 protein_id gnl|my_center|LOCUS_13440 16215 15943 gene locus_tag LOCUS_13450 gene aaeX 16215 15943 CDS product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116614.1 protein_id gnl|my_center|LOCUS_13450 16329 17258 gene locus_tag LOCUS_13460 gene aaeR 16329 17258 CDS product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440317.1 protein_id gnl|my_center|LOCUS_13460 <18472 17386 gene locus_tag LOCUS_13470 <18472 17386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000055909.1:metalloprotease TldD >Feature sequence048 <1 697 gene locus_tag LOCUS_13480 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064528964.1:leucine--tRNA ligase 712 1293 gene locus_tag LOCUS_13490 gene lptE 712 1293 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269673.1 protein_id gnl|my_center|LOCUS_13490 1293 2324 gene locus_tag LOCUS_13500 gene holA 1293 2324 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620503.1 protein_id gnl|my_center|LOCUS_13500 2326 2967 gene locus_tag LOCUS_13510 gene nadD 2326 2967 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838889.1 protein_id gnl|my_center|LOCUS_13510 2991 3602 gene locus_tag LOCUS_13520 2991 3602 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351014.1 protein_id gnl|my_center|LOCUS_13520 3862 4179 gene locus_tag LOCUS_13530 gene rsfS 3862 4179 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 protein_id gnl|my_center|LOCUS_13530 4183 4650 gene locus_tag LOCUS_13540 gene rlmH 4183 4650 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776104.1 protein_id gnl|my_center|LOCUS_13540 4681 6582 gene locus_tag LOCUS_13550 gene mrdA 4681 6582 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 protein_id gnl|my_center|LOCUS_13550 6585 7697 gene locus_tag LOCUS_13560 gene mrdB 6585 7697 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 protein_id gnl|my_center|LOCUS_13560 7708 8796 gene locus_tag LOCUS_13570 gene rlpA 7708 8796 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231428.1 protein_id gnl|my_center|LOCUS_13570 8936 10147 gene locus_tag LOCUS_13580 gene dacA 8936 10147 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 protein_id gnl|my_center|LOCUS_13580 10258 10521 gene locus_tag LOCUS_13590 gene ybeD 10258 10521 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850550.1 protein_id gnl|my_center|LOCUS_13590 10622 11263 gene locus_tag LOCUS_13600 gene lipB 10622 11263 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284027.1 protein_id gnl|my_center|LOCUS_13600 11522 12475 gene locus_tag LOCUS_13610 11522 12475 CDS product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378026.1 protein_id gnl|my_center|LOCUS_13610 12684 13649 gene locus_tag LOCUS_13620 gene lipA 12684 13649 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 protein_id gnl|my_center|LOCUS_13620 13953 13750 gene locus_tag LOCUS_13630 gene tatE 13953 13750 CDS product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 protein_id gnl|my_center|LOCUS_13630 14870 14082 gene locus_tag LOCUS_13640 14870 14082 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 protein_id gnl|my_center|LOCUS_13640 14963 15346 gene locus_tag LOCUS_13650 gene crcB 14963 15346 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939738.1 protein_id gnl|my_center|LOCUS_13650 15609 15400 gene locus_tag LOCUS_13660 gene cspE 15609 15400 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034825.1 protein_id gnl|my_center|LOCUS_13660 16344 15784 gene locus_tag LOCUS_13670 gene pagP 16344 15784 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103094.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence049 8399 7491 gene locus_tag LOCUS_13680 8399 7491 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_13680 9076 8387 gene locus_tag LOCUS_13690 9076 8387 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_13690 9510 9073 gene locus_tag LOCUS_13700 9510 9073 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_13700 9862 9659 gene locus_tag LOCUS_13710 9862 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 10367 9852 gene locus_tag LOCUS_13720 10367 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 11263 10376 gene locus_tag LOCUS_13730 11263 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 13086 11263 gene locus_tag LOCUS_13740 13086 11263 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_13740 14698 13073 gene locus_tag LOCUS_13750 14698 13073 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_13750 14974 14792 gene locus_tag LOCUS_13760 14974 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 15437 15198 gene locus_tag LOCUS_13770 15437 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 17920 16337 gene locus_tag LOCUS_13780 17920 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence050 1291 1422 gene locus_tag LOCUS_13790 gene sgrT 1291 1422 CDS product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248770.1 protein_id gnl|my_center|LOCUS_13790 1400 1651 gene locus_tag LOCUS_13800 1400 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1542 2702 gene locus_tag LOCUS_13810 gene setA 1542 2702 CDS product sugar efflux transporter SetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637846.1 protein_id gnl|my_center|LOCUS_13810 3356 2751 gene locus_tag LOCUS_13820 gene leuD 3356 2751 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818228.1 protein_id gnl|my_center|LOCUS_13820 4767 3367 gene locus_tag LOCUS_13830 gene leuC 4767 3367 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 protein_id gnl|my_center|LOCUS_13830 5861 4770 gene locus_tag LOCUS_13840 gene leuB 5861 4770 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042353.1 protein_id gnl|my_center|LOCUS_13840 7432 5861 gene locus_tag LOCUS_13850 gene leuA 7432 5861 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082850.1 protein_id gnl|my_center|LOCUS_13850 8271 9215 gene locus_tag LOCUS_13860 gene leuO 8271 9215 CDS product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115472.1 protein_id gnl|my_center|LOCUS_13860 9533 11257 gene locus_tag LOCUS_13870 gene ilvI 9533 11257 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295534.1 protein_id gnl|my_center|LOCUS_13870 11260 11751 gene locus_tag LOCUS_13880 gene ilvN 11260 11751 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300383.1 protein_id gnl|my_center|LOCUS_13880 11931 12935 gene locus_tag LOCUS_13890 gene cra 11931 12935 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 protein_id gnl|my_center|LOCUS_13890 13537 13995 gene locus_tag LOCUS_13900 gene mraZ 13537 13995 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295533.1 protein_id gnl|my_center|LOCUS_13900 13997 14938 gene locus_tag LOCUS_13910 gene rsmH 13997 14938 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 protein_id gnl|my_center|LOCUS_13910 14935 15300 gene locus_tag LOCUS_13920 gene ftsL 14935 15300 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625658.1 protein_id gnl|my_center|LOCUS_13920 15316 17082 gene locus_tag LOCUS_13930 gene ftsI 15316 17082 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence051 1674 916 gene locus_tag LOCUS_13940 gene gph 1674 916 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032691.1 protein_id gnl|my_center|LOCUS_13940 2344 1667 gene locus_tag LOCUS_13950 gene rpe 2344 1667 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 protein_id gnl|my_center|LOCUS_13950 3198 2362 gene locus_tag LOCUS_13960 gene dam 3198 2362 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 protein_id gnl|my_center|LOCUS_13960 4591 3305 gene locus_tag LOCUS_13970 gene damX 4591 3305 CDS product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343178.1 protein_id gnl|my_center|LOCUS_13970 5771 4683 gene locus_tag LOCUS_13980 gene aroB 5771 4683 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 protein_id gnl|my_center|LOCUS_13980 6313 5828 gene locus_tag LOCUS_13990 6313 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7988 6750 gene locus_tag LOCUS_14000 gene hofQ 7988 6750 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815987.1 protein_id gnl|my_center|LOCUS_14000 8304 7900 gene locus_tag LOCUS_14010 gene hofP 8304 7900 CDS product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 protein_id gnl|my_center|LOCUS_14010 8734 8294 gene locus_tag LOCUS_14020 gene hofO 8734 8294 CDS product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055760.1 protein_id gnl|my_center|LOCUS_14020 9257 8718 gene locus_tag LOCUS_14030 gene hofN 9257 8718 CDS product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 protein_id gnl|my_center|LOCUS_14030 10036 9257 gene locus_tag LOCUS_14040 gene hofM 10036 9257 CDS product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295166.1 protein_id gnl|my_center|LOCUS_14040 10177 12708 gene locus_tag LOCUS_14050 gene mrcA 10177 12708 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 protein_id gnl|my_center|LOCUS_14050 13433 12873 gene locus_tag LOCUS_14060 gene nudE 13433 12873 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 protein_id gnl|my_center|LOCUS_14060 13753 15888 gene locus_tag LOCUS_14070 gene igaA 13753 15888 CDS product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104518.1 protein_id gnl|my_center|LOCUS_14070 15953 16621 gene locus_tag LOCUS_14080 gene yrfG 15953 16621 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936227.1 protein_id gnl|my_center|LOCUS_14080 16632 17033 gene locus_tag LOCUS_14090 gene hslR 16632 17033 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 protein_id gnl|my_center|LOCUS_14090 17058 17936 gene locus_tag LOCUS_14100 gene hslO 17058 17936 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135574.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence052 2179 3129 gene locus_tag LOCUS_14110 gene tal 2179 3129 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 protein_id gnl|my_center|LOCUS_14110 3149 5152 gene locus_tag LOCUS_14120 gene tkt 3149 5152 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087280.1 protein_id gnl|my_center|LOCUS_14120 6131 5247 gene locus_tag LOCUS_14130 6131 5247 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 protein_id gnl|my_center|LOCUS_14130 6991 6416 gene locus_tag LOCUS_14140 gene nudK 6991 6416 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193711.1 protein_id gnl|my_center|LOCUS_14140 9038 7059 gene locus_tag LOCUS_14150 gene aegA 9038 7059 CDS product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 protein_id gnl|my_center|LOCUS_14150 9229 10944 gene locus_tag LOCUS_14160 gene narQ 9229 10944 CDS product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350312.1 protein_id gnl|my_center|LOCUS_14160 11108 11290 gene locus_tag LOCUS_14170 11108 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 11287 14220 gene locus_tag LOCUS_14180 gene acrD 11287 14220 CDS product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273151.1 protein_id gnl|my_center|LOCUS_14180 14759 15115 gene locus_tag LOCUS_14190 14759 15115 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258247.1 protein_id gnl|my_center|LOCUS_14190 15119 16246 gene locus_tag LOCUS_14200 gene dapE 15119 16246 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277801.1 protein_id gnl|my_center|LOCUS_14200 16274 16474 gene locus_tag LOCUS_14210 16274 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 17282 16584 gene locus_tag LOCUS_14220 gene ypfH 17282 16584 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679812.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence053 1211 444 gene locus_tag LOCUS_14230 gene ygbI 1211 444 CDS product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300386.1 protein_id gnl|my_center|LOCUS_14230 1407 2315 gene locus_tag LOCUS_14240 1407 2315 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 protein_id gnl|my_center|LOCUS_14240 2312 3574 gene locus_tag LOCUS_14250 2312 3574 CDS product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 protein_id gnl|my_center|LOCUS_14250 3571 4209 gene locus_tag LOCUS_14260 3571 4209 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 protein_id gnl|my_center|LOCUS_14260 4214 4990 gene locus_tag LOCUS_14270 4214 4990 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136918.1 protein_id gnl|my_center|LOCUS_14270 5124 6443 gene locus_tag LOCUS_14280 5124 6443 CDS product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104428.1 protein_id gnl|my_center|LOCUS_14280 6719 6483 gene locus_tag LOCUS_14290 6719 6483 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562982.1 protein_id gnl|my_center|LOCUS_14290 8157 6730 gene locus_tag LOCUS_14300 8157 6730 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863203.1 protein_id gnl|my_center|LOCUS_14300 8750 8157 gene locus_tag LOCUS_14310 8750 8157 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767718.1 protein_id gnl|my_center|LOCUS_14310 8897 9304 gene locus_tag LOCUS_14320 8897 9304 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208070.1 protein_id gnl|my_center|LOCUS_14320 10417 9425 gene locus_tag LOCUS_14330 gene rpoS 10417 9425 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 protein_id gnl|my_center|LOCUS_14330 11619 10480 gene locus_tag LOCUS_14340 gene nlpD 11619 10480 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 protein_id gnl|my_center|LOCUS_14340 12385 11759 gene locus_tag LOCUS_14350 gene pcm 12385 11759 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 protein_id gnl|my_center|LOCUS_14350 13140 12379 gene locus_tag LOCUS_14360 gene surE 13140 12379 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 protein_id gnl|my_center|LOCUS_14360 14170 13121 gene locus_tag LOCUS_14370 gene truD 14170 13121 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568943.1 protein_id gnl|my_center|LOCUS_14370 14646 14167 gene locus_tag LOCUS_14380 gene ispF 14646 14167 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 protein_id gnl|my_center|LOCUS_14380 15356 14646 gene locus_tag LOCUS_14390 gene ispD 15356 14646 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 protein_id gnl|my_center|LOCUS_14390 15686 15375 gene locus_tag LOCUS_14400 gene ftsB 15686 15375 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 protein_id gnl|my_center|LOCUS_14400 15895 15674 gene locus_tag LOCUS_14410 15895 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 16203 15880 gene locus_tag LOCUS_14420 16203 15880 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 protein_id gnl|my_center|LOCUS_14420 16858 16253 gene locus_tag LOCUS_14430 gene cysC 16858 16253 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 protein_id gnl|my_center|LOCUS_14430 <17643 16858 gene locus_tag LOCUS_14440 <17643 16858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001090340.1:sulfate adenylyltransferase subunit CysN >Feature sequence054 <1 1001 gene locus_tag LOCUS_14450 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000083065.1:hydrogenase 2 large subunit 1001 1495 gene locus_tag LOCUS_14460 1001 1495 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221939.1 protein_id gnl|my_center|LOCUS_14460 1488 1976 gene locus_tag LOCUS_14470 gene hybE 1488 1976 CDS product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 protein_id gnl|my_center|LOCUS_14470 1969 2310 gene locus_tag LOCUS_14480 gene hypA 1969 2310 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544953.1 protein_id gnl|my_center|LOCUS_14480 2323 2571 gene locus_tag LOCUS_14490 gene hybG 2323 2571 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 protein_id gnl|my_center|LOCUS_14490 3560 2694 gene locus_tag LOCUS_14500 gene yghU 3560 2694 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 protein_id gnl|my_center|LOCUS_14500 3765 5624 gene locus_tag LOCUS_14510 gene gss 3765 5624 CDS product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295514.1 protein_id gnl|my_center|LOCUS_14510 5916 7415 gene locus_tag LOCUS_14520 gene pitB 5916 7415 CDS product inorganic phosphate transporter PitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933302.1 protein_id gnl|my_center|LOCUS_14520 8156 7464 gene locus_tag LOCUS_14530 8156 7464 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190781.1 protein_id gnl|my_center|LOCUS_14530 8369 9043 gene locus_tag LOCUS_14540 8369 9043 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076097.1 protein_id gnl|my_center|LOCUS_14540 9075 9833 gene locus_tag LOCUS_14550 9075 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339532.1 protein_id gnl|my_center|LOCUS_14550 9879 11228 gene locus_tag LOCUS_14560 9879 11228 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896889.1 protein_id gnl|my_center|LOCUS_14560 11228 12052 gene locus_tag LOCUS_14570 11228 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984978.1 protein_id gnl|my_center|LOCUS_14570 12064 12624 gene locus_tag LOCUS_14580 12064 12624 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298770.1 protein_id gnl|my_center|LOCUS_14580 12655 13725 gene locus_tag LOCUS_14590 gene lptF 12655 13725 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 protein_id gnl|my_center|LOCUS_14590 13722 14801 gene locus_tag LOCUS_14600 gene lptG 13722 14801 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296409.1 protein_id gnl|my_center|LOCUS_14600 15391 14837 gene locus_tag LOCUS_14610 15391 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 16008 15388 gene locus_tag LOCUS_14620 16008 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14620 16256 16008 gene locus_tag LOCUS_14630 16256 16008 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 protein_id gnl|my_center|LOCUS_14630 17202 16288 gene locus_tag LOCUS_14640 17202 16288 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077177.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence055 2952 379 gene locus_tag LOCUS_14650 gene clpB 2952 379 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235102.1 protein_id gnl|my_center|LOCUS_14650 3813 3082 gene locus_tag LOCUS_14660 gene yfiH 3813 3082 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040130.1 protein_id gnl|my_center|LOCUS_14660 4790 3810 gene locus_tag LOCUS_14670 gene rluD 4790 3810 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079100.1 protein_id gnl|my_center|LOCUS_14670 4925 5662 gene locus_tag LOCUS_14680 gene bamD 4925 5662 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197686.1 protein_id gnl|my_center|LOCUS_14680 5933 6274 gene locus_tag LOCUS_14690 gene raiA 5933 6274 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178456.1 protein_id gnl|my_center|LOCUS_14690 6524 7684 gene locus_tag LOCUS_14700 gene pheA 6524 7684 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200116.1 protein_id gnl|my_center|LOCUS_14700 8848 7727 gene locus_tag LOCUS_14710 gene tyrA 8848 7727 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225204.1 protein_id gnl|my_center|LOCUS_14710 9929 8859 gene locus_tag LOCUS_14720 gene aroF 9929 8859 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168045.1 protein_id gnl|my_center|LOCUS_14720 10139 10504 gene locus_tag LOCUS_14730 10139 10504 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976004.1 protein_id gnl|my_center|LOCUS_14730 10654 11172 gene locus_tag LOCUS_14740 10654 11172 CDS product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212391.1 protein_id gnl|my_center|LOCUS_14740 11162 12388 gene locus_tag LOCUS_14750 gene dgcN 11162 12388 CDS product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969032.1 protein_id gnl|my_center|LOCUS_14750 12404 12886 gene locus_tag LOCUS_14760 12404 12886 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589828.1 protein_id gnl|my_center|LOCUS_14760 13309 12962 gene locus_tag LOCUS_14770 gene rplS 13309 12962 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_14770 14118 13351 gene locus_tag LOCUS_14780 gene trmD 14118 13351 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_14780 14697 14149 gene locus_tag LOCUS_14790 gene rimM 14697 14149 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_14790 14964 14716 gene locus_tag LOCUS_14800 gene rpsP 14964 14716 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 protein_id gnl|my_center|LOCUS_14800 16462 15101 gene locus_tag LOCUS_14810 gene ffh 16462 15101 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 protein_id gnl|my_center|LOCUS_14810 16811 16575 gene locus_tag LOCUS_14820 16811 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence056 90 938 gene locus_tag LOCUS_14830 gene focB 90 938 CDS product formate transporter FocB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244732.1 protein_id gnl|my_center|LOCUS_14830 2037 976 gene locus_tag LOCUS_14840 2037 976 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892044.1 protein_id gnl|my_center|LOCUS_14840 2250 3713 gene locus_tag LOCUS_14850 gene bepA 2250 3713 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 protein_id gnl|my_center|LOCUS_14850 3734 4093 gene locus_tag LOCUS_14860 gene arsC 3734 4093 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 protein_id gnl|my_center|LOCUS_14860 4977 4231 gene locus_tag LOCUS_14870 4977 4231 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 protein_id gnl|my_center|LOCUS_14870 6316 5027 gene locus_tag LOCUS_14880 gene uraA 6316 5027 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198328.1 protein_id gnl|my_center|LOCUS_14880 7028 6402 gene locus_tag LOCUS_14890 gene upp 7028 6402 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 protein_id gnl|my_center|LOCUS_14890 7338 8390 gene locus_tag LOCUS_14900 gene purM 7338 8390 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295474.1 protein_id gnl|my_center|LOCUS_14900 8390 9028 gene locus_tag LOCUS_14910 gene purN 8390 9028 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028614.1 protein_id gnl|my_center|LOCUS_14910 9193 11265 gene locus_tag LOCUS_14920 gene ppk1 9193 11265 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529576.1 protein_id gnl|my_center|LOCUS_14920 11270 12811 gene locus_tag LOCUS_14930 gene ppx 11270 12811 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121363.1 protein_id gnl|my_center|LOCUS_14930 13290 12850 gene locus_tag LOCUS_14940 13290 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14940 14924 13224 gene locus_tag LOCUS_14950 14924 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14950 15423 15271 gene locus_tag LOCUS_14960 15423 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017552.1 protein_id gnl|my_center|LOCUS_14960 15441 15632 gene locus_tag LOCUS_14970 15441 15632 CDS product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 protein_id gnl|my_center|LOCUS_14970 15946 16461 gene locus_tag LOCUS_14980 15946 16461 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295476.1 protein_id gnl|my_center|LOCUS_14980 16477 17016 gene locus_tag LOCUS_14990 16477 17016 CDS product DUF5384 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755173.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence057 <1 606 gene locus_tag LOCUS_15000 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001273738.1:galactarate dehydratase 755 1090 gene locus_tag LOCUS_15010 gene prlF 755 1090 CDS product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307405.1 protein_id gnl|my_center|LOCUS_15010 1090 1554 gene locus_tag LOCUS_15020 gene yhaV 1090 1554 CDS product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347267.1 protein_id gnl|my_center|LOCUS_15020 2418 1609 gene locus_tag LOCUS_15030 gene agaR 2418 1609 CDS product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 protein_id gnl|my_center|LOCUS_15030 2667 3947 gene locus_tag LOCUS_15040 gene kbaZ 2667 3947 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 protein_id gnl|my_center|LOCUS_15040 3970 4443 gene locus_tag LOCUS_15050 gene agaV 3970 4443 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295547.1 protein_id gnl|my_center|LOCUS_15050 4454 5233 gene locus_tag LOCUS_15060 gene agaW 4454 5233 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 protein_id gnl|my_center|LOCUS_15060 5223 6101 gene locus_tag LOCUS_15070 gene agaE 5223 6101 CDS product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295548.1 protein_id gnl|my_center|LOCUS_15070 6119 6553 gene locus_tag LOCUS_15080 gene agaF 6119 6553 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 protein_id gnl|my_center|LOCUS_15080 6550 7683 gene locus_tag LOCUS_15090 gene nagA 6550 7683 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326138.1 protein_id gnl|my_center|LOCUS_15090 8034 9188 gene locus_tag LOCUS_15100 8034 9188 CDS product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114869.1 protein_id gnl|my_center|LOCUS_15100 9201 10061 gene locus_tag LOCUS_15110 gene kbaY 9201 10061 CDS product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 protein_id gnl|my_center|LOCUS_15110 10228 10704 gene locus_tag LOCUS_15120 gene agaB 10228 10704 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 protein_id gnl|my_center|LOCUS_15120 10743 11342 gene locus_tag LOCUS_15130 10743 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 11291 11545 gene locus_tag LOCUS_15140 11291 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15140 11535 12326 gene locus_tag LOCUS_15150 gene agaD 11535 12326 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 protein_id gnl|my_center|LOCUS_15150 12381 13082 gene locus_tag LOCUS_15160 12381 13082 CDS product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311150.1 protein_id gnl|my_center|LOCUS_15160 13483 14067 gene locus_tag LOCUS_15170 13483 14067 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045442.1 protein_id gnl|my_center|LOCUS_15170 14243 14842 gene locus_tag LOCUS_15180 14243 14842 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044775.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence058 2177 921 gene locus_tag LOCUS_15190 2177 921 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345347.1 protein_id gnl|my_center|LOCUS_15190 2477 2190 gene locus_tag LOCUS_15200 2477 2190 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705930.1 protein_id gnl|my_center|LOCUS_15200 2936 2493 gene locus_tag LOCUS_15210 2936 2493 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916805.1 protein_id gnl|my_center|LOCUS_15210 3207 4238 gene locus_tag LOCUS_15220 3207 4238 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416151.1 protein_id gnl|my_center|LOCUS_15220 5616 4765 gene locus_tag LOCUS_15230 5616 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15230 6035 5589 gene locus_tag LOCUS_15240 6035 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15240 6932 7258 gene locus_tag LOCUS_15250 6932 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 7812 7468 gene locus_tag LOCUS_15260 7812 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 8100 8414 gene locus_tag LOCUS_15270 8100 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 9738 8971 gene locus_tag LOCUS_15280 gene fecE 9738 8971 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175457.1 protein_id gnl|my_center|LOCUS_15280 10695 9739 gene locus_tag LOCUS_15290 gene fecD 10695 9739 CDS product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684856.1 protein_id gnl|my_center|LOCUS_15290 11690 10692 gene locus_tag LOCUS_15300 gene fecC 11690 10692 CDS product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125187.1 protein_id gnl|my_center|LOCUS_15300 12589 11687 gene locus_tag LOCUS_15310 gene fecB 12589 11687 CDS product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879153.1 protein_id gnl|my_center|LOCUS_15310 14958 12634 gene locus_tag LOCUS_15320 gene fecA 14958 12634 CDS product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188283.1 protein_id gnl|my_center|LOCUS_15320 15998 15045 gene locus_tag LOCUS_15330 gene fecR 15998 15045 CDS product fec operon regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068910.1 protein_id gnl|my_center|LOCUS_15330 16516 15995 gene locus_tag LOCUS_15340 gene fecI 16516 15995 CDS product RNA polymerase sigma factor FecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283626.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence059 158 2401 gene locus_tag LOCUS_15350 gene fhuA 158 2401 CDS product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 protein_id gnl|my_center|LOCUS_15350 2452 3249 gene locus_tag LOCUS_15360 gene fhuC 2452 3249 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158931.1 protein_id gnl|my_center|LOCUS_15360 3249 4139 gene locus_tag LOCUS_15370 gene fhuD 3249 4139 CDS product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015990.1 protein_id gnl|my_center|LOCUS_15370 4136 6118 gene locus_tag LOCUS_15380 gene fhuB 4136 6118 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044094.1 protein_id gnl|my_center|LOCUS_15380 7433 6153 gene locus_tag LOCUS_15390 gene hemL 7433 6153 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045290.1 protein_id gnl|my_center|LOCUS_15390 7658 9079 gene locus_tag LOCUS_15400 gene clcA 7658 9079 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 protein_id gnl|my_center|LOCUS_15400 9161 9505 gene locus_tag LOCUS_15410 gene erpA 9161 9505 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 protein_id gnl|my_center|LOCUS_15410 10175 9552 gene locus_tag LOCUS_15420 10175 9552 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 protein_id gnl|my_center|LOCUS_15420 11013 10213 gene locus_tag LOCUS_15430 gene btuF 11013 10213 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 protein_id gnl|my_center|LOCUS_15430 11704 11006 gene locus_tag LOCUS_15440 gene mtnN 11704 11006 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 protein_id gnl|my_center|LOCUS_15440 11788 13305 gene locus_tag LOCUS_15450 gene dgt 11788 13305 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057094.1 protein_id gnl|my_center|LOCUS_15450 13435 14859 gene locus_tag LOCUS_15460 gene degP 13435 14859 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753946.1 protein_id gnl|my_center|LOCUS_15460 15014 16171 gene locus_tag LOCUS_15470 gene cdaR 15014 16171 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 protein_id gnl|my_center|LOCUS_15470 16646 16260 gene locus_tag LOCUS_15480 16646 16260 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence060 1254 22 gene locus_tag LOCUS_15490 gene serA 1254 22 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151604.1 protein_id gnl|my_center|LOCUS_15490 2169 1510 gene locus_tag LOCUS_15500 gene rpiA 2169 1510 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_15500 2455 2225 gene locus_tag LOCUS_15510 2455 2225 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 protein_id gnl|my_center|LOCUS_15510 2597 3490 gene locus_tag LOCUS_15520 gene argP 2597 3490 CDS product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 protein_id gnl|my_center|LOCUS_15520 3694 5838 gene locus_tag LOCUS_15530 gene scpA 3694 5838 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073261.1 protein_id gnl|my_center|LOCUS_15530 5831 6826 gene locus_tag LOCUS_15540 gene meaB 5831 6826 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 protein_id gnl|my_center|LOCUS_15540 6837 7622 gene locus_tag LOCUS_15550 gene scpB 6837 7622 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069498.1 protein_id gnl|my_center|LOCUS_15550 7646 9124 gene locus_tag LOCUS_15560 gene scpC 7646 9124 CDS product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449941.1 protein_id gnl|my_center|LOCUS_15560 10017 9121 gene locus_tag LOCUS_15570 10017 9121 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 protein_id gnl|my_center|LOCUS_15570 10925 10185 gene locus_tag LOCUS_15580 10925 10185 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 protein_id gnl|my_center|LOCUS_15580 11653 11018 gene locus_tag LOCUS_15590 gene argO 11653 11018 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493360.1 protein_id gnl|my_center|LOCUS_15590 12652 11792 gene locus_tag LOCUS_15600 gene mscS 12652 11792 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 protein_id gnl|my_center|LOCUS_15600 14089 13010 gene locus_tag LOCUS_15610 gene fbaA 14089 13010 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 protein_id gnl|my_center|LOCUS_15610 15467 14304 gene locus_tag LOCUS_15620 gene pgk 15467 14304 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 protein_id gnl|my_center|LOCUS_15620 16536 15517 gene locus_tag LOCUS_15630 gene epd 16536 15517 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence061 2527 4812 gene locus_tag LOCUS_15640 gene nrdA 2527 4812 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075164.1 protein_id gnl|my_center|LOCUS_15640 4919 6088 gene locus_tag LOCUS_15650 gene nrdB 4919 6088 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299501.1 protein_id gnl|my_center|LOCUS_15650 6088 6342 gene locus_tag LOCUS_15660 gene yfaE 6088 6342 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135039.1 protein_id gnl|my_center|LOCUS_15660 7046 6396 gene locus_tag LOCUS_15670 gene inaA 7046 6396 CDS product lipopolysaccharide kinase InaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301050.1 protein_id gnl|my_center|LOCUS_15670 7261 7467 gene locus_tag LOCUS_15680 7261 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009396.1 protein_id gnl|my_center|LOCUS_15680 8585 7509 gene locus_tag LOCUS_15690 gene glpQ 8585 7509 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768975.1 protein_id gnl|my_center|LOCUS_15690 9948 8590 gene locus_tag LOCUS_15700 gene glpT 9948 8590 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948731.1 protein_id gnl|my_center|LOCUS_15700 10221 11849 gene locus_tag LOCUS_15710 gene glpA 10221 11849 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857257.1 protein_id gnl|my_center|LOCUS_15710 11839 13098 gene locus_tag LOCUS_15720 gene glpB 11839 13098 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209898.1 protein_id gnl|my_center|LOCUS_15720 13095 14285 gene locus_tag LOCUS_15730 gene glpC 13095 14285 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000358.1 protein_id gnl|my_center|LOCUS_15730 14479 15378 gene locus_tag LOCUS_15740 14479 15378 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140592.1 protein_id gnl|my_center|LOCUS_15740 15391 15576 gene locus_tag LOCUS_15750 15391 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150333.1 protein_id gnl|my_center|LOCUS_15750 16420 15617 gene locus_tag LOCUS_15760 gene yfaU 16420 15617 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence062 572 153 gene locus_tag LOCUS_15770 gene gspB 572 153 CDS product putative general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461450.1 protein_id gnl|my_center|LOCUS_15770 2043 574 gene locus_tag LOCUS_15780 gene gspA 2043 574 CDS product type II secretion system protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107576.1 protein_id gnl|my_center|LOCUS_15780 2223 3038 gene locus_tag LOCUS_15790 gene gspC 2223 3038 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142708.1 protein_id gnl|my_center|LOCUS_15790 3010 4974 gene locus_tag LOCUS_15800 gene gspD 3010 4974 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326512.1 protein_id gnl|my_center|LOCUS_15800 4984 6465 gene locus_tag LOCUS_15810 gene gspE 4984 6465 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219894.1 protein_id gnl|my_center|LOCUS_15810 6462 7658 gene locus_tag LOCUS_15820 gene gspF 6462 7658 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109573.1 protein_id gnl|my_center|LOCUS_15820 7668 8105 gene locus_tag LOCUS_15830 gene gspG 7668 8105 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202874.1 protein_id gnl|my_center|LOCUS_15830 8113 8622 gene locus_tag LOCUS_15840 gene gspH 8113 8622 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076046.1 protein_id gnl|my_center|LOCUS_15840 8619 8996 gene locus_tag LOCUS_15850 gene gspI 8619 8996 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041743.1 protein_id gnl|my_center|LOCUS_15850 8989 9576 gene locus_tag LOCUS_15860 gene gspJ 8989 9576 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610632.1 protein_id gnl|my_center|LOCUS_15860 9569 10552 gene locus_tag LOCUS_15870 gene gspK 9569 10552 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058522.1 protein_id gnl|my_center|LOCUS_15870 10567 11730 gene locus_tag LOCUS_15880 gene gspL 10567 11730 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115238.1 protein_id gnl|my_center|LOCUS_15880 11727 12188 gene locus_tag LOCUS_15890 gene gspM 11727 12188 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295161.1 protein_id gnl|my_center|LOCUS_15890 12188 12865 gene locus_tag LOCUS_15900 gene gspO 12188 12865 CDS product prepilin peptidase GspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178154.1 protein_id gnl|my_center|LOCUS_15900 13370 12894 gene locus_tag LOCUS_15910 gene bfr 13370 12894 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 protein_id gnl|my_center|LOCUS_15910 13636 13442 gene locus_tag LOCUS_15920 gene bfd 13636 13442 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289085.1 protein_id gnl|my_center|LOCUS_15920 16498 13805 gene locus_tag LOCUS_15930 gene chiA 16498 13805 CDS product bifunctional chitinase/lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773156.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence063 1430 330 gene locus_tag LOCUS_15940 gene chaA 1430 330 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295620.1 protein_id gnl|my_center|LOCUS_15940 1700 1930 gene locus_tag LOCUS_15950 gene chaB 1700 1930 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146444.1 protein_id gnl|my_center|LOCUS_15950 2088 2783 gene locus_tag LOCUS_15960 gene chaC 2088 2783 CDS product glutathione-specific gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336325.1 protein_id gnl|my_center|LOCUS_15960 3180 2827 gene locus_tag LOCUS_15970 gene ychN 3180 2827 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 protein_id gnl|my_center|LOCUS_15970 3366 4760 gene locus_tag LOCUS_15980 gene ychO 3366 4760 CDS product inverse autotransporter invasin YchO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464994.1 protein_id gnl|my_center|LOCUS_15980 5411 4761 gene locus_tag LOCUS_15990 gene narL 5411 4761 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 protein_id gnl|my_center|LOCUS_15990 7200 5404 gene locus_tag LOCUS_16000 gene narX 7200 5404 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918073.1 protein_id gnl|my_center|LOCUS_16000 7226 7444 gene locus_tag LOCUS_16010 7226 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069498.1 protein_id gnl|my_center|LOCUS_16010 7695 8930 gene locus_tag LOCUS_16020 gene narK 7695 8930 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 protein_id gnl|my_center|LOCUS_16020 9446 13189 gene locus_tag LOCUS_16030 9446 13189 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032935.1 protein_id gnl|my_center|LOCUS_16030 13186 14724 gene locus_tag LOCUS_16040 gene narH 13186 14724 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702660.1 protein_id gnl|my_center|LOCUS_16040 14721 15431 gene locus_tag LOCUS_16050 gene narJ 14721 15431 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571699.1 protein_id gnl|my_center|LOCUS_16050 15431 16108 gene locus_tag LOCUS_16060 gene narI 15431 16108 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160110.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence064 1629 451 gene locus_tag LOCUS_16070 gene xylR 1629 451 CDS product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 protein_id gnl|my_center|LOCUS_16070 2888 1707 gene locus_tag LOCUS_16080 gene xylH 2888 1707 CDS product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 protein_id gnl|my_center|LOCUS_16080 4407 2866 gene locus_tag LOCUS_16090 gene xylG 4407 2866 CDS product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146479.1 protein_id gnl|my_center|LOCUS_16090 5477 4485 gene locus_tag LOCUS_16100 gene xylF 5477 4485 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694881.1 protein_id gnl|my_center|LOCUS_16100 5843 7165 gene locus_tag LOCUS_16110 gene xylA 5843 7165 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149592.1 protein_id gnl|my_center|LOCUS_16110 7237 8691 gene locus_tag LOCUS_16120 gene xylB 7237 8691 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275334.1 protein_id gnl|my_center|LOCUS_16120 8860 9201 gene locus_tag LOCUS_16130 gene yiaB 8860 9201 CDS product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295228.1 protein_id gnl|my_center|LOCUS_16130 9247 9684 gene locus_tag LOCUS_16140 gene yiaA 9247 9684 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 protein_id gnl|my_center|LOCUS_16140 10721 9726 gene locus_tag LOCUS_16150 gene wecH 10721 9726 CDS product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182650.1 protein_id gnl|my_center|LOCUS_16150 10896 11195 gene locus_tag LOCUS_16160 10896 11195 CDS product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980111.1 protein_id gnl|my_center|LOCUS_16160 11290 12201 gene locus_tag LOCUS_16170 gene glyQ 11290 12201 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 protein_id gnl|my_center|LOCUS_16170 12211 14280 gene locus_tag LOCUS_16180 gene glyS 12211 14280 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291797.1 protein_id gnl|my_center|LOCUS_16180 14580 15101 gene locus_tag LOCUS_16190 14580 15101 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042691.1 protein_id gnl|my_center|LOCUS_16190 15098 15928 gene locus_tag LOCUS_16200 15098 15928 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866395.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence065 429 163 gene locus_tag LOCUS_16210 gene minE 429 163 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185665.1 protein_id gnl|my_center|LOCUS_16210 1245 433 gene locus_tag LOCUS_16220 gene minD 1245 433 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101055.1 protein_id gnl|my_center|LOCUS_16220 1964 1269 gene locus_tag LOCUS_16230 gene minC 1964 1269 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072536.1 protein_id gnl|my_center|LOCUS_16230 2484 2852 gene locus_tag LOCUS_16240 2484 2852 CDS product YcgJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056840.1 protein_id gnl|my_center|LOCUS_16240 3373 2972 gene locus_tag LOCUS_16250 3373 2972 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695220.1 protein_id gnl|my_center|LOCUS_16250 3615 3908 gene locus_tag LOCUS_16260 3615 3908 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 protein_id gnl|my_center|LOCUS_16260 3980 4639 gene locus_tag LOCUS_16270 3980 4639 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284277.1 protein_id gnl|my_center|LOCUS_16270 4716 5177 gene locus_tag LOCUS_16280 4716 5177 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 protein_id gnl|my_center|LOCUS_16280 5814 5383 gene locus_tag LOCUS_16290 5814 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 6427 5768 gene locus_tag LOCUS_16300 6427 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16300 6656 7075 gene locus_tag LOCUS_16310 6656 7075 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897378.1 protein_id gnl|my_center|LOCUS_16310 7075 8343 gene locus_tag LOCUS_16320 gene umuC 7075 8343 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457616.1 protein_id gnl|my_center|LOCUS_16320 8919 8389 gene locus_tag LOCUS_16330 gene dsbB 8919 8389 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943462.1 protein_id gnl|my_center|LOCUS_16330 10606 9065 gene locus_tag LOCUS_16340 gene nhaB 10606 9065 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406391.1 protein_id gnl|my_center|LOCUS_16340 10827 11546 gene locus_tag LOCUS_16350 gene fadR 10827 11546 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 protein_id gnl|my_center|LOCUS_16350 13130 11598 gene locus_tag LOCUS_16360 13130 11598 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190854.1 protein_id gnl|my_center|LOCUS_16360 13487 14758 gene locus_tag LOCUS_16370 gene dadA 13487 14758 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266908.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence066 <1 768 gene locus_tag LOCUS_16380 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000884639.1:acetyl-CoA carboxylase biotin carboxylase subunit 877 1119 gene locus_tag LOCUS_16390 877 1119 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381173.1 protein_id gnl|my_center|LOCUS_16390 1109 2560 gene locus_tag LOCUS_16400 gene panF 1109 2560 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 protein_id gnl|my_center|LOCUS_16400 2572 3453 gene locus_tag LOCUS_16410 gene prmA 2572 3453 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 protein_id gnl|my_center|LOCUS_16410 3875 4747 gene locus_tag LOCUS_16420 gene dusB 3875 4747 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 protein_id gnl|my_center|LOCUS_16420 4773 5069 gene locus_tag LOCUS_16430 gene fis 4773 5069 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_16430 5155 6039 gene locus_tag LOCUS_16440 gene yhdJ 5155 6039 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258898.1 protein_id gnl|my_center|LOCUS_16440 6967 6305 gene locus_tag LOCUS_16450 gene acrS 6967 6305 CDS product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129518.1 protein_id gnl|my_center|LOCUS_16450 7366 8523 gene locus_tag LOCUS_16460 gene acrE 7366 8523 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 protein_id gnl|my_center|LOCUS_16460 8535 11639 gene locus_tag LOCUS_16470 gene acrF 8535 11639 CDS product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273225.1 protein_id gnl|my_center|LOCUS_16470 11892 12113 gene locus_tag LOCUS_16480 11892 12113 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 protein_id gnl|my_center|LOCUS_16480 12544 13569 gene locus_tag LOCUS_16490 12544 13569 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 protein_id gnl|my_center|LOCUS_16490 13619 14818 gene locus_tag LOCUS_16500 13619 14818 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019655.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence067 <1 509 gene locus_tag LOCUS_16510 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001310874.1:protein YdjO 1925 534 gene locus_tag LOCUS_16520 gene tcyP 1925 534 CDS product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010696.1 protein_id gnl|my_center|LOCUS_16520 2648 2058 gene locus_tag LOCUS_16530 2648 2058 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295408.1 protein_id gnl|my_center|LOCUS_16530 3479 2811 gene locus_tag LOCUS_16540 gene hxpB 3479 2811 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106833.1 protein_id gnl|my_center|LOCUS_16540 3626 4162 gene locus_tag LOCUS_16550 3626 4162 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222172.1 protein_id gnl|my_center|LOCUS_16550 5063 4203 gene locus_tag LOCUS_16560 5063 4203 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267654.1 protein_id gnl|my_center|LOCUS_16560 5459 5169 gene locus_tag LOCUS_16570 gene ghoS 5459 5169 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146159.1 protein_id gnl|my_center|LOCUS_16570 6489 5560 gene locus_tag LOCUS_16580 gene pfkB 6489 5560 CDS product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251727.1 protein_id gnl|my_center|LOCUS_16580 6776 7534 gene locus_tag LOCUS_16590 6776 7534 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771396.1 protein_id gnl|my_center|LOCUS_16590 9768 7870 gene locus_tag LOCUS_16600 gene espL1 9768 7870 CDS product type III secretion system effector EspL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081128.1 protein_id gnl|my_center|LOCUS_16600 10291 12219 gene locus_tag LOCUS_16610 gene thrS 10291 12219 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144202.1 protein_id gnl|my_center|LOCUS_16610 12331 12765 gene locus_tag LOCUS_16620 gene infC 12331 12765 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 protein_id gnl|my_center|LOCUS_16620 12862 13059 gene locus_tag LOCUS_16630 gene rpmI 12862 13059 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 protein_id gnl|my_center|LOCUS_16630 13112 13468 gene locus_tag LOCUS_16640 gene rplT 13112 13468 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 protein_id gnl|my_center|LOCUS_16640 13918 14901 gene locus_tag LOCUS_16650 gene pheS 13918 14901 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018588.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence068 925 203 gene locus_tag LOCUS_16660 gene mngR 925 203 CDS product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509902.1 protein_id gnl|my_center|LOCUS_16660 1094 2950 gene locus_tag LOCUS_16670 gene mngA 1094 2950 CDS product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242633.1 protein_id gnl|my_center|LOCUS_16670 3027 5660 gene locus_tag LOCUS_16680 gene mngB 3027 5660 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648976.1 protein_id gnl|my_center|LOCUS_16680 5685 5912 gene locus_tag LOCUS_16690 5685 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324497.1 protein_id gnl|my_center|LOCUS_16690 6507 8075 gene locus_tag LOCUS_16700 gene cydA 6507 8075 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884361.1 protein_id gnl|my_center|LOCUS_16700 8091 9230 gene locus_tag LOCUS_16710 gene cydB 8091 9230 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568275.1 protein_id gnl|my_center|LOCUS_16710 9358 9651 gene locus_tag LOCUS_16720 gene ybgE 9358 9651 CDS product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034602.1 protein_id gnl|my_center|LOCUS_16720 9801 10205 gene locus_tag LOCUS_16730 gene ybgC 9801 10205 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098384.1 protein_id gnl|my_center|LOCUS_16730 10202 10894 gene locus_tag LOCUS_16740 gene tolQ 10202 10894 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131314.1 protein_id gnl|my_center|LOCUS_16740 10898 11326 gene locus_tag LOCUS_16750 gene tolR 10898 11326 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090097.1 protein_id gnl|my_center|LOCUS_16750 11391 12656 gene locus_tag LOCUS_16760 11391 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 12789 14081 gene locus_tag LOCUS_16770 gene tolB 12789 14081 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 protein_id gnl|my_center|LOCUS_16770 14116 14637 gene locus_tag LOCUS_16780 gene pal 14116 14637 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 protein_id gnl|my_center|LOCUS_16780 14647 15438 gene locus_tag LOCUS_16790 gene cpoB 14647 15438 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097569.1 protein_id gnl|my_center|LOCUS_16790 15603 15678 gene locus_tag LOCUS_t00160 15603 15678 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 362 1072 gene locus_tag LOCUS_16800 362 1072 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 protein_id gnl|my_center|LOCUS_16800 1080 2060 gene locus_tag LOCUS_16810 1080 2060 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 protein_id gnl|my_center|LOCUS_16810 2162 3427 gene locus_tag LOCUS_16820 2162 3427 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956313.1 protein_id gnl|my_center|LOCUS_16820 4210 3518 gene locus_tag LOCUS_16830 gene ompL 4210 3518 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 protein_id gnl|my_center|LOCUS_16830 5681 4278 gene locus_tag LOCUS_16840 5681 4278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295267.1 protein_id gnl|my_center|LOCUS_16840 7109 5724 gene locus_tag LOCUS_16850 7109 5724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018380.1 protein_id gnl|my_center|LOCUS_16850 9191 7155 gene locus_tag LOCUS_16860 gene yihQ 9191 7155 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 protein_id gnl|my_center|LOCUS_16860 10316 9390 gene locus_tag LOCUS_16870 10316 9390 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 protein_id gnl|my_center|LOCUS_16870 11671 10430 gene locus_tag LOCUS_16880 gene yihS 11671 10430 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 protein_id gnl|my_center|LOCUS_16880 12566 11688 gene locus_tag LOCUS_16890 gene yihT 12566 11688 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 protein_id gnl|my_center|LOCUS_16890 13486 12590 gene locus_tag LOCUS_16900 gene yihU 13486 12590 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 protein_id gnl|my_center|LOCUS_16900 13654 14550 gene locus_tag LOCUS_16910 gene yihV 13654 14550 CDS product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 protein_id gnl|my_center|LOCUS_16910 14584 15369 gene locus_tag LOCUS_16920 14584 15369 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence070 1588 749 gene locus_tag LOCUS_16930 gene chbR 1588 749 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983653.1 protein_id gnl|my_center|LOCUS_16930 1949 1599 gene locus_tag LOCUS_16940 gene chbA 1949 1599 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968919.1 protein_id gnl|my_center|LOCUS_16940 3358 2000 gene locus_tag LOCUS_16950 gene chbC 3358 2000 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073041.1 protein_id gnl|my_center|LOCUS_16950 3763 3443 gene locus_tag LOCUS_16960 gene chbB 3763 3443 CDS product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412169.1 protein_id gnl|my_center|LOCUS_16960 4400 4062 gene locus_tag LOCUS_16970 gene osmE 4400 4062 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039044.1 protein_id gnl|my_center|LOCUS_16970 4602 5429 gene locus_tag LOCUS_16980 gene nadE 4602 5429 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175018.1 protein_id gnl|my_center|LOCUS_16980 5659 6546 gene locus_tag LOCUS_16990 gene cho 5659 6546 CDS product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252397.1 protein_id gnl|my_center|LOCUS_16990 6901 6506 gene locus_tag LOCUS_17000 6901 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 7769 7284 gene locus_tag LOCUS_17010 gene spy 7769 7284 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228991.1 protein_id gnl|my_center|LOCUS_17010 9067 8099 gene locus_tag LOCUS_17020 gene astE 9067 8099 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 protein_id gnl|my_center|LOCUS_17020 10403 9060 gene locus_tag LOCUS_17030 gene astB 10403 9060 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 protein_id gnl|my_center|LOCUS_17030 11878 10400 gene locus_tag LOCUS_17040 gene astD 11878 10400 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177232.1 protein_id gnl|my_center|LOCUS_17040 12909 11875 gene locus_tag LOCUS_17050 gene astA 12909 11875 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989419.1 protein_id gnl|my_center|LOCUS_17050 14126 12906 gene locus_tag LOCUS_17060 gene astC 14126 12906 CDS product succinylornithine/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081983.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence071 93 6 gene locus_tag LOCUS_t00170 93 6 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 520 1638 gene locus_tag LOCUS_17070 gene hyaA 520 1638 CDS product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 protein_id gnl|my_center|LOCUS_17070 1635 3428 gene locus_tag LOCUS_17080 gene hyaB 1635 3428 CDS product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107384.1 protein_id gnl|my_center|LOCUS_17080 3447 4154 gene locus_tag LOCUS_17090 gene hyaC 3447 4154 CDS product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186424.1 protein_id gnl|my_center|LOCUS_17090 4151 4738 gene locus_tag LOCUS_17100 4151 4738 CDS product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003671.1 protein_id gnl|my_center|LOCUS_17100 4735 5133 gene locus_tag LOCUS_17110 gene hyaE 4735 5133 CDS product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063978.1 protein_id gnl|my_center|LOCUS_17110 5130 5987 gene locus_tag LOCUS_17120 5130 5987 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004899.1 protein_id gnl|my_center|LOCUS_17120 6121 7665 gene locus_tag LOCUS_17130 gene appC 6121 7665 CDS product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263582.1 protein_id gnl|my_center|LOCUS_17130 7677 8813 gene locus_tag LOCUS_17140 gene appB 7677 8813 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460803.1 protein_id gnl|my_center|LOCUS_17140 8998 10296 gene locus_tag LOCUS_17150 gene appA 8998 10296 CDS product bifunctional acid phosphatase/4-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300464.1 protein_id gnl|my_center|LOCUS_17150 12591 10411 gene locus_tag LOCUS_17160 gene etk 12591 10411 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208650.1 protein_id gnl|my_center|LOCUS_17160 13069 12611 gene locus_tag LOCUS_17170 gene etp 13069 12611 CDS product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069318.1 protein_id gnl|my_center|LOCUS_17170 14184 13045 gene locus_tag LOCUS_17180 14184 13045 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 protein_id gnl|my_center|LOCUS_17180 <15294 14230 gene locus_tag LOCUS_17190 <15294 14230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000742329.1:YjbH domain-containing protein >Feature sequence072 <1 739 gene locus_tag LOCUS_17200 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572698.1:chromosome partition protein MukB 1000 2847 gene locus_tag LOCUS_17210 gene ldtD 1000 2847 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925997.1 protein_id gnl|my_center|LOCUS_17210 3028 3576 gene locus_tag LOCUS_17220 3028 3576 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 protein_id gnl|my_center|LOCUS_17220 3603 4250 gene locus_tag LOCUS_17230 gene gloC 3603 4250 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109487.1 protein_id gnl|my_center|LOCUS_17230 5662 4472 gene locus_tag LOCUS_17240 gene aspC 5662 4472 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462687.1 protein_id gnl|my_center|LOCUS_17240 5649 5831 gene locus_tag LOCUS_17250 5649 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196607.1 protein_id gnl|my_center|LOCUS_17250 6935 5847 gene locus_tag LOCUS_17260 gene ompF 6935 5847 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977920.1 protein_id gnl|my_center|LOCUS_17260 8938 7538 gene locus_tag LOCUS_17270 gene asnS 8938 7538 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117881.1 protein_id gnl|my_center|LOCUS_17270 10310 9108 gene locus_tag LOCUS_17280 gene pncB 10310 9108 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307697.1 protein_id gnl|my_center|LOCUS_17280 10576 13188 gene locus_tag LOCUS_17290 gene pepN 10576 13188 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193859.1 protein_id gnl|my_center|LOCUS_17290 14162 13395 gene locus_tag LOCUS_17300 gene ssuB 14162 13395 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090514.1 protein_id gnl|my_center|LOCUS_17300 14953 14159 gene locus_tag LOCUS_17310 gene ssuC 14953 14159 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235203.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence073 1104 1502 gene locus_tag LOCUS_17320 1104 1502 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295452.1 protein_id gnl|my_center|LOCUS_17320 1499 2194 gene locus_tag LOCUS_17330 1499 2194 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968208.1 protein_id gnl|my_center|LOCUS_17330 2324 3208 gene locus_tag LOCUS_17340 gene cdd 2324 3208 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553555.1 protein_id gnl|my_center|LOCUS_17340 3358 4077 gene locus_tag LOCUS_17350 gene sanA 3358 4077 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 protein_id gnl|my_center|LOCUS_17350 4080 4319 gene locus_tag LOCUS_17360 4080 4319 CDS product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383096.1 protein_id gnl|my_center|LOCUS_17360 4638 5876 gene locus_tag LOCUS_17370 gene preT 4638 5876 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136389.1 protein_id gnl|my_center|LOCUS_17370 5870 7105 gene locus_tag LOCUS_17380 gene preA 5870 7105 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 protein_id gnl|my_center|LOCUS_17380 8186 7176 gene locus_tag LOCUS_17390 gene mglC 8186 7176 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275118.1 protein_id gnl|my_center|LOCUS_17390 9722 8202 gene locus_tag LOCUS_17400 gene mglA 9722 8202 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255039.1 protein_id gnl|my_center|LOCUS_17400 10781 9783 gene locus_tag LOCUS_17410 gene mglB 10781 9783 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 protein_id gnl|my_center|LOCUS_17410 12101 11061 gene locus_tag LOCUS_17420 gene galS 12101 11061 CDS product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628671.1 protein_id gnl|my_center|LOCUS_17420 13226 12243 gene locus_tag LOCUS_17430 gene yeiB 13226 12243 CDS product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440902.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17430 13400 13227 gene locus_tag LOCUS_17440 13400 13227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17440 14085 13417 gene locus_tag LOCUS_17450 gene folE 14085 13417 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139613.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence074 983 1525 gene locus_tag LOCUS_17460 gene fimA 983 1525 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776555.1 protein_id gnl|my_center|LOCUS_17460 1745 2437 gene locus_tag LOCUS_17470 gene fimC 1745 2437 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988366.1 protein_id gnl|my_center|LOCUS_17470 2468 3283 gene locus_tag LOCUS_17480 2468 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17480 3296 5077 gene locus_tag LOCUS_17490 3296 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17490 5090 6097 gene locus_tag LOCUS_17500 gene fimH 5090 6097 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691070.1 protein_id gnl|my_center|LOCUS_17500 6108 6623 gene locus_tag LOCUS_17510 gene sfmF 6108 6623 CDS product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255114.1 protein_id gnl|my_center|LOCUS_17510 7258 6626 gene locus_tag LOCUS_17520 gene fimZ 7258 6626 CDS product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805422.1 protein_id gnl|my_center|LOCUS_17520 7501 7577 gene locus_tag LOCUS_t00180 7501 7577 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8384 7623 gene locus_tag LOCUS_17530 gene envY 8384 7623 CDS product DNA-binding transcriptional regulator EnvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177464.1 protein_id gnl|my_center|LOCUS_17530 9457 8567 gene locus_tag LOCUS_17540 9457 8567 CDS product DUF4434 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224568.1 protein_id gnl|my_center|LOCUS_17540 12430 9458 gene locus_tag LOCUS_17550 gene nfrA 12430 9458 CDS product bacteriophage adsorption protein NfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662366.1 protein_id gnl|my_center|LOCUS_17550 13196 12417 gene locus_tag LOCUS_17560 13196 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 14649 13240 gene locus_tag LOCUS_17570 14649 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 15108 14920 gene locus_tag LOCUS_17580 15108 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence075 1415 555 gene locus_tag LOCUS_17590 gene cheR 1415 555 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204335.1 protein_id gnl|my_center|LOCUS_17590 3035 1434 gene locus_tag LOCUS_17600 gene tap 3035 1434 CDS product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483221.1 protein_id gnl|my_center|LOCUS_17600 4742 3081 gene locus_tag LOCUS_17610 gene tar 4742 3081 CDS product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602282.1 protein_id gnl|my_center|LOCUS_17610 5390 4887 gene locus_tag LOCUS_17620 gene cheW 5390 4887 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 protein_id gnl|my_center|LOCUS_17620 7369 5411 gene locus_tag LOCUS_17630 gene cheA 7369 5411 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355043.1 protein_id gnl|my_center|LOCUS_17630 8306 7380 gene locus_tag LOCUS_17640 gene motB 8306 7380 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795630.1 protein_id gnl|my_center|LOCUS_17640 9190 8303 gene locus_tag LOCUS_17650 gene motA 9190 8303 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906325.1 protein_id gnl|my_center|LOCUS_17650 9895 9317 gene locus_tag LOCUS_17660 gene flhC 9895 9317 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291603.1 protein_id gnl|my_center|LOCUS_17660 10248 9898 gene locus_tag LOCUS_17670 gene flhD 10248 9898 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 protein_id gnl|my_center|LOCUS_17670 11028 11456 gene locus_tag LOCUS_17680 gene uspC 11028 11456 CDS product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122437.1 protein_id gnl|my_center|LOCUS_17680 12887 11463 gene locus_tag LOCUS_17690 gene otsA 12887 11463 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295646.1 protein_id gnl|my_center|LOCUS_17690 13662 12862 gene locus_tag LOCUS_17700 gene otsB 13662 12862 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295645.1 protein_id gnl|my_center|LOCUS_17700 14815 13829 gene locus_tag LOCUS_17710 gene araH 14815 13829 CDS product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100203.1 protein_id gnl|my_center|LOCUS_17710 14997 14830 gene locus_tag LOCUS_17720 14997 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence076 176 517 gene locus_tag LOCUS_17730 176 517 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201413.1 protein_id gnl|my_center|LOCUS_17730 1434 508 gene locus_tag LOCUS_17740 1434 508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 protein_id gnl|my_center|LOCUS_17740 1524 2522 gene locus_tag LOCUS_17750 1524 2522 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765610.1 protein_id gnl|my_center|LOCUS_17750 2737 2519 gene locus_tag LOCUS_17760 2737 2519 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410201.1 protein_id gnl|my_center|LOCUS_17760 4754 2739 gene locus_tag LOCUS_17770 gene ligA 4754 2739 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443665.1 protein_id gnl|my_center|LOCUS_17770 5259 4825 gene locus_tag LOCUS_17780 5259 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5350 5676 gene locus_tag LOCUS_17790 5350 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6041 6802 gene locus_tag LOCUS_17800 gene cysZ 6041 6802 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 protein_id gnl|my_center|LOCUS_17800 6987 7958 gene locus_tag LOCUS_17810 gene cysK 6987 7958 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034402.1 protein_id gnl|my_center|LOCUS_17810 8342 8599 gene locus_tag LOCUS_17820 gene ptsH 8342 8599 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_17820 8644 10371 gene locus_tag LOCUS_17830 gene ptsI 8644 10371 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623136.1 protein_id gnl|my_center|LOCUS_17830 10412 10921 gene locus_tag LOCUS_17840 gene crr 10412 10921 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522247.1 protein_id gnl|my_center|LOCUS_17840 11815 10964 gene locus_tag LOCUS_17850 gene pdxK 11815 10964 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096674.1 protein_id gnl|my_center|LOCUS_17850 11920 12294 gene locus_tag LOCUS_17860 11920 12294 CDS product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719924.1 protein_id gnl|my_center|LOCUS_17860 12327 13061 gene locus_tag LOCUS_17870 12327 13061 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745534.1 protein_id gnl|my_center|LOCUS_17870 14107 13250 gene locus_tag LOCUS_17880 gene cysM 14107 13250 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309637.1 protein_id gnl|my_center|LOCUS_17880 <14946 14295 gene locus_tag LOCUS_17890 <14946 14295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000021036.1:sulfate/thiosulfate ABC transporter ATP-binding protein CysA >Feature sequence077 516 1094 gene locus_tag LOCUS_17900 516 1094 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926370.1 protein_id gnl|my_center|LOCUS_17900 1117 1935 gene locus_tag LOCUS_17910 1117 1935 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270145.1 protein_id gnl|my_center|LOCUS_17910 1935 2453 gene locus_tag LOCUS_17920 1935 2453 CDS product FidL-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217010.1 protein_id gnl|my_center|LOCUS_17920 2973 3251 gene locus_tag LOCUS_17930 2973 3251 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502008.1 protein_id gnl|my_center|LOCUS_17930 3269 3553 gene locus_tag LOCUS_17940 3269 3553 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502010.1 protein_id gnl|my_center|LOCUS_17940 3568 3846 gene locus_tag LOCUS_17950 3568 3846 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206281.1 protein_id gnl|my_center|LOCUS_17950 3900 5486 gene locus_tag LOCUS_17960 3900 5486 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704261.1 protein_id gnl|my_center|LOCUS_17960 5513 5770 gene locus_tag LOCUS_17970 5513 5770 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599365.1 protein_id gnl|my_center|LOCUS_17970 5786 6940 gene locus_tag LOCUS_17980 5786 6940 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704260.1 protein_id gnl|my_center|LOCUS_17980 6967 10353 gene locus_tag LOCUS_17990 gene cutC 6967 10353 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083575.1 protein_id gnl|my_center|LOCUS_17990 10405 11352 gene locus_tag LOCUS_18000 gene cutD 10405 11352 CDS product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275637.1 protein_id gnl|my_center|LOCUS_18000 11364 11828 gene locus_tag LOCUS_18010 11364 11828 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086629.1 protein_id gnl|my_center|LOCUS_18010 11825 12445 gene locus_tag LOCUS_18020 11825 12445 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564322.1 protein_id gnl|my_center|LOCUS_18020 12457 13122 gene locus_tag LOCUS_18030 12457 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139438.1 protein_id gnl|my_center|LOCUS_18030 13155 13556 gene locus_tag LOCUS_18040 13155 13556 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095890.1 protein_id gnl|my_center|LOCUS_18040 13572 13901 gene locus_tag LOCUS_18050 13572 13901 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481836.1 protein_id gnl|my_center|LOCUS_18050 14457 14125 gene locus_tag LOCUS_18060 14457 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence078 558 737 gene locus_tag LOCUS_18070 558 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611928.1 protein_id gnl|my_center|LOCUS_18070 769 1122 gene locus_tag LOCUS_18080 769 1122 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015497.1 protein_id gnl|my_center|LOCUS_18080 3237 1159 gene locus_tag LOCUS_18090 gene flhA 3237 1159 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297144.1 protein_id gnl|my_center|LOCUS_18090 4321 3311 gene locus_tag LOCUS_18100 gene hypE 4321 3311 CDS product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059922.1 protein_id gnl|my_center|LOCUS_18100 5439 4318 gene locus_tag LOCUS_18110 gene hypD 5439 4318 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212982.1 protein_id gnl|my_center|LOCUS_18110 5711 5439 gene locus_tag LOCUS_18120 gene hypC 5711 5439 CDS product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 protein_id gnl|my_center|LOCUS_18120 6574 5702 gene locus_tag LOCUS_18130 gene hypB 6574 5702 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337665.1 protein_id gnl|my_center|LOCUS_18130 6928 6578 gene locus_tag LOCUS_18140 gene hypA 6928 6578 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 protein_id gnl|my_center|LOCUS_18140 7140 7601 gene locus_tag LOCUS_18150 gene hycA 7140 7601 CDS product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 protein_id gnl|my_center|LOCUS_18150 7726 8337 gene locus_tag LOCUS_18160 gene hycB 7726 8337 CDS product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079186.1 protein_id gnl|my_center|LOCUS_18160 8334 10160 gene locus_tag LOCUS_18170 gene hycC 8334 10160 CDS product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274388.1 protein_id gnl|my_center|LOCUS_18170 10163 11086 gene locus_tag LOCUS_18180 gene hycD 10163 11086 CDS product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115223.1 protein_id gnl|my_center|LOCUS_18180 11104 12813 gene locus_tag LOCUS_18190 gene hycE 11104 12813 CDS product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288122.1 protein_id gnl|my_center|LOCUS_18190 12823 13365 gene locus_tag LOCUS_18200 gene hycF 12823 13365 CDS product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493785.1 protein_id gnl|my_center|LOCUS_18200 13365 14132 gene locus_tag LOCUS_18210 gene hycG 13365 14132 CDS product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067401.1 protein_id gnl|my_center|LOCUS_18210 14129 14539 gene locus_tag LOCUS_18220 gene hycH 14129 14539 CDS product formate hydrogenlyase assembly protein HycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291921.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence079 <1 1300 gene locus_tag LOCUS_18230 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001122505.1:DNA mismatch repair endonuclease MutL 1293 2243 gene locus_tag LOCUS_18240 1293 2243 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 protein_id gnl|my_center|LOCUS_18240 2329 2637 gene locus_tag LOCUS_18250 gene hfq 2329 2637 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 protein_id gnl|my_center|LOCUS_18250 2714 3994 gene locus_tag LOCUS_18260 gene hflX 2714 3994 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460360.1 protein_id gnl|my_center|LOCUS_18260 4080 5339 gene locus_tag LOCUS_18270 gene hflK 4080 5339 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 protein_id gnl|my_center|LOCUS_18270 5342 6346 gene locus_tag LOCUS_18280 gene hflC 5342 6346 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 protein_id gnl|my_center|LOCUS_18280 6428 6625 gene locus_tag LOCUS_18290 6428 6625 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 protein_id gnl|my_center|LOCUS_18290 6729 8027 gene locus_tag LOCUS_18300 gene purA 6729 8027 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 protein_id gnl|my_center|LOCUS_18300 8232 8657 gene locus_tag LOCUS_18310 gene nsrR 8232 8657 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 protein_id gnl|my_center|LOCUS_18310 8696 11137 gene locus_tag LOCUS_18320 gene rnr 8696 11137 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076316.1 protein_id gnl|my_center|LOCUS_18320 11317 12048 gene locus_tag LOCUS_18330 gene rlmB 11317 12048 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 protein_id gnl|my_center|LOCUS_18330 12175 12576 gene locus_tag LOCUS_18340 12175 12576 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220128.1 protein_id gnl|my_center|LOCUS_18340 12595 13293 gene locus_tag LOCUS_18350 12595 13293 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 protein_id gnl|my_center|LOCUS_18350 13344 14003 gene locus_tag LOCUS_18360 13344 14003 CDS product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012553.1 protein_id gnl|my_center|LOCUS_18360 14021 14419 gene locus_tag LOCUS_18370 14021 14419 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence080 339 542 gene locus_tag LOCUS_18380 339 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 689 1024 gene locus_tag LOCUS_18390 689 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1674 1865 gene locus_tag LOCUS_18400 1674 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1889 2269 gene locus_tag LOCUS_18410 1889 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2220 2702 gene locus_tag LOCUS_18420 2220 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18420 2724 3710 gene locus_tag LOCUS_18430 2724 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18430 3857 4075 gene locus_tag LOCUS_18440 3857 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4190 4717 gene locus_tag LOCUS_18450 4190 4717 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722826.1 protein_id gnl|my_center|LOCUS_18450 4732 5259 gene locus_tag LOCUS_18460 4732 5259 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 protein_id gnl|my_center|LOCUS_18460 5345 6010 gene locus_tag LOCUS_18470 gene sfsA 5345 6010 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_18470 6089 6814 gene locus_tag LOCUS_18480 6089 6814 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 protein_id gnl|my_center|LOCUS_18480 8097 7267 gene locus_tag LOCUS_18490 8097 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8312 9700 gene locus_tag LOCUS_18500 8312 9700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_18500 9704 10459 gene locus_tag LOCUS_18510 9704 10459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_18510 10490 12415 gene locus_tag LOCUS_18520 10490 12415 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_18520 13013 13342 gene locus_tag LOCUS_18530 13013 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 13365 13826 gene locus_tag LOCUS_18540 13365 13826 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809665.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence081 495 3539 gene locus_tag LOCUS_18550 495 3539 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_18550 3533 5167 gene locus_tag LOCUS_18560 3533 5167 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_18560 5160 6392 gene locus_tag LOCUS_18570 5160 6392 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484770.1 protein_id gnl|my_center|LOCUS_18570 7229 7098 gene locus_tag LOCUS_18580 7229 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 7454 8374 gene locus_tag LOCUS_18590 7454 8374 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276285.1 protein_id gnl|my_center|LOCUS_18590 8542 10059 gene locus_tag LOCUS_18600 8542 10059 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277207.1 protein_id gnl|my_center|LOCUS_18600 10120 11490 gene locus_tag LOCUS_18610 10120 11490 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344915.1 protein_id gnl|my_center|LOCUS_18610 11490 12899 gene locus_tag LOCUS_18620 11490 12899 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602473.1 protein_id gnl|my_center|LOCUS_18620 12925 13932 gene locus_tag LOCUS_18630 12925 13932 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence082 388 1014 gene locus_tag LOCUS_18640 388 1014 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027096094.1 protein_id gnl|my_center|LOCUS_18640 1524 2288 gene locus_tag LOCUS_18650 1524 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2353 2769 gene locus_tag LOCUS_18660 2353 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2804 3262 gene locus_tag LOCUS_18670 2804 3262 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_18670 3259 5016 gene locus_tag LOCUS_18680 3259 5016 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_18680 6385 5072 gene locus_tag LOCUS_18690 6385 5072 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_18690 6782 6997 gene locus_tag LOCUS_18700 6782 6997 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_18700 7209 8075 gene locus_tag LOCUS_18710 7209 8075 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_18710 8089 8454 gene locus_tag LOCUS_18720 8089 8454 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_18720 8426 10813 gene locus_tag LOCUS_18730 8426 10813 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_18730 10816 12549 gene locus_tag LOCUS_18740 10816 12549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 12563 12829 gene locus_tag LOCUS_18750 12563 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12819 13547 gene locus_tag LOCUS_18760 12819 13547 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_18760 13593 13928 gene locus_tag LOCUS_18770 13593 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 14014 14295 gene locus_tag LOCUS_18780 14014 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence083 271 966 gene locus_tag LOCUS_18790 gene rsuA 271 966 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234850.1 protein_id gnl|my_center|LOCUS_18790 994 2184 gene locus_tag LOCUS_18800 gene bcr 994 2184 CDS product multidrug efflux MFS transporter Bcr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213385.1 protein_id gnl|my_center|LOCUS_18800 2517 2861 gene locus_tag LOCUS_18810 2517 2861 CDS product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202798.1 protein_id gnl|my_center|LOCUS_18810 4454 2865 gene locus_tag LOCUS_18820 gene yejF 4454 2865 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194914.1 protein_id gnl|my_center|LOCUS_18820 5481 4456 gene locus_tag LOCUS_18830 5481 4456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 protein_id gnl|my_center|LOCUS_18830 6575 5481 gene locus_tag LOCUS_18840 6575 5481 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501604.1 protein_id gnl|my_center|LOCUS_18840 8396 6576 gene locus_tag LOCUS_18850 8396 6576 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301507.1 protein_id gnl|my_center|LOCUS_18850 9965 8472 gene locus_tag LOCUS_18860 9965 8472 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470560.1 protein_id gnl|my_center|LOCUS_18860 10775 10209 gene locus_tag LOCUS_18870 gene mepS 10775 10209 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241011.1 protein_id gnl|my_center|LOCUS_18870 11900 11187 gene locus_tag LOCUS_18880 gene lpxT 11900 11187 CDS product Kdo(2)-lipid A phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594599.1 protein_id gnl|my_center|LOCUS_18880 12925 11939 gene locus_tag LOCUS_18890 gene yeiR 12925 11939 CDS product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198822.1 protein_id gnl|my_center|LOCUS_18890 <14410 13043 gene locus_tag LOCUS_18900 <14410 13043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001091940.1:mannitol dehydrogenase family protein >Feature sequence084 70 343 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacaca 1352 681 gene locus_tag LOCUS_18910 gene queE 1352 681 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199973.1 protein_id gnl|my_center|LOCUS_18910 1491 1631 gene locus_tag LOCUS_18920 gene yqcG 1491 1631 CDS product cell envelope stress response protein YqcG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288227.1 protein_id gnl|my_center|LOCUS_18920 1645 2517 gene locus_tag LOCUS_18930 1645 2517 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268460.1 protein_id gnl|my_center|LOCUS_18930 3875 2577 gene locus_tag LOCUS_18940 gene eno 3875 2577 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 protein_id gnl|my_center|LOCUS_18940 5600 3963 gene locus_tag LOCUS_18950 gene pyrG 5600 3963 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210878.1 protein_id gnl|my_center|LOCUS_18950 6619 5828 gene locus_tag LOCUS_18960 gene mazG 6619 5828 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 protein_id gnl|my_center|LOCUS_18960 7025 6690 gene locus_tag LOCUS_18970 gene mazF 7025 6690 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254738.1 protein_id gnl|my_center|LOCUS_18970 7273 7025 gene locus_tag LOCUS_18980 gene mazE 7273 7025 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 protein_id gnl|my_center|LOCUS_18980 9585 7351 gene locus_tag LOCUS_18990 9585 7351 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 protein_id gnl|my_center|LOCUS_18990 10934 9633 gene locus_tag LOCUS_19000 gene rlmD 10934 9633 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046812.1 protein_id gnl|my_center|LOCUS_19000 10991 13747 gene locus_tag LOCUS_19010 gene barA 10991 13747 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence085 268 56 gene locus_tag LOCUS_19020 gene cspA 268 56 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 protein_id gnl|my_center|LOCUS_19020 839 549 gene locus_tag LOCUS_19030 839 549 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 protein_id gnl|my_center|LOCUS_19030 1273 1983 gene locus_tag LOCUS_19040 1273 1983 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 protein_id gnl|my_center|LOCUS_19040 3007 2033 gene locus_tag LOCUS_19050 gene ghrB 3007 2033 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805027.1 protein_id gnl|my_center|LOCUS_19050 3770 3111 gene locus_tag LOCUS_19060 3770 3111 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 protein_id gnl|my_center|LOCUS_19060 4032 3883 gene locus_tag LOCUS_19070 4032 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3977 6256 gene locus_tag LOCUS_19080 gene bisC 3977 6256 CDS product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013950.1 protein_id gnl|my_center|LOCUS_19080 6665 6225 gene locus_tag LOCUS_19090 6665 6225 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617473.1 protein_id gnl|my_center|LOCUS_19090 7225 6662 gene locus_tag LOCUS_19100 gene tag 7225 6662 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438957.1 protein_id gnl|my_center|LOCUS_19100 7383 8081 gene locus_tag LOCUS_19110 7383 8081 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584472.1 protein_id gnl|my_center|LOCUS_19110 8310 9518 gene locus_tag LOCUS_19120 8310 9518 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189019.1 protein_id gnl|my_center|LOCUS_19120 9842 11533 gene locus_tag LOCUS_19130 gene eptB 9842 11533 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 protein_id gnl|my_center|LOCUS_19130 11625 11701 gene locus_tag LOCUS_t00190 11625 11701 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12446 14053 gene locus_tag LOCUS_19140 gene dppA 12446 14053 CDS product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence086 1 462 gene locus_tag LOCUS_19150 1 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 809 564 gene locus_tag LOCUS_19160 gene tusA 809 564 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 protein_id gnl|my_center|LOCUS_19160 1030 1695 gene locus_tag LOCUS_19170 1030 1695 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100469.1 protein_id gnl|my_center|LOCUS_19170 1768 2325 gene locus_tag LOCUS_19180 gene dcrB 1768 2325 CDS product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 protein_id gnl|my_center|LOCUS_19180 3579 2329 gene locus_tag LOCUS_19190 3579 2329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 protein_id gnl|my_center|LOCUS_19190 3678 4727 gene locus_tag LOCUS_19200 3678 4727 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300885.1 protein_id gnl|my_center|LOCUS_19200 4782 5369 gene locus_tag LOCUS_19210 gene acpT 4782 5369 CDS product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285774.1 protein_id gnl|my_center|LOCUS_19210 5480 7054 gene locus_tag LOCUS_19220 gene nikA 5480 7054 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953353.1 protein_id gnl|my_center|LOCUS_19220 7054 7998 gene locus_tag LOCUS_19230 gene nikB 7054 7998 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 protein_id gnl|my_center|LOCUS_19230 7995 8828 gene locus_tag LOCUS_19240 gene nikC 7995 8828 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 protein_id gnl|my_center|LOCUS_19240 8828 9592 gene locus_tag LOCUS_19250 gene nikD 8828 9592 CDS product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136232.1 protein_id gnl|my_center|LOCUS_19250 9589 10395 gene locus_tag LOCUS_19260 gene nikE 9589 10395 CDS product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173685.1 protein_id gnl|my_center|LOCUS_19260 10401 10802 gene locus_tag LOCUS_19270 gene nikR 10401 10802 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_19270 11281 10922 gene locus_tag LOCUS_19280 11281 10922 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593555.1 protein_id gnl|my_center|LOCUS_19280 12750 11626 gene locus_tag LOCUS_19290 12750 11626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216257.1 protein_id gnl|my_center|LOCUS_19290 <14006 12750 gene locus_tag LOCUS_19300 <14006 12750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000149156.1:ribosome-associated ATPase/putative transporter RbbA >Feature sequence087 1582 518 gene locus_tag LOCUS_19310 gene proW 1582 518 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774978.1 protein_id gnl|my_center|LOCUS_19310 2777 1575 gene locus_tag LOCUS_19320 gene proV 2777 1575 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985494.1 protein_id gnl|my_center|LOCUS_19320 4091 3132 gene locus_tag LOCUS_19330 gene nrdF 4091 3132 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 protein_id gnl|my_center|LOCUS_19330 6245 4101 gene locus_tag LOCUS_19340 gene nrdE 6245 4101 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246534.1 protein_id gnl|my_center|LOCUS_19340 6628 6218 gene locus_tag LOCUS_19350 gene nrdI 6628 6218 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 protein_id gnl|my_center|LOCUS_19350 6870 6625 gene locus_tag LOCUS_19360 gene nrdH 6870 6625 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 protein_id gnl|my_center|LOCUS_19360 7447 7118 gene locus_tag LOCUS_19370 7447 7118 CDS product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 protein_id gnl|my_center|LOCUS_19370 7599 7943 gene locus_tag LOCUS_19380 7599 7943 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 protein_id gnl|my_center|LOCUS_19380 8429 7980 gene locus_tag LOCUS_19390 gene alaE 8429 7980 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 protein_id gnl|my_center|LOCUS_19390 9098 9502 gene locus_tag LOCUS_19400 gene stpA 9098 9502 CDS product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115383.1 protein_id gnl|my_center|LOCUS_19400 10073 9549 gene locus_tag LOCUS_19410 gene ygaP 10073 9549 CDS product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229442.1 protein_id gnl|my_center|LOCUS_19410 10388 10083 gene locus_tag LOCUS_19420 10388 10083 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137280.1 protein_id gnl|my_center|LOCUS_19420 10565 10723 gene locus_tag LOCUS_19430 10565 10723 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508177.1 protein_id gnl|my_center|LOCUS_19430 10807 11256 gene locus_tag LOCUS_19440 gene kbp 10807 11256 CDS product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522415.1 protein_id gnl|my_center|LOCUS_19440 11919 11257 gene locus_tag LOCUS_19450 gene csiR 11919 11257 CDS product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 protein_id gnl|my_center|LOCUS_19450 13340 11940 gene locus_tag LOCUS_19460 gene gabP 13340 11940 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295173.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence088 33 968 gene locus_tag LOCUS_19470 33 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1590 1075 gene locus_tag LOCUS_19480 1590 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2223 2516 gene locus_tag LOCUS_19490 2223 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2938 2684 gene locus_tag LOCUS_19500 2938 2684 CDS product DUF826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114104.1 protein_id gnl|my_center|LOCUS_19500 3156 2974 gene locus_tag LOCUS_19510 3156 2974 CDS product DUF1378 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144787.1 protein_id gnl|my_center|LOCUS_19510 5355 3301 gene locus_tag LOCUS_19520 5355 3301 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917876.1 protein_id gnl|my_center|LOCUS_19520 5660 6181 gene locus_tag LOCUS_19530 5660 6181 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420351.1 protein_id gnl|my_center|LOCUS_19530 7094 6213 gene locus_tag LOCUS_19540 7094 6213 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469162.1 protein_id gnl|my_center|LOCUS_19540 7654 7094 gene locus_tag LOCUS_19550 7654 7094 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301577.1 protein_id gnl|my_center|LOCUS_19550 8727 7645 gene locus_tag LOCUS_19560 8727 7645 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146835.1 protein_id gnl|my_center|LOCUS_19560 9164 8727 gene locus_tag LOCUS_19570 9164 8727 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763330.1 protein_id gnl|my_center|LOCUS_19570 9768 9157 gene locus_tag LOCUS_19580 9768 9157 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980532.1 protein_id gnl|my_center|LOCUS_19580 10885 9761 gene locus_tag LOCUS_19590 10885 9761 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098807.1 protein_id gnl|my_center|LOCUS_19590 11189 10869 gene locus_tag LOCUS_19600 11189 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19600 12227 11208 gene locus_tag LOCUS_19610 12227 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19610 <13910 12214 gene locus_tag LOCUS_19620 <13910 12214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000113525.1:tape measure protein >Feature sequence089 3151 446 gene locus_tag LOCUS_19630 gene malT 3151 446 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906961.1 protein_id gnl|my_center|LOCUS_19630 3763 6156 gene locus_tag LOCUS_19640 gene malP 3763 6156 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081903.1 protein_id gnl|my_center|LOCUS_19640 6166 8250 gene locus_tag LOCUS_19650 gene malQ 6166 8250 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444321.1 protein_id gnl|my_center|LOCUS_19650 9677 8361 gene locus_tag LOCUS_19660 gene gntT 9677 8361 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 protein_id gnl|my_center|LOCUS_19660 10613 10038 gene locus_tag LOCUS_19670 gene nfuA 10613 10038 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 protein_id gnl|my_center|LOCUS_19670 11355 10672 gene locus_tag LOCUS_19680 gene gntX 11355 10672 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958727.1 protein_id gnl|my_center|LOCUS_19680 11393 12163 gene locus_tag LOCUS_19690 gene bioH 11393 12163 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060072.1 protein_id gnl|my_center|LOCUS_19690 13070 12192 gene locus_tag LOCUS_19700 gene rpnA 13070 12192 CDS product recombination-promoting nuclease RpnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039062.1 protein_id gnl|my_center|LOCUS_19700 13509 13273 gene locus_tag LOCUS_19710 gene feoC 13509 13273 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295699.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence090 710 561 gene locus_tag LOCUS_19720 gene acrZ 710 561 CDS product multidrug efflux pump accessory protein AcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891515.1 protein_id gnl|my_center|LOCUS_19720 839 1627 gene locus_tag LOCUS_19730 gene modE 839 1627 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147439.1 protein_id gnl|my_center|LOCUS_19730 1695 3167 gene locus_tag LOCUS_19740 gene modF 1695 3167 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096866.1 protein_id gnl|my_center|LOCUS_19740 3429 4445 gene locus_tag LOCUS_19750 gene galE 3429 4445 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265438.1 protein_id gnl|my_center|LOCUS_19750 4455 5501 gene locus_tag LOCUS_19760 gene galT 4455 5501 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 protein_id gnl|my_center|LOCUS_19760 5505 6653 gene locus_tag LOCUS_19770 gene galK 5505 6653 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053415.1 protein_id gnl|my_center|LOCUS_19770 6647 7687 gene locus_tag LOCUS_19780 gene galM 6647 7687 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931389.1 protein_id gnl|my_center|LOCUS_19780 7890 8642 gene locus_tag LOCUS_19790 gene gpmA 7890 8642 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 protein_id gnl|my_center|LOCUS_19790 9861 8809 gene locus_tag LOCUS_19800 gene aroG 9861 8809 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109193.1 protein_id gnl|my_center|LOCUS_19800 10177 10557 gene locus_tag LOCUS_19810 10177 10557 CDS product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784351.1 protein_id gnl|my_center|LOCUS_19810 10671 11612 gene locus_tag LOCUS_19820 gene zitB 10671 11612 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951276.1 protein_id gnl|my_center|LOCUS_19820 12328 11609 gene locus_tag LOCUS_19830 gene pnuC 12328 11609 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 protein_id gnl|my_center|LOCUS_19830 13409 12366 gene locus_tag LOCUS_19840 gene nadA 13409 12366 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115281.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence091 249 713 gene locus_tag LOCUS_19850 249 713 CDS product Gp37 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101804.1 protein_id gnl|my_center|LOCUS_19850 713 964 gene locus_tag LOCUS_19860 713 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666499.1 protein_id gnl|my_center|LOCUS_19860 954 2381 gene locus_tag LOCUS_19870 954 2381 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729834.1 protein_id gnl|my_center|LOCUS_19870 2381 2902 gene locus_tag LOCUS_19880 2381 2902 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162832341.1 protein_id gnl|my_center|LOCUS_19880 2905 3186 gene locus_tag LOCUS_19890 2905 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110118.1 protein_id gnl|my_center|LOCUS_19890 3284 3619 gene locus_tag LOCUS_19900 3284 3619 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084213.1 protein_id gnl|my_center|LOCUS_19900 3777 6728 gene locus_tag LOCUS_19910 3777 6728 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016537.1 protein_id gnl|my_center|LOCUS_19910 6728 7612 gene locus_tag LOCUS_19920 6728 7612 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458386.1 protein_id gnl|my_center|LOCUS_19920 7612 7824 gene locus_tag LOCUS_19930 7612 7824 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478224.1 protein_id gnl|my_center|LOCUS_19930 7812 8966 gene locus_tag LOCUS_19940 7812 8966 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808005.1 protein_id gnl|my_center|LOCUS_19940 8963 9559 gene locus_tag LOCUS_19950 8963 9559 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148265.1 protein_id gnl|my_center|LOCUS_19950 9614 9961 gene locus_tag LOCUS_19960 9614 9961 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859114.1 protein_id gnl|my_center|LOCUS_19960 9952 11055 gene locus_tag LOCUS_19970 9952 11055 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219102.1 protein_id gnl|my_center|LOCUS_19970 11048 11626 gene locus_tag LOCUS_19980 11048 11626 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138756.1 protein_id gnl|my_center|LOCUS_19980 11629 11982 gene locus_tag LOCUS_19990 11629 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19990 11988 12710 gene locus_tag LOCUS_20000 11988 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20000 12713 12946 gene locus_tag LOCUS_20010 12713 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 13337 12927 gene locus_tag LOCUS_20020 13337 12927 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223322.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence092 614 3244 gene locus_tag LOCUS_20030 gene alaS 614 3244 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047171.1 protein_id gnl|my_center|LOCUS_20030 3479 3664 gene locus_tag LOCUS_20040 gene csrA 3479 3664 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_20040 3980 4072 gene locus_tag LOCUS_t00200 3980 4072 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4076 4152 gene locus_tag LOCUS_t00210 4076 4152 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4167 4096 gene locus_tag LOCUS_t00220 4167 4096 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4351 4427 gene locus_tag LOCUS_t00230 4351 4427 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4490 4566 gene locus_tag LOCUS_t00240 4490 4566 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4765 4841 gene locus_tag LOCUS_t00250 4765 4841 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5122 5688 gene locus_tag LOCUS_20050 gene yqaB 5122 5688 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273290.1 protein_id gnl|my_center|LOCUS_20050 5685 6113 gene locus_tag LOCUS_20060 5685 6113 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 protein_id gnl|my_center|LOCUS_20060 6186 7742 gene locus_tag LOCUS_20070 gene gshA 6186 7742 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 protein_id gnl|my_center|LOCUS_20070 7892 8407 gene locus_tag LOCUS_20080 gene luxS 7892 8407 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130211.1 protein_id gnl|my_center|LOCUS_20080 10009 8471 gene locus_tag LOCUS_20090 gene emrB 10009 8471 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 protein_id gnl|my_center|LOCUS_20090 11198 10026 gene locus_tag LOCUS_20100 gene emrA 11198 10026 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295175.1 protein_id gnl|my_center|LOCUS_20100 11855 11325 gene locus_tag LOCUS_20110 gene emrR 11855 11325 CDS product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 protein_id gnl|my_center|LOCUS_20110 12281 11946 gene locus_tag LOCUS_20120 gene ygaH 12281 11946 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119749.1 protein_id gnl|my_center|LOCUS_20120 13008 12271 gene locus_tag LOCUS_20130 gene ygaZ 13008 12271 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence093 365 745 gene locus_tag LOCUS_20140 365 745 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084622.1 protein_id gnl|my_center|LOCUS_20140 2817 874 gene locus_tag LOCUS_20150 gene cpdB 2817 874 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589431.1 protein_id gnl|my_center|LOCUS_20150 3007 3747 gene locus_tag LOCUS_20160 gene cysQ 3007 3747 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 protein_id gnl|my_center|LOCUS_20160 4294 3737 gene locus_tag LOCUS_20170 4294 3737 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175289.1 protein_id gnl|my_center|LOCUS_20170 4619 4825 gene locus_tag LOCUS_20180 4619 4825 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 protein_id gnl|my_center|LOCUS_20180 6230 4887 gene locus_tag LOCUS_20190 6230 4887 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 protein_id gnl|my_center|LOCUS_20190 7191 6553 gene locus_tag LOCUS_20200 gene msrA 7191 6553 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 protein_id gnl|my_center|LOCUS_20200 7248 7427 gene locus_tag LOCUS_20210 7248 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 7397 9130 gene locus_tag LOCUS_20220 gene tamA 7397 9130 CDS product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269327.1 protein_id gnl|my_center|LOCUS_20220 9127 12906 gene locus_tag LOCUS_20230 gene tamB 9127 12906 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060946.1 protein_id gnl|my_center|LOCUS_20230 12909 13250 gene locus_tag LOCUS_20240 12909 13250 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence094 521 2176 gene locus_tag LOCUS_20250 gene lldP 521 2176 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295233.1 protein_id gnl|my_center|LOCUS_20250 2176 2952 gene locus_tag LOCUS_20260 gene lldR 2176 2952 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636500.1 protein_id gnl|my_center|LOCUS_20260 2949 4139 gene locus_tag LOCUS_20270 gene lldD 2949 4139 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586962.1 protein_id gnl|my_center|LOCUS_20270 4293 4766 gene locus_tag LOCUS_20280 gene trmL 4293 4766 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932351.1 protein_id gnl|my_center|LOCUS_20280 5640 4819 gene locus_tag LOCUS_20290 gene cysE 5640 4819 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 protein_id gnl|my_center|LOCUS_20290 6739 5720 gene locus_tag LOCUS_20300 gene gpsA 6739 5720 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_20300 7206 6739 gene locus_tag LOCUS_20310 gene secB 7206 6739 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003382.1 protein_id gnl|my_center|LOCUS_20310 7520 7269 gene locus_tag LOCUS_20320 gene grxC 7520 7269 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 protein_id gnl|my_center|LOCUS_20320 8093 7662 gene locus_tag LOCUS_20330 8093 7662 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156181.1 protein_id gnl|my_center|LOCUS_20330 8338 9882 gene locus_tag LOCUS_20340 gene gpmM 8338 9882 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116565.1 protein_id gnl|my_center|LOCUS_20340 9916 11175 gene locus_tag LOCUS_20350 gene envC 9916 11175 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214147.1 protein_id gnl|my_center|LOCUS_20350 11179 12138 gene locus_tag LOCUS_20360 11179 12138 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483860.1 protein_id gnl|my_center|LOCUS_20360 13159 12125 gene locus_tag LOCUS_20370 gene waaH 13159 12125 CDS product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982078.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence095 1119 1682 gene locus_tag LOCUS_20380 gene srlA 1119 1682 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 protein_id gnl|my_center|LOCUS_20380 1679 2638 gene locus_tag LOCUS_20390 gene srlE 1679 2638 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148875.1 protein_id gnl|my_center|LOCUS_20390 2649 3020 gene locus_tag LOCUS_20400 gene srlB 2649 3020 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216194.1 protein_id gnl|my_center|LOCUS_20400 3024 3803 gene locus_tag LOCUS_20410 gene srlD 3024 3803 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077358.1 protein_id gnl|my_center|LOCUS_20410 3908 4267 gene locus_tag LOCUS_20420 gene gutM 3908 4267 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 protein_id gnl|my_center|LOCUS_20420 4334 5107 gene locus_tag LOCUS_20430 gene srlR 4334 5107 CDS product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 protein_id gnl|my_center|LOCUS_20430 5100 6065 gene locus_tag LOCUS_20440 gene gutQ 5100 6065 CDS product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287420.1 protein_id gnl|my_center|LOCUS_20440 7576 6062 gene locus_tag LOCUS_20450 gene norR 7576 6062 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010749.1 protein_id gnl|my_center|LOCUS_20450 7763 9202 gene locus_tag LOCUS_20460 gene norV 7763 9202 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029605.1 protein_id gnl|my_center|LOCUS_20460 9199 10332 gene locus_tag LOCUS_20470 gene norW 9199 10332 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064748.1 protein_id gnl|my_center|LOCUS_20470 12712 10460 gene locus_tag LOCUS_20480 gene hypF 12712 10460 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107704.1 protein_id gnl|my_center|LOCUS_20480 13140 12865 gene locus_tag LOCUS_20490 13140 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence096 32 1357 gene locus_tag LOCUS_20500 gene dinF 32 1357 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295692.1 protein_id gnl|my_center|LOCUS_20500 1473 1682 gene locus_tag LOCUS_20510 1473 1682 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 protein_id gnl|my_center|LOCUS_20510 2239 1724 gene locus_tag LOCUS_20520 gene zur 2239 1724 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 protein_id gnl|my_center|LOCUS_20520 2557 2811 gene locus_tag LOCUS_20530 gene yjbL 2557 2811 CDS product protein YjbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912571.1 protein_id gnl|my_center|LOCUS_20530 2835 3542 gene locus_tag LOCUS_20540 2835 3542 CDS product DUF2713 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311303.1 protein_id gnl|my_center|LOCUS_20540 3923 4942 gene locus_tag LOCUS_20550 gene dusA 3923 4942 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 protein_id gnl|my_center|LOCUS_20550 5076 5318 gene locus_tag LOCUS_20560 gene pspG 5076 5318 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 protein_id gnl|my_center|LOCUS_20560 6467 5484 gene locus_tag LOCUS_20570 6467 5484 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235522.1 protein_id gnl|my_center|LOCUS_20570 6550 7965 gene locus_tag LOCUS_20580 gene dnaB 6550 7965 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 protein_id gnl|my_center|LOCUS_20580 8018 9097 gene locus_tag LOCUS_20590 gene alr 8018 9097 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 protein_id gnl|my_center|LOCUS_20590 9350 10543 gene locus_tag LOCUS_20600 gene tyrB 9350 10543 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 protein_id gnl|my_center|LOCUS_20600 10662 10841 gene locus_tag LOCUS_20610 10662 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 11268 10765 gene locus_tag LOCUS_20620 11268 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 11670 12383 gene locus_tag LOCUS_20630 gene aphA 11670 12383 CDS product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226928.1 protein_id gnl|my_center|LOCUS_20630 12494 12910 gene locus_tag LOCUS_20640 12494 12910 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270375.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence097 1683 973 gene locus_tag LOCUS_20650 gene ecpE 1683 973 CDS product fimbrial chaperone EcpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305432.1 protein_id gnl|my_center|LOCUS_20650 3295 1652 gene locus_tag LOCUS_20660 gene ecpD 3295 1652 CDS product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310578.1 protein_id gnl|my_center|LOCUS_20660 5810 3285 gene locus_tag LOCUS_20670 gene ecpC 5810 3285 CDS product fimbrial usher EcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131094.1 protein_id gnl|my_center|LOCUS_20670 6504 5836 gene locus_tag LOCUS_20680 gene ecpB 6504 5836 CDS product fimbrial chaperone EcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716398.1 protein_id gnl|my_center|LOCUS_20680 7149 6562 gene locus_tag LOCUS_20690 gene ecpA 7149 6562 CDS product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730972.1 protein_id gnl|my_center|LOCUS_20690 7765 7223 gene locus_tag LOCUS_20700 gene ecpR 7765 7223 CDS product ECP biosynthesis operon DNA-binding transcriptional regulator EcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220247.1 protein_id gnl|my_center|LOCUS_20700 8647 8814 gene locus_tag LOCUS_20710 8647 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 8989 8849 gene locus_tag LOCUS_20720 gene ykgO 8989 8849 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866436.1 protein_id gnl|my_center|LOCUS_20720 9255 8989 gene locus_tag LOCUS_20730 9255 8989 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803998.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence098 649 161 gene locus_tag LOCUS_20740 gene eco 649 161 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849209.1 protein_id gnl|my_center|LOCUS_20740 948 784 gene locus_tag LOCUS_20750 gene yojO 948 784 CDS product protein YojO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296837.1 protein_id gnl|my_center|LOCUS_20750 1541 1804 gene locus_tag LOCUS_20760 gene napD 1541 1804 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557378.1 protein_id gnl|my_center|LOCUS_20760 1801 4287 gene locus_tag LOCUS_20770 gene napA 1801 4287 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778067.1 protein_id gnl|my_center|LOCUS_20770 4375 4989 gene locus_tag LOCUS_20780 gene napG 4375 4989 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_20780 4976 5839 gene locus_tag LOCUS_20790 gene napH 4976 5839 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 protein_id gnl|my_center|LOCUS_20790 5836 6285 gene locus_tag LOCUS_20800 gene napB 5836 6285 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835177.1 protein_id gnl|my_center|LOCUS_20800 6295 6897 gene locus_tag LOCUS_20810 gene napC 6295 6897 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 protein_id gnl|my_center|LOCUS_20810 6910 7533 gene locus_tag LOCUS_20820 gene ccmA 6910 7533 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525587.1 protein_id gnl|my_center|LOCUS_20820 7530 8192 gene locus_tag LOCUS_20830 gene ccmB 7530 8192 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971730.1 protein_id gnl|my_center|LOCUS_20830 8210 8971 gene locus_tag LOCUS_20840 gene ccmC 8210 8971 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 protein_id gnl|my_center|LOCUS_20840 8968 9177 gene locus_tag LOCUS_20850 8968 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 9174 9653 gene locus_tag LOCUS_20860 gene ccmE 9174 9653 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 protein_id gnl|my_center|LOCUS_20860 9650 11593 gene locus_tag LOCUS_20870 gene ccmF 9650 11593 CDS product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982447.1 protein_id gnl|my_center|LOCUS_20870 11590 12147 gene locus_tag LOCUS_20880 gene dsbE 11590 12147 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824439.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence099 2 814 gene locus_tag LOCUS_20890 2 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1699 998 gene locus_tag LOCUS_20900 gene fre 1699 998 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 protein_id gnl|my_center|LOCUS_20900 3238 1745 gene locus_tag LOCUS_20910 gene ubiD 3238 1745 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 protein_id gnl|my_center|LOCUS_20910 3405 3893 gene locus_tag LOCUS_20920 gene rfaH 3405 3893 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 protein_id gnl|my_center|LOCUS_20920 4672 3890 gene locus_tag LOCUS_20930 gene tatD 4672 3890 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301305.1 protein_id gnl|my_center|LOCUS_20930 5490 4714 gene locus_tag LOCUS_20940 gene tatC 5490 4714 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 protein_id gnl|my_center|LOCUS_20940 6008 5493 gene locus_tag LOCUS_20950 gene tatB 6008 5493 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 protein_id gnl|my_center|LOCUS_20950 6281 6012 gene locus_tag LOCUS_20960 gene tatA 6281 6012 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 protein_id gnl|my_center|LOCUS_20960 8000 6360 gene locus_tag LOCUS_20970 gene ubiB 8000 6360 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 protein_id gnl|my_center|LOCUS_20970 8602 7997 gene locus_tag LOCUS_20980 gene ubiJ 8602 7997 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 protein_id gnl|my_center|LOCUS_20980 9371 8616 gene locus_tag LOCUS_20990 gene ubiE 9371 8616 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_20990 10893 9466 gene locus_tag LOCUS_21000 gene rmuC 10893 9466 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 protein_id gnl|my_center|LOCUS_21000 11795 11034 gene locus_tag LOCUS_21010 gene udp 11795 11034 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045180.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence100 1829 744 gene locus_tag LOCUS_21020 gene ypdF 1829 744 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173288.1 protein_id gnl|my_center|LOCUS_21020 3091 1844 gene locus_tag LOCUS_21030 3091 1844 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985359.1 protein_id gnl|my_center|LOCUS_21030 3439 3113 gene locus_tag LOCUS_21040 3439 3113 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 protein_id gnl|my_center|LOCUS_21040 4623 3658 gene locus_tag LOCUS_21050 gene glk 4623 3658 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170346.1 protein_id gnl|my_center|LOCUS_21050 4827 6083 gene locus_tag LOCUS_21060 4827 6083 CDS product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903148.1 protein_id gnl|my_center|LOCUS_21060 6198 6524 gene locus_tag LOCUS_21070 gene ypeC 6198 6524 CDS product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490072.1 protein_id gnl|my_center|LOCUS_21070 7840 6665 gene locus_tag LOCUS_21080 7840 6665 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186369.1 protein_id gnl|my_center|LOCUS_21080 8239 9441 gene locus_tag LOCUS_21090 gene nupC 8239 9441 CDS product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376337.1 protein_id gnl|my_center|LOCUS_21090 11680 9491 gene locus_tag LOCUS_21100 11680 9491 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301445.1 protein_id gnl|my_center|LOCUS_21100 11964 11889 gene locus_tag LOCUS_t00260 11964 11889 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12079 12004 gene locus_tag LOCUS_t00270 12079 12004 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12315 12659 gene locus_tag LOCUS_21110 12315 12659 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence101 593 129 gene locus_tag LOCUS_21120 gene nrdG 593 129 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 protein_id gnl|my_center|LOCUS_21120 2890 752 gene locus_tag LOCUS_21130 gene nrdD 2890 752 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 protein_id gnl|my_center|LOCUS_21130 4939 3284 gene locus_tag LOCUS_21140 gene treC 4939 3284 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331056.1 protein_id gnl|my_center|LOCUS_21140 6410 4989 gene locus_tag LOCUS_21150 gene treB 6410 4989 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299664.1 protein_id gnl|my_center|LOCUS_21150 7476 6529 gene locus_tag LOCUS_21160 gene treR 7476 6529 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181324.1 protein_id gnl|my_center|LOCUS_21160 7855 10551 gene locus_tag LOCUS_21170 gene mgtA 7855 10551 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471866.1 protein_id gnl|my_center|LOCUS_21170 11143 10757 gene locus_tag LOCUS_21180 gene ridA 11143 10757 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 protein_id gnl|my_center|LOCUS_21180 11677 11216 gene locus_tag LOCUS_21190 gene pyrI 11677 11216 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 protein_id gnl|my_center|LOCUS_21190 12625 11690 gene locus_tag LOCUS_21200 gene pyrB 12625 11690 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence102 210 503 gene locus_tag LOCUS_21210 210 503 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081071.1 protein_id gnl|my_center|LOCUS_21210 560 2206 gene locus_tag LOCUS_21220 gene fadK 560 2206 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 protein_id gnl|my_center|LOCUS_21220 4641 2263 gene locus_tag LOCUS_21230 gene ppsA 4641 2263 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069375.1 protein_id gnl|my_center|LOCUS_21230 5055 5807 gene locus_tag LOCUS_21240 gene ppsR 5055 5807 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368046.1 protein_id gnl|my_center|LOCUS_21240 5964 7010 gene locus_tag LOCUS_21250 gene aroH 5964 7010 CDS product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082226.1 protein_id gnl|my_center|LOCUS_21250 7115 7333 gene locus_tag LOCUS_21260 gene hemP 7115 7333 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966807.1 protein_id gnl|my_center|LOCUS_21260 8773 7337 gene locus_tag LOCUS_21270 gene selO 8773 7337 CDS product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175641.1 protein_id gnl|my_center|LOCUS_21270 9549 8836 gene locus_tag LOCUS_21280 gene ydiV 9549 8836 CDS product anti-FlhDC factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326034.1 protein_id gnl|my_center|LOCUS_21280 10260 9796 gene locus_tag LOCUS_21290 10260 9796 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 protein_id gnl|my_center|LOCUS_21290 11087 10338 gene locus_tag LOCUS_21300 gene btuD 11087 10338 CDS product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 protein_id gnl|my_center|LOCUS_21300 11638 11087 gene locus_tag LOCUS_21310 gene btuE 11638 11087 CDS product bifunctional thioredoxin/glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154183.1 protein_id gnl|my_center|LOCUS_21310 12681 11701 gene locus_tag LOCUS_21320 gene btuC 12681 11701 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956528.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence103 2143 848 gene locus_tag LOCUS_21330 2143 848 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627106.1 protein_id gnl|my_center|LOCUS_21330 2493 2203 gene locus_tag LOCUS_21340 2493 2203 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768384.1 protein_id gnl|my_center|LOCUS_21340 3633 2752 gene locus_tag LOCUS_21350 gene yddG 3633 2752 CDS product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198214.1 protein_id gnl|my_center|LOCUS_21350 3865 6912 gene locus_tag LOCUS_21360 gene fdnG 3865 6912 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012311994.1 transl_except (pos:4450..4452,aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_21360 6925 7809 gene locus_tag LOCUS_21370 gene fdnH 6925 7809 CDS product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 protein_id gnl|my_center|LOCUS_21370 7802 8455 gene locus_tag LOCUS_21380 gene fdnI 7802 8455 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 protein_id gnl|my_center|LOCUS_21380 8968 8684 gene locus_tag LOCUS_21390 8968 8684 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781370.1 protein_id gnl|my_center|LOCUS_21390 9776 9114 gene locus_tag LOCUS_21400 9776 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21400 10116 9661 gene locus_tag LOCUS_21410 10116 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21410 11947 10250 gene locus_tag LOCUS_21420 gene maeA 11947 10250 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433476.1 protein_id gnl|my_center|LOCUS_21420 12241 12104 gene locus_tag LOCUS_21430 gene sra 12241 12104 CDS product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841554.1 protein_id gnl|my_center|LOCUS_21430 12558 12343 gene locus_tag LOCUS_21440 gene bdm 12558 12343 CDS product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495771.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence104 3838 515 gene locus_tag LOCUS_21450 gene mscM 3838 515 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236847.1 protein_id gnl|my_center|LOCUS_21450 4828 3860 gene locus_tag LOCUS_21460 gene asd 4828 3860 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 protein_id gnl|my_center|LOCUS_21460 5977 4925 gene locus_tag LOCUS_21470 gene rsgA 5977 4925 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 protein_id gnl|my_center|LOCUS_21470 6072 6617 gene locus_tag LOCUS_21480 gene orn 6072 6617 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_21480 6828 6903 gene locus_tag LOCUS_t00280 6828 6903 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7061 7136 gene locus_tag LOCUS_t00290 7061 7136 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7172 7247 gene locus_tag LOCUS_t00300 7172 7247 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8656 7517 gene locus_tag LOCUS_21490 gene queG 8656 7517 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 protein_id gnl|my_center|LOCUS_21490 8655 10202 gene locus_tag LOCUS_21500 gene nnr 8655 10202 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295189.1 protein_id gnl|my_center|LOCUS_21500 10174 10635 gene locus_tag LOCUS_21510 gene tsaE 10174 10635 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_21510 10654 11991 gene locus_tag LOCUS_21520 gene amiB 10654 11991 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990333.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence105 870 1 gene locus_tag LOCUS_21530 gene sucD 870 1 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025458.1 protein_id gnl|my_center|LOCUS_21530 2036 870 gene locus_tag LOCUS_21540 gene sucC 2036 870 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048602.1 protein_id gnl|my_center|LOCUS_21540 3347 2130 gene locus_tag LOCUS_21550 gene odhB 3347 2130 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 protein_id gnl|my_center|LOCUS_21550 6163 3362 gene locus_tag LOCUS_21560 gene sucA 6163 3362 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181473.1 protein_id gnl|my_center|LOCUS_21560 7180 6464 gene locus_tag LOCUS_21570 gene sdhB 7180 6464 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235253.1 protein_id gnl|my_center|LOCUS_21570 8962 7196 gene locus_tag LOCUS_21580 gene sdhA 8962 7196 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 protein_id gnl|my_center|LOCUS_21580 9309 8962 gene locus_tag LOCUS_21590 gene sdhD 9309 8962 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254365.1 protein_id gnl|my_center|LOCUS_21590 9707 9303 gene locus_tag LOCUS_21600 gene sdhC 9707 9303 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 protein_id gnl|my_center|LOCUS_21600 10401 11684 gene locus_tag LOCUS_21610 gene gltA 10401 11684 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence106 <1 945 gene locus_tag LOCUS_21620 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000646142.1:zinc-dependent alcohol dehydrogenase 1586 1176 gene locus_tag LOCUS_21630 gene rnk 1586 1176 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089731.1 protein_id gnl|my_center|LOCUS_21630 2621 1815 gene locus_tag LOCUS_21640 gene rna 2621 1815 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643397.1 protein_id gnl|my_center|LOCUS_21640 4198 2735 gene locus_tag LOCUS_21650 gene citT 4198 2735 CDS product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050323.1 protein_id gnl|my_center|LOCUS_21650 5127 4249 gene locus_tag LOCUS_21660 gene citG 5127 4249 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062457.1 protein_id gnl|my_center|LOCUS_21660 5653 5102 gene locus_tag LOCUS_21670 gene citX 5653 5102 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 protein_id gnl|my_center|LOCUS_21670 7189 5657 gene locus_tag LOCUS_21680 gene citF 7189 5657 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192245.1 protein_id gnl|my_center|LOCUS_21680 8108 7200 gene locus_tag LOCUS_21690 gene citE 8108 7200 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622357.1 protein_id gnl|my_center|LOCUS_21690 8401 8105 gene locus_tag LOCUS_21700 gene citD 8401 8105 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700701.1 protein_id gnl|my_center|LOCUS_21700 9474 8416 gene locus_tag LOCUS_21710 gene citC 9474 8416 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 protein_id gnl|my_center|LOCUS_21710 9854 11512 gene locus_tag LOCUS_21720 gene dpiB 9854 11512 CDS product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939767.1 protein_id gnl|my_center|LOCUS_21720 11481 12161 gene locus_tag LOCUS_21730 gene dpiA 11481 12161 CDS product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126500.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence107 102 257 gene locus_tag LOCUS_21740 102 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 393 1583 gene locus_tag LOCUS_21750 393 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2997 3674 gene locus_tag LOCUS_21760 2997 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5146 4238 gene locus_tag LOCUS_21770 5146 4238 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860958.1 protein_id gnl|my_center|LOCUS_21770 6479 5286 gene locus_tag LOCUS_21780 6479 5286 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_21780 7776 6523 gene locus_tag LOCUS_21790 7776 6523 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_21790 10027 8111 gene locus_tag LOCUS_21800 10027 8111 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392246.1 protein_id gnl|my_center|LOCUS_21800 10227 11522 gene locus_tag LOCUS_21810 gene rpoN 10227 11522 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647965.1 protein_id gnl|my_center|LOCUS_21810 11537 11926 gene locus_tag LOCUS_21820 11537 11926 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228753.1 protein_id gnl|my_center|LOCUS_21820 12462 12190 gene locus_tag LOCUS_21830 12462 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence108 3069 484 gene locus_tag LOCUS_21840 3069 484 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_21840 3499 3143 gene locus_tag LOCUS_21850 3499 3143 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 protein_id gnl|my_center|LOCUS_21850 3732 4259 gene locus_tag LOCUS_21860 3732 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 4247 4786 gene locus_tag LOCUS_21870 4247 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4783 6336 gene locus_tag LOCUS_21880 gene sdhA 4783 6336 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808703.1 protein_id gnl|my_center|LOCUS_21880 6333 7034 gene locus_tag LOCUS_21890 gene sdhB 6333 7034 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808702.1 protein_id gnl|my_center|LOCUS_21890 7330 7079 gene locus_tag LOCUS_21900 7330 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 7745 8659 gene locus_tag LOCUS_21910 7745 8659 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_21910 8760 9230 gene locus_tag LOCUS_21920 8760 9230 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_21920 9227 11035 gene locus_tag LOCUS_21930 9227 11035 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_21930 11047 11313 gene locus_tag LOCUS_21940 11047 11313 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_21940 11417 12280 gene locus_tag LOCUS_21950 11417 12280 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence109 334 1143 gene locus_tag LOCUS_21960 334 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1180 2928 gene locus_tag LOCUS_21970 gene msbA 1180 2928 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551270.1 protein_id gnl|my_center|LOCUS_21970 2925 3911 gene locus_tag LOCUS_21980 gene lpxK 2925 3911 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570540.1 protein_id gnl|my_center|LOCUS_21980 3948 5180 gene locus_tag LOCUS_21990 gene ycaQ 3948 5180 CDS product crosslink repair DNA glycosylase YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056529.1 protein_id gnl|my_center|LOCUS_21990 5232 5414 gene locus_tag LOCUS_22000 gene ycaR 5232 5414 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350058.1 protein_id gnl|my_center|LOCUS_22000 5411 6157 gene locus_tag LOCUS_22010 gene kdsB 5411 6157 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011599.1 protein_id gnl|my_center|LOCUS_22010 6311 7204 gene locus_tag LOCUS_22020 6311 7204 CDS product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436922.1 protein_id gnl|my_center|LOCUS_22020 7960 7181 gene locus_tag LOCUS_22030 gene elyC 7960 7181 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899600.1 protein_id gnl|my_center|LOCUS_22030 8096 8881 gene locus_tag LOCUS_22040 gene cmoM 8096 8881 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298300.1 protein_id gnl|my_center|LOCUS_22040 8878 10200 gene locus_tag LOCUS_22050 gene mukF 8878 10200 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288850.1 protein_id gnl|my_center|LOCUS_22050 10181 10885 gene locus_tag LOCUS_22060 gene mukE 10181 10885 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence110 848 1066 gene locus_tag LOCUS_22070 848 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1565 1050 gene locus_tag LOCUS_22080 gene sulA 1565 1050 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 protein_id gnl|my_center|LOCUS_22080 1778 2407 gene locus_tag LOCUS_22090 gene sxy 1778 2407 CDS product CRP-S regulon transcriptional coactivator Sxy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839153.1 protein_id gnl|my_center|LOCUS_22090 4532 2370 gene locus_tag LOCUS_22100 gene yccS 4532 2370 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875023.1 protein_id gnl|my_center|LOCUS_22100 4988 4542 gene locus_tag LOCUS_22110 4988 4542 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 protein_id gnl|my_center|LOCUS_22110 5111 7165 gene locus_tag LOCUS_22120 gene helD 5111 7165 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295354.1 protein_id gnl|my_center|LOCUS_22120 7664 7197 gene locus_tag LOCUS_22130 gene mgsA 7664 7197 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275684.1 protein_id gnl|my_center|LOCUS_22130 8413 7751 gene locus_tag LOCUS_22140 8413 7751 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 protein_id gnl|my_center|LOCUS_22140 8611 8453 gene locus_tag LOCUS_22150 8611 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 8586 8999 gene locus_tag LOCUS_22160 8586 8999 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311585.1 protein_id gnl|my_center|LOCUS_22160 9361 9044 gene locus_tag LOCUS_22170 gene hspQ 9361 9044 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295356.1 protein_id gnl|my_center|LOCUS_22170 10609 9419 gene locus_tag LOCUS_22180 gene rlmI 10609 9419 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116297.1 protein_id gnl|my_center|LOCUS_22180 10704 10982 gene locus_tag LOCUS_22190 gene yccX 10704 10982 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048252.1 protein_id gnl|my_center|LOCUS_22190 11308 10979 gene locus_tag LOCUS_22200 gene tusE 11308 10979 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904442.1 protein_id gnl|my_center|LOCUS_22200 12058 11399 gene locus_tag LOCUS_22210 gene yccA 12058 11399 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375136.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence111 <1 1048 gene locus_tag LOCUS_22220 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001287154.1:glutamine--tRNA ligase 1626 3032 gene locus_tag LOCUS_22230 gene chiP 1626 3032 CDS product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258839.1 protein_id gnl|my_center|LOCUS_22230 3082 3408 gene locus_tag LOCUS_22240 gene chiQ 3082 3408 CDS product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733579.1 protein_id gnl|my_center|LOCUS_22240 3939 3493 gene locus_tag LOCUS_22250 gene fur 3939 3493 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 protein_id gnl|my_center|LOCUS_22250 4758 4228 gene locus_tag LOCUS_22260 gene fldA 4758 4228 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 protein_id gnl|my_center|LOCUS_22260 5260 4898 gene locus_tag LOCUS_22270 gene ybfE 5260 4898 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291238.1 protein_id gnl|my_center|LOCUS_22270 6095 5331 gene locus_tag LOCUS_22280 gene ybfF 6095 5331 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773288.1 protein_id gnl|my_center|LOCUS_22280 6280 6825 gene locus_tag LOCUS_22290 gene seqA 6280 6825 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 protein_id gnl|my_center|LOCUS_22290 6851 8491 gene locus_tag LOCUS_22300 gene pgm 6851 8491 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295675.1 protein_id gnl|my_center|LOCUS_22300 9890 9240 gene locus_tag LOCUS_22310 9890 9240 CDS product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017803196.1 protein_id gnl|my_center|LOCUS_22310 11558 10239 gene locus_tag LOCUS_22320 gene potE 11558 10239 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075845.1 protein_id gnl|my_center|LOCUS_22320 <12274 11555 gene locus_tag LOCUS_22330 <12274 11555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000040195.1:ornithine decarboxylase SpeF >Feature sequence112 <1 1725 gene locus_tag LOCUS_22340 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000556469.1:autotransporter adhesin EhaB 1813 2436 gene locus_tag LOCUS_22350 gene iprA 1813 2436 CDS product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 protein_id gnl|my_center|LOCUS_22350 3594 2437 gene locus_tag LOCUS_22360 gene ampH 3594 2437 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 protein_id gnl|my_center|LOCUS_22360 3946 5166 gene locus_tag LOCUS_22370 gene sbmA 3946 5166 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477009.1 protein_id gnl|my_center|LOCUS_22370 5179 6273 gene locus_tag LOCUS_22380 gene yaiW 5179 6273 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092069.1 protein_id gnl|my_center|LOCUS_22380 6640 6332 gene locus_tag LOCUS_22390 6640 6332 CDS product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 protein_id gnl|my_center|LOCUS_22390 6900 7112 gene locus_tag LOCUS_22400 6900 7112 CDS product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 protein_id gnl|my_center|LOCUS_22400 8230 7136 gene locus_tag LOCUS_22410 gene ddlA 8230 7136 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 protein_id gnl|my_center|LOCUS_22410 8693 8953 gene locus_tag LOCUS_22420 gene iraP 8693 8953 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 protein_id gnl|my_center|LOCUS_22420 9054 10283 gene locus_tag LOCUS_22430 gene phoA 9054 10283 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814404.1 protein_id gnl|my_center|LOCUS_22430 10308 10469 gene locus_tag LOCUS_22440 10308 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22440 10588 10908 gene locus_tag LOCUS_22450 gene psiF 10588 10908 CDS product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 protein_id gnl|my_center|LOCUS_22450 11223 12125 gene locus_tag LOCUS_22460 gene adrA 11223 12125 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484048.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence113 1426 611 gene locus_tag LOCUS_22470 1426 611 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306952.1 protein_id gnl|my_center|LOCUS_22470 2696 1437 gene locus_tag LOCUS_22480 2696 1437 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495385.1 protein_id gnl|my_center|LOCUS_22480 4373 2706 gene locus_tag LOCUS_22490 4373 2706 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580806.1 protein_id gnl|my_center|LOCUS_22490 4690 5739 gene locus_tag LOCUS_22500 gene allD 4690 5739 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703900.1 protein_id gnl|my_center|LOCUS_22500 5761 6996 gene locus_tag LOCUS_22510 gene allC 5761 6996 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306951.1 protein_id gnl|my_center|LOCUS_22510 7007 7792 gene locus_tag LOCUS_22520 gene allE 7007 7792 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540946.1 protein_id gnl|my_center|LOCUS_22520 9165 8020 gene locus_tag LOCUS_22530 gene glxK 9165 8020 CDS product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706355.1 protein_id gnl|my_center|LOCUS_22530 10488 9187 gene locus_tag LOCUS_22540 10488 9187 CDS product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298987.1 protein_id gnl|my_center|LOCUS_22540 11906 10545 gene locus_tag LOCUS_22550 gene allB 11906 10545 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006900.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence114 12 749 gene locus_tag LOCUS_22560 gene fliP 12 749 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253450.1 protein_id gnl|my_center|LOCUS_22560 759 1028 gene locus_tag LOCUS_22570 gene fliQ 759 1028 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187358.1 protein_id gnl|my_center|LOCUS_22570 1037 1822 gene locus_tag LOCUS_22580 gene fliR 1037 1822 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983977.1 protein_id gnl|my_center|LOCUS_22580 2112 2735 gene locus_tag LOCUS_22590 gene rcsA 2112 2735 CDS product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103994.1 protein_id gnl|my_center|LOCUS_22590 2967 2779 gene locus_tag LOCUS_22600 gene dsrB 2967 2779 CDS product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867217.1 protein_id gnl|my_center|LOCUS_22600 3130 3357 gene locus_tag LOCUS_22610 gene yodD 3130 3357 CDS product peroxide/acid resistance protein YodD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844800.1 protein_id gnl|my_center|LOCUS_22610 3655 4470 gene locus_tag LOCUS_22620 3655 4470 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491522.1 protein_id gnl|my_center|LOCUS_22620 6143 4467 gene locus_tag LOCUS_22630 gene dgcQ 6143 4467 CDS product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302088.1 protein_id gnl|my_center|LOCUS_22630 6581 6399 gene locus_tag LOCUS_22640 6581 6399 CDS product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009306.1 protein_id gnl|my_center|LOCUS_22640 7577 6660 gene locus_tag LOCUS_22650 7577 6660 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922683.1 protein_id gnl|my_center|LOCUS_22650 7750 8670 gene locus_tag LOCUS_22660 gene yedA 7750 8670 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 protein_id gnl|my_center|LOCUS_22660 9129 8659 gene locus_tag LOCUS_22670 gene vsr 9129 8659 CDS product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785996.1 protein_id gnl|my_center|LOCUS_22670 10528 9110 gene locus_tag LOCUS_22680 gene dcm 10528 9110 CDS product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157239.1 protein_id gnl|my_center|LOCUS_22680 11290 10595 gene locus_tag LOCUS_22690 11290 10595 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365562.1 protein_id gnl|my_center|LOCUS_22690 11713 11330 gene locus_tag LOCUS_22700 gene drpB 11713 11330 CDS product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313057.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence115 1692 1135 gene locus_tag LOCUS_22710 gene puuR 1692 1135 CDS product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278727.1 protein_id gnl|my_center|LOCUS_22710 2471 1719 gene locus_tag LOCUS_22720 gene puuD 2471 1719 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300506.1 protein_id gnl|my_center|LOCUS_22720 2695 4113 gene locus_tag LOCUS_22730 gene puuA 2695 4113 CDS product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298814.1 protein_id gnl|my_center|LOCUS_22730 4416 5801 gene locus_tag LOCUS_22740 gene puuP 4416 5801 CDS product putrescine/proton symporter PuuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302119.1 protein_id gnl|my_center|LOCUS_22740 5935 6180 gene locus_tag LOCUS_22750 5935 6180 CDS product DUF2543 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015099.1 protein_id gnl|my_center|LOCUS_22750 6534 8135 gene locus_tag LOCUS_22760 gene sapA 6534 8135 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250213.1 protein_id gnl|my_center|LOCUS_22760 8132 9097 gene locus_tag LOCUS_22770 gene sapB 8132 9097 CDS product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583277.1 protein_id gnl|my_center|LOCUS_22770 9084 9974 gene locus_tag LOCUS_22780 gene sapC 9084 9974 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146163.1 protein_id gnl|my_center|LOCUS_22780 9974 10966 gene locus_tag LOCUS_22790 gene sapD 9974 10966 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128858.1 protein_id gnl|my_center|LOCUS_22790 10968 11774 gene locus_tag LOCUS_22800 gene sapF 10968 11774 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence116 4121 2634 gene locus_tag LOCUS_22810 gene nusA 4121 2634 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031057.1 protein_id gnl|my_center|LOCUS_22810 4601 4149 gene locus_tag LOCUS_22820 gene rimP 4601 4149 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 protein_id gnl|my_center|LOCUS_22820 4884 4808 gene locus_tag LOCUS_t00310 4884 4808 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5232 6575 gene locus_tag LOCUS_22830 gene argG 5232 6575 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207685.1 protein_id gnl|my_center|LOCUS_22830 8100 6583 gene locus_tag LOCUS_22840 8100 6583 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333576.1 protein_id gnl|my_center|LOCUS_22840 8753 8667 gene locus_tag LOCUS_t00320 8753 8667 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9100 8768 gene locus_tag LOCUS_22850 gene secG 9100 8768 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 protein_id gnl|my_center|LOCUS_22850 10665 9328 gene locus_tag LOCUS_22860 gene glmM 10665 9328 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 protein_id gnl|my_center|LOCUS_22860 11506 10658 gene locus_tag LOCUS_22870 gene folP 11506 10658 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence117 683 3037 gene locus_tag LOCUS_22880 gene lon 683 3037 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 protein_id gnl|my_center|LOCUS_22880 3246 3518 gene locus_tag LOCUS_22890 gene hupB 3246 3518 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 protein_id gnl|my_center|LOCUS_22890 3710 5581 gene locus_tag LOCUS_22900 gene ppiD 3710 5581 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 protein_id gnl|my_center|LOCUS_22900 5732 6061 gene locus_tag LOCUS_22910 5732 6061 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 protein_id gnl|my_center|LOCUS_22910 6167 6565 gene locus_tag LOCUS_22920 gene fadM 6167 6565 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 protein_id gnl|my_center|LOCUS_22920 7312 6617 gene locus_tag LOCUS_22930 gene queC 7312 6617 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817227.1 protein_id gnl|my_center|LOCUS_22930 9092 7377 gene locus_tag LOCUS_22940 9092 7377 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238234.1 protein_id gnl|my_center|LOCUS_22940 9177 9995 gene locus_tag LOCUS_22950 gene cof 9177 9995 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113027.1 protein_id gnl|my_center|LOCUS_22950 10148 10606 gene locus_tag LOCUS_22960 gene decR 10148 10606 CDS product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence118 1935 1729 gene locus_tag LOCUS_22970 1935 1729 CDS product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424924.1 protein_id gnl|my_center|LOCUS_22970 2337 4010 gene locus_tag LOCUS_22980 gene kdpA 2337 4010 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741112.1 protein_id gnl|my_center|LOCUS_22980 4033 6081 gene locus_tag LOCUS_22990 gene kdpB 4033 6081 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 protein_id gnl|my_center|LOCUS_22990 6090 6662 gene locus_tag LOCUS_23000 gene kdpC 6090 6662 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334152.1 protein_id gnl|my_center|LOCUS_23000 6655 9339 gene locus_tag LOCUS_23010 gene kdpD 6655 9339 CDS product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309343.1 protein_id gnl|my_center|LOCUS_23010 9336 10013 gene locus_tag LOCUS_23020 gene kdpE 9336 10013 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186076.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence119 170 364 gene locus_tag LOCUS_23030 170 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 442 807 gene locus_tag LOCUS_23040 442 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 986 1720 gene locus_tag LOCUS_23050 986 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1858 1998 gene locus_tag LOCUS_23060 1858 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2262 2756 gene locus_tag LOCUS_23070 2262 2756 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_23070 2749 3453 gene locus_tag LOCUS_23080 2749 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3570 4070 gene locus_tag LOCUS_23090 3570 4070 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905239.1 protein_id gnl|my_center|LOCUS_23090 4048 4245 gene locus_tag LOCUS_23100 4048 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4303 4713 gene locus_tag LOCUS_23110 4303 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 5154 5552 gene locus_tag LOCUS_23120 5154 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 5928 5584 gene locus_tag LOCUS_23130 5928 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 6040 7143 gene locus_tag LOCUS_23140 6040 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7318 7512 gene locus_tag LOCUS_23150 7318 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 7502 8242 gene locus_tag LOCUS_23160 7502 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 8239 9078 gene locus_tag LOCUS_23170 8239 9078 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_23170 9091 9282 gene locus_tag LOCUS_23180 9091 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 9418 11025 gene locus_tag LOCUS_23190 9418 11025 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_23190 11344 11559 gene locus_tag LOCUS_23200 11344 11559 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence120 89 1225 gene locus_tag LOCUS_23210 89 1225 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333512.1 protein_id gnl|my_center|LOCUS_23210 1222 3222 gene locus_tag LOCUS_23220 1222 3222 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351453.1 protein_id gnl|my_center|LOCUS_23220 3347 3808 gene locus_tag LOCUS_23230 3347 3808 CDS product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295429.1 protein_id gnl|my_center|LOCUS_23230 4319 3849 gene locus_tag LOCUS_23240 4319 3849 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295430.1 protein_id gnl|my_center|LOCUS_23240 5085 4366 gene locus_tag LOCUS_23250 gene btsR 5085 4366 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598641.1 protein_id gnl|my_center|LOCUS_23250 6782 5082 gene locus_tag LOCUS_23260 gene btsS 6782 5082 CDS product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 protein_id gnl|my_center|LOCUS_23260 6989 7720 gene locus_tag LOCUS_23270 gene mlrA 6989 7720 CDS product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240401.1 protein_id gnl|my_center|LOCUS_23270 8599 7868 gene locus_tag LOCUS_23280 gene yehW 8599 7868 CDS product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783120.1 protein_id gnl|my_center|LOCUS_23280 9530 8604 gene locus_tag LOCUS_23290 gene yehX 9530 8604 CDS product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569352.1 protein_id gnl|my_center|LOCUS_23290 10680 9523 gene locus_tag LOCUS_23300 gene yehY 10680 9523 CDS product glycine betaine ABC transporter permease YehY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220837.1 protein_id gnl|my_center|LOCUS_23300 11604 10687 gene locus_tag LOCUS_23310 gene osmF 11604 10687 CDS product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131252.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence121 621 1937 gene locus_tag LOCUS_23320 gene ugpB 621 1937 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803190.1 protein_id gnl|my_center|LOCUS_23320 2035 2922 gene locus_tag LOCUS_23330 gene ugpA 2035 2922 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099276.1 protein_id gnl|my_center|LOCUS_23330 2919 3764 gene locus_tag LOCUS_23340 gene ugpE 2919 3764 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572164.1 protein_id gnl|my_center|LOCUS_23340 3766 4836 gene locus_tag LOCUS_23350 gene ugpC 3766 4836 CDS product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907792.1 protein_id gnl|my_center|LOCUS_23350 4833 5576 gene locus_tag LOCUS_23360 gene ugpQ 4833 5576 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073609.1 protein_id gnl|my_center|LOCUS_23360 6003 5563 gene locus_tag LOCUS_23370 6003 5563 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 protein_id gnl|my_center|LOCUS_23370 6123 7865 gene locus_tag LOCUS_23380 gene ggt 6123 7865 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 protein_id gnl|my_center|LOCUS_23380 8187 7903 gene locus_tag LOCUS_23390 8187 7903 CDS product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 protein_id gnl|my_center|LOCUS_23390 8542 8387 gene locus_tag LOCUS_23400 8542 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 9131 8637 gene locus_tag LOCUS_23410 gene yrhA 9131 8637 CDS product protein YrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988501.1 protein_id gnl|my_center|LOCUS_23410 10306 9128 gene locus_tag LOCUS_23420 10306 9128 CDS product Hcp1 family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065894.1 protein_id gnl|my_center|LOCUS_23420 11031 10543 gene locus_tag LOCUS_23430 gene yhhY 11031 10543 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295206.1 protein_id gnl|my_center|LOCUS_23430 11417 11265 gene locus_tag LOCUS_23440 11417 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence122 1771 749 gene locus_tag LOCUS_23450 1771 749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145123.1 protein_id gnl|my_center|LOCUS_23450 3323 1773 gene locus_tag LOCUS_23460 3323 1773 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830577.1 protein_id gnl|my_center|LOCUS_23460 3918 3337 gene locus_tag LOCUS_23470 gene ddpX 3918 3337 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285834.1 protein_id gnl|my_center|LOCUS_23470 6575 4176 gene locus_tag LOCUS_23480 gene dosP 6575 4176 CDS product oxygen-sensing cyclic-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307211.1 protein_id gnl|my_center|LOCUS_23480 7982 6600 gene locus_tag LOCUS_23490 gene dosC 7982 6600 CDS product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426279.1 protein_id gnl|my_center|LOCUS_23490 9508 8354 gene locus_tag LOCUS_23500 9508 8354 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350395.1 protein_id gnl|my_center|LOCUS_23500 9463 9639 gene locus_tag LOCUS_23510 9463 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 11339 9804 gene locus_tag LOCUS_23520 gene gadC 11339 9804 CDS product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246019.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence123 3881 1710 gene locus_tag LOCUS_23530 gene glcB 3881 1710 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084122.1 protein_id gnl|my_center|LOCUS_23530 4307 3903 gene locus_tag LOCUS_23540 4307 3903 CDS product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 protein_id gnl|my_center|LOCUS_23540 5535 4312 gene locus_tag LOCUS_23550 gene glcF 5535 4312 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194680.1 protein_id gnl|my_center|LOCUS_23550 6598 5546 gene locus_tag LOCUS_23560 gene glcE 6598 5546 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943100.1 protein_id gnl|my_center|LOCUS_23560 8097 6598 gene locus_tag LOCUS_23570 gene glcD 8097 6598 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 protein_id gnl|my_center|LOCUS_23570 8348 9112 gene locus_tag LOCUS_23580 gene glcC 8348 9112 CDS product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 protein_id gnl|my_center|LOCUS_23580 10261 9119 gene locus_tag LOCUS_23590 gene yghO 10261 9119 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence124 3371 1938 gene locus_tag LOCUS_23600 gene glgA 3371 1938 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 protein_id gnl|my_center|LOCUS_23600 4666 3371 gene locus_tag LOCUS_23610 gene glgC 4666 3371 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 protein_id gnl|my_center|LOCUS_23610 6657 4684 gene locus_tag LOCUS_23620 gene glgX 6657 4684 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192540.1 protein_id gnl|my_center|LOCUS_23620 8840 6654 gene locus_tag LOCUS_23630 gene glgB 8840 6654 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 protein_id gnl|my_center|LOCUS_23630 10216 9113 gene locus_tag LOCUS_23640 gene asd 10216 9113 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 protein_id gnl|my_center|LOCUS_23640 10409 11002 gene locus_tag LOCUS_23650 gene yhgN 10409 11002 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence125 1825 797 gene locus_tag LOCUS_23660 gene lsrC 1825 797 CDS product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911184.1 protein_id gnl|my_center|LOCUS_23660 3354 1819 gene locus_tag LOCUS_23670 gene lsrA 3354 1819 CDS product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194860.1 protein_id gnl|my_center|LOCUS_23670 3603 4556 gene locus_tag LOCUS_23680 gene lsrR 3603 4556 CDS product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154339.1 protein_id gnl|my_center|LOCUS_23680 4635 6227 gene locus_tag LOCUS_23690 gene lsrK 4635 6227 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113145.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence126 1777 641 gene locus_tag LOCUS_23700 gene pdxB 1777 641 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699105.1 protein_id gnl|my_center|LOCUS_23700 1876 2871 gene locus_tag LOCUS_23710 gene flk 1876 2871 CDS product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615834.1 protein_id gnl|my_center|LOCUS_23710 4046 2868 gene locus_tag LOCUS_23720 4046 2868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127781.1 protein_id gnl|my_center|LOCUS_23720 5575 4355 gene locus_tag LOCUS_23730 gene fabB 5575 4355 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817183.1 protein_id gnl|my_center|LOCUS_23730 5734 7740 gene locus_tag LOCUS_23740 gene mnmC 5734 7740 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 protein_id gnl|my_center|LOCUS_23740 8139 7861 gene locus_tag LOCUS_23750 8139 7861 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559764.1 protein_id gnl|my_center|LOCUS_23750 8721 8173 gene locus_tag LOCUS_23760 gene epmC 8721 8173 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089222.1 protein_id gnl|my_center|LOCUS_23760 9530 8721 gene locus_tag LOCUS_23770 9530 8721 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447361.1 protein_id gnl|my_center|LOCUS_23770 10354 9530 gene locus_tag LOCUS_23780 gene mepA 10354 9530 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043825.1 protein_id gnl|my_center|LOCUS_23780 <11386 10358 gene locus_tag LOCUS_23790 <11386 10358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000918470.1:chorismate synthase >Feature sequence127 1373 615 gene locus_tag LOCUS_23800 1373 615 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 protein_id gnl|my_center|LOCUS_23800 2490 1510 gene locus_tag LOCUS_23810 gene ydjG 2490 1510 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723719.1 protein_id gnl|my_center|LOCUS_23810 3447 2500 gene locus_tag LOCUS_23820 3447 2500 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 protein_id gnl|my_center|LOCUS_23820 4288 3452 gene locus_tag LOCUS_23830 4288 3452 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 protein_id gnl|my_center|LOCUS_23830 5121 4309 gene locus_tag LOCUS_23840 5121 4309 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798115.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23840 5351 5091 gene locus_tag LOCUS_23850 5351 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23850 6747 5368 gene locus_tag LOCUS_23860 6747 5368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435292.1 protein_id gnl|my_center|LOCUS_23860 7850 6774 gene locus_tag LOCUS_23870 7850 6774 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645221.1 protein_id gnl|my_center|LOCUS_23870 8492 8220 gene locus_tag LOCUS_23880 8492 8220 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046790.1 protein_id gnl|my_center|LOCUS_23880 8947 8534 gene locus_tag LOCUS_23890 gene msrB 8947 8534 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284618.1 protein_id gnl|my_center|LOCUS_23890 9289 10284 gene locus_tag LOCUS_23900 gene gapA 9289 10284 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 protein_id gnl|my_center|LOCUS_23900 10368 11252 gene locus_tag LOCUS_23910 10368 11252 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299317.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence128 139 357 gene locus_tag LOCUS_23920 139 357 CDS product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972391.1 protein_id gnl|my_center|LOCUS_23920 2278 593 gene locus_tag LOCUS_23930 2278 593 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024876.1 protein_id gnl|my_center|LOCUS_23930 3212 2955 gene locus_tag LOCUS_23940 gene grxA 3212 2955 CDS product glutaredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195231.1 protein_id gnl|my_center|LOCUS_23940 3372 3659 gene locus_tag LOCUS_23950 3372 3659 CDS product DUF1418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201560.1 protein_id gnl|my_center|LOCUS_23950 3643 4347 gene locus_tag LOCUS_23960 gene nfsA 3643 4347 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189187.1 protein_id gnl|my_center|LOCUS_23960 4426 5328 gene locus_tag LOCUS_23970 gene rimK 4426 5328 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684321.1 protein_id gnl|my_center|LOCUS_23970 5416 5892 gene locus_tag LOCUS_23980 5416 5892 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203025.1 protein_id gnl|my_center|LOCUS_23980 6243 7355 gene locus_tag LOCUS_23990 gene potF 6243 7355 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126072.1 protein_id gnl|my_center|LOCUS_23990 7450 8583 gene locus_tag LOCUS_24000 gene potG 7450 8583 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996005.1 protein_id gnl|my_center|LOCUS_24000 8593 9546 gene locus_tag LOCUS_24010 gene potH 8593 9546 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105436.1 protein_id gnl|my_center|LOCUS_24010 9543 10388 gene locus_tag LOCUS_24020 gene potI 9543 10388 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061657.1 protein_id gnl|my_center|LOCUS_24020 10448 10936 gene locus_tag LOCUS_24030 10448 10936 CDS product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389260.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence129 1945 3054 gene locus_tag LOCUS_24040 gene ycbX 1945 3054 CDS product 6-N-hydroxylaminopurine resistance protein YcbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224274.1 protein_id gnl|my_center|LOCUS_24040 3593 3051 gene locus_tag LOCUS_24050 gene zapC 3593 3051 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295353.1 protein_id gnl|my_center|LOCUS_24050 4777 3767 gene locus_tag LOCUS_24060 gene pyrD 4777 3767 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295352.1 protein_id gnl|my_center|LOCUS_24060 5568 4888 gene locus_tag LOCUS_24070 5568 4888 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307090.1 protein_id gnl|my_center|LOCUS_24070 6106 5591 gene locus_tag LOCUS_24080 6106 5591 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919497.1 protein_id gnl|my_center|LOCUS_24080 6566 6114 gene locus_tag LOCUS_24090 6566 6114 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349463.1 protein_id gnl|my_center|LOCUS_24090 7738 6668 gene locus_tag LOCUS_24100 7738 6668 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165668.1 protein_id gnl|my_center|LOCUS_24100 10329 7729 gene locus_tag LOCUS_24110 10329 7729 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286318.1 protein_id gnl|my_center|LOCUS_24110 11055 10354 gene locus_tag LOCUS_24120 11055 10354 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295349.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence130 1118 1855 gene locus_tag LOCUS_24130 gene trmN 1118 1855 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295363.1 protein_id gnl|my_center|LOCUS_24130 3462 1840 gene locus_tag LOCUS_24140 gene nadB 3462 1840 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 protein_id gnl|my_center|LOCUS_24140 3870 4445 gene locus_tag LOCUS_24150 gene rpoE 3870 4445 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 protein_id gnl|my_center|LOCUS_24150 4478 5128 gene locus_tag LOCUS_24160 gene rseA 4478 5128 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 protein_id gnl|my_center|LOCUS_24160 5128 6084 gene locus_tag LOCUS_24170 gene rseB 5128 6084 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 protein_id gnl|my_center|LOCUS_24170 6081 6560 gene locus_tag LOCUS_24180 gene rseC 6081 6560 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589070.1 protein_id gnl|my_center|LOCUS_24180 6758 8557 gene locus_tag LOCUS_24190 gene lepA 6758 8557 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 protein_id gnl|my_center|LOCUS_24190 8573 9547 gene locus_tag LOCUS_24200 gene lepB 8573 9547 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 protein_id gnl|my_center|LOCUS_24200 9820 10500 gene locus_tag LOCUS_24210 gene rnc 9820 10500 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence131 847 1650 gene locus_tag LOCUS_24220 gene suhB 847 1650 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 protein_id gnl|my_center|LOCUS_24220 1795 2649 gene locus_tag LOCUS_24230 1795 2649 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299515.1 protein_id gnl|my_center|LOCUS_24230 2840 4120 gene locus_tag LOCUS_24240 gene csiE 2840 4120 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982994.1 protein_id gnl|my_center|LOCUS_24240 5251 4112 gene locus_tag LOCUS_24250 5251 4112 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 protein_id gnl|my_center|LOCUS_24250 6301 5411 gene locus_tag LOCUS_24260 gene hcaR 6301 5411 CDS product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423257.1 protein_id gnl|my_center|LOCUS_24260 6437 7798 gene locus_tag LOCUS_24270 6437 7798 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 protein_id gnl|my_center|LOCUS_24270 7795 8313 gene locus_tag LOCUS_24280 7795 8313 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 protein_id gnl|my_center|LOCUS_24280 8313 8633 gene locus_tag LOCUS_24290 8313 8633 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 protein_id gnl|my_center|LOCUS_24290 8630 9442 gene locus_tag LOCUS_24300 gene hcaB 8630 9442 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281372.1 protein_id gnl|my_center|LOCUS_24300 9452 10654 gene locus_tag LOCUS_24310 9452 10654 CDS product phenylpropionate dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660788.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence132 428 12 gene locus_tag LOCUS_24320 gene ruvX 428 12 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017106.1 protein_id gnl|my_center|LOCUS_24320 991 428 gene locus_tag LOCUS_24330 991 428 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 protein_id gnl|my_center|LOCUS_24330 2050 1100 gene locus_tag LOCUS_24340 gene gshB 2050 1100 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 protein_id gnl|my_center|LOCUS_24340 2794 2063 gene locus_tag LOCUS_24350 gene rsmE 2794 2063 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222508.1 protein_id gnl|my_center|LOCUS_24350 3581 2874 gene locus_tag LOCUS_24360 gene endA 3581 2874 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 protein_id gnl|my_center|LOCUS_24360 4131 3676 gene locus_tag LOCUS_24370 4131 3676 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858396.1 protein_id gnl|my_center|LOCUS_24370 5644 4250 gene locus_tag LOCUS_24380 gene galP 5644 4250 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 protein_id gnl|my_center|LOCUS_24380 7234 6080 gene locus_tag LOCUS_24390 gene metK 7234 6080 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 protein_id gnl|my_center|LOCUS_24390 8107 10005 gene locus_tag LOCUS_24400 gene speA 8107 10005 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295380.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence133 1338 139 gene locus_tag LOCUS_24410 gene lolC 1338 139 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284714.1 protein_id gnl|my_center|LOCUS_24410 1600 2673 gene locus_tag LOCUS_24420 1600 2673 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810253.1 protein_id gnl|my_center|LOCUS_24420 2738 6247 gene locus_tag LOCUS_24430 gene mfd 2738 6247 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115094.1 protein_id gnl|my_center|LOCUS_24430 6394 7353 gene locus_tag LOCUS_24440 gene ldtC 6394 7353 CDS product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098471.1 protein_id gnl|my_center|LOCUS_24440 7693 7436 gene locus_tag LOCUS_24450 gene bhsA 7693 7436 CDS product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800153.1 protein_id gnl|my_center|LOCUS_24450 7934 8566 gene locus_tag LOCUS_24460 gene comR 7934 8566 CDS product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179805.1 protein_id gnl|my_center|LOCUS_24460 9167 8628 gene locus_tag LOCUS_24470 9167 8628 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 protein_id gnl|my_center|LOCUS_24470 10698 9394 gene locus_tag LOCUS_24480 gene ndh 10698 9394 CDS product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211045.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence134 1069 446 gene locus_tag LOCUS_24490 gene clpP 1069 446 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 protein_id gnl|my_center|LOCUS_24490 2613 1315 gene locus_tag LOCUS_24500 gene tig 2613 1315 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 protein_id gnl|my_center|LOCUS_24500 3274 2957 gene locus_tag LOCUS_24510 gene bolA 3274 2957 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 protein_id gnl|my_center|LOCUS_24510 3579 4157 gene locus_tag LOCUS_24520 3579 4157 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 protein_id gnl|my_center|LOCUS_24520 4201 5676 gene locus_tag LOCUS_24530 gene ampG 4201 5676 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098438.1 protein_id gnl|my_center|LOCUS_24530 6137 7084 gene locus_tag LOCUS_24540 gene cyoA 6137 7084 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239441.1 protein_id gnl|my_center|LOCUS_24540 7106 9097 gene locus_tag LOCUS_24550 gene cyoB 7106 9097 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 protein_id gnl|my_center|LOCUS_24550 9186 9701 gene locus_tag LOCUS_24560 9186 9701 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 protein_id gnl|my_center|LOCUS_24560 9701 10030 gene locus_tag LOCUS_24570 9701 10030 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence135 4192 2723 gene locus_tag LOCUS_24580 gene rng 4192 2723 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 protein_id gnl|my_center|LOCUS_24580 4775 4182 gene locus_tag LOCUS_24590 gene yhdE 4775 4182 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203105.1 protein_id gnl|my_center|LOCUS_24590 5272 4784 gene locus_tag LOCUS_24600 gene mreD 5272 4784 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 protein_id gnl|my_center|LOCUS_24600 6375 5272 gene locus_tag LOCUS_24610 gene mreC 6375 5272 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802516.1 protein_id gnl|my_center|LOCUS_24610 7484 6441 gene locus_tag LOCUS_24620 gene mreB 7484 6441 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 protein_id gnl|my_center|LOCUS_24620 9729 7789 gene locus_tag LOCUS_24630 gene csrD 9729 7789 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 protein_id gnl|my_center|LOCUS_24630 9881 10855 gene locus_tag LOCUS_24640 9881 10855 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148481.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence136 366 76 gene locus_tag LOCUS_24650 366 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1822 464 gene locus_tag LOCUS_24660 1822 464 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409841.1 protein_id gnl|my_center|LOCUS_24660 2410 4833 gene locus_tag LOCUS_24670 gene pgaA 2410 4833 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287458.1 protein_id gnl|my_center|LOCUS_24670 4842 6860 gene locus_tag LOCUS_24680 gene pgaB 4842 6860 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945561.1 protein_id gnl|my_center|LOCUS_24680 6973 8178 gene locus_tag LOCUS_24690 gene pgaC 6973 8178 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610451.1 protein_id gnl|my_center|LOCUS_24690 8180 8593 gene locus_tag LOCUS_24700 gene pgaD 8180 8593 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061095.1 protein_id gnl|my_center|LOCUS_24700 9566 8643 gene locus_tag LOCUS_24710 gene phoH 9566 8643 CDS product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258765.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence137 413 736 gene locus_tag LOCUS_24720 413 736 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160737.1 protein_id gnl|my_center|LOCUS_24720 733 1563 gene locus_tag LOCUS_24730 gene amiD 733 1563 CDS product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255167.1 protein_id gnl|my_center|LOCUS_24730 2609 1560 gene locus_tag LOCUS_24740 2609 1560 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069300.1 protein_id gnl|my_center|LOCUS_24740 4102 2672 gene locus_tag LOCUS_24750 4102 2672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136554.1 protein_id gnl|my_center|LOCUS_24750 5114 4113 gene locus_tag LOCUS_24760 gene ltaE 5114 4113 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566370.1 protein_id gnl|my_center|LOCUS_24760 6869 5151 gene locus_tag LOCUS_24770 gene poxB 6869 5151 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815359.1 protein_id gnl|my_center|LOCUS_24770 7970 7002 gene locus_tag LOCUS_24780 gene hcr 7970 7002 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178677.1 protein_id gnl|my_center|LOCUS_24780 9634 7982 gene locus_tag LOCUS_24790 gene hcp 9634 7982 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458817.1 protein_id gnl|my_center|LOCUS_24790 10677 9778 gene locus_tag LOCUS_24800 gene lysO 10677 9778 CDS product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491142.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence138 <1 598 gene locus_tag LOCUS_24810 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001007421.1:bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase 600 1544 gene locus_tag LOCUS_24820 gene mhpB 600 1544 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_24820 1573 2439 gene locus_tag LOCUS_24830 gene mhpC 1573 2439 CDS product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 protein_id gnl|my_center|LOCUS_24830 2449 3258 gene locus_tag LOCUS_24840 gene mhpD 2449 3258 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 protein_id gnl|my_center|LOCUS_24840 3255 4205 gene locus_tag LOCUS_24850 gene mhpF 3255 4205 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 protein_id gnl|my_center|LOCUS_24850 4202 5215 gene locus_tag LOCUS_24860 gene dmpG 4202 5215 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013510.1 protein_id gnl|my_center|LOCUS_24860 5285 6496 gene locus_tag LOCUS_24870 gene mhpT 5285 6496 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107624.1 protein_id gnl|my_center|LOCUS_24870 6747 8174 gene locus_tag LOCUS_24880 gene mmuP 6747 8174 CDS product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393629.1 protein_id gnl|my_center|LOCUS_24880 8161 9093 gene locus_tag LOCUS_24890 gene mmuM 8161 9093 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081352.1 protein_id gnl|my_center|LOCUS_24890 10248 9202 gene locus_tag LOCUS_24900 gene fbpC 10248 9202 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192349.1 protein_id gnl|my_center|LOCUS_24900 10622 10260 gene locus_tag LOCUS_24910 10622 10260 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295711.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence139 468 82 gene locus_tag LOCUS_24920 468 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1495 668 gene locus_tag LOCUS_24930 gene dkgA 1495 668 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 protein_id gnl|my_center|LOCUS_24930 2763 1600 gene locus_tag LOCUS_24940 gene yqhD 2763 1600 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058802.1 protein_id gnl|my_center|LOCUS_24940 2957 3856 gene locus_tag LOCUS_24950 gene yqhC 2957 3856 CDS product DNA-binding transcriptional regulator YqhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298382.1 protein_id gnl|my_center|LOCUS_24950 4555 3896 gene locus_tag LOCUS_24960 gene yghB 4555 3896 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 protein_id gnl|my_center|LOCUS_24960 5882 4695 gene locus_tag LOCUS_24970 gene metC 5882 4695 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301079.1 protein_id gnl|my_center|LOCUS_24970 6134 6868 gene locus_tag LOCUS_24980 gene exbB 6134 6868 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 protein_id gnl|my_center|LOCUS_24980 6875 7300 gene locus_tag LOCUS_24990 gene exbD 6875 7300 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 protein_id gnl|my_center|LOCUS_24990 8456 7572 gene locus_tag LOCUS_25000 gene yghA 8456 7572 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 protein_id gnl|my_center|LOCUS_25000 8647 9141 gene locus_tag LOCUS_25010 8647 9141 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_25010 10221 9181 gene locus_tag LOCUS_25020 gene gpr 10221 9181 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262150.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence140 1357 146 gene locus_tag LOCUS_25030 1357 146 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597374.1 protein_id gnl|my_center|LOCUS_25030 2542 1379 gene locus_tag LOCUS_25040 2542 1379 CDS product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 protein_id gnl|my_center|LOCUS_25040 3689 2583 gene locus_tag LOCUS_25050 3689 2583 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674094.1 protein_id gnl|my_center|LOCUS_25050 4594 3701 gene locus_tag LOCUS_25060 4594 3701 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 protein_id gnl|my_center|LOCUS_25060 5981 4677 gene locus_tag LOCUS_25070 5981 4677 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 protein_id gnl|my_center|LOCUS_25070 6368 6012 gene locus_tag LOCUS_25080 6368 6012 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816883.1 protein_id gnl|my_center|LOCUS_25080 6766 6410 gene locus_tag LOCUS_25090 6766 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 8175 6799 gene locus_tag LOCUS_25100 gene amiE 8175 6799 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234970.1 protein_id gnl|my_center|LOCUS_25100 9233 8322 gene locus_tag LOCUS_25110 gene yhfZ 9233 8322 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005177131.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence141 2733 457 gene locus_tag LOCUS_25120 gene clpA 2733 457 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 protein_id gnl|my_center|LOCUS_25120 3084 2764 gene locus_tag LOCUS_25130 gene clpS 3084 2764 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520781.1 protein_id gnl|my_center|LOCUS_25130 3407 3631 gene locus_tag LOCUS_25140 gene cspD 3407 3631 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410785.1 protein_id gnl|my_center|LOCUS_25140 5632 3704 gene locus_tag LOCUS_25150 gene macB 5632 3704 CDS product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188136.1 protein_id gnl|my_center|LOCUS_25150 6726 5629 gene locus_tag LOCUS_25160 gene macA 6726 5629 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746460.1 protein_id gnl|my_center|LOCUS_25160 6859 7851 gene locus_tag LOCUS_25170 6859 7851 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241049.1 protein_id gnl|my_center|LOCUS_25170 9506 7848 gene locus_tag LOCUS_25180 9506 7848 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599802.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence142 1893 847 gene locus_tag LOCUS_25190 gene fbpC 1893 847 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 protein_id gnl|my_center|LOCUS_25190 3983 1905 gene locus_tag LOCUS_25200 3983 1905 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 protein_id gnl|my_center|LOCUS_25200 5083 4052 gene locus_tag LOCUS_25210 5083 4052 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_25210 6384 5080 gene locus_tag LOCUS_25220 gene uhpC 6384 5080 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 protein_id gnl|my_center|LOCUS_25220 8010 6469 gene locus_tag LOCUS_25230 8010 6469 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089287.1 protein_id gnl|my_center|LOCUS_25230 8639 8010 gene locus_tag LOCUS_25240 8639 8010 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621916.1 protein_id gnl|my_center|LOCUS_25240 10103 8922 gene locus_tag LOCUS_25250 10103 8922 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence143 1351 65 gene locus_tag LOCUS_25260 1351 65 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 protein_id gnl|my_center|LOCUS_25260 2343 1402 gene locus_tag LOCUS_25270 2343 1402 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091480.1 protein_id gnl|my_center|LOCUS_25270 3128 2358 gene locus_tag LOCUS_25280 3128 2358 CDS product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692204.1 protein_id gnl|my_center|LOCUS_25280 3775 5115 gene locus_tag LOCUS_25290 gene caiT 3775 5115 CDS product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787104.1 protein_id gnl|my_center|LOCUS_25290 5146 6288 gene locus_tag LOCUS_25300 gene caiA 5146 6288 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_25300 6417 7634 gene locus_tag LOCUS_25310 gene caiB 6417 7634 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349936.1 protein_id gnl|my_center|LOCUS_25310 7708 9261 gene locus_tag LOCUS_25320 gene caiC 7708 9261 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301863.1 protein_id gnl|my_center|LOCUS_25320 9370 10155 gene locus_tag LOCUS_25330 gene caiD 9370 10155 CDS product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295419.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence144 374 96 gene locus_tag LOCUS_25340 374 96 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163908.1 protein_id gnl|my_center|LOCUS_25340 471 779 gene locus_tag LOCUS_25350 471 779 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094527.1 protein_id gnl|my_center|LOCUS_25350 829 1806 gene locus_tag LOCUS_25360 829 1806 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247218.1 protein_id gnl|my_center|LOCUS_25360 1809 2171 gene locus_tag LOCUS_25370 1809 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2171 2608 gene locus_tag LOCUS_25380 2171 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 5918 2769 gene locus_tag LOCUS_25390 gene acrB 5918 2769 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132469.1 protein_id gnl|my_center|LOCUS_25390 7026 5941 gene locus_tag LOCUS_25400 gene acrA 7026 5941 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 protein_id gnl|my_center|LOCUS_25400 7276 7923 gene locus_tag LOCUS_25410 gene acrR 7276 7923 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence145 3375 4931 gene locus_tag LOCUS_25420 gene mltF 3375 4931 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 protein_id gnl|my_center|LOCUS_25420 5431 4928 gene locus_tag LOCUS_25430 gene tadA 5431 4928 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 protein_id gnl|my_center|LOCUS_25430 6124 5489 gene locus_tag LOCUS_25440 gene yfhb 6124 5489 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 protein_id gnl|my_center|LOCUS_25440 6333 7181 gene locus_tag LOCUS_25450 6333 7181 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013779.1 protein_id gnl|my_center|LOCUS_25450 7312 7497 gene locus_tag LOCUS_25460 7312 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 8572 8192 gene locus_tag LOCUS_25470 gene acpS 8572 8192 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986029.1 protein_id gnl|my_center|LOCUS_25470 9303 8572 gene locus_tag LOCUS_25480 gene pdxJ 9303 8572 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 protein_id gnl|my_center|LOCUS_25480 10043 9315 gene locus_tag LOCUS_25490 gene recO 10043 9315 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399393.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence146 <1 640 gene locus_tag LOCUS_25500 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000977128.1:TVP38/TMEM64 family protein 640 1188 gene locus_tag LOCUS_25510 640 1188 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524097.1 protein_id gnl|my_center|LOCUS_25510 1198 2364 gene locus_tag LOCUS_25520 1198 2364 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215339.1 protein_id gnl|my_center|LOCUS_25520 2370 3872 gene locus_tag LOCUS_25530 2370 3872 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224958.1 protein_id gnl|my_center|LOCUS_25530 3872 4525 gene locus_tag LOCUS_25540 3872 4525 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300558.1 protein_id gnl|my_center|LOCUS_25540 4592 5899 gene locus_tag LOCUS_25550 gene ynjE 4592 5899 CDS product thiosulfate sulfurtransferase YnjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351355.1 protein_id gnl|my_center|LOCUS_25550 6528 5908 gene locus_tag LOCUS_25560 6528 5908 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295484.1 protein_id gnl|my_center|LOCUS_25560 6615 7022 gene locus_tag LOCUS_25570 gene nudG 6615 7022 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781880.1 protein_id gnl|my_center|LOCUS_25570 7260 6988 gene locus_tag LOCUS_25580 7260 6988 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085238.1 protein_id gnl|my_center|LOCUS_25580 7496 8839 gene locus_tag LOCUS_25590 gene gdhA 7496 8839 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373043.1 protein_id gnl|my_center|LOCUS_25590 9996 8956 gene locus_tag LOCUS_25600 9996 8956 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756914.1 protein_id gnl|my_center|LOCUS_25600 10396 10124 gene locus_tag LOCUS_25610 10396 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence147 2047 152 gene locus_tag LOCUS_25620 gene cirA 2047 152 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489247.1 protein_id gnl|my_center|LOCUS_25620 3904 2435 gene locus_tag LOCUS_25630 gene lysP 3904 2435 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253273.1 protein_id gnl|my_center|LOCUS_25630 4915 4109 gene locus_tag LOCUS_25640 gene yieE 4915 4109 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548294.1 protein_id gnl|my_center|LOCUS_25640 5089 6138 gene locus_tag LOCUS_25650 5089 6138 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182053.1 protein_id gnl|my_center|LOCUS_25650 6212 7069 gene locus_tag LOCUS_25660 gene nfo 6212 7069 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 protein_id gnl|my_center|LOCUS_25660 7072 8160 gene locus_tag LOCUS_25670 7072 8160 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065016.1 protein_id gnl|my_center|LOCUS_25670 9466 8216 gene locus_tag LOCUS_25680 9466 8216 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382966.1 protein_id gnl|my_center|LOCUS_25680 <10396 9566 gene locus_tag LOCUS_25690 <10396 9566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000415455.1:ribosylpyrimidine nucleosidase >Feature sequence148 156 70 gene locus_tag LOCUS_t00330 156 70 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 242 169 gene locus_tag LOCUS_t00340 242 169 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 372 297 gene locus_tag LOCUS_t00350 372 297 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1072 524 gene locus_tag LOCUS_25700 gene pgsA 1072 524 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160187.1 protein_id gnl|my_center|LOCUS_25700 2961 1129 gene locus_tag LOCUS_25710 gene uvrC 2961 1129 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283421.1 protein_id gnl|my_center|LOCUS_25710 3614 2958 gene locus_tag LOCUS_25720 gene uvrY 3614 2958 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611335.1 protein_id gnl|my_center|LOCUS_25720 4073 4297 gene locus_tag LOCUS_25730 gene yecF 4073 4297 CDS product DUF2594 family protein YecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106474.1 protein_id gnl|my_center|LOCUS_25730 5086 4364 gene locus_tag LOCUS_25740 gene sdiA 5086 4364 CDS product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154288.1 protein_id gnl|my_center|LOCUS_25740 6068 5316 gene locus_tag LOCUS_25750 gene yecC 6068 5316 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272991.1 protein_id gnl|my_center|LOCUS_25750 6733 6065 gene locus_tag LOCUS_25760 gene tcyL 6733 6065 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158220.1 protein_id gnl|my_center|LOCUS_25760 7734 6748 gene locus_tag LOCUS_25770 gene dcyD 7734 6748 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 protein_id gnl|my_center|LOCUS_25770 8696 7839 gene locus_tag LOCUS_25780 gene tcyJ 8696 7839 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494889.1 protein_id gnl|my_center|LOCUS_25780 9314 8883 gene locus_tag LOCUS_25790 9314 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25790 10013 9324 gene locus_tag LOCUS_25800 gene fliA 10013 9324 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence149 1950 757 gene locus_tag LOCUS_25810 1950 757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074477.1 protein_id gnl|my_center|LOCUS_25810 2086 3810 gene locus_tag LOCUS_25820 gene iucA 2086 3810 CDS product NIS family aerobactin synthetase IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069567.1 protein_id gnl|my_center|LOCUS_25820 3811 4758 gene locus_tag LOCUS_25830 gene iucB 3811 4758 CDS product N(6)-hydroxylysine O-acetyltransferase IucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287497.1 protein_id gnl|my_center|LOCUS_25830 4758 6500 gene locus_tag LOCUS_25840 gene iucC 4758 6500 CDS product NIS family aerobactin synthetase IucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015709.1 protein_id gnl|my_center|LOCUS_25840 6497 7834 gene locus_tag LOCUS_25850 gene iucD 6497 7834 CDS product NADPH-dependent L-lysine N(6)-monooxygenase IucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750139.1 protein_id gnl|my_center|LOCUS_25850 7837 10035 gene locus_tag LOCUS_25860 gene iutA 7837 10035 CDS product ferric aerobactin receptor IutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403966.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence150 1127 81 gene locus_tag LOCUS_25870 gene potD 1127 81 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759317.1 protein_id gnl|my_center|LOCUS_25870 1918 1124 gene locus_tag LOCUS_25880 gene potC 1918 1124 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 protein_id gnl|my_center|LOCUS_25880 2772 1915 gene locus_tag LOCUS_25890 gene potB 2772 1915 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799401.1 protein_id gnl|my_center|LOCUS_25890 3874 2756 gene locus_tag LOCUS_25900 gene potA 3874 2756 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531594.1 protein_id gnl|my_center|LOCUS_25900 4086 3871 gene locus_tag LOCUS_25910 4086 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310720.1 protein_id gnl|my_center|LOCUS_25910 4142 5368 gene locus_tag LOCUS_25920 gene pepT 4142 5368 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359446.1 protein_id gnl|my_center|LOCUS_25920 6538 5417 gene locus_tag LOCUS_25930 gene roxA 6538 5417 CDS product [50S ribosomal protein L16]-arginine 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933638.1 protein_id gnl|my_center|LOCUS_25930 8074 6614 gene locus_tag LOCUS_25940 gene phoQ 8074 6614 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735412.1 protein_id gnl|my_center|LOCUS_25940 8745 8074 gene locus_tag LOCUS_25950 gene phoP 8745 8074 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265471.1 protein_id gnl|my_center|LOCUS_25950 <10032 8914 gene locus_tag LOCUS_25960 <10032 8914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000423729.1:adenylosuccinate lyase >Feature sequence151 <1 507 gene locus_tag LOCUS_25970 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001086511.1:bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL 519 2426 gene locus_tag LOCUS_25980 519 2426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053099.1 protein_id gnl|my_center|LOCUS_25980 2556 3809 gene locus_tag LOCUS_25990 gene pqiA 2556 3809 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333176.1 protein_id gnl|my_center|LOCUS_25990 3814 5454 gene locus_tag LOCUS_26000 gene pqiB 3814 5454 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445533.1 protein_id gnl|my_center|LOCUS_26000 5451 6014 gene locus_tag LOCUS_26010 gene pqiC 5451 6014 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759120.1 protein_id gnl|my_center|LOCUS_26010 6270 6437 gene locus_tag LOCUS_26020 gene rmf 6270 6437 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828648.1 protein_id gnl|my_center|LOCUS_26020 7133 6507 gene locus_tag LOCUS_26030 gene fabA 7133 6507 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018747.1 protein_id gnl|my_center|LOCUS_26030 8854 7094 gene locus_tag LOCUS_26040 8854 7094 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156518.1 protein_id gnl|my_center|LOCUS_26040 9040 9492 gene locus_tag LOCUS_26050 gene matP 9040 9492 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence152 2434 1457 gene locus_tag LOCUS_26060 gene epmA 2434 1457 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 protein_id gnl|my_center|LOCUS_26060 2759 4567 gene locus_tag LOCUS_26070 gene frdA 2759 4567 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192973.1 protein_id gnl|my_center|LOCUS_26070 4560 5294 gene locus_tag LOCUS_26080 gene frdB 4560 5294 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 protein_id gnl|my_center|LOCUS_26080 5305 5700 gene locus_tag LOCUS_26090 gene frdC 5305 5700 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 protein_id gnl|my_center|LOCUS_26090 5711 6070 gene locus_tag LOCUS_26100 gene frdD 5711 6070 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609663.1 protein_id gnl|my_center|LOCUS_26100 6133 7266 gene locus_tag LOCUS_26110 6133 7266 CDS product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477369.1 protein_id gnl|my_center|LOCUS_26110 7355 7888 gene locus_tag LOCUS_26120 gene blc 7355 7888 CDS product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238369.1 protein_id gnl|my_center|LOCUS_26120 8202 7885 gene locus_tag LOCUS_26130 gene sugE 8202 7885 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 protein_id gnl|my_center|LOCUS_26130 8524 8378 gene locus_tag LOCUS_26140 gene ecnB 8524 8378 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 protein_id gnl|my_center|LOCUS_26140 9378 8812 gene locus_tag LOCUS_26150 gene efp 9378 8812 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence153 936 118 gene locus_tag LOCUS_26160 gene nlpA 936 118 CDS product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 protein_id gnl|my_center|LOCUS_26160 1158 1451 gene locus_tag LOCUS_26170 gene yicS 1158 1451 CDS product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 protein_id gnl|my_center|LOCUS_26170 2682 1492 gene locus_tag LOCUS_26180 gene nepI 2682 1492 CDS product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 protein_id gnl|my_center|LOCUS_26180 3345 2893 gene locus_tag LOCUS_26190 3345 2893 CDS product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 protein_id gnl|my_center|LOCUS_26190 4732 3398 gene locus_tag LOCUS_26200 gene adeQ 4732 3398 CDS product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001403836.1 protein_id gnl|my_center|LOCUS_26200 4907 6673 gene locus_tag LOCUS_26210 gene adeD 4907 6673 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065695.1 protein_id gnl|my_center|LOCUS_26210 8110 6719 gene locus_tag LOCUS_26220 gene uhpT 8110 6719 CDS product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 protein_id gnl|my_center|LOCUS_26220 9567 8248 gene locus_tag LOCUS_26230 gene uhpC 9567 8248 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936566.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence154 <1 657 gene locus_tag LOCUS_26240 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001299828.1:trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase 1335 697 gene locus_tag LOCUS_26250 gene rutR 1335 697 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191701.1 protein_id gnl|my_center|LOCUS_26250 1620 2714 gene locus_tag LOCUS_26260 gene rutA 1620 2714 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326839.1 protein_id gnl|my_center|LOCUS_26260 2714 3406 gene locus_tag LOCUS_26270 gene rutB 2714 3406 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307708.1 protein_id gnl|my_center|LOCUS_26270 3418 3804 gene locus_tag LOCUS_26280 gene rutC 3418 3804 CDS product 3-aminoacrylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126780.1 protein_id gnl|my_center|LOCUS_26280 3812 4612 gene locus_tag LOCUS_26290 gene rutD 3812 4612 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307099.1 protein_id gnl|my_center|LOCUS_26290 4622 5212 gene locus_tag LOCUS_26300 4622 5212 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001165.1 protein_id gnl|my_center|LOCUS_26300 5223 5717 gene locus_tag LOCUS_26310 gene rutF 5223 5717 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028095.1 protein_id gnl|my_center|LOCUS_26310 5738 7066 gene locus_tag LOCUS_26320 gene rutG 5738 7066 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326838.1 protein_id gnl|my_center|LOCUS_26320 7322 7149 gene locus_tag LOCUS_26330 7322 7149 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273658.1 protein_id gnl|my_center|LOCUS_26330 7695 8291 gene locus_tag LOCUS_26340 gene wrbA 7695 8291 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151437.1 protein_id gnl|my_center|LOCUS_26340 8312 8539 gene locus_tag LOCUS_26350 8312 8539 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143120.1 protein_id gnl|my_center|LOCUS_26350 9818 8577 gene locus_tag LOCUS_26360 gene agp 9818 8577 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044279.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence155 2152 1376 gene locus_tag LOCUS_26370 2152 1376 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 protein_id gnl|my_center|LOCUS_26370 3004 2162 gene locus_tag LOCUS_26380 3004 2162 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205251.1 protein_id gnl|my_center|LOCUS_26380 3805 3014 gene locus_tag LOCUS_26390 3805 3014 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 protein_id gnl|my_center|LOCUS_26390 4018 4665 gene locus_tag LOCUS_26400 4018 4665 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 protein_id gnl|my_center|LOCUS_26400 5287 4649 gene locus_tag LOCUS_26410 gene ytfB 5287 4649 CDS product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 protein_id gnl|my_center|LOCUS_26410 5506 6126 gene locus_tag LOCUS_26420 gene fklB 5506 6126 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211225.1 protein_id gnl|my_center|LOCUS_26420 6435 7847 gene locus_tag LOCUS_26430 gene cycA 6435 7847 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 protein_id gnl|my_center|LOCUS_26430 8554 7892 gene locus_tag LOCUS_26440 gene ytfE 8554 7892 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 protein_id gnl|my_center|LOCUS_26440 9627 8662 gene locus_tag LOCUS_26450 9627 8662 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296686.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence156 803 591 gene locus_tag LOCUS_26460 803 591 CDS product YncH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882235.1 protein_id gnl|my_center|LOCUS_26460 1496 879 gene locus_tag LOCUS_26470 1496 879 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598868.1 protein_id gnl|my_center|LOCUS_26470 1763 3262 gene locus_tag LOCUS_26480 gene ansP 1763 3262 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300590.1 protein_id gnl|my_center|LOCUS_26480 4438 3377 gene locus_tag LOCUS_26490 4438 3377 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550675.1 protein_id gnl|my_center|LOCUS_26490 4764 6782 gene locus_tag LOCUS_26500 gene pqqU 4764 6782 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689363.1 protein_id gnl|my_center|LOCUS_26500 7483 6818 gene locus_tag LOCUS_26510 gene mcbR 7483 6818 CDS product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300742.1 protein_id gnl|my_center|LOCUS_26510 8718 7681 gene locus_tag LOCUS_26520 gene curA 8718 7681 CDS product NADPH-dependent curcumin/dihydrocurcumin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531452.1 protein_id gnl|my_center|LOCUS_26520 8899 9417 gene locus_tag LOCUS_26530 gene mddA 8899 9417 CDS product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027563.1 protein_id gnl|my_center|LOCUS_26530 9414 9863 gene locus_tag LOCUS_26540 9414 9863 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076535.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence157 155 955 gene locus_tag LOCUS_26550 155 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1183 1524 gene locus_tag LOCUS_26560 gene symE 1183 1524 CDS product endoribonuclease SymE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132614.1 protein_id gnl|my_center|LOCUS_26560 8970 1567 gene locus_tag LOCUS_26570 8970 1567 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213431.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence158 1877 141 gene locus_tag LOCUS_26580 1877 141 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340216.1 protein_id gnl|my_center|LOCUS_26580 2886 1972 gene locus_tag LOCUS_26590 gene ldcA 2886 1972 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051583.1 protein_id gnl|my_center|LOCUS_26590 2859 3047 gene locus_tag LOCUS_26600 2859 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2986 3597 gene locus_tag LOCUS_26610 gene emtA 2986 3597 CDS product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295616.1 protein_id gnl|my_center|LOCUS_26610 4333 3599 gene locus_tag LOCUS_26620 4333 3599 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020169.1 protein_id gnl|my_center|LOCUS_26620 4534 4788 gene locus_tag LOCUS_26630 4534 4788 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511315.1 protein_id gnl|my_center|LOCUS_26630 4966 5406 gene locus_tag LOCUS_26640 gene ycgY 4966 5406 CDS product protein YcgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615067.1 protein_id gnl|my_center|LOCUS_26640 7182 5485 gene locus_tag LOCUS_26650 gene treA 7182 5485 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841714.1 protein_id gnl|my_center|LOCUS_26650 8920 7502 gene locus_tag LOCUS_26660 gene dhaM 8920 7502 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301101.1 protein_id gnl|my_center|LOCUS_26660 9563 8931 gene locus_tag LOCUS_26670 gene dhaL 9563 8931 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059411.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence159 1423 341 gene locus_tag LOCUS_26680 gene prfA 1423 341 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 protein_id gnl|my_center|LOCUS_26680 2721 1465 gene locus_tag LOCUS_26690 gene hemA 2721 1465 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299679.1 protein_id gnl|my_center|LOCUS_26690 2935 3558 gene locus_tag LOCUS_26700 gene lolB 2935 3558 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 protein_id gnl|my_center|LOCUS_26700 3558 4409 gene locus_tag LOCUS_26710 gene ispE 3558 4409 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260323.1 protein_id gnl|my_center|LOCUS_26710 4494 5507 gene locus_tag LOCUS_26720 gene prs 4494 5507 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 protein_id gnl|my_center|LOCUS_26720 5632 7311 gene locus_tag LOCUS_26730 gene dauA 5632 7311 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033352.1 protein_id gnl|my_center|LOCUS_26730 7644 7366 gene locus_tag LOCUS_26740 gene ychH 7644 7366 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 protein_id gnl|my_center|LOCUS_26740 7922 8506 gene locus_tag LOCUS_26750 gene pth 7922 8506 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152933.1 protein_id gnl|my_center|LOCUS_26750 8623 9714 gene locus_tag LOCUS_26760 gene ychF 8623 9714 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence160 1321 125 gene locus_tag LOCUS_26770 gene ispC 1321 125 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811924.1 protein_id gnl|my_center|LOCUS_26770 1970 1413 gene locus_tag LOCUS_26780 gene frr 1970 1413 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 protein_id gnl|my_center|LOCUS_26780 2988 2263 gene locus_tag LOCUS_26790 gene pyrH 2988 2263 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 protein_id gnl|my_center|LOCUS_26790 3986 3135 gene locus_tag LOCUS_26800 gene tsf 3986 3135 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 protein_id gnl|my_center|LOCUS_26800 4969 4244 gene locus_tag LOCUS_26810 gene rpsB 4969 4244 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246884.1 protein_id gnl|my_center|LOCUS_26810 5337 6131 gene locus_tag LOCUS_26820 gene map 5337 6131 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 protein_id gnl|my_center|LOCUS_26820 6193 8865 gene locus_tag LOCUS_26830 gene glnD 6193 8865 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094571.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence161 <1 794 gene locus_tag LOCUS_26840 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000063125.1:phosphate ABC transporter ATP-binding protein PstB 809 1534 gene locus_tag LOCUS_26850 gene phoU 809 1534 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 protein_id gnl|my_center|LOCUS_26850 1820 2656 gene locus_tag LOCUS_26860 gene bglG 1820 2656 CDS product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 protein_id gnl|my_center|LOCUS_26860 2790 4667 gene locus_tag LOCUS_26870 gene bglF 2790 4667 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137296.1 protein_id gnl|my_center|LOCUS_26870 4686 6080 gene locus_tag LOCUS_26880 gene bglB 4686 6080 CDS product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643236.1 protein_id gnl|my_center|LOCUS_26880 6166 7782 gene locus_tag LOCUS_26890 gene bglH 6166 7782 CDS product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 protein_id gnl|my_center|LOCUS_26890 7809 8978 gene locus_tag LOCUS_26900 7809 8978 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence162 612 358 gene locus_tag LOCUS_26910 612 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 988 1230 gene locus_tag LOCUS_26920 988 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1227 1565 gene locus_tag LOCUS_26930 1227 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1667 3766 gene locus_tag LOCUS_26940 gene ptsG 1667 3766 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473200.1 protein_id gnl|my_center|LOCUS_26940 4572 4009 gene locus_tag LOCUS_26950 4572 4009 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_26950 5156 4569 gene locus_tag LOCUS_26960 5156 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 5408 6412 gene locus_tag LOCUS_26970 5408 6412 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_26970 7667 6531 gene locus_tag LOCUS_26980 7667 6531 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_26980 9039 7684 gene locus_tag LOCUS_26990 9039 7684 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828500.1 protein_id gnl|my_center|LOCUS_26990 9545 9054 gene locus_tag LOCUS_27000 9545 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence163 800 276 gene locus_tag LOCUS_27010 gene tssJ 800 276 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080149.1 protein_id gnl|my_center|LOCUS_27010 2077 797 gene locus_tag LOCUS_27020 gene tagH 2077 797 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113725.1 protein_id gnl|my_center|LOCUS_27020 3184 2102 gene locus_tag LOCUS_27030 gene tssG 3184 2102 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348793.1 protein_id gnl|my_center|LOCUS_27030 4998 3148 gene locus_tag LOCUS_27040 gene tssF 4998 3148 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393844.1 protein_id gnl|my_center|LOCUS_27040 5415 5002 gene locus_tag LOCUS_27050 gene tssE 5415 5002 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611748.1 protein_id gnl|my_center|LOCUS_27050 6897 5422 gene locus_tag LOCUS_27060 gene tssC 6897 5422 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056978.1 protein_id gnl|my_center|LOCUS_27060 7172 6948 gene locus_tag LOCUS_27070 7172 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123970.1 protein_id gnl|my_center|LOCUS_27070 7707 7207 gene locus_tag LOCUS_27080 gene tssB 7707 7207 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037399.1 protein_id gnl|my_center|LOCUS_27080 8404 8922 gene locus_tag LOCUS_27090 8404 8922 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142958.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence164 1101 898 gene locus_tag LOCUS_27100 1101 898 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 protein_id gnl|my_center|LOCUS_27100 3301 1151 gene locus_tag LOCUS_27110 gene btsT 3301 1151 CDS product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299714.1 protein_id gnl|my_center|LOCUS_27110 3678 5342 gene locus_tag LOCUS_27120 gene tsr 3678 5342 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919571.1 protein_id gnl|my_center|LOCUS_27120 6752 5391 gene locus_tag LOCUS_27130 6752 5391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410140.1 protein_id gnl|my_center|LOCUS_27130 7881 6967 gene locus_tag LOCUS_27140 7881 6967 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091572.1 protein_id gnl|my_center|LOCUS_27140 8020 9042 gene locus_tag LOCUS_27150 gene lgoD 8020 9042 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence165 997 137 gene locus_tag LOCUS_27160 997 137 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350555.1 protein_id gnl|my_center|LOCUS_27160 1652 990 gene locus_tag LOCUS_27170 gene ulaD 1652 990 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089481.1 protein_id gnl|my_center|LOCUS_27170 3145 1649 gene locus_tag LOCUS_27180 gene lyxK 3145 1649 CDS product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196054.1 protein_id gnl|my_center|LOCUS_27180 4135 3149 gene locus_tag LOCUS_27190 gene yiaO 4135 3149 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776887.1 protein_id gnl|my_center|LOCUS_27190 5425 4148 gene locus_tag LOCUS_27200 gene yiaN 5425 4148 CDS product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279599.1 protein_id gnl|my_center|LOCUS_27200 5901 5428 gene locus_tag LOCUS_27210 gene yiaM 5901 5428 CDS product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 protein_id gnl|my_center|LOCUS_27210 6486 6019 gene locus_tag LOCUS_27220 6486 6019 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576079.1 protein_id gnl|my_center|LOCUS_27220 7496 6498 gene locus_tag LOCUS_27230 gene yiaK 7496 6498 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869037.1 protein_id gnl|my_center|LOCUS_27230 7697 8545 gene locus_tag LOCUS_27240 gene yiaJ 7697 8545 CDS product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514240.1 protein_id gnl|my_center|LOCUS_27240 8647 9120 gene locus_tag LOCUS_27250 8647 9120 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296790.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence166 1861 716 gene locus_tag LOCUS_27260 1861 716 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047424.1 protein_id gnl|my_center|LOCUS_27260 3512 2106 gene locus_tag LOCUS_27270 3512 2106 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760626.1 protein_id gnl|my_center|LOCUS_27270 4028 3591 gene locus_tag LOCUS_27280 gene hicB 4028 3591 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209405.1 protein_id gnl|my_center|LOCUS_27280 4511 4681 gene locus_tag LOCUS_27290 4511 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 6734 4773 gene locus_tag LOCUS_27300 gene rlhA 6734 4773 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303492.1 protein_id gnl|my_center|LOCUS_27300 7343 6807 gene locus_tag LOCUS_27310 gene sutR 7343 6807 CDS product DNA-binding transcriptional regulator SutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429162.1 protein_id gnl|my_center|LOCUS_27310 7435 8610 gene locus_tag LOCUS_27320 gene ydcO 7435 8610 CDS product BenE family transporter YdcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236265.1 protein_id gnl|my_center|LOCUS_27320 <9320 8650 gene locus_tag LOCUS_27330 <9320 8650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000826404.1:RNA-guided endonuclease TnpB family protein >Feature sequence167 170 538 gene locus_tag LOCUS_27340 170 538 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360951.1 protein_id gnl|my_center|LOCUS_27340 632 1285 gene locus_tag LOCUS_27350 gene nfsB 632 1285 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351464.1 protein_id gnl|my_center|LOCUS_27350 1393 2640 gene locus_tag LOCUS_27360 gene ybdG 1393 2640 CDS product mechanosensitive ion channel YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153148.1 protein_id gnl|my_center|LOCUS_27360 4120 2708 gene locus_tag LOCUS_27370 gene pheP 4120 2708 CDS product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786320.1 protein_id gnl|my_center|LOCUS_27370 7329 4186 gene locus_tag LOCUS_27380 gene cusA 7329 4186 CDS product Cu(+)/Ag(+) efflux RND transporter permease subunit CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573945.1 protein_id gnl|my_center|LOCUS_27380 8564 7341 gene locus_tag LOCUS_27390 gene cusB 8564 7341 CDS product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717115.1 protein_id gnl|my_center|LOCUS_27390 8912 8580 gene locus_tag LOCUS_27400 gene cusF 8912 8580 CDS product Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709873.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence168 1989 457 gene locus_tag LOCUS_27410 1989 457 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054872.1 protein_id gnl|my_center|LOCUS_27410 2551 2673 gene locus_tag LOCUS_27420 2551 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2978 3736 gene locus_tag LOCUS_27430 2978 3736 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 protein_id gnl|my_center|LOCUS_27430 3748 3978 gene locus_tag LOCUS_27440 3748 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 4160 4285 gene locus_tag LOCUS_27450 4160 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 4494 5177 gene locus_tag LOCUS_27460 4494 5177 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_27460 5217 6059 gene locus_tag LOCUS_27470 5217 6059 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_27470 6056 6688 gene locus_tag LOCUS_27480 6056 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 7846 6716 gene locus_tag LOCUS_27490 7846 6716 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_27490 8844 7912 gene locus_tag LOCUS_27500 8844 7912 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence169 1268 372 gene locus_tag LOCUS_27510 gene yhaJ 1268 372 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041009.1 protein_id gnl|my_center|LOCUS_27510 1373 2074 gene locus_tag LOCUS_27520 1373 2074 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 protein_id gnl|my_center|LOCUS_27520 2097 2261 gene locus_tag LOCUS_27530 gene yhaL 2097 2261 CDS product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295544.1 protein_id gnl|my_center|LOCUS_27530 3705 2395 gene locus_tag LOCUS_27540 gene cyuA 3705 2395 CDS product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460512.1 protein_id gnl|my_center|LOCUS_27540 5064 3733 gene locus_tag LOCUS_27550 5064 3733 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 protein_id gnl|my_center|LOCUS_27550 6704 5340 gene locus_tag LOCUS_27560 gene tdcG 6704 5340 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622126.1 protein_id gnl|my_center|LOCUS_27560 7165 6776 gene locus_tag LOCUS_27570 7165 6776 CDS product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 protein_id gnl|my_center|LOCUS_27570 <9263 7179 gene locus_tag LOCUS_27580 <9263 7179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000861753.1:2-ketobutyrate formate-lyase/pyruvate formate-lyase >Feature sequence170 708 115 gene locus_tag LOCUS_27590 gene rclC 708 115 CDS product reactive chlorine species resistance protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306921.1 protein_id gnl|my_center|LOCUS_27590 956 720 gene locus_tag LOCUS_27600 gene rclB 956 720 CDS product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474077.1 protein_id gnl|my_center|LOCUS_27600 2390 1065 gene locus_tag LOCUS_27610 gene rclA 2390 1065 CDS product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046293.1 protein_id gnl|my_center|LOCUS_27610 2616 3470 gene locus_tag LOCUS_27620 gene rclR 2616 3470 CDS product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339593.1 protein_id gnl|my_center|LOCUS_27620 3999 4718 gene locus_tag LOCUS_27630 3999 4718 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102108.1 protein_id gnl|my_center|LOCUS_27630 4729 6156 gene locus_tag LOCUS_27640 4729 6156 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023927.1 protein_id gnl|my_center|LOCUS_27640 6149 6844 gene locus_tag LOCUS_27650 6149 6844 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370307.1 protein_id gnl|my_center|LOCUS_27650 7755 7087 gene locus_tag LOCUS_27660 gene ykgH 7755 7087 CDS product protein YkgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209100.1 protein_id gnl|my_center|LOCUS_27660 <9215 7968 gene locus_tag LOCUS_27670 <9215 7968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001159094.1:choline dehydrogenase >Feature sequence171 529 2187 gene locus_tag LOCUS_27680 gene fliF 529 2187 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994427.1 protein_id gnl|my_center|LOCUS_27680 2180 3175 gene locus_tag LOCUS_27690 gene fliG 2180 3175 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067950.1 protein_id gnl|my_center|LOCUS_27690 3168 3854 gene locus_tag LOCUS_27700 gene fliH 3168 3854 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282694.1 protein_id gnl|my_center|LOCUS_27700 3854 5227 gene locus_tag LOCUS_27710 gene fliI 3854 5227 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213294.1 protein_id gnl|my_center|LOCUS_27710 5246 5689 gene locus_tag LOCUS_27720 gene fliJ 5246 5689 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807584.1 protein_id gnl|my_center|LOCUS_27720 5686 6813 gene locus_tag LOCUS_27730 5686 6813 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620097.1 protein_id gnl|my_center|LOCUS_27730 6918 7382 gene locus_tag LOCUS_27740 gene fliL 6918 7382 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133106.1 protein_id gnl|my_center|LOCUS_27740 7387 8391 gene locus_tag LOCUS_27750 gene fliM 7387 8391 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295641.1 protein_id gnl|my_center|LOCUS_27750 8388 8801 gene locus_tag LOCUS_27760 gene fliN 8388 8801 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282098.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence172 1060 173 gene locus_tag LOCUS_27770 1060 173 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327311.1 protein_id gnl|my_center|LOCUS_27770 2399 1050 gene locus_tag LOCUS_27780 2399 1050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291196.1 protein_id gnl|my_center|LOCUS_27780 3931 2498 gene locus_tag LOCUS_27790 3931 2498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078436.1 protein_id gnl|my_center|LOCUS_27790 5011 4001 gene locus_tag LOCUS_27800 5011 4001 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357967.1 protein_id gnl|my_center|LOCUS_27800 5931 5044 gene locus_tag LOCUS_27810 5931 5044 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094544.1 protein_id gnl|my_center|LOCUS_27810 6834 5956 gene locus_tag LOCUS_27820 gene yihU 6834 5956 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306655.1 protein_id gnl|my_center|LOCUS_27820 7058 7903 gene locus_tag LOCUS_27830 7058 7903 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196715.1 protein_id gnl|my_center|LOCUS_27830 7943 8731 gene locus_tag LOCUS_27840 7943 8731 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022286.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence173 830 561 gene locus_tag LOCUS_27850 830 561 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325798.1 protein_id gnl|my_center|LOCUS_27850 1080 895 gene locus_tag LOCUS_27860 1080 895 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 protein_id gnl|my_center|LOCUS_27860 3716 1077 gene locus_tag LOCUS_27870 3716 1077 CDS product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900912.1 protein_id gnl|my_center|LOCUS_27870 3924 4913 gene locus_tag LOCUS_27880 gene ldhA 3924 4913 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762229.1 protein_id gnl|my_center|LOCUS_27880 5024 5446 gene locus_tag LOCUS_27890 gene hslJ 5024 5446 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298828.1 protein_id gnl|my_center|LOCUS_27890 5709 5443 gene locus_tag LOCUS_27900 5709 5443 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295715.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence174 2462 1710 gene locus_tag LOCUS_27910 gene nagD 2462 1710 CDS product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153129.1 protein_id gnl|my_center|LOCUS_27910 3730 2510 gene locus_tag LOCUS_27920 gene nagC 3730 2510 CDS product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187594.1 protein_id gnl|my_center|LOCUS_27920 4887 3739 gene locus_tag LOCUS_27930 gene nagA 4887 3739 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271153.1 protein_id gnl|my_center|LOCUS_27930 5747 4947 gene locus_tag LOCUS_27940 gene nagB 5747 4947 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 protein_id gnl|my_center|LOCUS_27940 6080 8026 gene locus_tag LOCUS_27950 gene nagE 6080 8026 CDS product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023104.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence175 195 1142 gene locus_tag LOCUS_27960 195 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27960 1057 1518 gene locus_tag LOCUS_27970 1057 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27970 2408 1515 gene locus_tag LOCUS_27980 2408 1515 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 protein_id gnl|my_center|LOCUS_27980 2575 4290 gene locus_tag LOCUS_27990 2575 4290 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 protein_id gnl|my_center|LOCUS_27990 4287 5780 gene locus_tag LOCUS_28000 4287 5780 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828500.1 protein_id gnl|my_center|LOCUS_28000 6276 5827 gene locus_tag LOCUS_28010 gene yidI 6276 5827 CDS product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511287.1 protein_id gnl|my_center|LOCUS_28010 6385 6732 gene locus_tag LOCUS_28020 6385 6732 CDS product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 protein_id gnl|my_center|LOCUS_28020 6722 7084 gene locus_tag LOCUS_28030 6722 7084 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 protein_id gnl|my_center|LOCUS_28030 7081 7578 gene locus_tag LOCUS_28040 7081 7578 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148063.1 protein_id gnl|my_center|LOCUS_28040 8746 7586 gene locus_tag LOCUS_28050 gene emrD 8746 7586 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence176 2742 1729 gene locus_tag LOCUS_28060 gene yhjD 2742 1729 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191257.1 protein_id gnl|my_center|LOCUS_28060 3672 2791 gene locus_tag LOCUS_28070 3672 2791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 protein_id gnl|my_center|LOCUS_28070 4210 4812 gene locus_tag LOCUS_28080 4210 4812 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 protein_id gnl|my_center|LOCUS_28080 6512 4863 gene locus_tag LOCUS_28090 6512 4863 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934218.1 protein_id gnl|my_center|LOCUS_28090 6917 8314 gene locus_tag LOCUS_28100 gene ccp 6917 8314 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784815.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence177 1203 1895 gene locus_tag LOCUS_28110 1203 1895 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 protein_id gnl|my_center|LOCUS_28110 2094 3182 gene locus_tag LOCUS_28120 gene serC 2094 3182 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057149.1 protein_id gnl|my_center|LOCUS_28120 3253 4536 gene locus_tag LOCUS_28130 gene aroA 3253 4536 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445231.1 protein_id gnl|my_center|LOCUS_28130 4705 5469 gene locus_tag LOCUS_28140 gene ycaL 4705 5469 CDS product metallopeptidase YcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295345.1 protein_id gnl|my_center|LOCUS_28140 5642 6325 gene locus_tag LOCUS_28150 gene cmk 5642 6325 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 protein_id gnl|my_center|LOCUS_28150 6436 8109 gene locus_tag LOCUS_28160 gene rpsA 6436 8109 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 protein_id gnl|my_center|LOCUS_28160 8269 8553 gene locus_tag LOCUS_28170 gene ihfB 8269 8553 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167336.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence178 <1 622 gene locus_tag LOCUS_28180 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276780.1:rhomboid family intramembrane serine protease 2238 700 gene locus_tag LOCUS_28190 gene lnt 2238 700 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853033.1 protein_id gnl|my_center|LOCUS_28190 3141 2263 gene locus_tag LOCUS_28200 gene corC 3141 2263 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278605.1 protein_id gnl|my_center|LOCUS_28200 3698 3231 gene locus_tag LOCUS_28210 gene ybeY 3698 3231 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084469.1 protein_id gnl|my_center|LOCUS_28210 4735 3695 gene locus_tag LOCUS_28220 4735 3695 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 protein_id gnl|my_center|LOCUS_28220 6312 4888 gene locus_tag LOCUS_28230 gene miaB 6312 4888 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 protein_id gnl|my_center|LOCUS_28230 6458 7633 gene locus_tag LOCUS_28240 gene ubiF 6458 7633 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184573.1 protein_id gnl|my_center|LOCUS_28240 7861 7787 gene locus_tag LOCUS_t00360 7861 7787 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7973 7899 gene locus_tag LOCUS_t00370 7973 7899 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8097 8021 gene locus_tag LOCUS_t00380 8097 8021 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8187 8113 gene locus_tag LOCUS_t00390 8187 8113 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8296 8222 gene locus_tag LOCUS_t00400 8296 8222 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8404 8320 gene locus_tag LOCUS_t00410 8404 8320 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8489 8413 gene locus_tag LOCUS_t00420 8489 8413 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence179 1007 645 gene locus_tag LOCUS_28250 1007 645 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 protein_id gnl|my_center|LOCUS_28250 1292 1501 gene locus_tag LOCUS_28260 gene yibT 1292 1501 CDS product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 protein_id gnl|my_center|LOCUS_28260 2100 1513 gene locus_tag LOCUS_28270 gene mtlR 2100 1513 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228269.1 protein_id gnl|my_center|LOCUS_28270 3248 2100 gene locus_tag LOCUS_28280 gene mtlD 3248 2100 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645420.1 protein_id gnl|my_center|LOCUS_28280 5391 3478 gene locus_tag LOCUS_28290 gene mtlA 5391 3478 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 protein_id gnl|my_center|LOCUS_28290 5928 6290 gene locus_tag LOCUS_28300 5928 6290 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479624.1 protein_id gnl|my_center|LOCUS_28300 6293 7429 gene locus_tag LOCUS_28310 6293 7429 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 protein_id gnl|my_center|LOCUS_28310 8326 7889 gene locus_tag LOCUS_28320 8326 7889 CDS product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 protein_id gnl|my_center|LOCUS_28320 8708 8415 gene locus_tag LOCUS_28330 8708 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence180 99 689 gene locus_tag LOCUS_28340 gene uidR 99 689 CDS product DNA-binding transcriptional regulator UidR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969092.1 protein_id gnl|my_center|LOCUS_28340 1080 2891 gene locus_tag LOCUS_28350 gene uidA 1080 2891 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945913.1 protein_id gnl|my_center|LOCUS_28350 2888 4261 gene locus_tag LOCUS_28360 gene uidB 2888 4261 CDS product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075893.1 protein_id gnl|my_center|LOCUS_28360 4312 5565 gene locus_tag LOCUS_28370 gene uidC 4312 5565 CDS product glucuronide uptake porin UidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227023.1 protein_id gnl|my_center|LOCUS_28370 7118 5610 gene locus_tag LOCUS_28380 7118 5610 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043342.1 protein_id gnl|my_center|LOCUS_28380 8394 7219 gene locus_tag LOCUS_28390 gene manA 8394 7219 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170664.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence181 <1 537 gene locus_tag LOCUS_28400 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964791.1:DUF554 domain-containing protein 1159 1548 gene locus_tag LOCUS_28410 1159 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1639 1977 gene locus_tag LOCUS_28420 1639 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3277 2030 gene locus_tag LOCUS_28430 3277 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 3452 3225 gene locus_tag LOCUS_28440 3452 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 4039 3458 gene locus_tag LOCUS_28450 4039 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 4280 4522 gene locus_tag LOCUS_28460 4280 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 4536 4892 gene locus_tag LOCUS_28470 4536 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 5228 5043 gene locus_tag LOCUS_28480 5228 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 5825 5750 gene locus_tag LOCUS_t00430 5825 5750 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6107 7324 gene locus_tag LOCUS_28490 6107 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 7344 8441 gene locus_tag LOCUS_28500 7344 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence182 95 1 gene locus_tag LOCUS_t00440 95 1 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 388 1770 gene locus_tag LOCUS_28510 388 1770 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 protein_id gnl|my_center|LOCUS_28510 1780 4098 gene locus_tag LOCUS_28520 gene yicI 1780 4098 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702898.1 protein_id gnl|my_center|LOCUS_28520 5707 4151 gene locus_tag LOCUS_28530 5707 4151 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300954.1 protein_id gnl|my_center|LOCUS_28530 7361 5970 gene locus_tag LOCUS_28540 gene xanP 7361 5970 CDS product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence183 81 476 gene locus_tag LOCUS_28550 81 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3417 697 gene locus_tag LOCUS_28560 gene nikB 3417 697 CDS product IncI1-type relaxase NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387486.1 protein_id gnl|my_center|LOCUS_28560 3761 3429 gene locus_tag LOCUS_28570 gene nikA 3761 3429 CDS product IncI1-type relaxosome accessory protein NikA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283947.1 protein_id gnl|my_center|LOCUS_28570 3992 4327 gene locus_tag LOCUS_28580 3992 4327 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157095.1 protein_id gnl|my_center|LOCUS_28580 5260 4412 gene locus_tag LOCUS_28590 5260 4412 CDS product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077053.1 protein_id gnl|my_center|LOCUS_28590 5841 6092 gene locus_tag LOCUS_28600 5841 6092 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148285.1 protein_id gnl|my_center|LOCUS_28600 6303 6109 gene locus_tag LOCUS_28610 6303 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150314.1 protein_id gnl|my_center|LOCUS_28610 7306 6365 gene locus_tag LOCUS_28620 7306 6365 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038348.1 protein_id gnl|my_center|LOCUS_28620 7637 7371 gene locus_tag LOCUS_28630 7637 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804663.1 protein_id gnl|my_center|LOCUS_28630 8163 7729 gene locus_tag LOCUS_28640 8163 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218858.1 protein_id gnl|my_center|LOCUS_28640 8375 8160 gene locus_tag LOCUS_28650 8375 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence184 1202 1621 gene locus_tag LOCUS_28660 gene trxC 1202 1621 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 protein_id gnl|my_center|LOCUS_28660 1858 2388 gene locus_tag LOCUS_28670 gene tapT 1858 2388 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138184.1 protein_id gnl|my_center|LOCUS_28670 2420 5080 gene locus_tag LOCUS_28680 gene pat 2420 5080 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082964.1 protein_id gnl|my_center|LOCUS_28680 5191 6549 gene locus_tag LOCUS_28690 gene pssA 5191 6549 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 protein_id gnl|my_center|LOCUS_28690 6646 6918 gene locus_tag LOCUS_28700 6646 6918 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 protein_id gnl|my_center|LOCUS_28700 8213 6915 gene locus_tag LOCUS_28710 gene kgtP 8213 6915 CDS product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence185 970 113 gene locus_tag LOCUS_28720 gene murI 970 113 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201819.1 protein_id gnl|my_center|LOCUS_28720 2759 915 gene locus_tag LOCUS_28730 gene btuB 2759 915 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 protein_id gnl|my_center|LOCUS_28730 3128 4228 gene locus_tag LOCUS_28740 gene trmA 3128 4228 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 protein_id gnl|my_center|LOCUS_28740 4627 4268 gene locus_tag LOCUS_28750 4627 4268 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 protein_id gnl|my_center|LOCUS_28750 5331 4627 gene locus_tag LOCUS_28760 gene fabR 5331 4627 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 protein_id gnl|my_center|LOCUS_28760 5608 7008 gene locus_tag LOCUS_28770 gene sthA 5608 7008 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 protein_id gnl|my_center|LOCUS_28770 7908 6991 gene locus_tag LOCUS_28780 gene oxyR 7908 6991 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 protein_id gnl|my_center|LOCUS_28780 8528 8175 gene locus_tag LOCUS_28790 8528 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence186 22 97 gene locus_tag LOCUS_t00450 22 97 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1275 112 gene locus_tag LOCUS_28800 1275 112 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051894.1 protein_id gnl|my_center|LOCUS_28800 1807 1502 gene locus_tag LOCUS_28810 gene yfdT 1807 1502 CDS product protein YfdT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206732.1 protein_id gnl|my_center|LOCUS_28810 2169 1807 gene locus_tag LOCUS_28820 2169 1807 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242717.1 protein_id gnl|my_center|LOCUS_28820 2696 2160 gene locus_tag LOCUS_28830 gene yfdR 2696 2160 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008183.1 protein_id gnl|my_center|LOCUS_28830 3648 2824 gene locus_tag LOCUS_28840 3648 2824 CDS product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081287.1 protein_id gnl|my_center|LOCUS_28840 4076 3714 gene locus_tag LOCUS_28850 4076 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 4546 5061 gene locus_tag LOCUS_28860 4546 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559928.1 protein_id gnl|my_center|LOCUS_28860 5833 5276 gene locus_tag LOCUS_28870 5833 5276 CDS product LexA family transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848748.1 protein_id gnl|my_center|LOCUS_28870 6041 6241 gene locus_tag LOCUS_28880 6041 6241 CDS product YdaS family helix-turn-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649477.1 protein_id gnl|my_center|LOCUS_28880 6285 6842 gene locus_tag LOCUS_28890 gene ymfL 6285 6842 CDS product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515837.1 protein_id gnl|my_center|LOCUS_28890 7018 7197 gene locus_tag LOCUS_28900 7018 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 7187 8128 gene locus_tag LOCUS_28910 7187 8128 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104945.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence187 1301 45 gene locus_tag LOCUS_28920 gene nupG 1301 45 CDS product nucleoside permease NupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333541.1 protein_id gnl|my_center|LOCUS_28920 2585 1503 gene locus_tag LOCUS_28930 gene mltC 2585 1503 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760323.1 protein_id gnl|my_center|LOCUS_28930 2922 2647 gene locus_tag LOCUS_28940 2922 2647 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 protein_id gnl|my_center|LOCUS_28940 4002 2950 gene locus_tag LOCUS_28950 gene mutY 4002 2950 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321419.1 protein_id gnl|my_center|LOCUS_28950 4163 4882 gene locus_tag LOCUS_28960 gene trmB 4163 4882 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786911.1 protein_id gnl|my_center|LOCUS_28960 4882 5208 gene locus_tag LOCUS_28970 4882 5208 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 protein_id gnl|my_center|LOCUS_28970 5392 6111 gene locus_tag LOCUS_28980 5392 6111 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 protein_id gnl|my_center|LOCUS_28980 6287 7333 gene locus_tag LOCUS_28990 gene ansB 6287 7333 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394125.1 protein_id gnl|my_center|LOCUS_28990 7450 8457 gene locus_tag LOCUS_29000 7450 8457 CDS product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745210.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence188 270 1967 gene locus_tag LOCUS_29010 gene dld 270 1967 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097356.1 protein_id gnl|my_center|LOCUS_29010 2042 2761 gene locus_tag LOCUS_29020 2042 2761 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102119.1 protein_id gnl|my_center|LOCUS_29020 2772 4199 gene locus_tag LOCUS_29030 2772 4199 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023919.1 protein_id gnl|my_center|LOCUS_29030 4192 4887 gene locus_tag LOCUS_29040 4192 4887 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 protein_id gnl|my_center|LOCUS_29040 5353 4937 gene locus_tag LOCUS_29050 5353 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 5600 6580 gene locus_tag LOCUS_29060 5600 6580 CDS product IS5-like element ISKpn26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019441.1 protein_id gnl|my_center|LOCUS_29060 7349 8362 gene locus_tag LOCUS_29070 7349 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence189 <1 664 gene locus_tag LOCUS_29080 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000212477.1:transcriptional regulator EbgR 848 3940 gene locus_tag LOCUS_29090 gene ebgA 848 3940 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082832.1 protein_id gnl|my_center|LOCUS_29090 3937 4386 gene locus_tag LOCUS_29100 3937 4386 CDS product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 protein_id gnl|my_center|LOCUS_29100 4449 5882 gene locus_tag LOCUS_29110 4449 5882 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285463.1 protein_id gnl|my_center|LOCUS_29110 6016 7086 gene locus_tag LOCUS_29120 gene ygjJ 6016 7086 CDS product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767654.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence190 1406 123 gene locus_tag LOCUS_29130 gene codA 1406 123 CDS product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295686.1 protein_id gnl|my_center|LOCUS_29130 2655 1396 gene locus_tag LOCUS_29140 gene codB 2655 1396 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076233.1 protein_id gnl|my_center|LOCUS_29140 4966 3080 gene locus_tag LOCUS_29150 gene prpE 4966 3080 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010288.1 protein_id gnl|my_center|LOCUS_29150 6457 5006 gene locus_tag LOCUS_29160 gene prpD 6457 5006 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275861.1 protein_id gnl|my_center|LOCUS_29160 7660 6491 gene locus_tag LOCUS_29170 gene prpC 7660 6491 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285927.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence191 847 506 gene locus_tag LOCUS_29180 847 506 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617184.1 protein_id gnl|my_center|LOCUS_29180 985 1779 gene locus_tag LOCUS_29190 985 1779 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 protein_id gnl|my_center|LOCUS_29190 1983 2462 gene locus_tag LOCUS_29200 gene ybaK 1983 2462 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186631.1 protein_id gnl|my_center|LOCUS_29200 4151 2499 gene locus_tag LOCUS_29210 gene ushA 4151 2499 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771719.1 protein_id gnl|my_center|LOCUS_29210 4369 5589 gene locus_tag LOCUS_29220 gene fsr 4369 5589 CDS product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 protein_id gnl|my_center|LOCUS_29220 5827 7503 gene locus_tag LOCUS_29230 gene ybaL 5827 7503 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546255.1 protein_id gnl|my_center|LOCUS_29230 <8359 7637 gene locus_tag LOCUS_29240 <8359 7637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000671574.1:inosine/guanosine kinase >Feature sequence192 <1 842 gene locus_tag LOCUS_29250 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001141192.1:MFS transporter 1409 855 gene locus_tag LOCUS_29260 gene kptA 1409 855 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151855.1 protein_id gnl|my_center|LOCUS_29260 1647 2342 gene locus_tag LOCUS_29270 1647 2342 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513390.1 protein_id gnl|my_center|LOCUS_29270 2339 2800 gene locus_tag LOCUS_29280 2339 2800 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211971.1 protein_id gnl|my_center|LOCUS_29280 2813 3985 gene locus_tag LOCUS_29290 gene iadA 2813 3985 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568397.1 protein_id gnl|my_center|LOCUS_29290 4050 4961 gene locus_tag LOCUS_29300 gene hypT 4050 4961 CDS product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340758.1 protein_id gnl|my_center|LOCUS_29300 5205 4954 gene locus_tag LOCUS_29310 5205 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 6018 6848 gene locus_tag LOCUS_29320 6018 6848 CDS product DUF2686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062571.1 protein_id gnl|my_center|LOCUS_29320 7762 6989 gene locus_tag LOCUS_29330 gene uxuR 7762 6989 CDS product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833679.1 protein_id gnl|my_center|LOCUS_29330 7761 7955 gene locus_tag LOCUS_29340 7761 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence193 185 898 gene locus_tag LOCUS_29350 gene msyB 185 898 CDS product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102367.1 protein_id gnl|my_center|LOCUS_29350 1047 1613 gene locus_tag LOCUS_29360 gene satP 1047 1613 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 protein_id gnl|my_center|LOCUS_29360 2235 1648 gene locus_tag LOCUS_29370 gene mog 2235 1648 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 protein_id gnl|my_center|LOCUS_29370 3303 2350 gene locus_tag LOCUS_29380 gene tal 3303 2350 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130185.1 protein_id gnl|my_center|LOCUS_29380 3582 5012 gene locus_tag LOCUS_29390 3582 5012 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112606.1 protein_id gnl|my_center|LOCUS_29390 5082 5858 gene locus_tag LOCUS_29400 gene yaaA 5082 5858 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906203.1 protein_id gnl|my_center|LOCUS_29400 6168 6007 gene locus_tag LOCUS_29410 6168 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 7807 6521 gene locus_tag LOCUS_29420 gene thrC 7807 6521 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 protein_id gnl|my_center|LOCUS_29420 <8344 7808 gene locus_tag LOCUS_29430 <8344 7808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000241662.1:homoserine kinase >Feature sequence194 699 2042 gene locus_tag LOCUS_29440 gene gntP 699 2042 CDS product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558251.1 protein_id gnl|my_center|LOCUS_29440 3117 2215 gene locus_tag LOCUS_29450 gene fimH 3117 2215 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832247.1 protein_id gnl|my_center|LOCUS_29450 3640 3137 gene locus_tag LOCUS_29460 gene fimG 3640 3137 CDS product type 1 fimbria minor subunit FimG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870592.1 protein_id gnl|my_center|LOCUS_29460 4183 3653 gene locus_tag LOCUS_29470 gene fimF 4183 3653 CDS product type 1 fimbria minor subunit FimF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244826.1 protein_id gnl|my_center|LOCUS_29470 6829 4193 gene locus_tag LOCUS_29480 gene fimD 6829 4193 CDS product fimbrial usher FimD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120940.1 protein_id gnl|my_center|LOCUS_29480 7621 6896 gene locus_tag LOCUS_29490 gene fimC 7621 6896 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066560.1 protein_id gnl|my_center|LOCUS_29490 8044 7658 gene locus_tag LOCUS_29500 8044 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence195 722 1651 gene locus_tag LOCUS_29510 gene paaA 722 1651 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191077.1 protein_id gnl|my_center|LOCUS_29510 1663 1950 gene locus_tag LOCUS_29520 gene paaB 1663 1950 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073393.1 protein_id gnl|my_center|LOCUS_29520 1959 2705 gene locus_tag LOCUS_29530 gene paaC 1959 2705 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072837.1 protein_id gnl|my_center|LOCUS_29530 2720 3217 gene locus_tag LOCUS_29540 gene paaD 2720 3217 CDS product phenylacetate degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189201.1 protein_id gnl|my_center|LOCUS_29540 3225 4295 gene locus_tag LOCUS_29550 gene paaK 3225 4295 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206388.1 protein_id gnl|my_center|LOCUS_29550 4292 5059 gene locus_tag LOCUS_29560 4292 5059 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292353.1 protein_id gnl|my_center|LOCUS_29560 5059 5847 gene locus_tag LOCUS_29570 gene paaG 5059 5847 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_29570 5894 7276 gene locus_tag LOCUS_29580 gene paaC 5894 7276 CDS product 3-hydroxyacyl-CoA dehydrogenase PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973360.1 protein_id gnl|my_center|LOCUS_29580 7266 7688 gene locus_tag LOCUS_29590 gene paaI 7266 7688 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018413.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence196 22 98 gene locus_tag LOCUS_t00460 22 98 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 261 1064 gene locus_tag LOCUS_29600 gene dkgB 261 1064 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997036.1 protein_id gnl|my_center|LOCUS_29600 1975 1061 gene locus_tag LOCUS_29610 gene yafC 1975 1061 CDS product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648586.1 protein_id gnl|my_center|LOCUS_29610 2216 3016 gene locus_tag LOCUS_29620 2216 3016 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 protein_id gnl|my_center|LOCUS_29620 3094 3864 gene locus_tag LOCUS_29630 3094 3864 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211713.1 protein_id gnl|my_center|LOCUS_29630 5066 3912 gene locus_tag LOCUS_29640 gene mltD 5066 3912 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 protein_id gnl|my_center|LOCUS_29640 6097 5342 gene locus_tag LOCUS_29650 gene gloB 6097 5342 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052743.1 protein_id gnl|my_center|LOCUS_29650 6131 6853 gene locus_tag LOCUS_29660 6131 6853 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295200.1 protein_id gnl|my_center|LOCUS_29660 7317 6850 gene locus_tag LOCUS_29670 gene rnhA 7317 6850 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 protein_id gnl|my_center|LOCUS_29670 7382 8113 gene locus_tag LOCUS_29680 gene dnaQ 7382 8113 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001366128.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence197 2147 669 gene locus_tag LOCUS_29690 2147 669 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039688.1 protein_id gnl|my_center|LOCUS_29690 3451 2174 gene locus_tag LOCUS_29700 3451 2174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164544.1 protein_id gnl|my_center|LOCUS_29700 3770 4555 gene locus_tag LOCUS_29710 3770 4555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021321.1 protein_id gnl|my_center|LOCUS_29710 4625 6079 gene locus_tag LOCUS_29720 4625 6079 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059312.1 protein_id gnl|my_center|LOCUS_29720 6173 7510 gene locus_tag LOCUS_29730 6173 7510 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098105.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence198 1338 391 gene locus_tag LOCUS_29740 gene hyfC 1338 391 CDS product hydrogenase 4 subunit HyfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001459972.1 protein_id gnl|my_center|LOCUS_29740 2620 1349 gene locus_tag LOCUS_29750 2620 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29750 3366 2695 gene locus_tag LOCUS_29760 3366 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29760 3983 3366 gene locus_tag LOCUS_29770 gene hyfA 3983 3366 CDS product hydrogenase 4 subunit HyfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295470.1 protein_id gnl|my_center|LOCUS_29770 4706 4236 gene locus_tag LOCUS_29780 gene bcp 4706 4236 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 protein_id gnl|my_center|LOCUS_29780 5278 4706 gene locus_tag LOCUS_29790 5278 4706 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 protein_id gnl|my_center|LOCUS_29790 5424 6302 gene locus_tag LOCUS_29800 gene dapA 5424 6302 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295469.1 protein_id gnl|my_center|LOCUS_29800 6319 7353 gene locus_tag LOCUS_29810 gene bamC 6319 7353 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297320.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence199 4040 3177 gene locus_tag LOCUS_29820 4040 3177 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_29820 4932 4033 gene locus_tag LOCUS_29830 4932 4033 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_29830 6300 4966 gene locus_tag LOCUS_29840 6300 4966 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289133.1 protein_id gnl|my_center|LOCUS_29840 7542 6583 gene locus_tag LOCUS_29850 7542 6583 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence200 78 3 gene locus_tag LOCUS_t00470 78 3 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1446 193 gene locus_tag LOCUS_29860 gene proA 1446 193 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893256.1 protein_id gnl|my_center|LOCUS_29860 2561 1458 gene locus_tag LOCUS_29870 gene proB 2561 1458 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 protein_id gnl|my_center|LOCUS_29870 2849 3904 gene locus_tag LOCUS_29880 gene phoE 2849 3904 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749881.1 protein_id gnl|my_center|LOCUS_29880 4344 3943 gene locus_tag LOCUS_29890 gene crl 4344 3943 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 protein_id gnl|my_center|LOCUS_29890 5646 4402 gene locus_tag LOCUS_29900 gene frsA 5646 4402 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189541.1 protein_id gnl|my_center|LOCUS_29900 6196 5738 gene locus_tag LOCUS_29910 gene gpt 6196 5738 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 protein_id gnl|my_center|LOCUS_29910 6457 7914 gene locus_tag LOCUS_29920 gene pepD 6457 7914 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293009.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence201 84 749 gene locus_tag LOCUS_29930 gene yecA 84 749 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847902.1 protein_id gnl|my_center|LOCUS_29930 2022 811 gene locus_tag LOCUS_29940 gene tyrP 2022 811 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797560.1 protein_id gnl|my_center|LOCUS_29940 2214 2453 gene locus_tag LOCUS_29950 2214 2453 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377223.1 protein_id gnl|my_center|LOCUS_29950 2988 2491 gene locus_tag LOCUS_29960 gene ftnA 2988 2491 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917208.1 protein_id gnl|my_center|LOCUS_29960 3280 3456 gene locus_tag LOCUS_29970 3280 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3947 4198 gene locus_tag LOCUS_29980 gene yecJ 3947 4198 CDS product DUF2766 family protein YecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082127.1 protein_id gnl|my_center|LOCUS_29980 4780 4277 gene locus_tag LOCUS_29990 4780 4277 CDS product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179469.1 protein_id gnl|my_center|LOCUS_29990 5577 6566 gene locus_tag LOCUS_30000 gene araF 5577 6566 CDS product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548675.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence202 1267 815 gene locus_tag LOCUS_30010 gene moaE 1267 815 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852287.1 protein_id gnl|my_center|LOCUS_30010 1514 1269 gene locus_tag LOCUS_30020 gene moaD 1514 1269 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598619.1 protein_id gnl|my_center|LOCUS_30020 1992 1507 gene locus_tag LOCUS_30030 gene moaC 1992 1507 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080885.1 protein_id gnl|my_center|LOCUS_30030 2507 1995 gene locus_tag LOCUS_30040 gene moaB 2507 1995 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084639.1 protein_id gnl|my_center|LOCUS_30040 3518 2529 gene locus_tag LOCUS_30050 gene moaA 3518 2529 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295301.1 protein_id gnl|my_center|LOCUS_30050 3915 4823 gene locus_tag LOCUS_30060 gene yvcK 3915 4823 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295302.1 protein_id gnl|my_center|LOCUS_30060 7036 5015 gene locus_tag LOCUS_30070 gene uvrB 7036 5015 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042533.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence203 1656 1093 gene locus_tag LOCUS_30080 1656 1093 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033328.1 protein_id gnl|my_center|LOCUS_30080 2825 2340 gene locus_tag LOCUS_30090 gene sixA 2825 2340 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195819.1 protein_id gnl|my_center|LOCUS_30090 5172 3028 gene locus_tag LOCUS_30100 gene fadJ 5172 3028 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424986.1 protein_id gnl|my_center|LOCUS_30100 6482 5172 gene locus_tag LOCUS_30110 gene fadI 6482 5172 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531952.1 protein_id gnl|my_center|LOCUS_30110 6947 6663 gene locus_tag LOCUS_30120 6947 6663 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030901.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence204 1126 266 gene locus_tag LOCUS_30130 gene tesB 1126 266 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075876.1 protein_id gnl|my_center|LOCUS_30130 1344 1916 gene locus_tag LOCUS_30140 1344 1916 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779826.1 protein_id gnl|my_center|LOCUS_30140 2258 1947 gene locus_tag LOCUS_30150 gene atl 2258 1947 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 protein_id gnl|my_center|LOCUS_30150 2637 2990 gene locus_tag LOCUS_30160 2637 2990 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 protein_id gnl|my_center|LOCUS_30160 4588 3032 gene locus_tag LOCUS_30170 gene pdeB 4588 3032 CDS product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310610.1 protein_id gnl|my_center|LOCUS_30170 5216 4746 gene locus_tag LOCUS_30180 5216 4746 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 protein_id gnl|my_center|LOCUS_30180 5883 5332 gene locus_tag LOCUS_30190 gene maa 5883 5332 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 protein_id gnl|my_center|LOCUS_30190 6273 6055 gene locus_tag LOCUS_30200 6273 6055 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 protein_id gnl|my_center|LOCUS_30200 6673 6299 gene locus_tag LOCUS_30210 gene tomB 6673 6299 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 protein_id gnl|my_center|LOCUS_30210 7606 7466 gene locus_tag LOCUS_30220 7606 7466 CDS product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078916.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence205 <1 841 gene locus_tag LOCUS_30230 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195286.1:DNA topoisomerase IV subunit B 1203 889 gene locus_tag LOCUS_30240 1203 889 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 protein_id gnl|my_center|LOCUS_30240 1815 1234 gene locus_tag LOCUS_30250 gene mdaB 1815 1234 CDS product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 protein_id gnl|my_center|LOCUS_30250 2065 2544 gene locus_tag LOCUS_30260 2065 2544 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065333.1 protein_id gnl|my_center|LOCUS_30260 2547 3257 gene locus_tag LOCUS_30270 2547 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834028.1 protein_id gnl|my_center|LOCUS_30270 3264 3596 gene locus_tag LOCUS_30280 3264 3596 CDS product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914692.1 protein_id gnl|my_center|LOCUS_30280 4991 3642 gene locus_tag LOCUS_30290 gene qseC 4991 3642 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673354.1 protein_id gnl|my_center|LOCUS_30290 5647 4988 gene locus_tag LOCUS_30300 gene qseB 5647 4988 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221502.1 protein_id gnl|my_center|LOCUS_30300 5799 6191 gene locus_tag LOCUS_30310 gene ygiW 5799 6191 CDS product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 protein_id gnl|my_center|LOCUS_30310 6244 6726 gene locus_tag LOCUS_30320 6244 6726 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183494.1 protein_id gnl|my_center|LOCUS_30320 6931 7227 gene locus_tag LOCUS_30330 gene mqsR 6931 7227 CDS product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 protein_id gnl|my_center|LOCUS_30330 7229 7624 gene locus_tag LOCUS_30340 gene mqsA 7229 7624 CDS product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence206 1388 369 gene locus_tag LOCUS_30350 gene galE 1388 369 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_30350 2591 1698 gene locus_tag LOCUS_30360 gene galF 2591 1698 CDS product UTP--glucose-1-phosphate uridylyltransferase GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183060.1 protein_id gnl|my_center|LOCUS_30360 3829 2834 gene locus_tag LOCUS_30370 3829 2834 CDS product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 protein_id gnl|my_center|LOCUS_30370 5381 3987 gene locus_tag LOCUS_30380 gene wcaM 5381 3987 CDS product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116116.1 protein_id gnl|my_center|LOCUS_30380 6612 5392 gene locus_tag LOCUS_30390 gene wcaL 6612 5392 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862592.1 protein_id gnl|my_center|LOCUS_30390 7775 6609 gene locus_tag LOCUS_30400 gene wcaK 7775 6609 CDS product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770864.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence207 793 71 gene locus_tag LOCUS_30410 793 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 1019 783 gene locus_tag LOCUS_30420 1019 783 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088653.1 protein_id gnl|my_center|LOCUS_30420 1398 1159 gene locus_tag LOCUS_30430 1398 1159 CDS product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488403.1 protein_id gnl|my_center|LOCUS_30430 1978 1763 gene locus_tag LOCUS_30440 1978 1763 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386642.1 protein_id gnl|my_center|LOCUS_30440 2246 2055 gene locus_tag LOCUS_30450 2246 2055 CDS product DUF1382 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548537.1 protein_id gnl|my_center|LOCUS_30450 3078 2398 gene locus_tag LOCUS_30460 3078 2398 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186715.1 protein_id gnl|my_center|LOCUS_30460 3860 3075 gene locus_tag LOCUS_30470 gene bet 3860 3075 CDS product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100847.1 protein_id gnl|my_center|LOCUS_30470 4162 3866 gene locus_tag LOCUS_30480 4162 3866 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995439.1 protein_id gnl|my_center|LOCUS_30480 4444 4238 gene locus_tag LOCUS_30490 4444 4238 CDS product phage encoded cell division inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233576.1 protein_id gnl|my_center|LOCUS_30490 5383 5003 gene locus_tag LOCUS_30500 5383 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 6124 5432 gene locus_tag LOCUS_30510 6124 5432 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 protein_id gnl|my_center|LOCUS_30510 6235 6462 gene locus_tag LOCUS_30520 6235 6462 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184665.1 protein_id gnl|my_center|LOCUS_30520 6493 7032 gene locus_tag LOCUS_30530 6493 7032 CDS product toxin YdaT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182881.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence208 199 534 gene locus_tag LOCUS_30540 gene eutS 199 534 CDS product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 protein_id gnl|my_center|LOCUS_30540 547 1026 gene locus_tag LOCUS_30550 gene eutP 547 1026 CDS product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820764.1 protein_id gnl|my_center|LOCUS_30550 1001 1702 gene locus_tag LOCUS_30560 gene eutQ 1001 1702 CDS product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733903.1 protein_id gnl|my_center|LOCUS_30560 1699 2502 gene locus_tag LOCUS_30570 gene eutT 1699 2502 CDS product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651298.1 protein_id gnl|my_center|LOCUS_30570 2499 3515 gene locus_tag LOCUS_30580 gene pta 2499 3515 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582977.1 protein_id gnl|my_center|LOCUS_30580 3554 3847 gene locus_tag LOCUS_30590 gene eutM 3554 3847 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_30590 3954 4241 gene locus_tag LOCUS_30600 gene eutN 3954 4241 CDS product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762193.1 protein_id gnl|my_center|LOCUS_30600 4253 5656 gene locus_tag LOCUS_30610 4253 5656 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075711.1 protein_id gnl|my_center|LOCUS_30610 5667 6503 gene locus_tag LOCUS_30620 gene eutJ 5667 6503 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929729.1 protein_id gnl|my_center|LOCUS_30620 6493 7680 gene locus_tag LOCUS_30630 gene eutG 6493 7680 CDS product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301866.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence209 844 1872 gene locus_tag LOCUS_30640 gene torT 844 1872 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264919.1 protein_id gnl|my_center|LOCUS_30640 2537 1845 gene locus_tag LOCUS_30650 gene torR 2537 1845 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120112.1 protein_id gnl|my_center|LOCUS_30650 2667 3839 gene locus_tag LOCUS_30660 gene torC 2667 3839 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 protein_id gnl|my_center|LOCUS_30660 3839 6385 gene locus_tag LOCUS_30670 gene torA 3839 6385 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063172.1 protein_id gnl|my_center|LOCUS_30670 6382 6981 gene locus_tag LOCUS_30680 gene torD 6382 6981 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209890.1 protein_id gnl|my_center|LOCUS_30680 7379 7074 gene locus_tag LOCUS_30690 gene cbpM 7379 7074 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024560.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence210 162 1337 gene locus_tag LOCUS_30700 gene entC 162 1337 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295313.1 protein_id gnl|my_center|LOCUS_30700 1347 2957 gene locus_tag LOCUS_30710 gene entE 1347 2957 CDS product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026805.1 protein_id gnl|my_center|LOCUS_30710 2971 3828 gene locus_tag LOCUS_30720 gene entB 2971 3828 CDS product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007138.1 protein_id gnl|my_center|LOCUS_30720 3828 4574 gene locus_tag LOCUS_30730 gene entA 3828 4574 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347657.1 protein_id gnl|my_center|LOCUS_30730 4577 4990 gene locus_tag LOCUS_30740 gene entH 4577 4990 CDS product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637953.1 protein_id gnl|my_center|LOCUS_30740 5171 7276 gene locus_tag LOCUS_30750 gene cstA 5171 7276 CDS product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043156.1 protein_id gnl|my_center|LOCUS_30750 7452 7649 gene locus_tag LOCUS_30760 7452 7649 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence211 526 1566 gene locus_tag LOCUS_30770 526 1566 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147574.1 protein_id gnl|my_center|LOCUS_30770 2346 1771 gene locus_tag LOCUS_30780 gene dolP 2346 1771 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646033.1 protein_id gnl|my_center|LOCUS_30780 2946 2356 gene locus_tag LOCUS_30790 gene diaA 2946 2356 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158035.1 protein_id gnl|my_center|LOCUS_30790 3361 2966 gene locus_tag LOCUS_30800 3361 2966 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246830.1 protein_id gnl|my_center|LOCUS_30800 5355 3319 gene locus_tag LOCUS_30810 gene lpoA 5355 3319 CDS product penicillin-binding protein activator LpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249104.1 protein_id gnl|my_center|LOCUS_30810 5420 6280 gene locus_tag LOCUS_30820 gene rsmI 5420 6280 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 protein_id gnl|my_center|LOCUS_30820 7282 6323 gene locus_tag LOCUS_30830 7282 6323 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816992.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence212 416 24 gene locus_tag LOCUS_30840 416 24 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072317.1 protein_id gnl|my_center|LOCUS_30840 736 413 gene locus_tag LOCUS_30850 736 413 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104350.1 protein_id gnl|my_center|LOCUS_30850 939 739 gene locus_tag LOCUS_30860 939 739 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864897.1 protein_id gnl|my_center|LOCUS_30860 1433 939 gene locus_tag LOCUS_30870 1433 939 CDS product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063103.1 protein_id gnl|my_center|LOCUS_30870 2335 1535 gene locus_tag LOCUS_30880 gene gpM 2335 1535 CDS product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632318.1 protein_id gnl|my_center|LOCUS_30880 3433 2381 gene locus_tag LOCUS_30890 3433 2381 CDS product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055094.1 protein_id gnl|my_center|LOCUS_30890 4293 3457 gene locus_tag LOCUS_30900 4293 3457 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262665.1 protein_id gnl|my_center|LOCUS_30900 4448 6199 gene locus_tag LOCUS_30910 4448 6199 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613796.1 protein_id gnl|my_center|LOCUS_30910 6199 7245 gene locus_tag LOCUS_30920 6199 7245 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087812.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence213 1877 1131 gene locus_tag LOCUS_30930 1877 1131 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038079.1 protein_id gnl|my_center|LOCUS_30930 2518 1874 gene locus_tag LOCUS_30940 gene gfcB 2518 1874 CDS product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 protein_id gnl|my_center|LOCUS_30940 2930 2625 gene locus_tag LOCUS_30950 2930 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032438.1 protein_id gnl|my_center|LOCUS_30950 3584 3372 gene locus_tag LOCUS_30960 gene cspH 3584 3372 CDS product cold shock-like protein CspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087763.1 protein_id gnl|my_center|LOCUS_30960 3870 4082 gene locus_tag LOCUS_30970 gene cspG 3870 4082 CDS product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066490.1 protein_id gnl|my_center|LOCUS_30970 4476 4649 gene locus_tag LOCUS_30980 4476 4649 CDS product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019197.1 protein_id gnl|my_center|LOCUS_30980 5770 4697 gene locus_tag LOCUS_30990 5770 4697 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829662.1 protein_id gnl|my_center|LOCUS_30990 <7542 5842 gene locus_tag LOCUS_31000 <7542 5842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001300633.1:TMAO reductase system sensor histidine kinase/response regulator TorS >Feature sequence214 34 957 gene locus_tag LOCUS_31010 34 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871667.1 protein_id gnl|my_center|LOCUS_31010 1929 1030 gene locus_tag LOCUS_31020 gene nhaR 1929 1030 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062888.1 protein_id gnl|my_center|LOCUS_31020 3161 1995 gene locus_tag LOCUS_31030 gene nhaA 3161 1995 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681368.1 protein_id gnl|my_center|LOCUS_31030 3747 3899 gene locus_tag LOCUS_31040 gene mokC 3747 3899 CDS product type I toxin-antitoxin system toxin MokC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809168.1 protein_id gnl|my_center|LOCUS_31040 5133 4003 gene locus_tag LOCUS_31050 gene dnaJ 5133 4003 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_31050 7138 5222 gene locus_tag LOCUS_31060 gene dnaK 7138 5222 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence215 2182 1748 gene locus_tag LOCUS_31070 gene tssE 2182 1748 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705635.1 protein_id gnl|my_center|LOCUS_31070 2718 2182 gene locus_tag LOCUS_31080 gene tssJ 2718 2182 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074160625.1 protein_id gnl|my_center|LOCUS_31080 3529 2699 gene locus_tag LOCUS_31090 3529 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 5517 3754 gene locus_tag LOCUS_31100 gene tssF 5517 3754 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 protein_id gnl|my_center|LOCUS_31100 <7483 6219 gene locus_tag LOCUS_31110 <7483 6219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705644.1:type VI secretion system protein TssA >Feature sequence216 742 377 gene locus_tag LOCUS_31120 742 377 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 protein_id gnl|my_center|LOCUS_31120 2021 1035 gene locus_tag LOCUS_31130 gene yqjG 2021 1035 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531205.1 protein_id gnl|my_center|LOCUS_31130 2573 2091 gene locus_tag LOCUS_31140 2573 2091 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603618.1 protein_id gnl|my_center|LOCUS_31140 2968 2669 gene locus_tag LOCUS_31150 2968 2669 CDS product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096086.1 protein_id gnl|my_center|LOCUS_31150 3362 2958 gene locus_tag LOCUS_31160 3362 2958 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 protein_id gnl|my_center|LOCUS_31160 3670 3365 gene locus_tag LOCUS_31170 3670 3365 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 protein_id gnl|my_center|LOCUS_31170 4076 3708 gene locus_tag LOCUS_31180 gene yqjC 4076 3708 CDS product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297156.1 protein_id gnl|my_center|LOCUS_31180 4606 4223 gene locus_tag LOCUS_31190 gene mzrA 4606 4223 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166761.1 protein_id gnl|my_center|LOCUS_31190 5272 4610 gene locus_tag LOCUS_31200 gene yqjA 5272 4610 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 protein_id gnl|my_center|LOCUS_31200 6393 5617 gene locus_tag LOCUS_31210 gene exuR 6393 5617 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 protein_id gnl|my_center|LOCUS_31210 6767 7405 gene locus_tag LOCUS_31220 6767 7405 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225857.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence217 1302 58 gene locus_tag LOCUS_31230 gene mtr 1302 58 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224351.1 protein_id gnl|my_center|LOCUS_31230 3345 1456 gene locus_tag LOCUS_31240 gene deaD 3345 1456 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 protein_id gnl|my_center|LOCUS_31240 4409 3525 gene locus_tag LOCUS_31250 gene nlpI 4409 3525 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 protein_id gnl|my_center|LOCUS_31250 6653 4518 gene locus_tag LOCUS_31260 gene pnp 6653 4518 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295554.1 protein_id gnl|my_center|LOCUS_31260 7169 6900 gene locus_tag LOCUS_31270 gene rpsO 7169 6900 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence218 307 1329 gene locus_tag LOCUS_31280 gene lsrB 307 1329 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172466.1 protein_id gnl|my_center|LOCUS_31280 1356 2231 gene locus_tag LOCUS_31290 gene lsrF 1356 2231 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774178.1 protein_id gnl|my_center|LOCUS_31290 2255 2545 gene locus_tag LOCUS_31300 gene lsrG 2255 2545 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558527.1 protein_id gnl|my_center|LOCUS_31300 2602 3360 gene locus_tag LOCUS_31310 gene tam 2602 3360 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286597.1 protein_id gnl|my_center|LOCUS_31310 4278 3364 gene locus_tag LOCUS_31320 4278 3364 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637082.1 protein_id gnl|my_center|LOCUS_31320 5936 4485 gene locus_tag LOCUS_31330 gene uxaB 5936 4485 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854624.1 protein_id gnl|my_center|LOCUS_31330 7110 6163 gene locus_tag LOCUS_31340 7110 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence219 430 579 gene locus_tag LOCUS_31350 430 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1335 2870 gene locus_tag LOCUS_31360 1335 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 2885 3595 gene locus_tag LOCUS_31370 2885 3595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_31370 3592 4440 gene locus_tag LOCUS_31380 3592 4440 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_31380 4437 4973 gene locus_tag LOCUS_31390 4437 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 5310 4975 gene locus_tag LOCUS_31400 5310 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 6856 5624 gene locus_tag LOCUS_31410 6856 5624 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_31410 7252 6965 gene locus_tag LOCUS_31420 7252 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence220 114 39 gene locus_tag LOCUS_t00480 114 39 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 796 221 gene locus_tag LOCUS_31430 796 221 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 protein_id gnl|my_center|LOCUS_31430 2530 833 gene locus_tag LOCUS_31440 gene dsbD 2530 833 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068978.1 protein_id gnl|my_center|LOCUS_31440 2844 2506 gene locus_tag LOCUS_31450 gene cutA 2844 2506 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 protein_id gnl|my_center|LOCUS_31450 4261 2960 gene locus_tag LOCUS_31460 gene dcuA 4261 2960 CDS product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 protein_id gnl|my_center|LOCUS_31460 5815 4379 gene locus_tag LOCUS_31470 gene aspA 5815 4379 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335685.1 protein_id gnl|my_center|LOCUS_31470 6152 6628 gene locus_tag LOCUS_31480 gene fxsA 6152 6628 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 protein_id gnl|my_center|LOCUS_31480 <7363 6644 gene locus_tag LOCUS_31490 <7363 6644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000015802.1:L-methionine/branched-chain amino acid transporter >Feature sequence221 790 551 gene locus_tag LOCUS_31500 790 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 1774 806 gene locus_tag LOCUS_31510 1774 806 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_31510 3166 1784 gene locus_tag LOCUS_31520 3166 1784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_31520 3592 3200 gene locus_tag LOCUS_31530 3592 3200 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_31530 4650 3589 gene locus_tag LOCUS_31540 4650 3589 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_31540 5963 4836 gene locus_tag LOCUS_31550 5963 4836 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 protein_id gnl|my_center|LOCUS_31550 6420 6172 gene locus_tag LOCUS_31560 6420 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence222 496 8 gene locus_tag LOCUS_31570 496 8 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299676.1 protein_id gnl|my_center|LOCUS_31570 2406 673 gene locus_tag LOCUS_31580 gene argS 2406 673 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025326.1 protein_id gnl|my_center|LOCUS_31580 2622 3188 gene locus_tag LOCUS_31590 2622 3188 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326063.1 protein_id gnl|my_center|LOCUS_31590 3202 3948 gene locus_tag LOCUS_31600 gene cutC 3202 3948 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185734.1 protein_id gnl|my_center|LOCUS_31600 4336 5151 gene locus_tag LOCUS_31610 4336 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31610 >Feature sequence223 <1 1358 gene locus_tag LOCUS_31620 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010723175.1:HlyC/CorC family transporter 2006 1413 gene locus_tag LOCUS_31630 gene grpE 2006 1413 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296310.1 protein_id gnl|my_center|LOCUS_31630 2197 2003 gene locus_tag LOCUS_31640 2197 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 2129 3007 gene locus_tag LOCUS_31650 gene nadK 2129 3007 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059169.1 protein_id gnl|my_center|LOCUS_31650 3093 4754 gene locus_tag LOCUS_31660 gene recN 3093 4754 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880915.1 protein_id gnl|my_center|LOCUS_31660 4903 5244 gene locus_tag LOCUS_31670 gene bamE 4903 5244 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203437.1 protein_id gnl|my_center|LOCUS_31670 5596 5306 gene locus_tag LOCUS_31680 5596 5306 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 protein_id gnl|my_center|LOCUS_31680 6062 5586 gene locus_tag LOCUS_31690 gene ratA 6062 5586 CDS product type II toxin-antitoxin system toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600189.1 protein_id gnl|my_center|LOCUS_31690 6194 6676 gene locus_tag LOCUS_31700 gene smpB 6194 6676 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162574.1 protein_id gnl|my_center|LOCUS_31700 6891 7253 gene locus_tag LOCUS_tm00010 6891 7253 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence224 <1 1202 gene locus_tag LOCUS_31710 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000628537.1:ABC transporter ATP-binding protein/permease 1240 3612 gene locus_tag LOCUS_31720 1240 3612 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832437.1 protein_id gnl|my_center|LOCUS_31720 3669 6452 gene locus_tag LOCUS_31730 3669 6452 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723101.1 protein_id gnl|my_center|LOCUS_31730 >Feature sequence225 2181 3134 gene locus_tag LOCUS_31740 gene metR 2181 3134 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 protein_id gnl|my_center|LOCUS_31740 3921 3022 gene locus_tag LOCUS_31750 gene bioP 3921 3022 CDS product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 protein_id gnl|my_center|LOCUS_31750 4797 3997 gene locus_tag LOCUS_31760 gene yigL 4797 3997 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285348.1 protein_id gnl|my_center|LOCUS_31760 5827 4805 gene locus_tag LOCUS_31770 gene pldB 5827 4805 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 protein_id gnl|my_center|LOCUS_31770 5938 6558 gene locus_tag LOCUS_31780 gene rhtB 5938 6558 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 protein_id gnl|my_center|LOCUS_31780 <7196 6620 gene locus_tag LOCUS_31790 <7196 6620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000928824.1:threonine export protein RhtC >Feature sequence226 <1 513 gene locus_tag LOCUS_31800 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000446378.1:multidrug efflux transporter periplasmic adaptor subunit MdtN 513 2564 gene locus_tag LOCUS_31810 gene mdtO 513 2564 CDS product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275193.1 protein_id gnl|my_center|LOCUS_31810 2561 4027 gene locus_tag LOCUS_31820 gene mdtP 2561 4027 CDS product multidrug efflux transporter outer membrane subunit MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610574.1 protein_id gnl|my_center|LOCUS_31820 4225 6372 gene locus_tag LOCUS_31830 gene fdhF 4225 6372 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_except (pos:4642..4644,aa:Sec) note codon on position 140 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_31830 6466 7155 gene locus_tag LOCUS_31840 gene yjcO 6466 7155 CDS product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719886.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence227 912 4193 gene locus_tag LOCUS_31850 912 4193 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333903.1 protein_id gnl|my_center|LOCUS_31850 4290 5273 gene locus_tag LOCUS_31860 4290 5273 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124894.1 protein_id gnl|my_center|LOCUS_31860 5296 6807 gene locus_tag LOCUS_31870 5296 6807 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493489.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence228 636 82 gene locus_tag LOCUS_31880 636 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2222 633 gene locus_tag LOCUS_31890 gene hsdM 2222 633 CDS product type I restriction-modification system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063204.1 protein_id gnl|my_center|LOCUS_31890 5811 2299 gene locus_tag LOCUS_31900 gene hsdR 5811 2299 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981385.1 protein_id gnl|my_center|LOCUS_31900 5999 6913 gene locus_tag LOCUS_31910 gene mrr 5999 6913 CDS product adenine/cytosine-specific restriction endonuclease Mrr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217934.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence229 149 1393 gene locus_tag LOCUS_31920 gene sstT 149 1393 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211655.1 protein_id gnl|my_center|LOCUS_31920 1949 1398 gene locus_tag LOCUS_31930 1949 1398 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128138.1 protein_id gnl|my_center|LOCUS_31930 3519 2032 gene locus_tag LOCUS_31940 gene uxaA 3519 2032 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199352.1 protein_id gnl|my_center|LOCUS_31940 4946 3534 gene locus_tag LOCUS_31950 gene uxaC 4946 3534 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_31950 5429 6727 gene locus_tag LOCUS_31960 gene exuT 5429 6727 CDS product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 protein_id gnl|my_center|LOCUS_31960 >Feature sequence230 1056 175 gene locus_tag LOCUS_31970 gene htpX 1056 175 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984517.1 protein_id gnl|my_center|LOCUS_31970 3296 1248 gene locus_tag LOCUS_31980 gene prc 3296 1248 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055778.1 protein_id gnl|my_center|LOCUS_31980 4014 3316 gene locus_tag LOCUS_31990 gene proQ 4014 3316 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431370.1 protein_id gnl|my_center|LOCUS_31990 4608 4111 gene locus_tag LOCUS_32000 gene msrC 4608 4111 CDS product L-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299249.1 protein_id gnl|my_center|LOCUS_32000 4783 6021 gene locus_tag LOCUS_32010 gene yebS 4783 6021 CDS product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207283.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence231 6291 4561 gene locus_tag LOCUS_32020 6291 4561 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214693.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence232 417 902 gene locus_tag LOCUS_32030 417 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 899 1381 gene locus_tag LOCUS_32040 899 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 1606 4872 gene locus_tag LOCUS_32050 1606 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 4869 5780 gene locus_tag LOCUS_32060 4869 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence233 2776 1763 gene locus_tag LOCUS_32070 gene dmpG 2776 1763 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 protein_id gnl|my_center|LOCUS_32070 3723 2773 gene locus_tag LOCUS_32080 gene mhpF 3723 2773 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 protein_id gnl|my_center|LOCUS_32080 4529 3720 gene locus_tag LOCUS_32090 gene mhpD 4529 3720 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160710.1 protein_id gnl|my_center|LOCUS_32090 5405 4539 gene locus_tag LOCUS_32100 gene mhpC 5405 4539 CDS product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 protein_id gnl|my_center|LOCUS_32100 6367 5423 gene locus_tag LOCUS_32110 gene mhpB 6367 5423 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence234 1882 653 gene locus_tag LOCUS_32120 gene sorE 1882 653 CDS product L-sorbose 1-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858545.1 protein_id gnl|my_center|LOCUS_32120 2413 1934 gene locus_tag LOCUS_32130 2413 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32130 2757 2299 gene locus_tag LOCUS_32140 2757 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32140 3565 2768 gene locus_tag LOCUS_32150 3565 2768 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406313.1 protein_id gnl|my_center|LOCUS_32150 4125 3631 gene locus_tag LOCUS_32160 4125 3631 CDS product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027849.1 protein_id gnl|my_center|LOCUS_32160 4532 4125 gene locus_tag LOCUS_32170 4532 4125 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245650.1 protein_id gnl|my_center|LOCUS_32170 5348 4542 gene locus_tag LOCUS_32180 5348 4542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195423.1 protein_id gnl|my_center|LOCUS_32180 6365 5418 gene locus_tag LOCUS_32190 6365 5418 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050527.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence235 168 656 gene locus_tag LOCUS_32200 gene iscR 168 656 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 protein_id gnl|my_center|LOCUS_32200 768 1982 gene locus_tag LOCUS_32210 gene iscS 768 1982 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_32210 2010 2396 gene locus_tag LOCUS_32220 gene iscU 2010 2396 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_32220 2413 2736 gene locus_tag LOCUS_32230 gene iscA 2413 2736 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_32230 2832 3347 gene locus_tag LOCUS_32240 gene hscB 2832 3347 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384411.1 protein_id gnl|my_center|LOCUS_32240 3364 5214 gene locus_tag LOCUS_32250 gene hscA 3364 5214 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_32250 5216 5551 gene locus_tag LOCUS_32260 gene fdx 5216 5551 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124474.1 protein_id gnl|my_center|LOCUS_32260 5563 5763 gene locus_tag LOCUS_32270 gene iscX 5563 5763 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence236 214 1269 gene locus_tag LOCUS_32280 gene apbE 214 1269 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406130.1 protein_id gnl|my_center|LOCUS_32280 1609 1391 gene locus_tag LOCUS_32290 1609 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1646 2407 gene locus_tag LOCUS_32300 1646 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2407 3057 gene locus_tag LOCUS_32310 gene alkB 2407 3057 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884942.1 protein_id gnl|my_center|LOCUS_32310 3133 4776 gene locus_tag LOCUS_32320 gene yojI 3133 4776 CDS product microcin J25 efflux ABC transporter YojI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422182.1 protein_id gnl|my_center|LOCUS_32320 4994 6640 gene locus_tag LOCUS_32330 gene mqo 4994 6640 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758077.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence237 <1 570 gene locus_tag LOCUS_32340 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000168712.1:L-threonine dehydrogenase 735 2273 gene locus_tag LOCUS_32350 gene aldB 735 2273 CDS product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183976.1 protein_id gnl|my_center|LOCUS_32350 2704 2492 gene locus_tag LOCUS_32360 2704 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 protein_id gnl|my_center|LOCUS_32360 2818 3141 gene locus_tag LOCUS_32370 2818 3141 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478193.1 protein_id gnl|my_center|LOCUS_32370 3147 4283 gene locus_tag LOCUS_32380 3147 4283 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 protein_id gnl|my_center|LOCUS_32380 5254 4280 gene locus_tag LOCUS_32390 5254 4280 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 protein_id gnl|my_center|LOCUS_32390 5368 6108 gene locus_tag LOCUS_32400 5368 6108 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906819.1 protein_id gnl|my_center|LOCUS_32400 >Feature sequence238 2381 507 gene locus_tag LOCUS_32410 gene htpG 2381 507 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 protein_id gnl|my_center|LOCUS_32410 3096 2491 gene locus_tag LOCUS_32420 gene recR 3096 2491 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 protein_id gnl|my_center|LOCUS_32420 3425 3096 gene locus_tag LOCUS_32430 3425 3096 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_32430 5409 3478 gene locus_tag LOCUS_32440 gene dnaX 5409 3478 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122008.1 protein_id gnl|my_center|LOCUS_32440 6089 5538 gene locus_tag LOCUS_32450 gene apt 6089 5538 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 protein_id gnl|my_center|LOCUS_32450 6619 6242 gene locus_tag LOCUS_32460 6619 6242 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 protein_id gnl|my_center|LOCUS_32460 >Feature sequence239 868 1527 gene locus_tag LOCUS_32470 gene cynT 868 1527 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658652.1 protein_id gnl|my_center|LOCUS_32470 1612 2028 gene locus_tag LOCUS_32480 gene cynS 1612 2028 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616241.1 protein_id gnl|my_center|LOCUS_32480 2061 3215 gene locus_tag LOCUS_32490 gene cynX 2061 3215 CDS product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927953.1 protein_id gnl|my_center|LOCUS_32490 3929 3318 gene locus_tag LOCUS_32500 gene lacA 3929 3318 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335915.1 protein_id gnl|my_center|LOCUS_32500 5248 3995 gene locus_tag LOCUS_32510 gene lacY 5248 3995 CDS product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291549.1 protein_id gnl|my_center|LOCUS_32510 6748 5300 gene locus_tag LOCUS_32520 6748 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence240 1539 526 gene locus_tag LOCUS_32530 gene tsaD 1539 526 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264365.1 protein_id gnl|my_center|LOCUS_32530 1776 1991 gene locus_tag LOCUS_32540 gene rpsU 1776 1991 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_32540 2102 3847 gene locus_tag LOCUS_32550 gene dnaG 2102 3847 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 protein_id gnl|my_center|LOCUS_32550 4042 5883 gene locus_tag LOCUS_32560 gene rpoD 4042 5883 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 protein_id gnl|my_center|LOCUS_32560 6468 5962 gene locus_tag LOCUS_32570 gene mug 6468 5962 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 protein_id gnl|my_center|LOCUS_32570 6593 6668 gene locus_tag LOCUS_t00490 6593 6668 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence241 1010 2929 gene locus_tag LOCUS_32580 gene dhaR 1010 2929 CDS product dihydroxyacetone kinase operon transcriptional regulator DhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350505.1 protein_id gnl|my_center|LOCUS_32580 5896 3029 gene locus_tag LOCUS_32590 5896 3029 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358436.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence242 591 1640 gene locus_tag LOCUS_32600 gene yahK 591 1640 CDS product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692754.1 protein_id gnl|my_center|LOCUS_32600 1883 2698 gene locus_tag LOCUS_32610 gene yahL 1883 2698 CDS product protein YahL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301260.1 protein_id gnl|my_center|LOCUS_32610 3041 3121 gene locus_tag LOCUS_t00500 3041 3121 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4044 3373 gene locus_tag LOCUS_32620 4044 3373 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983410.1 protein_id gnl|my_center|LOCUS_32620 4191 4466 gene locus_tag LOCUS_32630 gene yahO 4191 4466 CDS product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691953.1 protein_id gnl|my_center|LOCUS_32630 6150 4564 gene locus_tag LOCUS_32640 gene prpR 6150 4564 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941052.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence243 <1 1093 gene locus_tag LOCUS_32650 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705647.1:type VI secretion system contractile sheath large subunit 1109 2446 gene locus_tag LOCUS_32660 gene tssK 1109 2446 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211664.1 protein_id gnl|my_center|LOCUS_32660 2443 3096 gene locus_tag LOCUS_32670 gene tssL 2443 3096 CDS product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210015.1 protein_id gnl|my_center|LOCUS_32670 3099 4829 gene locus_tag LOCUS_32680 3099 4829 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158270.1 protein_id gnl|my_center|LOCUS_32680 4835 5326 gene locus_tag LOCUS_32690 gene hcp 4835 5326 CDS product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence244 34 1485 gene locus_tag LOCUS_32700 gene traB 34 1485 CDS product F-type conjugal transfer pilus assembly protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146665.1 protein_id gnl|my_center|LOCUS_32700 1475 2041 gene locus_tag LOCUS_32710 gene traP 1475 2041 CDS product conjugal transfer pilus-stabilizing protein TraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002787.1 protein_id gnl|my_center|LOCUS_32710 2028 2348 gene locus_tag LOCUS_32720 2028 2348 CDS product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315561.1 protein_id gnl|my_center|LOCUS_32720 2341 2592 gene locus_tag LOCUS_32730 2341 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 2589 3104 gene locus_tag LOCUS_32740 gene traV 2589 3104 CDS product type IV conjugative transfer system lipoprotein TraV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809888.1 protein_id gnl|my_center|LOCUS_32740 3239 3460 gene locus_tag LOCUS_32750 gene traR 3239 3460 CDS product conjugal transfer protein TraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278694.1 protein_id gnl|my_center|LOCUS_32750 3453 3689 gene locus_tag LOCUS_32760 3453 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32760 3871 6501 gene locus_tag LOCUS_32770 gene traC 3871 6501 CDS product type IV secretion system protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069778.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence245 368 1065 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctgacgcggggaac 1457 1173 gene locus_tag LOCUS_32780 gene cas2e 1457 1173 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378852.1 protein_id gnl|my_center|LOCUS_32780 2328 1459 gene locus_tag LOCUS_32790 gene cas1e 2328 1459 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 protein_id gnl|my_center|LOCUS_32790 2991 2392 gene locus_tag LOCUS_32800 gene cas6e 2991 2392 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281401.1 protein_id gnl|my_center|LOCUS_32800 4746 3655 gene locus_tag LOCUS_32810 gene cas7e 4746 3655 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064450.1 protein_id gnl|my_center|LOCUS_32810 5241 4759 gene locus_tag LOCUS_32820 gene casB 5241 4759 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752800.1 protein_id gnl|my_center|LOCUS_32820 6475 5234 gene locus_tag LOCUS_32830 gene casA 6475 5234 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050401.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence246 <1 654 gene locus_tag LOCUS_32840 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000484640.1:YhaC family protein note possible pseudo, frameshifted 2801 1656 gene locus_tag LOCUS_32850 gene garK 2801 1656 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300387.1 protein_id gnl|my_center|LOCUS_32850 3797 2898 gene locus_tag LOCUS_32860 gene garR 3797 2898 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_32860 4588 3818 gene locus_tag LOCUS_32870 gene garL 4588 3818 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058227.1 protein_id gnl|my_center|LOCUS_32870 5938 4604 gene locus_tag LOCUS_32880 gene garP 5938 4604 CDS product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence247 583 17 gene locus_tag LOCUS_32890 gene yieF 583 17 CDS product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291268.1 protein_id gnl|my_center|LOCUS_32890 1354 605 gene locus_tag LOCUS_32900 1354 605 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190670.1 protein_id gnl|my_center|LOCUS_32900 2479 1511 gene locus_tag LOCUS_32910 gene yidZ 2479 1511 CDS product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748502.1 protein_id gnl|my_center|LOCUS_32910 3620 2445 gene locus_tag LOCUS_32920 gene mdtL 3620 2445 CDS product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085995.1 protein_id gnl|my_center|LOCUS_32920 5000 3753 gene locus_tag LOCUS_32930 gene tnaB 5000 3753 CDS product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131911.1 protein_id gnl|my_center|LOCUS_32930 6506 5091 gene locus_tag LOCUS_32940 gene tnaA 6506 5091 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 protein_id gnl|my_center|LOCUS_32940 >Feature sequence248 482 1393 gene locus_tag LOCUS_32950 gene panE 482 1393 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 protein_id gnl|my_center|LOCUS_32950 1356 1946 gene locus_tag LOCUS_32960 gene yajL 1356 1946 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276309.1 protein_id gnl|my_center|LOCUS_32960 3448 2000 gene locus_tag LOCUS_32970 gene thiI 3448 2000 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668685.1 protein_id gnl|my_center|LOCUS_32970 3654 3896 gene locus_tag LOCUS_32980 gene xseB 3654 3896 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 protein_id gnl|my_center|LOCUS_32980 3896 4795 gene locus_tag LOCUS_32990 gene ispA 3896 4795 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347217.1 protein_id gnl|my_center|LOCUS_32990 >Feature sequence249 846 13 gene locus_tag LOCUS_33000 gene fghA 846 13 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419049.1 protein_id gnl|my_center|LOCUS_33000 2048 939 gene locus_tag LOCUS_33010 gene frmA 2048 939 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 protein_id gnl|my_center|LOCUS_33010 2358 2083 gene locus_tag LOCUS_33020 gene frmR 2358 2083 CDS product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 protein_id gnl|my_center|LOCUS_33020 3317 2544 gene locus_tag LOCUS_33030 3317 2544 CDS product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596085.1 protein_id gnl|my_center|LOCUS_33030 3759 3319 gene locus_tag LOCUS_33040 3759 3319 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088545487.1 protein_id gnl|my_center|LOCUS_33040 5074 3878 gene locus_tag LOCUS_33050 5074 3878 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860444.1 protein_id gnl|my_center|LOCUS_33050 5755 5084 gene locus_tag LOCUS_33060 5755 5084 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362029.1 protein_id gnl|my_center|LOCUS_33060 6417 6193 gene locus_tag LOCUS_33070 6417 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence250 <1 1708 gene locus_tag LOCUS_33080 <1 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001186481.1:phenylacetic acid degradation bifunctional protein PaaZ 1956 4229 gene locus_tag LOCUS_33090 gene tynA 1956 4229 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535469.1 protein_id gnl|my_center|LOCUS_33090 5787 4288 gene locus_tag LOCUS_33100 gene feaB 5787 4288 CDS product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138615.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence251 1761 1180 gene locus_tag LOCUS_33110 gene yqiA 1761 1180 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_33110 2588 1761 gene locus_tag LOCUS_33120 gene cpdA 2588 1761 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 protein_id gnl|my_center|LOCUS_33120 3035 2613 gene locus_tag LOCUS_33130 3035 2613 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 protein_id gnl|my_center|LOCUS_33130 3665 3036 gene locus_tag LOCUS_33140 gene nudF 3665 3036 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 protein_id gnl|my_center|LOCUS_33140 3870 5351 gene locus_tag LOCUS_33150 gene tolC 3870 5351 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 protein_id gnl|my_center|LOCUS_33150 5628 6170 gene locus_tag LOCUS_33160 5628 6170 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence252 56 877 gene locus_tag LOCUS_33170 gene ulaG 56 877 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 protein_id gnl|my_center|LOCUS_33170 985 1740 gene locus_tag LOCUS_33180 gene ulaR 985 1740 CDS product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 protein_id gnl|my_center|LOCUS_33180 2486 1737 gene locus_tag LOCUS_33190 gene yjfP 2486 1737 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569714.1 protein_id gnl|my_center|LOCUS_33190 2728 2997 gene locus_tag LOCUS_33200 2728 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3146 3421 gene locus_tag LOCUS_33210 gene yjfN 3146 3421 CDS product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 protein_id gnl|my_center|LOCUS_33210 5163 3538 gene locus_tag LOCUS_33220 5163 3538 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350567.1 protein_id gnl|my_center|LOCUS_33220 <6368 5247 gene locus_tag LOCUS_33230 <6368 5247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000943963.1:glutathionylspermidine synthase family protein >Feature sequence253 1554 352 gene locus_tag LOCUS_33240 gene ubiI 1554 352 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192185.1 protein_id gnl|my_center|LOCUS_33240 2755 1577 gene locus_tag LOCUS_33250 gene ubiH 2755 1577 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111225.1 protein_id gnl|my_center|LOCUS_33250 4077 2752 gene locus_tag LOCUS_33260 gene pepP 4077 2752 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290129.1 protein_id gnl|my_center|LOCUS_33260 4681 4103 gene locus_tag LOCUS_33270 gene ygfB 4681 4103 CDS product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 protein_id gnl|my_center|LOCUS_33270 4849 5178 gene locus_tag LOCUS_33280 gene zapA 4849 5178 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 protein_id gnl|my_center|LOCUS_33280 5478 6026 gene locus_tag LOCUS_33290 5478 6026 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192742.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence254 586 903 gene locus_tag LOCUS_33300 586 903 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493756.1 protein_id gnl|my_center|LOCUS_33300 962 1258 gene locus_tag LOCUS_33310 gene nadS 962 1258 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650976.1 protein_id gnl|my_center|LOCUS_33310 2632 1289 gene locus_tag LOCUS_33320 gene envZ 2632 1289 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 protein_id gnl|my_center|LOCUS_33320 3357 2638 gene locus_tag LOCUS_33330 gene ompR 3357 2638 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 protein_id gnl|my_center|LOCUS_33330 3585 4061 gene locus_tag LOCUS_33340 gene greB 3585 4061 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence255 134 595 gene locus_tag LOCUS_33350 134 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 597 875 gene locus_tag LOCUS_33360 597 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644414.1 protein_id gnl|my_center|LOCUS_33360 1203 889 gene locus_tag LOCUS_33370 1203 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33370 1681 1409 gene locus_tag LOCUS_33380 1681 1409 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303397.1 protein_id gnl|my_center|LOCUS_33380 2434 1826 gene locus_tag LOCUS_33390 2434 1826 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702307.1 protein_id gnl|my_center|LOCUS_33390 2935 2618 gene locus_tag LOCUS_33400 gene metJ 2935 2618 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 protein_id gnl|my_center|LOCUS_33400 3212 4372 gene locus_tag LOCUS_33410 gene metB 3212 4372 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 protein_id gnl|my_center|LOCUS_33410 >Feature sequence256 113 493 gene locus_tag LOCUS_33420 gene panD 113 493 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 protein_id gnl|my_center|LOCUS_33420 1726 497 gene locus_tag LOCUS_33430 1726 497 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277917.1 protein_id gnl|my_center|LOCUS_33430 2230 1790 gene locus_tag LOCUS_33440 2230 1790 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901987.1 protein_id gnl|my_center|LOCUS_33440 3105 2335 gene locus_tag LOCUS_33450 3105 2335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 protein_id gnl|my_center|LOCUS_33450 4028 3102 gene locus_tag LOCUS_33460 4028 3102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 protein_id gnl|my_center|LOCUS_33460 4137 4799 gene locus_tag LOCUS_33470 gene can 4137 4799 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 protein_id gnl|my_center|LOCUS_33470 5376 4840 gene locus_tag LOCUS_33480 gene hpt 5376 4840 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence257 2596 1049 gene locus_tag LOCUS_33490 gene fdrA 2596 1049 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111784.1 protein_id gnl|my_center|LOCUS_33490 3449 2586 gene locus_tag LOCUS_33500 3449 2586 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310582.1 protein_id gnl|my_center|LOCUS_33500 4094 3489 gene locus_tag LOCUS_33510 4094 3489 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023635.1 protein_id gnl|my_center|LOCUS_33510 4352 4849 gene locus_tag LOCUS_33520 4352 4849 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013892.1 protein_id gnl|my_center|LOCUS_33520 4941 5873 gene locus_tag LOCUS_33530 4941 5873 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084388.1 protein_id gnl|my_center|LOCUS_33530 >Feature sequence258 1383 715 gene locus_tag LOCUS_33540 gene ftsE 1383 715 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 protein_id gnl|my_center|LOCUS_33540 2882 1386 gene locus_tag LOCUS_33550 gene ftsY 2882 1386 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040684.1 protein_id gnl|my_center|LOCUS_33550 3032 3628 gene locus_tag LOCUS_33560 gene rsmD 3032 3628 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 protein_id gnl|my_center|LOCUS_33560 3618 3887 gene locus_tag LOCUS_33570 3618 3887 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295207.1 protein_id gnl|my_center|LOCUS_33570 4249 3890 gene locus_tag LOCUS_33580 4249 3890 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042900.1 protein_id gnl|my_center|LOCUS_33580 4390 5016 gene locus_tag LOCUS_33590 4390 5016 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence259 <1 837 gene locus_tag LOCUS_33600 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000578056.1:DEAD/DEAH box helicase 962 1246 gene locus_tag LOCUS_33610 gene rplY 962 1246 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494183.1 protein_id gnl|my_center|LOCUS_33610 2392 1385 gene locus_tag LOCUS_33620 gene yejK 2392 1385 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050789.1 protein_id gnl|my_center|LOCUS_33620 2574 2801 gene locus_tag LOCUS_33630 2574 2801 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 protein_id gnl|my_center|LOCUS_33630 2821 4581 gene locus_tag LOCUS_33640 gene yejM 2821 4581 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256203.1 protein_id gnl|my_center|LOCUS_33640 4656 4732 gene locus_tag LOCUS_t00510 4656 4732 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence260 400 1077 gene locus_tag LOCUS_33650 gene fetA 400 1077 CDS product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157548.1 protein_id gnl|my_center|LOCUS_33650 1064 1843 gene locus_tag LOCUS_33660 gene fetB 1064 1843 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 protein_id gnl|my_center|LOCUS_33660 2760 1906 gene locus_tag LOCUS_33670 gene cnoX 2760 1906 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 protein_id gnl|my_center|LOCUS_33670 3630 2821 gene locus_tag LOCUS_33680 gene ybbO 3630 2821 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 protein_id gnl|my_center|LOCUS_33680 4276 3620 gene locus_tag LOCUS_33690 gene tesA 4276 3620 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 protein_id gnl|my_center|LOCUS_33690 4214 4900 gene locus_tag LOCUS_33700 4214 4900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence261 483 923 gene locus_tag LOCUS_33710 483 923 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325907.1 protein_id gnl|my_center|LOCUS_33710 1174 2160 gene locus_tag LOCUS_33720 1174 2160 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981355.1 protein_id gnl|my_center|LOCUS_33720 2209 3693 gene locus_tag LOCUS_33730 2209 3693 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447335.1 protein_id gnl|my_center|LOCUS_33730 3686 4657 gene locus_tag LOCUS_33740 3686 4657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818900.1 protein_id gnl|my_center|LOCUS_33740 4654 5610 gene locus_tag LOCUS_33750 4654 5610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750340.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence262 225 884 gene locus_tag LOCUS_33760 gene yeiL 225 884 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310375.1 protein_id gnl|my_center|LOCUS_33760 2184 955 gene locus_tag LOCUS_33770 2184 955 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353878.1 protein_id gnl|my_center|LOCUS_33770 3237 2299 gene locus_tag LOCUS_33780 gene psuG 3237 2299 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292468.1 protein_id gnl|my_center|LOCUS_33780 4013 3225 gene locus_tag LOCUS_33790 4013 3225 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208134.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33790 <5937 4590 gene locus_tag LOCUS_33800 <5937 4590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000854472.1:PTS fructose transporter subunit IIBC >Feature sequence263 2099 201 gene locus_tag LOCUS_33810 2099 201 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_33810 2330 2647 gene locus_tag LOCUS_33820 2330 2647 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 protein_id gnl|my_center|LOCUS_33820 2663 3931 gene locus_tag LOCUS_33830 2663 3931 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245438.1 protein_id gnl|my_center|LOCUS_33830 3971 4306 gene locus_tag LOCUS_33840 3971 4306 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439961.1 protein_id gnl|my_center|LOCUS_33840 4290 5735 gene locus_tag LOCUS_33850 4290 5735 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674121.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence264 1388 63 gene locus_tag LOCUS_33860 gene zraR 1388 63 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148503.1 protein_id gnl|my_center|LOCUS_33860 2761 1385 gene locus_tag LOCUS_33870 gene zraS 2761 1385 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211931.1 protein_id gnl|my_center|LOCUS_33870 2999 3424 gene locus_tag LOCUS_33880 2999 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 4061 3426 gene locus_tag LOCUS_33890 4061 3426 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299291.1 protein_id gnl|my_center|LOCUS_33890 4406 4134 gene locus_tag LOCUS_33900 gene hupA 4406 4134 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 protein_id gnl|my_center|LOCUS_33900 5183 4593 gene locus_tag LOCUS_33910 5183 4593 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 protein_id gnl|my_center|LOCUS_33910 <5901 5226 gene locus_tag LOCUS_33920 <5901 5226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000362388.1:deoxyribonuclease V >Feature sequence265 389 1654 gene locus_tag LOCUS_33930 gene puuE 389 1654 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069229.1 protein_id gnl|my_center|LOCUS_33930 2751 1774 gene locus_tag LOCUS_33940 gene pspF 2751 1774 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852835.1 protein_id gnl|my_center|LOCUS_33940 2918 3586 gene locus_tag LOCUS_33950 gene pspA 2918 3586 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511025.1 protein_id gnl|my_center|LOCUS_33950 3640 3864 gene locus_tag LOCUS_33960 gene pspB 3640 3864 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274963.1 protein_id gnl|my_center|LOCUS_33960 3864 4223 gene locus_tag LOCUS_33970 gene pspC 3864 4223 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907387.1 protein_id gnl|my_center|LOCUS_33970 4232 4453 gene locus_tag LOCUS_33980 gene pspD 4232 4453 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 protein_id gnl|my_center|LOCUS_33980 4528 4842 gene locus_tag LOCUS_33990 gene pspE 4528 4842 CDS product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473109.1 protein_id gnl|my_center|LOCUS_33990 >Feature sequence266 >Feature sequence267 439 14 gene locus_tag LOCUS_34000 gene arsC 439 14 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 protein_id gnl|my_center|LOCUS_34000 1741 452 gene locus_tag LOCUS_34010 gene arsB 1741 452 CDS product arsenite/antimonite:H(+) antiporter ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922639.1 protein_id gnl|my_center|LOCUS_34010 2148 1795 gene locus_tag LOCUS_34020 gene arsR 2148 1795 CDS product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008957.1 protein_id gnl|my_center|LOCUS_34020 2860 2687 gene locus_tag LOCUS_34030 2860 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004976829.1 protein_id gnl|my_center|LOCUS_34030 2822 2971 gene locus_tag LOCUS_34040 2822 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 4377 3025 gene locus_tag LOCUS_34050 gene gorA 4377 3025 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160808.1 protein_id gnl|my_center|LOCUS_34050 5291 4449 gene locus_tag LOCUS_34060 gene rlmJ 5291 4449 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954225.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence268 1575 499 gene locus_tag LOCUS_34070 1575 499 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065024.1 protein_id gnl|my_center|LOCUS_34070 1852 1694 gene locus_tag LOCUS_34080 1852 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 1883 3805 gene locus_tag LOCUS_34090 1883 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 4507 4929 gene locus_tag LOCUS_34100 4507 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 4926 5264 gene locus_tag LOCUS_34110 4926 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence269 2042 207 gene locus_tag LOCUS_34120 gene recQ 2042 207 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 protein_id gnl|my_center|LOCUS_34120 3038 2169 gene locus_tag LOCUS_34130 gene pldA 3038 2169 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 protein_id gnl|my_center|LOCUS_34130 3203 3670 gene locus_tag LOCUS_34140 gene yigI 3203 3670 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 protein_id gnl|my_center|LOCUS_34140 3722 4612 gene locus_tag LOCUS_34150 gene rarD 3722 4612 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339104.1 protein_id gnl|my_center|LOCUS_34150 5101 5481 gene locus_tag LOCUS_34160 5101 5481 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032581.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence270 1410 535 gene locus_tag LOCUS_34170 gene cysW 1410 535 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852686.1 protein_id gnl|my_center|LOCUS_34170 2243 1410 gene locus_tag LOCUS_34180 gene cysT 2243 1410 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458406.1 protein_id gnl|my_center|LOCUS_34180 3259 2243 gene locus_tag LOCUS_34190 gene cysP 3259 2243 CDS product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290236.1 protein_id gnl|my_center|LOCUS_34190 4354 3563 gene locus_tag LOCUS_34200 gene ucpA 4354 3563 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517443.1 protein_id gnl|my_center|LOCUS_34200 5340 4483 gene locus_tag LOCUS_34210 gene murR 5340 4483 CDS product HTH-type transcriptional regulator MurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966443.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence271 786 247 gene locus_tag LOCUS_34220 786 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 1328 783 gene locus_tag LOCUS_34230 1328 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 1703 1392 gene locus_tag LOCUS_34240 1703 1392 CDS product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211280.1 protein_id gnl|my_center|LOCUS_34240 2667 1708 gene locus_tag LOCUS_34250 2667 1708 CDS product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686540.1 protein_id gnl|my_center|LOCUS_34250 5566 2744 gene locus_tag LOCUS_34260 5566 2744 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123463.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence272 791 624 gene locus_tag LOCUS_34270 791 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34270 1207 2478 gene locus_tag LOCUS_34280 1207 2478 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295225.1 protein_id gnl|my_center|LOCUS_34280 3512 2508 gene locus_tag LOCUS_34290 gene dppF 3512 2508 CDS product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107012.1 protein_id gnl|my_center|LOCUS_34290 4492 3509 gene locus_tag LOCUS_34300 gene dppD 4492 3509 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 protein_id gnl|my_center|LOCUS_34300 5405 4503 gene locus_tag LOCUS_34310 gene dppC 5405 4503 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence273 1551 328 gene locus_tag LOCUS_34320 gene deoB 1551 328 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 protein_id gnl|my_center|LOCUS_34320 2925 1603 gene locus_tag LOCUS_34330 gene deoA 2925 1603 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477811.1 protein_id gnl|my_center|LOCUS_34330 3831 3052 gene locus_tag LOCUS_34340 gene deoC 3831 3052 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 protein_id gnl|my_center|LOCUS_34340 4089 5639 gene locus_tag LOCUS_34350 4089 5639 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence274 1734 1129 gene locus_tag LOCUS_34360 gene ttdB 1734 1129 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 protein_id gnl|my_center|LOCUS_34360 2642 1731 gene locus_tag LOCUS_34370 gene ttdA 2642 1731 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986803.1 protein_id gnl|my_center|LOCUS_34370 2849 3781 gene locus_tag LOCUS_34380 gene ttdR 2849 3781 CDS product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 protein_id gnl|my_center|LOCUS_34380 4411 3794 gene locus_tag LOCUS_34390 gene plsY 4411 3794 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 protein_id gnl|my_center|LOCUS_34390 4513 4884 gene locus_tag LOCUS_34400 gene folB 4513 4884 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence275 456 668 gene locus_tag LOCUS_34410 gene ybcJ 456 668 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 protein_id gnl|my_center|LOCUS_34410 776 1297 gene locus_tag LOCUS_34420 776 1297 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143542.1 protein_id gnl|my_center|LOCUS_34420 2718 1333 gene locus_tag LOCUS_34430 gene cysS 2718 1333 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912345.1 protein_id gnl|my_center|LOCUS_34430 2892 3386 gene locus_tag LOCUS_34440 gene ppiB 2892 3386 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255997.1 protein_id gnl|my_center|LOCUS_34440 3389 4111 gene locus_tag LOCUS_34450 gene lpxH 3389 4111 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212237.1 protein_id gnl|my_center|LOCUS_34450 4229 4738 gene locus_tag LOCUS_34460 gene purE 4229 4738 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295318.1 protein_id gnl|my_center|LOCUS_34460 >Feature sequence276 2654 1314 gene locus_tag LOCUS_34470 gene dcuB 2654 1314 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 protein_id gnl|my_center|LOCUS_34470 3944 3225 gene locus_tag LOCUS_34480 gene dcuR 3944 3225 CDS product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 protein_id gnl|my_center|LOCUS_34480 5479 3941 gene locus_tag LOCUS_34490 5479 3941 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216477.1 protein_id gnl|my_center|LOCUS_34490 5591 5436 gene locus_tag LOCUS_34500 5591 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence277 2458 1211 gene locus_tag LOCUS_34510 2458 1211 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681219.1 protein_id gnl|my_center|LOCUS_34510 3366 2668 gene locus_tag LOCUS_34520 3366 2668 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681221.1 protein_id gnl|my_center|LOCUS_34520 3969 3367 gene locus_tag LOCUS_34530 3969 3367 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666370.1 protein_id gnl|my_center|LOCUS_34530 4660 4046 gene locus_tag LOCUS_34540 4660 4046 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_34540 4763 4572 gene locus_tag LOCUS_34550 4763 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 5177 4950 gene locus_tag LOCUS_34560 5177 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 5441 5292 gene locus_tag LOCUS_34570 5441 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence278 547 1482 gene locus_tag LOCUS_34580 gene rihA 547 1482 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207503.1 protein_id gnl|my_center|LOCUS_34580 1566 3236 gene locus_tag LOCUS_34590 gene hscC 1566 3236 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 protein_id gnl|my_center|LOCUS_34590 4747 3296 gene locus_tag LOCUS_34600 gene djlC 4747 3296 CDS product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 protein_id gnl|my_center|LOCUS_34600 5451 4744 gene locus_tag LOCUS_34610 5451 4744 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030930.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence279 1555 140 gene locus_tag LOCUS_34620 1555 140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130850.1 protein_id gnl|my_center|LOCUS_34620 4633 1556 gene locus_tag LOCUS_34630 gene mdtC 4633 1556 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667481.1 protein_id gnl|my_center|LOCUS_34630 <5670 4634 gene locus_tag LOCUS_34640 <5670 4634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001197857.1:multidrug efflux RND transporter permease subunit MdtB >Feature sequence280 965 1141 gene locus_tag LOCUS_34650 965 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 1089 2126 gene locus_tag LOCUS_34660 1089 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34660 2340 2558 gene locus_tag LOCUS_34670 2340 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3119 2619 gene locus_tag LOCUS_34680 3119 2619 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117611.1 protein_id gnl|my_center|LOCUS_34680 3245 3415 gene locus_tag LOCUS_34690 3245 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 4179 3583 gene locus_tag LOCUS_34700 4179 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977995.1 protein_id gnl|my_center|LOCUS_34700 4895 4176 gene locus_tag LOCUS_34710 4895 4176 CDS product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276270.1 protein_id gnl|my_center|LOCUS_34710 5326 4892 gene locus_tag LOCUS_34720 gene psiB 5326 4892 CDS product conjugation system SOS inhibitor PsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845936.1 protein_id gnl|my_center|LOCUS_34720 5632 5381 gene locus_tag LOCUS_34730 5632 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence281 88 1494 gene locus_tag LOCUS_34740 gene gndA 88 1494 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043483.1 protein_id gnl|my_center|LOCUS_34740 1743 2909 gene locus_tag LOCUS_34750 gene ugd 1743 2909 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704855.1 protein_id gnl|my_center|LOCUS_34750 3056 4033 gene locus_tag LOCUS_34760 gene wzzB 3056 4033 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001553141.1 protein_id gnl|my_center|LOCUS_34760 4740 4129 gene locus_tag LOCUS_34770 gene hisIE 4740 4129 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954872.1 protein_id gnl|my_center|LOCUS_34770 5510 4734 gene locus_tag LOCUS_34780 gene hisF 5510 4734 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence282 1224 685 gene locus_tag LOCUS_34790 gene hyfH 1224 685 CDS product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916082.1 protein_id gnl|my_center|LOCUS_34790 2901 1234 gene locus_tag LOCUS_34800 gene hyfG 2901 1234 CDS product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102321.1 protein_id gnl|my_center|LOCUS_34800 4471 2891 gene locus_tag LOCUS_34810 gene hyfF 4471 2891 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122577.1 protein_id gnl|my_center|LOCUS_34810 5126 4476 gene locus_tag LOCUS_34820 gene hyfE 5126 4476 CDS product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147991.1 protein_id gnl|my_center|LOCUS_34820 >Feature sequence283 587 859 gene locus_tag LOCUS_34830 gene rcnR 587 859 CDS product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019944.1 protein_id gnl|my_center|LOCUS_34830 1082 1870 gene locus_tag LOCUS_34840 gene thiM 1082 1870 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195577.1 protein_id gnl|my_center|LOCUS_34840 1867 2667 gene locus_tag LOCUS_34850 gene thiD 1867 2667 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822274.1 protein_id gnl|my_center|LOCUS_34850 2732 3550 gene locus_tag LOCUS_34860 2732 3550 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297420.1 protein_id gnl|my_center|LOCUS_34860 3602 4348 gene locus_tag LOCUS_34870 3602 4348 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434038.1 protein_id gnl|my_center|LOCUS_34870 5287 4322 gene locus_tag LOCUS_34880 5287 4322 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012008.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence284 205 1290 gene locus_tag LOCUS_34890 205 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34890 1626 2603 gene locus_tag LOCUS_34900 gene glaH 1626 2603 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993114.1 protein_id gnl|my_center|LOCUS_34900 2623 3891 gene locus_tag LOCUS_34910 gene lhgO 2623 3891 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271909.1 protein_id gnl|my_center|LOCUS_34910 3914 5362 gene locus_tag LOCUS_34920 gene gabD 3914 5362 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772689.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence285 1062 253 gene locus_tag LOCUS_34930 gene rlmA 1062 253 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010115.1 protein_id gnl|my_center|LOCUS_34930 1437 1228 gene locus_tag LOCUS_34940 gene cspE 1437 1228 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_34940 2549 2262 gene locus_tag LOCUS_34950 2549 2262 CDS product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006866.1 protein_id gnl|my_center|LOCUS_34950 2926 3165 gene locus_tag LOCUS_34960 2926 3165 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211011.1 protein_id gnl|my_center|LOCUS_34960 4099 3308 gene locus_tag LOCUS_34970 gene kdgR 4099 3308 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262182.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence286 174 2432 gene locus_tag LOCUS_34980 gene parC 174 2432 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 protein_id gnl|my_center|LOCUS_34980 2665 3402 gene locus_tag LOCUS_34990 gene plsC 2665 3402 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 protein_id gnl|my_center|LOCUS_34990 3477 4889 gene locus_tag LOCUS_35000 gene ftsP 3477 4889 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059395.1 protein_id gnl|my_center|LOCUS_35000 >Feature sequence287 393 1178 gene locus_tag LOCUS_35010 gene frlD 393 1178 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853351.1 protein_id gnl|my_center|LOCUS_35010 1278 2009 gene locus_tag LOCUS_35020 gene frlR 1278 2009 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 protein_id gnl|my_center|LOCUS_35020 3246 2161 gene locus_tag LOCUS_35030 3246 2161 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 protein_id gnl|my_center|LOCUS_35030 4433 3258 gene locus_tag LOCUS_35040 4433 3258 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366832.1 protein_id gnl|my_center|LOCUS_35040 4562 4434 gene locus_tag LOCUS_35050 4562 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35050 4927 4574 gene locus_tag LOCUS_35060 4927 4574 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719728.1 protein_id gnl|my_center|LOCUS_35060 <5486 4938 gene locus_tag LOCUS_35070 <5486 4938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000006973.1:phosphotriesterase-related protein >Feature sequence288 518 1519 gene locus_tag LOCUS_35080 gene add 518 1519 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567490.1 protein_id gnl|my_center|LOCUS_35080 2594 1554 gene locus_tag LOCUS_35090 2594 1554 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300538.1 protein_id gnl|my_center|LOCUS_35090 3235 3450 gene locus_tag LOCUS_35100 gene ydgT 3235 3450 CDS product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 protein_id gnl|my_center|LOCUS_35100 3536 3976 gene locus_tag LOCUS_35110 3536 3976 CDS product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214176.1 protein_id gnl|my_center|LOCUS_35110 4053 4634 gene locus_tag LOCUS_35120 gene rsxA 4053 4634 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133193.1 protein_id gnl|my_center|LOCUS_35120 4634 5212 gene locus_tag LOCUS_35130 gene rsxB 4634 5212 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991809.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence289 106 2757 gene locus_tag LOCUS_35140 gene ppc 106 2757 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005586.1 protein_id gnl|my_center|LOCUS_35140 2940 4673 gene locus_tag LOCUS_35150 2940 4673 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556273.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence290 <1 750 gene locus_tag LOCUS_35160 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000561872.1:ABC transporter permease 2558 1464 gene locus_tag LOCUS_35170 gene mnmH 2558 1464 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157938.1 protein_id gnl|my_center|LOCUS_35170 3553 2627 gene locus_tag LOCUS_35180 gene allS 3553 2627 CDS product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460145.1 protein_id gnl|my_center|LOCUS_35180 3783 4265 gene locus_tag LOCUS_35190 gene allA 3783 4265 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 protein_id gnl|my_center|LOCUS_35190 4343 5158 gene locus_tag LOCUS_35200 gene allR 4343 5158 CDS product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence291 <1 5183 gene locus_tag LOCUS_35210 <1 5183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014640143.1:autotransporter outer membrane protein >Feature sequence292 1459 770 gene locus_tag LOCUS_35220 gene trmH 1459 770 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 protein_id gnl|my_center|LOCUS_35220 3574 1466 gene locus_tag LOCUS_35230 gene spoT 3574 1466 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 protein_id gnl|my_center|LOCUS_35230 3868 3593 gene locus_tag LOCUS_35240 gene rpoZ 3868 3593 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_35240 4546 3923 gene locus_tag LOCUS_35250 gene gmk 4546 3923 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence293 468 1091 gene locus_tag LOCUS_35260 gene nfeR 468 1091 CDS product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018003.1 protein_id gnl|my_center|LOCUS_35260 2765 1245 gene locus_tag LOCUS_35270 gene aer 2765 1245 CDS product aerotaxis sensor receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094721.1 protein_id gnl|my_center|LOCUS_35270 3273 4562 gene locus_tag LOCUS_35280 gene ygjG 3273 4562 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301395.1 protein_id gnl|my_center|LOCUS_35280 4936 4604 gene locus_tag LOCUS_35290 4936 4604 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450594.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence294 1056 1739 gene locus_tag LOCUS_35300 gene cusR 1056 1739 CDS product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 protein_id gnl|my_center|LOCUS_35300 1729 3177 gene locus_tag LOCUS_35310 gene cusS 1729 3177 CDS product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253826.1 protein_id gnl|my_center|LOCUS_35310 >Feature sequence295 1058 1801 gene locus_tag LOCUS_35320 gene ybgI 1058 1801 CDS product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798871.1 protein_id gnl|my_center|LOCUS_35320 1824 2480 gene locus_tag LOCUS_35330 gene pxpB 1824 2480 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188343.1 protein_id gnl|my_center|LOCUS_35330 2474 3406 gene locus_tag LOCUS_35340 gene pxpC 2474 3406 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912736.1 protein_id gnl|my_center|LOCUS_35340 3396 4130 gene locus_tag LOCUS_35350 gene pxpA 3396 4130 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687142.1 protein_id gnl|my_center|LOCUS_35350 4166 4957 gene locus_tag LOCUS_35360 gene nei 4166 4957 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114006.1 protein_id gnl|my_center|LOCUS_35360 >Feature sequence296 1914 853 gene locus_tag LOCUS_35370 1914 853 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272420.1 protein_id gnl|my_center|LOCUS_35370 2642 1911 gene locus_tag LOCUS_35380 2642 1911 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143529.1 protein_id gnl|my_center|LOCUS_35380 5116 2657 gene locus_tag LOCUS_35390 5116 2657 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316936.1 protein_id gnl|my_center|LOCUS_35390 >Feature sequence297 817 1017 gene locus_tag LOCUS_35400 817 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 1142 5044 gene locus_tag LOCUS_35410 1142 5044 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766976.1 protein_id gnl|my_center|LOCUS_35410 >Feature sequence298 724 443 gene locus_tag LOCUS_35420 gene traQ 724 443 CDS product type-F conjugative transfer system pilin chaperone TraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624107.1 protein_id gnl|my_center|LOCUS_35420 1592 849 gene locus_tag LOCUS_35430 gene traF 1592 849 CDS product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030371.1 protein_id gnl|my_center|LOCUS_35430 1842 1585 gene locus_tag LOCUS_35440 1842 1585 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864353.1 protein_id gnl|my_center|LOCUS_35440 3677 1869 gene locus_tag LOCUS_35450 gene traN 3677 1869 CDS product type-F conjugative transfer system mating-pair stabilization protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821859.1 protein_id gnl|my_center|LOCUS_35450 4096 3674 gene locus_tag LOCUS_35460 4096 3674 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149288330.1 protein_id gnl|my_center|LOCUS_35460 4492 4121 gene locus_tag LOCUS_35470 4492 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 5130 4489 gene locus_tag LOCUS_35480 gene trbC 5130 4489 CDS product type-F conjugative transfer system pilin assembly protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080256.1 protein_id gnl|my_center|LOCUS_35480 >Feature sequence299 1175 2518 gene locus_tag LOCUS_35490 1175 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247490.1 protein_id gnl|my_center|LOCUS_35490 4174 2666 gene locus_tag LOCUS_35500 gene putP 4174 2666 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018485.1 protein_id gnl|my_center|LOCUS_35500 4485 4333 gene locus_tag LOCUS_35510 4485 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence300 316 1542 gene locus_tag LOCUS_35520 gene eutH 316 1542 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512372.1 protein_id gnl|my_center|LOCUS_35520 1539 2942 gene locus_tag LOCUS_35530 gene eutA 1539 2942 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097464.1 protein_id gnl|my_center|LOCUS_35530 2954 4315 gene locus_tag LOCUS_35540 gene eutB 2954 4315 CDS product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769961.1 protein_id gnl|my_center|LOCUS_35540 4336 5223 gene locus_tag LOCUS_35550 gene eutC 4336 5223 CDS product ethanolamine ammonia-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372321.1 protein_id gnl|my_center|LOCUS_35550 >Feature sequence301 1958 1062 gene locus_tag LOCUS_35560 1958 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35560 2494 1958 gene locus_tag LOCUS_35570 2494 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35570 3517 2570 gene locus_tag LOCUS_35580 3517 2570 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723652.1 protein_id gnl|my_center|LOCUS_35580 3806 4759 gene locus_tag LOCUS_35590 3806 4759 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679972.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence302 134 547 gene locus_tag LOCUS_35600 134 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 1911 661 gene locus_tag LOCUS_35610 gene icd 1911 661 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444487.1 protein_id gnl|my_center|LOCUS_35610 2203 2736 gene locus_tag LOCUS_35620 gene rluE 2203 2736 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248691.1 protein_id gnl|my_center|LOCUS_35620 2746 3207 gene locus_tag LOCUS_35630 gene nudJ 2746 3207 CDS product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476093.1 protein_id gnl|my_center|LOCUS_35630 3216 4367 gene locus_tag LOCUS_35640 3216 4367 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297484.1 protein_id gnl|my_center|LOCUS_35640 4403 5044 gene locus_tag LOCUS_35650 gene hflD 4403 5044 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence303 1977 799 gene locus_tag LOCUS_35660 gene hybB 1977 799 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 protein_id gnl|my_center|LOCUS_35660 2953 1967 gene locus_tag LOCUS_35670 gene hybA 2953 1967 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 protein_id gnl|my_center|LOCUS_35670 4074 2956 gene locus_tag LOCUS_35680 gene hybO 4074 2956 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 protein_id gnl|my_center|LOCUS_35680 4550 4263 gene locus_tag LOCUS_35690 gene yghW 4550 4263 CDS product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059136.1 protein_id gnl|my_center|LOCUS_35690 5253 4669 gene locus_tag LOCUS_35700 5253 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence304 <1 1056 gene locus_tag LOCUS_35710 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000138717.1:YcjF family protein 1204 2745 gene locus_tag LOCUS_35720 gene tyrR 1204 2745 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300658.1 protein_id gnl|my_center|LOCUS_35720 3295 2789 gene locus_tag LOCUS_35730 gene tpx 3295 2789 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 protein_id gnl|my_center|LOCUS_35730 3414 4379 gene locus_tag LOCUS_35740 gene ycjG 3414 4379 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324049.1 protein_id gnl|my_center|LOCUS_35740 5010 4354 gene locus_tag LOCUS_35750 gene mpaA 5010 4354 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219122.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence305 418 846 gene locus_tag LOCUS_35760 gene uspG 418 846 CDS product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278505.1 protein_id gnl|my_center|LOCUS_35760 2532 967 gene locus_tag LOCUS_35770 gene ahpF 2532 967 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887629.1 protein_id gnl|my_center|LOCUS_35770 3340 2777 gene locus_tag LOCUS_35780 gene ahpC 3340 2777 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052796.1 protein_id gnl|my_center|LOCUS_35780 3712 4458 gene locus_tag LOCUS_35790 gene dsbG 3712 4458 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913829.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence306 669 97 gene locus_tag LOCUS_35800 gene yeiP 669 97 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 protein_id gnl|my_center|LOCUS_35800 824 1078 gene locus_tag LOCUS_35810 824 1078 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389030.1 protein_id gnl|my_center|LOCUS_35810 2256 1075 gene locus_tag LOCUS_35820 gene setB 2256 1075 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551977.1 protein_id gnl|my_center|LOCUS_35820 2624 3754 gene locus_tag LOCUS_35830 gene fruB 2624 3754 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487246.1 protein_id gnl|my_center|LOCUS_35830 3754 4692 gene locus_tag LOCUS_35840 gene fruK 3754 4692 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091263.1 protein_id gnl|my_center|LOCUS_35840 >Feature sequence307 1169 1810 gene locus_tag LOCUS_35850 gene udk 1169 1810 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295424.1 protein_id gnl|my_center|LOCUS_35850 1902 2483 gene locus_tag LOCUS_35860 gene dcd 1902 2483 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234767.1 protein_id gnl|my_center|LOCUS_35860 2505 4358 gene locus_tag LOCUS_35870 gene asmA 2505 4358 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252331.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence308 2404 326 gene locus_tag LOCUS_35880 gene flhA 2404 326 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066983.1 protein_id gnl|my_center|LOCUS_35880 3545 2397 gene locus_tag LOCUS_35890 gene flhB 3545 2397 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278954.1 protein_id gnl|my_center|LOCUS_35890 4396 3752 gene locus_tag LOCUS_35900 gene cheZ 4396 3752 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983609.1 protein_id gnl|my_center|LOCUS_35900 4796 4407 gene locus_tag LOCUS_35910 gene cheY 4796 4407 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763867.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence309 554 994 gene locus_tag LOCUS_35920 554 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 1142 3145 gene locus_tag LOCUS_35930 gene betT 1142 3145 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 protein_id gnl|my_center|LOCUS_35930 3208 4485 gene locus_tag LOCUS_35940 3208 4485 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 protein_id gnl|my_center|LOCUS_35940 4733 5035 gene locus_tag LOCUS_35950 4733 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence310 1554 2885 gene locus_tag LOCUS_35960 gene pepQ 1554 2885 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 protein_id gnl|my_center|LOCUS_35960 2882 3499 gene locus_tag LOCUS_35970 2882 3499 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295262.1 protein_id gnl|my_center|LOCUS_35970 3538 4989 gene locus_tag LOCUS_35980 gene trkH 3538 4989 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence311 1134 367 gene locus_tag LOCUS_35990 gene livG 1134 367 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 protein_id gnl|my_center|LOCUS_35990 2408 1131 gene locus_tag LOCUS_36000 gene livM 2408 1131 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803797.1 protein_id gnl|my_center|LOCUS_36000 3331 2405 gene locus_tag LOCUS_36010 gene livH 3331 2405 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 protein_id gnl|my_center|LOCUS_36010 4488 3379 gene locus_tag LOCUS_36020 gene livK 4488 3379 CDS product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence312 1960 1274 gene locus_tag LOCUS_36030 1960 1274 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223164.1 protein_id gnl|my_center|LOCUS_36030 2596 3312 gene locus_tag LOCUS_36040 gene arcA 2596 3312 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 protein_id gnl|my_center|LOCUS_36040 4724 3372 gene locus_tag LOCUS_36050 gene creD 4724 3372 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920350.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence313 3160 287 gene locus_tag LOCUS_36060 gene gcvP 3160 287 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195009.1 protein_id gnl|my_center|LOCUS_36060 3668 3279 gene locus_tag LOCUS_36070 gene gcvH 3668 3279 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 protein_id gnl|my_center|LOCUS_36070 4786 3692 gene locus_tag LOCUS_36080 gene gcvT 4786 3692 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 protein_id gnl|my_center|LOCUS_36080 >Feature sequence314 577 236 gene locus_tag LOCUS_36090 577 236 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323846.1 protein_id gnl|my_center|LOCUS_36090 1457 579 gene locus_tag LOCUS_36100 1457 579 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204139.1 protein_id gnl|my_center|LOCUS_36100 3720 1423 gene locus_tag LOCUS_36110 3720 1423 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 protein_id gnl|my_center|LOCUS_36110 4091 3771 gene locus_tag LOCUS_36120 4091 3771 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_36120 <4951 4106 gene locus_tag LOCUS_36130 <4951 4106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001004434.1:PTS fructose transporter subunit EIIC >Feature sequence315 310 1368 gene locus_tag LOCUS_36140 310 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36140 >Feature sequence316 1308 1144 gene locus_tag LOCUS_36150 1308 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36150 2109 1420 gene locus_tag LOCUS_36160 2109 1420 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859648.1 protein_id gnl|my_center|LOCUS_36160 3665 2109 gene locus_tag LOCUS_36170 3665 2109 CDS product maltose/glucose-specific PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351184.1 protein_id gnl|my_center|LOCUS_36170 3832 4656 gene locus_tag LOCUS_36180 3832 4656 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114712.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence317 2070 1480 gene locus_tag LOCUS_36190 gene paaY 2070 1480 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123464.1 protein_id gnl|my_center|LOCUS_36190 3002 2052 gene locus_tag LOCUS_36200 gene paaX 3002 2052 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039887.1 protein_id gnl|my_center|LOCUS_36200 4416 3103 gene locus_tag LOCUS_36210 gene paaF 4416 3103 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632280.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence318 102 1040 gene locus_tag LOCUS_36220 gene tdcA 102 1040 CDS product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 protein_id gnl|my_center|LOCUS_36220 1139 2128 gene locus_tag LOCUS_36230 gene tdcB 1139 2128 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 protein_id gnl|my_center|LOCUS_36230 2150 3481 gene locus_tag LOCUS_36240 gene tdcC 2150 3481 CDS product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107723.1 protein_id gnl|my_center|LOCUS_36240 3507 4715 gene locus_tag LOCUS_36250 gene tdcD 3507 4715 CDS product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence319 472 1239 gene locus_tag LOCUS_36260 gene tauB 472 1239 CDS product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939375.1 protein_id gnl|my_center|LOCUS_36260 1236 2063 gene locus_tag LOCUS_36270 gene tauC 1236 2063 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114607.1 protein_id gnl|my_center|LOCUS_36270 2060 2911 gene locus_tag LOCUS_36280 gene tauD 2060 2911 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004024.1 protein_id gnl|my_center|LOCUS_36280 3991 3017 gene locus_tag LOCUS_36290 gene hemB 3991 3017 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence320 546 1076 gene locus_tag LOCUS_36300 546 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36300 1025 1483 gene locus_tag LOCUS_36310 1025 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36310 3137 1725 gene locus_tag LOCUS_36320 3137 1725 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199325.1 protein_id gnl|my_center|LOCUS_36320 3314 3478 gene locus_tag LOCUS_36330 3314 3478 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394276.1 protein_id gnl|my_center|LOCUS_36330 >Feature sequence321 478 236 gene locus_tag LOCUS_36340 478 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2626 977 gene locus_tag LOCUS_36350 gene pgi 2626 977 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 protein_id gnl|my_center|LOCUS_36350 3151 4500 gene locus_tag LOCUS_36360 gene lysC 3151 4500 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290310.1 protein_id gnl|my_center|LOCUS_36360 >Feature sequence322 799 557 gene locus_tag LOCUS_36370 gene cedA 799 557 CDS product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241561.1 protein_id gnl|my_center|LOCUS_36370 1003 3264 gene locus_tag LOCUS_36380 gene katE 1003 3264 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077872.1 protein_id gnl|my_center|LOCUS_36380 4280 3522 gene locus_tag LOCUS_36390 gene chbG 4280 3522 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440442.1 protein_id gnl|my_center|LOCUS_36390 <4850 4293 gene locus_tag LOCUS_36400 <4850 4293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000078722.1:6-phospho-beta-glucosidase >Feature sequence323 <1 693 gene locus_tag LOCUS_36410 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350523.1:L,D-transpeptidase 824 749 gene locus_tag LOCUS_t00520 824 749 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1151 2068 gene locus_tag LOCUS_36420 gene nac 1151 2068 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011462.1 protein_id gnl|my_center|LOCUS_36420 2170 3120 gene locus_tag LOCUS_36430 gene cbl 2170 3120 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011000.1 protein_id gnl|my_center|LOCUS_36430 3233 3158 gene locus_tag LOCUS_t00530 3233 3158 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence324 1376 240 gene locus_tag LOCUS_36440 gene hemW 1376 240 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239941.1 protein_id gnl|my_center|LOCUS_36440 1962 1369 gene locus_tag LOCUS_36450 1962 1369 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 protein_id gnl|my_center|LOCUS_36450 2260 1970 gene locus_tag LOCUS_36460 gene yggU 2260 1970 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994920.1 protein_id gnl|my_center|LOCUS_36460 2823 2257 gene locus_tag LOCUS_36470 gene yggT 2823 2257 CDS product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 protein_id gnl|my_center|LOCUS_36470 3545 2841 gene locus_tag LOCUS_36480 gene yggS 3545 2841 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 protein_id gnl|my_center|LOCUS_36480 3563 4543 gene locus_tag LOCUS_36490 3563 4543 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349546.1 protein_id gnl|my_center|LOCUS_36490 >Feature sequence325 2246 3091 gene locus_tag LOCUS_36500 gene sseA 2246 3091 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 protein_id gnl|my_center|LOCUS_36500 4361 3585 gene locus_tag LOCUS_36510 gene sseB 4361 3585 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence326 824 117 gene locus_tag LOCUS_36520 824 117 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367023.1 protein_id gnl|my_center|LOCUS_36520 989 1966 gene locus_tag LOCUS_36530 gene ybeQ 989 1966 CDS product Sel1 family TPR-like repeat protein YbeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605311.1 protein_id gnl|my_center|LOCUS_36530 2518 2036 gene locus_tag LOCUS_36540 2518 2036 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044880.1 protein_id gnl|my_center|LOCUS_36540 >Feature sequence327 <1 591 gene locus_tag LOCUS_36550 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001034469.1:lipoprotein metalloprotease SslE 886 1548 gene locus_tag LOCUS_36560 gene pppA 886 1548 CDS product prepilin peptidase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001365924.1 protein_id gnl|my_center|LOCUS_36560 1656 2024 gene locus_tag LOCUS_36570 gene gspS2 1656 2024 CDS product type II secretion system pilot lipoprotein GspS-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324279.1 protein_id gnl|my_center|LOCUS_36570 2183 3001 gene locus_tag LOCUS_36580 gene gspC 2183 3001 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317325.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence328 43 2523 gene locus_tag LOCUS_36590 43 2523 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945432.1 protein_id gnl|my_center|LOCUS_36590 2539 3573 gene locus_tag LOCUS_36600 2539 3573 CDS product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405711.1 protein_id gnl|my_center|LOCUS_36600 3993 3655 gene locus_tag LOCUS_36610 gene rcnB 3993 3655 CDS product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153067.1 protein_id gnl|my_center|LOCUS_36610 4511 4212 gene locus_tag LOCUS_36620 4511 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence329 19 873 gene locus_tag LOCUS_36630 gene gatY 19 873 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301486.1 protein_id gnl|my_center|LOCUS_36630 902 1057 gene locus_tag LOCUS_36640 902 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36640 1076 2164 gene locus_tag LOCUS_36650 gene gatZ 1076 2164 CDS product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853883.1 protein_id gnl|my_center|LOCUS_36650 2174 2626 gene locus_tag LOCUS_36660 gene gatA 2174 2626 CDS product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182904.1 protein_id gnl|my_center|LOCUS_36660 2657 2941 gene locus_tag LOCUS_36670 gene gatB 2657 2941 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823272.1 protein_id gnl|my_center|LOCUS_36670 2945 4300 gene locus_tag LOCUS_36680 2945 4300 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490679.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence330 201 1625 gene locus_tag LOCUS_36690 gene murP 201 1625 CDS product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040450.1 protein_id gnl|my_center|LOCUS_36690 1642 2934 gene locus_tag LOCUS_36700 gene pbp4b 1642 2934 CDS product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315775.1 protein_id gnl|my_center|LOCUS_36700 3891 2992 gene locus_tag LOCUS_36710 gene yfeX 3891 2992 CDS product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084590.1 protein_id gnl|my_center|LOCUS_36710 4562 3987 gene locus_tag LOCUS_36720 4562 3987 CDS product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838944.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence331 1026 1859 gene locus_tag LOCUS_36730 1026 1859 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303819.1 protein_id gnl|my_center|LOCUS_36730 1927 3018 gene locus_tag LOCUS_36740 gene lacI 1927 3018 CDS product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307621.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence332 >Feature sequence333 1227 340 gene locus_tag LOCUS_36750 1227 340 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566329.1 protein_id gnl|my_center|LOCUS_36750 1360 2370 gene locus_tag LOCUS_36760 1360 2370 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023619.1 protein_id gnl|my_center|LOCUS_36760 2390 3187 gene locus_tag LOCUS_36770 2390 3187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762716.1 protein_id gnl|my_center|LOCUS_36770 3213 3629 gene locus_tag LOCUS_36780 3213 3629 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140838.1 protein_id gnl|my_center|LOCUS_36780 4148 4273 gene locus_tag LOCUS_36790 4148 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314467.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence334 <1 1402 gene locus_tag LOCUS_36800 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000035619.1:DNA polymerase II 1567 4473 gene locus_tag LOCUS_36810 gene rapA 1567 4473 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence335 1 486 gene locus_tag LOCUS_36820 gene fumE 1 486 CDS product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224138.1 protein_id gnl|my_center|LOCUS_36820 483 1196 gene locus_tag LOCUS_36830 483 1196 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687768.1 protein_id gnl|my_center|LOCUS_36830 1845 1168 gene locus_tag LOCUS_36840 1845 1168 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956868.1 protein_id gnl|my_center|LOCUS_36840 2516 1839 gene locus_tag LOCUS_36850 2516 1839 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256969.1 protein_id gnl|my_center|LOCUS_36850 3211 2504 gene locus_tag LOCUS_36860 3211 2504 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553215.1 protein_id gnl|my_center|LOCUS_36860 3790 3212 gene locus_tag LOCUS_36870 3790 3212 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124312.1 protein_id gnl|my_center|LOCUS_36870 4244 3813 gene locus_tag LOCUS_36880 4244 3813 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988693.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence336 631 1404 gene locus_tag LOCUS_36890 gene zupT 631 1404 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295627.1 protein_id gnl|my_center|LOCUS_36890 1632 1462 gene locus_tag LOCUS_36900 gene yqiD 1632 1462 CDS product protein YqiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469266.1 protein_id gnl|my_center|LOCUS_36900 2547 1894 gene locus_tag LOCUS_36910 gene ribB 2547 1894 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 protein_id gnl|my_center|LOCUS_36910 2921 3211 gene locus_tag LOCUS_36920 gene ubiK 2921 3211 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222100.1 protein_id gnl|my_center|LOCUS_36920 3495 4046 gene locus_tag LOCUS_36930 3495 4046 CDS product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272153.1 protein_id gnl|my_center|LOCUS_36930 >Feature sequence337 1497 454 gene locus_tag LOCUS_36940 gene selD 1497 454 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295485.1 protein_id gnl|my_center|LOCUS_36940 2165 1614 gene locus_tag LOCUS_36950 2165 1614 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 protein_id gnl|my_center|LOCUS_36950 2326 4182 gene locus_tag LOCUS_36960 gene sppA 2326 4182 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259830.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence338 424 349 gene locus_tag LOCUS_t00540 424 349 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 505 431 gene locus_tag LOCUS_t00550 505 431 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 706 622 gene locus_tag LOCUS_t00560 706 622 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 790 715 gene locus_tag LOCUS_t00570 790 715 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1176 2102 gene locus_tag LOCUS_36970 gene coaA 1176 2102 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 protein_id gnl|my_center|LOCUS_36970 3096 2131 gene locus_tag LOCUS_36980 gene birA 3096 2131 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654614.1 protein_id gnl|my_center|LOCUS_36980 4121 3093 gene locus_tag LOCUS_36990 gene murB 4121 3093 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016672.1 protein_id gnl|my_center|LOCUS_36990 >Feature sequence339 141 614 gene locus_tag LOCUS_37000 141 614 CDS product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538176.1 protein_id gnl|my_center|LOCUS_37000 722 1261 gene locus_tag LOCUS_37010 gene dnaT 722 1261 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 protein_id gnl|my_center|LOCUS_37010 1264 2001 gene locus_tag LOCUS_37020 gene dnaC 1264 2001 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 protein_id gnl|my_center|LOCUS_37020 2050 2544 gene locus_tag LOCUS_37030 gene yjjA 2050 2544 CDS product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001385190.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence340 741 1673 gene locus_tag LOCUS_37040 gene glsA 741 1673 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883024.1 protein_id gnl|my_center|LOCUS_37040 1676 2968 gene locus_tag LOCUS_37050 1676 2968 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982172.1 protein_id gnl|my_center|LOCUS_37050 3093 3500 gene locus_tag LOCUS_37060 gene cueR 3093 3500 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 protein_id gnl|my_center|LOCUS_37060 3959 3501 gene locus_tag LOCUS_37070 3959 3501 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 protein_id gnl|my_center|LOCUS_37070 <4495 3956 gene locus_tag LOCUS_37080 <4495 3956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000904502.1:SPFH domain-containing protein >Feature sequence341 1237 2493 gene locus_tag LOCUS_37090 1237 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 2490 3839 gene locus_tag LOCUS_37100 2490 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 4052 4366 gene locus_tag LOCUS_37110 4052 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence342 <1 844 gene locus_tag LOCUS_37120 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000228535.1:DNA-protecting protein DprA 816 1289 gene locus_tag LOCUS_37130 gene smg 816 1289 CDS product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460672.1 protein_id gnl|my_center|LOCUS_37130 1318 1860 gene locus_tag LOCUS_37140 1318 1860 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129723.1 protein_id gnl|my_center|LOCUS_37140 1865 2437 gene locus_tag LOCUS_37150 gene tsaC 1865 2437 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297709.1 protein_id gnl|my_center|LOCUS_37150 2442 3260 gene locus_tag LOCUS_37160 gene aroE 2442 3260 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451211.1 protein_id gnl|my_center|LOCUS_37160 3257 3514 gene locus_tag LOCUS_37170 3257 3514 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 protein_id gnl|my_center|LOCUS_37170 4044 3490 gene locus_tag LOCUS_37180 4044 3490 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286216.1 protein_id gnl|my_center|LOCUS_37180 >Feature sequence343 1214 183 gene locus_tag LOCUS_37190 gene rsmC 1214 183 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 protein_id gnl|my_center|LOCUS_37190 1317 1730 gene locus_tag LOCUS_37200 gene holD 1317 1730 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204018.1 protein_id gnl|my_center|LOCUS_37200 1699 2145 gene locus_tag LOCUS_37210 gene rimI 1699 2145 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092460.1 protein_id gnl|my_center|LOCUS_37210 2160 2837 gene locus_tag LOCUS_37220 gene yjjG 2160 2837 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870712.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence344 2046 2576 gene locus_tag LOCUS_37230 gene thpR 2046 2576 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 protein_id gnl|my_center|LOCUS_37230 2591 3295 gene locus_tag LOCUS_37240 gene sfsA 2591 3295 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 protein_id gnl|my_center|LOCUS_37240 3473 3928 gene locus_tag LOCUS_37250 gene dksA 3473 3928 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_37250 >Feature sequence345 1646 2224 gene locus_tag LOCUS_37260 gene lpcA 1646 2224 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 protein_id gnl|my_center|LOCUS_37260 2430 3197 gene locus_tag LOCUS_37270 2430 3197 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333379.1 protein_id gnl|my_center|LOCUS_37270 3908 3168 gene locus_tag LOCUS_37280 gene dpaA 3908 3168 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 protein_id gnl|my_center|LOCUS_37280 4294 4154 gene locus_tag LOCUS_37290 4294 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence346 922 512 gene locus_tag LOCUS_37300 922 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846713.1 protein_id gnl|my_center|LOCUS_37300 1426 938 gene locus_tag LOCUS_37310 1426 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 2827 1757 gene locus_tag LOCUS_37320 2827 1757 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102643.1 protein_id gnl|my_center|LOCUS_37320 3729 2824 gene locus_tag LOCUS_37330 3729 2824 CDS product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203541.1 protein_id gnl|my_center|LOCUS_37330 <4422 3726 gene locus_tag LOCUS_37340 <4422 3726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000544732.1:dynamin family protein >Feature sequence347 1637 642 gene locus_tag LOCUS_37350 1637 642 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 protein_id gnl|my_center|LOCUS_37350 1846 2370 gene locus_tag LOCUS_37360 1846 2370 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 protein_id gnl|my_center|LOCUS_37360 2364 2867 gene locus_tag LOCUS_37370 2364 2867 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 protein_id gnl|my_center|LOCUS_37370 3156 2854 gene locus_tag LOCUS_37380 gene yhbQ 3156 2854 CDS product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189314.1 protein_id gnl|my_center|LOCUS_37380 3207 3650 gene locus_tag LOCUS_37390 3207 3650 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 protein_id gnl|my_center|LOCUS_37390 4148 3630 gene locus_tag LOCUS_37400 gene yhbO 4148 3630 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence348 <1 657 gene locus_tag LOCUS_37410 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295303.1:adenosylmethionine--8-amino-7-oxononanoate transaminase 716 1192 gene locus_tag LOCUS_37420 716 1192 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767389.1 protein_id gnl|my_center|LOCUS_37420 1344 2627 gene locus_tag LOCUS_37430 1344 2627 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091569.1 protein_id gnl|my_center|LOCUS_37430 <4342 2861 gene locus_tag LOCUS_37440 <4342 2861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000593938.1:hydratase >Feature sequence349 18 992 gene locus_tag LOCUS_37450 gene yajO 18 992 CDS product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199800.1 protein_id gnl|my_center|LOCUS_37450 1555 1046 gene locus_tag LOCUS_37460 gene pgpA 1555 1046 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154044.1 protein_id gnl|my_center|LOCUS_37460 2519 1542 gene locus_tag LOCUS_37470 gene thiL 2519 1542 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 protein_id gnl|my_center|LOCUS_37470 3016 2597 gene locus_tag LOCUS_37480 gene nusB 3016 2597 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 protein_id gnl|my_center|LOCUS_37480 3506 3036 gene locus_tag LOCUS_37490 gene ribE 3506 3036 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 protein_id gnl|my_center|LOCUS_37490 4320 3595 gene locus_tag LOCUS_37500 4320 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence350 2515 1163 gene locus_tag LOCUS_37510 gene rseP 2515 1163 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 protein_id gnl|my_center|LOCUS_37510 3384 2527 gene locus_tag LOCUS_37520 gene cdsA 3384 2527 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 protein_id gnl|my_center|LOCUS_37520 4155 3397 gene locus_tag LOCUS_37530 gene ispU 4155 3397 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979579.1 protein_id gnl|my_center|LOCUS_37530 >Feature sequence351 1094 144 gene locus_tag LOCUS_37540 1094 144 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_37540 1292 1152 gene locus_tag LOCUS_37550 1292 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 2012 1413 gene locus_tag LOCUS_37560 2012 1413 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 protein_id gnl|my_center|LOCUS_37560 2864 2163 gene locus_tag LOCUS_37570 2864 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 3649 2861 gene locus_tag LOCUS_37580 3649 2861 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_37580 <4312 3734 gene locus_tag LOCUS_37590 <4312 3734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291702.1:class I SAM-dependent methyltransferase >Feature sequence352 29 139 gene locus_tag LOCUS_r00010 29 139 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 700 257 gene locus_tag LOCUS_37600 700 257 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236960.1 protein_id gnl|my_center|LOCUS_37600 857 1786 gene locus_tag LOCUS_37610 gene metA 857 1786 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122789.1 protein_id gnl|my_center|LOCUS_37610 2055 3656 gene locus_tag LOCUS_37620 gene aceB 2055 3656 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138870.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence353 756 1295 gene locus_tag LOCUS_37630 756 1295 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026744.1 protein_id gnl|my_center|LOCUS_37630 1372 2055 gene locus_tag LOCUS_37640 1372 2055 CDS product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183040.1 protein_id gnl|my_center|LOCUS_37640 2134 3120 gene locus_tag LOCUS_37650 2134 3120 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456357.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence354 2585 288 gene locus_tag LOCUS_37660 gene bglX 2585 288 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871517.1 protein_id gnl|my_center|LOCUS_37660 >Feature sequence355 520 1167 gene locus_tag LOCUS_37670 gene gpmB 520 1167 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 protein_id gnl|my_center|LOCUS_37670 2033 1164 gene locus_tag LOCUS_37680 gene robA 2033 1164 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 protein_id gnl|my_center|LOCUS_37680 2244 2717 gene locus_tag LOCUS_37690 gene creA 2244 2717 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 protein_id gnl|my_center|LOCUS_37690 2730 3419 gene locus_tag LOCUS_37700 gene creB 2730 3419 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188679.1 protein_id gnl|my_center|LOCUS_37700 >Feature sequence356 2146 296 gene locus_tag LOCUS_37710 gene ilvD 2146 296 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 protein_id gnl|my_center|LOCUS_37710 3140 2211 gene locus_tag LOCUS_37720 gene ilvE 3140 2211 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 protein_id gnl|my_center|LOCUS_37720 3423 3160 gene locus_tag LOCUS_37730 gene ilvM 3423 3160 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 protein_id gnl|my_center|LOCUS_37730 <4256 3420 gene locus_tag LOCUS_37740 <4256 3420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001012613.1:acetolactate synthase 2 catalytic subunit >Feature sequence357 1773 67 gene locus_tag LOCUS_37750 1773 67 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079698.1 protein_id gnl|my_center|LOCUS_37750 2039 3445 gene locus_tag LOCUS_37760 gene fliD 2039 3445 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 protein_id gnl|my_center|LOCUS_37760 3470 3880 gene locus_tag LOCUS_37770 gene fliS 3470 3880 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270663.1 protein_id gnl|my_center|LOCUS_37770 >Feature sequence358 1139 57 gene locus_tag LOCUS_37780 gene lptG 1139 57 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 protein_id gnl|my_center|LOCUS_37780 2218 1139 gene locus_tag LOCUS_37790 gene lptF 2218 1139 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 protein_id gnl|my_center|LOCUS_37790 2506 4017 gene locus_tag LOCUS_37800 gene pepA 2506 4017 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence359 778 11 gene locus_tag LOCUS_37810 gene hdhA 778 11 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483371.1 protein_id gnl|my_center|LOCUS_37810 1918 890 gene locus_tag LOCUS_37820 gene malI 1918 890 CDS product mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179510.1 protein_id gnl|my_center|LOCUS_37820 2015 3607 gene locus_tag LOCUS_37830 gene malX 2015 3607 CDS product PTS maltose transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125609.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence360 293 1036 gene locus_tag LOCUS_37840 293 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 1039 1572 gene locus_tag LOCUS_37850 1039 1572 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902877.1 protein_id gnl|my_center|LOCUS_37850 2131 1601 gene locus_tag LOCUS_37860 2131 1601 CDS product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902877.1 protein_id gnl|my_center|LOCUS_37860 <4142 2132 gene locus_tag LOCUS_37870 <4142 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000216502.1:phage tail protein >Feature sequence361 1377 2285 gene locus_tag LOCUS_37880 gene gltI 1377 2285 CDS product glutamate/aspartate ABC transporter substrate-binding protein GltI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177085.1 protein_id gnl|my_center|LOCUS_37880 2455 3195 gene locus_tag LOCUS_37890 gene gltJ 2455 3195 CDS product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020944.1 protein_id gnl|my_center|LOCUS_37890 3195 3869 gene locus_tag LOCUS_37900 gene gltK 3195 3869 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272824.1 protein_id gnl|my_center|LOCUS_37900 >Feature sequence362 2132 1155 gene locus_tag LOCUS_37910 gene gspK 2132 1155 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633238.1 protein_id gnl|my_center|LOCUS_37910 2734 2135 gene locus_tag LOCUS_37920 gene gspJ 2734 2135 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255040.1 protein_id gnl|my_center|LOCUS_37920 3102 2731 gene locus_tag LOCUS_37930 gene gspI 3102 2731 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820125.1 protein_id gnl|my_center|LOCUS_37930 3662 3099 gene locus_tag LOCUS_37940 gene gspH 3662 3099 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115129.1 protein_id gnl|my_center|LOCUS_37940 >Feature sequence363 64 1551 gene locus_tag LOCUS_37950 gene amyA 64 1551 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245699.1 protein_id gnl|my_center|LOCUS_37950 1998 1585 gene locus_tag LOCUS_37960 gene yedD 1998 1585 CDS product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295642.1 protein_id gnl|my_center|LOCUS_37960 2185 3390 gene locus_tag LOCUS_37970 gene yedE 2185 3390 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118897.1 protein_id gnl|my_center|LOCUS_37970 3387 3620 gene locus_tag LOCUS_37980 gene yedF 3387 3620 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence364 1101 2105 gene locus_tag LOCUS_37990 gene argC 1101 2105 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 protein_id gnl|my_center|LOCUS_37990 2116 2889 gene locus_tag LOCUS_38000 gene argB 2116 2889 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence365 366 1724 gene locus_tag LOCUS_38010 gene murF 366 1724 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626688.1 protein_id gnl|my_center|LOCUS_38010 1718 2800 gene locus_tag LOCUS_38020 gene mraY 1718 2800 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 protein_id gnl|my_center|LOCUS_38020 >Feature sequence366 1233 724 gene locus_tag LOCUS_38030 gene nudB 1233 724 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300367.1 protein_id gnl|my_center|LOCUS_38030 3066 1294 gene locus_tag LOCUS_38040 gene aspS 3066 1294 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258662.1 protein_id gnl|my_center|LOCUS_38040 3376 3942 gene locus_tag LOCUS_38050 3376 3942 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891610.1 protein_id gnl|my_center|LOCUS_38050 >Feature sequence367 934 542 gene locus_tag LOCUS_38060 934 542 CDS product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602156.1 protein_id gnl|my_center|LOCUS_38060 1912 938 gene locus_tag LOCUS_38070 gene parM 1912 938 CDS product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103694.1 protein_id gnl|my_center|LOCUS_38070 2526 2152 gene locus_tag LOCUS_38080 2526 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176570.1 protein_id gnl|my_center|LOCUS_38080 3158 2526 gene locus_tag LOCUS_38090 3158 2526 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176595.1 protein_id gnl|my_center|LOCUS_38090 >Feature sequence368 <1 727 gene locus_tag LOCUS_38100 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295369.1:two-component system response regulator GlrR 788 1126 gene locus_tag LOCUS_38110 gene glnB 788 1126 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 protein_id gnl|my_center|LOCUS_38110 2361 1171 gene locus_tag LOCUS_38120 gene hmpA 2361 1171 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 protein_id gnl|my_center|LOCUS_38120 2689 3942 gene locus_tag LOCUS_38130 gene glyA 2689 3942 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence369 1224 223 gene locus_tag LOCUS_38140 gene ascG 1224 223 CDS product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001374632.1 protein_id gnl|my_center|LOCUS_38140 1493 2950 gene locus_tag LOCUS_38150 gene ascF 1493 2950 CDS product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107859.1 protein_id gnl|my_center|LOCUS_38150 >Feature sequence370 1534 296 gene locus_tag LOCUS_38160 gene cca 1534 296 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 protein_id gnl|my_center|LOCUS_38160 2218 1598 gene locus_tag LOCUS_38170 2218 1598 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125331.1 protein_id gnl|my_center|LOCUS_38170 2460 3761 gene locus_tag LOCUS_38180 gene ygiF 2460 3761 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046281.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence371 <1 919 gene locus_tag LOCUS_38190 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861101.1:relaxase/mobilization nuclease domain-containing protein 1031 1927 gene locus_tag LOCUS_38200 1031 1927 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194812347.1 protein_id gnl|my_center|LOCUS_38200 2244 2044 gene locus_tag LOCUS_38210 2244 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3191 2247 gene locus_tag LOCUS_38220 3191 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 <3840 3195 gene locus_tag LOCUS_38230 <3840 3195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861107.1:YodL domain-containing protein >Feature sequence372 314 1486 gene locus_tag LOCUS_38240 gene dacD 314 1486 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830156.1 protein_id gnl|my_center|LOCUS_38240 1604 2077 gene locus_tag LOCUS_38250 gene sbmC 1604 2077 CDS product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105393.1 protein_id gnl|my_center|LOCUS_38250 2275 3333 gene locus_tag LOCUS_38260 2275 3333 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200891.1 protein_id gnl|my_center|LOCUS_38260 3505 3834 gene locus_tag LOCUS_38270 3505 3834 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450409.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence373 1186 425 gene locus_tag LOCUS_38280 1186 425 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 protein_id gnl|my_center|LOCUS_38280 1319 1729 gene locus_tag LOCUS_38290 1319 1729 CDS product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871982.1 protein_id gnl|my_center|LOCUS_38290 2797 1691 gene locus_tag LOCUS_38300 2797 1691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 protein_id gnl|my_center|LOCUS_38300 <3824 2808 gene locus_tag LOCUS_38310 <3824 2808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000070131.1:ABC transporter permease >Feature sequence374 261 1529 gene locus_tag LOCUS_38320 261 1529 CDS product IS110-like element ISDha10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461193.1 protein_id gnl|my_center|LOCUS_38320 1815 2498 gene locus_tag LOCUS_38330 1815 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 2495 2932 gene locus_tag LOCUS_38340 2495 2932 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_38340 3118 3696 gene locus_tag LOCUS_38350 3118 3696 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 protein_id gnl|my_center|LOCUS_38350 >Feature sequence375 1502 2326 gene locus_tag LOCUS_38360 gene iclR 1502 2326 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 protein_id gnl|my_center|LOCUS_38360 >Feature sequence376 880 2316 gene locus_tag LOCUS_38370 gene mdtQ 880 2316 CDS product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078114.1 protein_id gnl|my_center|LOCUS_38370 2369 3130 gene locus_tag LOCUS_38380 2369 3130 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079517.1 protein_id gnl|my_center|LOCUS_38380 3757 3260 gene locus_tag LOCUS_38390 3757 3260 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955285.1 protein_id gnl|my_center|LOCUS_38390 >Feature sequence377 2032 233 gene locus_tag LOCUS_38400 gene cysJ 2032 233 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211913.1 protein_id gnl|my_center|LOCUS_38400 2348 2713 gene locus_tag LOCUS_38410 gene queD 2348 2713 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987944.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence378 2898 1141 gene locus_tag LOCUS_38420 2898 1141 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431834.1 protein_id gnl|my_center|LOCUS_38420 3381 2914 gene locus_tag LOCUS_38430 3381 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence379 274 1467 gene locus_tag LOCUS_38440 274 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 1958 3205 gene locus_tag LOCUS_38450 1958 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 3284 3598 gene locus_tag LOCUS_38460 3284 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 >Feature sequence380 2480 3127 gene locus_tag LOCUS_38470 gene narP 2480 3127 CDS product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113637.1 protein_id gnl|my_center|LOCUS_38470 >Feature sequence381 3207 2317 gene locus_tag LOCUS_38480 gene metF 3207 2317 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence382 1602 514 gene locus_tag LOCUS_38490 1602 514 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074859.1 protein_id gnl|my_center|LOCUS_38490 3040 2288 gene locus_tag LOCUS_38500 3040 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38500 >Feature sequence383 951 1334 gene locus_tag LOCUS_38510 gene grcA 951 1334 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627807.1 protein_id gnl|my_center|LOCUS_38510 1977 1390 gene locus_tag LOCUS_38520 gene eamB 1977 1390 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189207.1 protein_id gnl|my_center|LOCUS_38520 2080 2961 gene locus_tag LOCUS_38530 2080 2961 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386989.1 protein_id gnl|my_center|LOCUS_38530 >Feature sequence384 417 91 gene locus_tag LOCUS_38540 gene trpR 417 91 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 protein_id gnl|my_center|LOCUS_38540 2444 507 gene locus_tag LOCUS_38550 gene sltY 2444 507 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence385 941 2188 gene locus_tag LOCUS_38560 gene mdtA 941 2188 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678969.1 protein_id gnl|my_center|LOCUS_38560 >Feature sequence386 50 1600 gene locus_tag LOCUS_38570 gene cueO 50 1600 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 protein_id gnl|my_center|LOCUS_38570 <3610 1802 gene locus_tag LOCUS_38580 <3610 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001349940.1:quinoprotein glucose dehydrogenase >Feature sequence387 747 959 gene locus_tag LOCUS_38590 gene hha 747 959 CDS product hemolysin expression modulator Hha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453331.1 protein_id gnl|my_center|LOCUS_38590 1576 2145 gene locus_tag LOCUS_38600 1576 2145 CDS product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220727.1 protein_id gnl|my_center|LOCUS_38600 2183 2341 gene locus_tag LOCUS_38610 2183 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 2313 2696 gene locus_tag LOCUS_38620 2313 2696 CDS product putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271022.1 protein_id gnl|my_center|LOCUS_38620 2812 3105 gene locus_tag LOCUS_38630 2812 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38630 >Feature sequence388 1223 177 gene locus_tag LOCUS_38640 1223 177 CDS product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265083.1 protein_id gnl|my_center|LOCUS_38640 1497 1225 gene locus_tag LOCUS_38650 1497 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917803.1 protein_id gnl|my_center|LOCUS_38650 1648 1466 gene locus_tag LOCUS_38660 1648 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 2720 1599 gene locus_tag LOCUS_38670 2720 1599 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861734.1 protein_id gnl|my_center|LOCUS_38670 3324 2731 gene locus_tag LOCUS_38680 3324 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 >Feature sequence389 2859 1972 gene locus_tag LOCUS_38690 gene ribF 2859 1972 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767329.1 protein_id gnl|my_center|LOCUS_38690 3242 3505 gene locus_tag LOCUS_38700 gene rpsT 3242 3505 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 protein_id gnl|my_center|LOCUS_38700 >Feature sequence390 115 972 gene locus_tag LOCUS_38710 gene alkA 115 972 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288389.1 protein_id gnl|my_center|LOCUS_38710 <3576 1011 gene locus_tag LOCUS_38720 <3576 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000043761.1:diguanylate cyclase >Feature sequence391 1331 327 gene locus_tag LOCUS_38730 gene fepD 1331 327 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295314.1 protein_id gnl|my_center|LOCUS_38730 1442 2692 gene locus_tag LOCUS_38740 gene entS 1442 2692 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041788.1 protein_id gnl|my_center|LOCUS_38740 <3529 2696 gene locus_tag LOCUS_38750 <3529 2696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001234333.1:Fe2+-enterobactin ABC transporter substrate-binding protein >Feature sequence392 >Feature sequence393 1556 912 gene locus_tag LOCUS_38760 1556 912 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 protein_id gnl|my_center|LOCUS_38760 1662 2630 gene locus_tag LOCUS_38770 gene serB 1662 2630 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 protein_id gnl|my_center|LOCUS_38770 >Feature sequence394 721 107 gene locus_tag LOCUS_38780 721 107 CDS product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 protein_id gnl|my_center|LOCUS_38780 1139 1828 gene locus_tag LOCUS_38790 gene paoA 1139 1828 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070694.1 protein_id gnl|my_center|LOCUS_38790 1825 2781 gene locus_tag LOCUS_38800 gene paoB 1825 2781 CDS product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643328.1 protein_id gnl|my_center|LOCUS_38800 >Feature sequence395 182 1285 gene locus_tag LOCUS_38810 gene gldA 182 1285 CDS product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 protein_id gnl|my_center|LOCUS_38810 1560 2177 gene locus_tag LOCUS_38820 1560 2177 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_38820 3109 2204 gene locus_tag LOCUS_38830 gene yijE 3109 2204 CDS product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271242.1 protein_id gnl|my_center|LOCUS_38830 >Feature sequence396 1030 824 gene locus_tag LOCUS_38840 1030 824 CDS product gpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198149.1 protein_id gnl|my_center|LOCUS_38840 2952 1027 gene locus_tag LOCUS_38850 2952 1027 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027223.1 protein_id gnl|my_center|LOCUS_38850 3472 2927 gene locus_tag LOCUS_38860 3472 2927 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867493.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence397 990 1535 gene locus_tag LOCUS_38870 gene cobU 990 1535 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973176.1 protein_id gnl|my_center|LOCUS_38870 1532 2275 gene locus_tag LOCUS_38880 gene cobS 1532 2275 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295633.1 protein_id gnl|my_center|LOCUS_38880 2287 3366 gene locus_tag LOCUS_38890 gene cobT 2287 3366 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193776.1 protein_id gnl|my_center|LOCUS_38890 >Feature sequence398 1141 266 gene locus_tag LOCUS_38900 gene nanK 1141 266 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209017.1 protein_id gnl|my_center|LOCUS_38900 1827 1138 gene locus_tag LOCUS_38910 1827 1138 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 protein_id gnl|my_center|LOCUS_38910 3365 1875 gene locus_tag LOCUS_38920 gene nanT 3365 1875 CDS product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108459.1 protein_id gnl|my_center|LOCUS_38920 >Feature sequence399 327 935 gene locus_tag LOCUS_38930 327 935 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 protein_id gnl|my_center|LOCUS_38930 1033 2424 gene locus_tag LOCUS_38940 gene selA 1033 2424 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 protein_id gnl|my_center|LOCUS_38940 >Feature sequence400 2008 536 gene locus_tag LOCUS_38950 gene betB 2008 536 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089077.1 protein_id gnl|my_center|LOCUS_38950 2609 2022 gene locus_tag LOCUS_38960 gene betI 2609 2022 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295527.1 protein_id gnl|my_center|LOCUS_38960 >Feature sequence401 <1 828 gene locus_tag LOCUS_38970 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000699727.1:colanic acid biosynthesis fucosyltransferase WcaI 831 2267 gene locus_tag LOCUS_38980 gene cpsB 831 2267 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079285.1 protein_id gnl|my_center|LOCUS_38980 >Feature sequence402 1410 697 gene locus_tag LOCUS_38990 gene qseG 1410 697 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215861.1 protein_id gnl|my_center|LOCUS_38990 2957 1575 gene locus_tag LOCUS_39000 gene qseE 2957 1575 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311037.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence403 736 2124 gene locus_tag LOCUS_39010 gene sad 736 2124 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296740.1 protein_id gnl|my_center|LOCUS_39010 2188 3114 gene locus_tag LOCUS_39020 gene glsB 2188 3114 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 protein_id gnl|my_center|LOCUS_39020 >Feature sequence404 2153 1359 gene locus_tag LOCUS_39030 2153 1359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555458.1 protein_id gnl|my_center|LOCUS_39030 3084 2143 gene locus_tag LOCUS_39040 3084 2143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 protein_id gnl|my_center|LOCUS_39040 >Feature sequence405 394 639 gene locus_tag LOCUS_39050 394 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39050 649 1440 gene locus_tag LOCUS_39060 gene lgoD 649 1440 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39060 1529 2581 gene locus_tag LOCUS_39070 1529 2581 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704302.1 protein_id gnl|my_center|LOCUS_39070 2704 3300 gene locus_tag LOCUS_39080 2704 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence406 767 1585 gene locus_tag LOCUS_39090 gene ybhA 767 1585 CDS product bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213425.1 protein_id gnl|my_center|LOCUS_39090 2644 1586 gene locus_tag LOCUS_39100 gene modC 2644 1586 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891692.1 protein_id gnl|my_center|LOCUS_39100 3336 2647 gene locus_tag LOCUS_39110 gene modB 3336 2647 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604034.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence407 <1 766 gene locus_tag LOCUS_39120 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096433.1:type VI secretion system ATPase TssH 763 1329 gene locus_tag LOCUS_39130 763 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence408 <3357 1282 gene locus_tag LOCUS_39140 <3357 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000040458.1:nitrate reductase Z subunit alpha >Feature sequence409 62 982 gene locus_tag LOCUS_39150 gene lpxP 62 982 CDS product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484404.1 protein_id gnl|my_center|LOCUS_39150 2712 1474 gene locus_tag LOCUS_39160 gene alaC 2712 1474 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 protein_id gnl|my_center|LOCUS_39160 >Feature sequence410 162 974 gene locus_tag LOCUS_39170 gene truA 162 974 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283586.1 protein_id gnl|my_center|LOCUS_39170 1057 1716 gene locus_tag LOCUS_39180 1057 1716 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364335.1 protein_id gnl|my_center|LOCUS_39180 1872 2786 gene locus_tag LOCUS_39190 gene accD 1872 2786 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118404.1 protein_id gnl|my_center|LOCUS_39190 >Feature sequence411 <1 598 gene locus_tag LOCUS_39200 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000775779.1:beta-phosphoglucomutase 612 1694 gene locus_tag LOCUS_39210 612 1694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057985.1 protein_id gnl|my_center|LOCUS_39210 1739 2644 gene locus_tag LOCUS_39220 gene ompG 1739 2644 CDS product monomeric porin OmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735257.1 protein_id gnl|my_center|LOCUS_39220 3312 2755 gene locus_tag LOCUS_39230 3312 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence412 22 98 gene locus_tag LOCUS_t00580 22 98 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 107 182 gene locus_tag LOCUS_t00590 107 182 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1117 278 gene locus_tag LOCUS_39240 gene hdfR 1117 278 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379245.1 protein_id gnl|my_center|LOCUS_39240 1236 1574 gene locus_tag LOCUS_39250 gene maoP 1236 1574 CDS product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 protein_id gnl|my_center|LOCUS_39250 3119 1599 gene locus_tag LOCUS_39260 3119 1599 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058964.1 protein_id gnl|my_center|LOCUS_39260 >Feature sequence413 641 135 gene locus_tag LOCUS_39270 641 135 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079505.1 protein_id gnl|my_center|LOCUS_39270 1187 687 gene locus_tag LOCUS_39280 1187 687 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056491.1 protein_id gnl|my_center|LOCUS_39280 1452 1273 gene locus_tag LOCUS_39290 1452 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 2644 1838 gene locus_tag LOCUS_39300 gene trpA 2644 1838 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443067.1 protein_id gnl|my_center|LOCUS_39300 <3246 2644 gene locus_tag LOCUS_39310 <3246 2644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000209521.1:tryptophan synthase subunit beta >Feature sequence414 142 3024 gene locus_tag LOCUS_r00020 142 3024 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence415 1791 1591 gene locus_tag LOCUS_39320 1791 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 2456 1815 gene locus_tag LOCUS_39330 2456 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 <3238 2443 gene locus_tag LOCUS_39340 <3238 2443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096433.1:type VI secretion system ATPase TssH >Feature sequence416 2758 257 gene locus_tag LOCUS_39350 gene ptsP 2758 257 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174088.1 protein_id gnl|my_center|LOCUS_39350 >Feature sequence417 >Feature sequence418 665 186 gene locus_tag LOCUS_39360 665 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 2584 662 gene locus_tag LOCUS_39370 2584 662 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208722.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence419 729 1022 gene locus_tag LOCUS_39380 729 1022 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_39380 1066 2712 gene locus_tag LOCUS_39390 gene groL 1066 2712 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence420 2549 960 gene locus_tag LOCUS_39400 gene purH 2549 960 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187566.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence421 >Feature sequence422 181 1590 gene locus_tag LOCUS_39410 181 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39410 2955 1603 gene locus_tag LOCUS_39420 gene yegD 2955 1603 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469759.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence423 50 562 gene locus_tag LOCUS_39430 50 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 972 616 gene locus_tag LOCUS_39440 972 616 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_39440 1123 1641 gene locus_tag LOCUS_39450 1123 1641 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429152.1 protein_id gnl|my_center|LOCUS_39450 2005 1688 gene locus_tag LOCUS_39460 2005 1688 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_39460 2089 2454 gene locus_tag LOCUS_39470 2089 2454 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_39470 <3072 2502 gene locus_tag LOCUS_39480 <3072 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459352.1:heavy metal translocating P-type ATPase >Feature sequence424 29 751 gene locus_tag LOCUS_39490 gene baeR 29 751 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137873.1 protein_id gnl|my_center|LOCUS_39490 942 1274 gene locus_tag LOCUS_39500 942 1274 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929408.1 protein_id gnl|my_center|LOCUS_39500 1528 1779 gene locus_tag LOCUS_39510 1528 1779 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307279.1 protein_id gnl|my_center|LOCUS_39510 1781 2077 gene locus_tag LOCUS_39520 1781 2077 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220181.1 protein_id gnl|my_center|LOCUS_39520 >Feature sequence425 453 1697 gene locus_tag LOCUS_39530 gene lolE 453 1697 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251348.1 protein_id gnl|my_center|LOCUS_39530 1726 2637 gene locus_tag LOCUS_39540 gene nagK 1726 2637 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291270.1 protein_id gnl|my_center|LOCUS_39540 >Feature sequence426 <1 561 gene locus_tag LOCUS_39550 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001306920.1:helix-turn-helix domain-containing protein <3014 701 gene locus_tag LOCUS_39560 <3014 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000092539.1:inverse autotransporter adhesin FdeC >Feature sequence427 487 1326 gene locus_tag LOCUS_39570 gene wcaA 487 1326 CDS product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654503.1 protein_id gnl|my_center|LOCUS_39570 1329 1817 gene locus_tag LOCUS_39580 gene wcaB 1329 1817 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888740.1 protein_id gnl|my_center|LOCUS_39580 >Feature sequence428 470 258 gene locus_tag LOCUS_39590 gene rpmE 470 258 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 protein_id gnl|my_center|LOCUS_39590 673 2871 gene locus_tag LOCUS_39600 gene priA 673 2871 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 protein_id gnl|my_center|LOCUS_39600 >Feature sequence429 2032 1103 gene locus_tag LOCUS_39610 2032 1103 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803351.1 protein_id gnl|my_center|LOCUS_39610 2902 2078 gene locus_tag LOCUS_39620 2902 2078 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 protein_id gnl|my_center|LOCUS_39620 >Feature sequence430 546 97 gene locus_tag LOCUS_39630 546 97 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842944.1 protein_id gnl|my_center|LOCUS_39630 958 533 gene locus_tag LOCUS_39640 958 533 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406000.1 protein_id gnl|my_center|LOCUS_39640 1172 2041 gene locus_tag LOCUS_39650 gene amiA 1172 2041 CDS product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102891.1 protein_id gnl|my_center|LOCUS_39650 2045 2944 gene locus_tag LOCUS_39660 gene hemF 2045 2944 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801365.1 protein_id gnl|my_center|LOCUS_39660 >Feature sequence431 >Feature sequence432 <1 543 gene locus_tag LOCUS_39670 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000857839.1:isocitrate lyase 824 2560 gene locus_tag LOCUS_39680 gene aceK 824 2560 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137214.1 protein_id gnl|my_center|LOCUS_39680 2738 2529 gene locus_tag LOCUS_39690 2738 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39690 >Feature sequence433 >Feature sequence434 >Feature sequence435 1188 1838 gene locus_tag LOCUS_39700 1188 1838 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 protein_id gnl|my_center|LOCUS_39700 1850 2473 gene locus_tag LOCUS_39710 gene bglJ 1850 2473 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094869.1 protein_id gnl|my_center|LOCUS_39710 >Feature sequence436 1415 978 gene locus_tag LOCUS_39720 gene dtd 1415 978 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 protein_id gnl|my_center|LOCUS_39720 2284 1412 gene locus_tag LOCUS_39730 2284 1412 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 protein_id gnl|my_center|LOCUS_39730 2877 2278 gene locus_tag LOCUS_39740 gene yihX 2877 2278 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 protein_id gnl|my_center|LOCUS_39740 >Feature sequence437 450 1415 gene locus_tag LOCUS_39750 gene glpX 450 1415 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987283.1 protein_id gnl|my_center|LOCUS_39750 1437 1946 gene locus_tag LOCUS_39760 gene fumE 1437 1946 CDS product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224131.1 protein_id gnl|my_center|LOCUS_39760 1943 2656 gene locus_tag LOCUS_39770 1943 2656 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687705.1 protein_id gnl|my_center|LOCUS_39770 >Feature sequence438 1622 249 gene locus_tag LOCUS_39780 gene mpl 1622 249 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219792.1 protein_id gnl|my_center|LOCUS_39780 1798 2796 gene locus_tag LOCUS_39790 gene fbp 1798 2796 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 protein_id gnl|my_center|LOCUS_39790 >Feature sequence439 1 531 gene locus_tag LOCUS_39800 1 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 2014 1733 gene locus_tag LOCUS_39810 2014 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133414.1 protein_id gnl|my_center|LOCUS_39810 2630 2088 gene locus_tag LOCUS_39820 2630 2088 CDS product DNA-packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453566.1 protein_id gnl|my_center|LOCUS_39820 >Feature sequence440 <1 643 gene locus_tag LOCUS_39830 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000746151.1:LPS assembly protein LptD 696 1982 gene locus_tag LOCUS_39840 gene surA 696 1982 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 protein_id gnl|my_center|LOCUS_39840 >Feature sequence441 1656 2471 gene locus_tag LOCUS_39850 gene djlA 1656 2471 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200579.1 protein_id gnl|my_center|LOCUS_39850 >Feature sequence442 123 257 gene locus_tag LOCUS_39860 123 257 CDS product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517635.1 protein_id gnl|my_center|LOCUS_39860 1260 406 gene locus_tag LOCUS_39870 gene kdsA 1260 406 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 protein_id gnl|my_center|LOCUS_39870 2105 1296 gene locus_tag LOCUS_39880 gene sirB1 2105 1296 CDS product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257044.1 protein_id gnl|my_center|LOCUS_39880 2501 2109 gene locus_tag LOCUS_39890 gene sirB2 2501 2109 CDS product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200378.1 protein_id gnl|my_center|LOCUS_39890 2797 2498 gene locus_tag LOCUS_39900 2797 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 >Feature sequence443 801 49 gene locus_tag LOCUS_39910 801 49 CDS product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047135.1 protein_id gnl|my_center|LOCUS_39910 1864 815 gene locus_tag LOCUS_39920 1864 815 CDS product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393597.1 protein_id gnl|my_center|LOCUS_39920 2459 2211 gene locus_tag LOCUS_39930 gene rem 2459 2211 CDS product protein Rem inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980994.1 protein_id gnl|my_center|LOCUS_39930 >Feature sequence444 378 983 gene locus_tag LOCUS_39940 gene gspJ 378 983 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255030.1 protein_id gnl|my_center|LOCUS_39940 980 1942 gene locus_tag LOCUS_39950 gene gspK 980 1942 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631650.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence445 655 74 gene locus_tag LOCUS_39960 655 74 CDS product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202371.1 protein_id gnl|my_center|LOCUS_39960 1593 658 gene locus_tag LOCUS_39970 gene traN 1593 658 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202372.1 protein_id gnl|my_center|LOCUS_39970 <2767 1627 gene locus_tag LOCUS_39980 <2767 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202373.1:conjugative transposon protein TraM >Feature sequence446 2231 513 gene locus_tag LOCUS_39990 2231 513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772887.1 protein_id gnl|my_center|LOCUS_39990 2659 2225 gene locus_tag LOCUS_40000 2659 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 >Feature sequence447 635 901 gene locus_tag LOCUS_40010 gene sdhE 635 901 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 protein_id gnl|my_center|LOCUS_40010 882 1289 gene locus_tag LOCUS_40020 882 1289 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 protein_id gnl|my_center|LOCUS_40020 1850 1329 gene locus_tag LOCUS_40030 gene fldB 1850 1329 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 protein_id gnl|my_center|LOCUS_40030 >Feature sequence448 655 74 gene locus_tag LOCUS_40040 655 74 CDS product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202371.1 protein_id gnl|my_center|LOCUS_40040 1593 658 gene locus_tag LOCUS_40050 gene traN 1593 658 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202372.1 protein_id gnl|my_center|LOCUS_40050 <2746 1627 gene locus_tag LOCUS_40060 <2746 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202373.1:conjugative transposon protein TraM >Feature sequence449 727 353 gene locus_tag LOCUS_40070 727 353 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059892.1 protein_id gnl|my_center|LOCUS_40070 1857 802 gene locus_tag LOCUS_40080 gene dinB 1857 802 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 protein_id gnl|my_center|LOCUS_40080 2386 1928 gene locus_tag LOCUS_40090 2386 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40090 2698 2396 gene locus_tag LOCUS_40100 2698 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40100 >Feature sequence450 38 1330 gene locus_tag LOCUS_40110 38 1330 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202385.1 protein_id gnl|my_center|LOCUS_40110 >Feature sequence451 394 627 gene locus_tag LOCUS_40120 394 627 CDS product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244218.1 protein_id gnl|my_center|LOCUS_40120 627 854 gene locus_tag LOCUS_40130 627 854 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752613.1 protein_id gnl|my_center|LOCUS_40130 851 1708 gene locus_tag LOCUS_40140 851 1708 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 protein_id gnl|my_center|LOCUS_40140 >Feature sequence452 2163 1861 gene locus_tag LOCUS_40150 2163 1861 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281009.1 protein_id gnl|my_center|LOCUS_40150 >Feature sequence453 <1 1329 gene locus_tag LOCUS_40160 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000024951.1:ketol-acid reductoisomerase 1697 1416 gene locus_tag LOCUS_40170 gene ppiC 1697 1416 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 protein_id gnl|my_center|LOCUS_40170 >Feature sequence454 <1 1203 gene locus_tag LOCUS_40180 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000980540.1:exodeoxyribonuclease I 1473 1246 gene locus_tag LOCUS_40190 gene tsuB 1473 1246 CDS product thiosulfate utilization sulfurtransferase TsuB/YeeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985273.1 protein_id gnl|my_center|LOCUS_40190 2491 1487 gene locus_tag LOCUS_40200 gene tsuA 2491 1487 CDS product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492324.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence455 581 1531 gene locus_tag LOCUS_40210 581 1531 CDS product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661672.1 protein_id gnl|my_center|LOCUS_40210 >Feature sequence456 <1 2365 gene locus_tag LOCUS_40220 <1 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001390260.1:phage tail tape measure protein >Feature sequence457 915 82 gene locus_tag LOCUS_40230 915 82 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216223.1 protein_id gnl|my_center|LOCUS_40230 >Feature sequence458 303 1487 gene locus_tag LOCUS_40240 303 1487 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172876.1 protein_id gnl|my_center|LOCUS_40240 1598 2518 gene locus_tag LOCUS_40250 1598 2518 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535959.1 protein_id gnl|my_center|LOCUS_40250 >Feature sequence459 <2610 1647 gene locus_tag LOCUS_40260 <2610 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001207905.1:nitrate/nitrite transporter NarU >Feature sequence460 75 1889 gene locus_tag LOCUS_40270 75 1889 CDS product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817023.1 protein_id gnl|my_center|LOCUS_40270 2177 2422 gene locus_tag LOCUS_40280 2177 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125506.1 protein_id gnl|my_center|LOCUS_40280 >Feature sequence461 1717 329 gene locus_tag LOCUS_40290 gene cmtA 1717 329 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428805.1 protein_id gnl|my_center|LOCUS_40290 2188 1745 gene locus_tag LOCUS_40300 gene cmtB 2188 1745 CDS product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 protein_id gnl|my_center|LOCUS_40300 >Feature sequence462 79 4 gene locus_tag LOCUS_t00600 79 4 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 159 84 gene locus_tag LOCUS_t00610 159 84 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 281 206 gene locus_tag LOCUS_t00620 281 206 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 401 326 gene locus_tag LOCUS_t00630 401 326 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 660 2075 gene locus_tag LOCUS_40310 gene gltX 660 2075 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695655.1 protein_id gnl|my_center|LOCUS_40310 2510 2127 gene locus_tag LOCUS_40320 2510 2127 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826503.1 protein_id gnl|my_center|LOCUS_40320 >Feature sequence463 449 90 gene locus_tag LOCUS_40330 449 90 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140020.1 protein_id gnl|my_center|LOCUS_40330 1511 462 gene locus_tag LOCUS_40340 1511 462 CDS product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265083.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence464 171 614 gene locus_tag LOCUS_40350 gene wzb 171 614 CDS product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482901.1 protein_id gnl|my_center|LOCUS_40350 >Feature sequence465 <1 1168 gene locus_tag LOCUS_40360 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000028114.1:melibiose:sodium transporter MelB 1936 1307 gene locus_tag LOCUS_40370 1936 1307 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 protein_id gnl|my_center|LOCUS_40370 <2568 2059 gene locus_tag LOCUS_40380 <2568 2059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000066699.1:class I fumarate hydratase >Feature sequence466 135 950 gene locus_tag LOCUS_40390 gene fepC 135 950 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140647.1 protein_id gnl|my_center|LOCUS_40390 1951 947 gene locus_tag LOCUS_40400 gene wzz(fepE) 1951 947 CDS product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096692.1 protein_id gnl|my_center|LOCUS_40400 >Feature sequence467 <1 592 gene locus_tag LOCUS_40410 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000701842.1:metalloprotease LoiP 2240 678 gene locus_tag LOCUS_40420 2240 678 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442530.1 protein_id gnl|my_center|LOCUS_40420 >Feature sequence468 919 2196 gene locus_tag LOCUS_40430 919 2196 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 protein_id gnl|my_center|LOCUS_40430 >Feature sequence469 <1 556 gene locus_tag LOCUS_40440 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000948348.1:conjugative transfer relaxase/helicase TraI 576 1322 gene locus_tag LOCUS_40450 gene traX 576 1322 CDS product conjugal transfer pilus acetylase TraX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205762.1 protein_id gnl|my_center|LOCUS_40450 1381 2241 gene locus_tag LOCUS_40460 1381 2241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704522.1 protein_id gnl|my_center|LOCUS_40460 >Feature sequence470 545 1459 gene locus_tag LOCUS_40470 545 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence471 3 872 gene locus_tag LOCUS_40480 3 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 873 2099 gene locus_tag LOCUS_40490 873 2099 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090644.1 protein_id gnl|my_center|LOCUS_40490 >Feature sequence472 1229 384 gene locus_tag LOCUS_40500 gene nhoA 1229 384 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187905.1 protein_id gnl|my_center|LOCUS_40500 1402 1971 gene locus_tag LOCUS_40510 1402 1971 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085899.1 protein_id gnl|my_center|LOCUS_40510 2201 1968 gene locus_tag LOCUS_40520 gene pptA 2201 1968 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120143.1 protein_id gnl|my_center|LOCUS_40520 >Feature sequence473 1330 17 gene locus_tag LOCUS_40530 gene gltP 1330 17 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835799.1 protein_id gnl|my_center|LOCUS_40530 2268 1672 gene locus_tag LOCUS_40540 gene nrfG 2268 1672 CDS product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812982.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence474 <1 712 gene locus_tag LOCUS_40550 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000183107.1:UDP-glucose--undecaprenyl-phosphate glucose-1-phosphate transferase 714 2192 gene locus_tag LOCUS_40560 gene wzxC 714 2192 CDS product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058456.1 protein_id gnl|my_center|LOCUS_40560 >Feature sequence475 1354 1581 gene locus_tag LOCUS_40570 gene vapB 1354 1581 CDS product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450520.1 protein_id gnl|my_center|LOCUS_40570 1581 1979 gene locus_tag LOCUS_40580 1581 1979 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_40580 >Feature sequence476 2341 1463 gene locus_tag LOCUS_40590 gene glxR 2341 1463 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765839.1 protein_id gnl|my_center|LOCUS_40590 >Feature sequence477 316 1050 gene locus_tag LOCUS_40600 316 1050 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295426.1 protein_id gnl|my_center|LOCUS_40600 2031 1132 gene locus_tag LOCUS_40610 gene yegS 2031 1132 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807362.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence478 31 474 gene locus_tag LOCUS_40620 gene holC 31 474 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 protein_id gnl|my_center|LOCUS_40620 >Feature sequence479 <2460 162 gene locus_tag LOCUS_40630 <2460 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000918155.1:bifunctional glycosyl transferase/transpeptidase >Feature sequence480 <2457 1285 gene locus_tag LOCUS_40640 <2457 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000131044.1:choline BCCT transporter BetT >Feature sequence481 >Feature sequence482 82 486 gene locus_tag LOCUS_40650 82 486 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839179.1 protein_id gnl|my_center|LOCUS_40650 483 830 gene locus_tag LOCUS_40660 gene tnpB 483 830 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612626.1 protein_id gnl|my_center|LOCUS_40660 879 2417 gene locus_tag LOCUS_40670 879 2417 CDS product IS66-like element ISEc8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998048.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence483 <1 1372 gene locus_tag LOCUS_40680 <1 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001290706.1:assimilatory sulfite reductase (NADPH) hemoprotein subunit 1447 2181 gene locus_tag LOCUS_40690 gene cysH 1447 2181 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039850.1 protein_id gnl|my_center|LOCUS_40690 >Feature sequence484 1070 573 gene locus_tag LOCUS_40700 gene tssB 1070 573 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098939.1 protein_id gnl|my_center|LOCUS_40700 1577 1789 gene locus_tag LOCUS_40710 1577 1789 CDS product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287796.1 protein_id gnl|my_center|LOCUS_40710 2042 1809 gene locus_tag LOCUS_40720 2042 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124181.1 protein_id gnl|my_center|LOCUS_40720 >Feature sequence485 1357 527 gene locus_tag LOCUS_40730 gene glpG 1357 527 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928731.1 protein_id gnl|my_center|LOCUS_40730 1728 1402 gene locus_tag LOCUS_40740 gene glpE 1728 1402 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 protein_id gnl|my_center|LOCUS_40740 >Feature sequence486 <2421 1276 gene locus_tag LOCUS_40750 <2421 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000096011.1:methionine synthase >Feature sequence487 1292 174 gene locus_tag LOCUS_40760 1292 174 CDS product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence488 466 83 gene locus_tag LOCUS_40770 466 83 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178671.1 protein_id gnl|my_center|LOCUS_40770 819 478 gene locus_tag LOCUS_40780 819 478 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190772.1 protein_id gnl|my_center|LOCUS_40780 1869 829 gene locus_tag LOCUS_40790 1869 829 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228111.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence489 420 659 gene locus_tag LOCUS_40800 420 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 701 898 gene locus_tag LOCUS_40810 701 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 825 1271 gene locus_tag LOCUS_40820 825 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 1301 1759 gene locus_tag LOCUS_40830 1301 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 >Feature sequence490 833 1792 gene locus_tag LOCUS_40840 gene aes 833 1792 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801832.1 protein_id gnl|my_center|LOCUS_40840 <2395 1789 gene locus_tag LOCUS_40850 <2395 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250132.1:ferrochelatase >Feature sequence491 <1 1138 gene locus_tag LOCUS_40860 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000973083.1:acyl-CoA dehydrogenase FadE 1654 1181 gene locus_tag LOCUS_40870 gene ivy 1654 1181 CDS product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 protein_id gnl|my_center|LOCUS_40870 >Feature sequence492 >Feature sequence493 885 688 gene locus_tag LOCUS_40880 885 688 CDS product DUF957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772029.1 protein_id gnl|my_center|LOCUS_40880 1387 896 gene locus_tag LOCUS_40890 1387 896 CDS product DUF5983 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976839.1 protein_id gnl|my_center|LOCUS_40890 1758 1384 gene locus_tag LOCUS_40900 1758 1384 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094433.1 protein_id gnl|my_center|LOCUS_40900 2216 1848 gene locus_tag LOCUS_40910 2216 1848 CDS product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012908802.1 protein_id gnl|my_center|LOCUS_40910 >Feature sequence494 <1 607 gene locus_tag LOCUS_40920 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250088.1:ferrochelatase 1550 582 gene locus_tag LOCUS_40930 gene aes 1550 582 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801813.1 protein_id gnl|my_center|LOCUS_40930 >Feature sequence495 <1 2047 gene locus_tag LOCUS_40940 <1 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000955860.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence496 80 961 gene locus_tag LOCUS_40950 80 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 1695 1054 gene locus_tag LOCUS_40960 1695 1054 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135066.1 protein_id gnl|my_center|LOCUS_40960 <2359 1706 gene locus_tag LOCUS_40970 <2359 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001170162.1:asparaginase >Feature sequence497 959 1837 gene locus_tag LOCUS_40980 gene araC 959 1837 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300811.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence498 1071 502 gene locus_tag LOCUS_40990 1071 502 CDS product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148641.1 protein_id gnl|my_center|LOCUS_40990 1727 1515 gene locus_tag LOCUS_41000 gene hha 1727 1515 CDS product hemolysin expression modulator Hha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453331.1 protein_id gnl|my_center|LOCUS_41000 >Feature sequence499 829 2025 gene locus_tag LOCUS_41010 829 2025 CDS product IS110-like element ISSfl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069413.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence500 529 110 gene locus_tag LOCUS_41020 529 110 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126294.1 protein_id gnl|my_center|LOCUS_41020 837 526 gene locus_tag LOCUS_41030 837 526 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 protein_id gnl|my_center|LOCUS_41030 1772 1011 gene locus_tag LOCUS_41040 1772 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005000912.1 protein_id gnl|my_center|LOCUS_41040 2267 1797 gene locus_tag LOCUS_41050 gene hycI 2267 1797 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132961.1 protein_id gnl|my_center|LOCUS_41050 >Feature sequence501 2044 32 gene locus_tag LOCUS_41060 gene hyfR 2044 32 CDS product DNA-binding transcriptional regulator HyfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251508.1 protein_id gnl|my_center|LOCUS_41060 >Feature sequence502 <1 729 gene locus_tag LOCUS_41070 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000130686.1:tyrosine recombinase XerC 729 1445 gene locus_tag LOCUS_41080 gene yigB 729 1445 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 protein_id gnl|my_center|LOCUS_41080 >Feature sequence503 2059 320 gene locus_tag LOCUS_41090 gene ade 2059 320 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_41090 >Feature sequence504 2061 1834 gene locus_tag LOCUS_41100 gene feoA 2061 1834 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 protein_id gnl|my_center|LOCUS_41100 >Feature sequence505 1384 428 gene locus_tag LOCUS_41110 1384 428 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045450.1 protein_id gnl|my_center|LOCUS_41110 <2296 1384 gene locus_tag LOCUS_41120 <2296 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000650337.1:cardiolipin synthase ClsB >Feature sequence506 2292 1255 gene locus_tag LOCUS_41130 2292 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence507 >Feature sequence508 511 633 gene locus_tag LOCUS_41140 511 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 657 2180 gene locus_tag LOCUS_41150 gene ltrA 657 2180 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189111.1 protein_id gnl|my_center|LOCUS_41150 >Feature sequence509 552 1157 gene locus_tag LOCUS_41160 gene osmY 552 1157 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295410.1 protein_id gnl|my_center|LOCUS_41160 1284 1445 gene locus_tag LOCUS_41170 1284 1445 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence510 <2259 1537 gene locus_tag LOCUS_41180 <2259 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000695479.1:alpha-glucosidase >Feature sequence511 1219 464 gene locus_tag LOCUS_41190 gene bioC 1219 464 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201219.1 protein_id gnl|my_center|LOCUS_41190 <2249 1206 gene locus_tag LOCUS_41200 <2249 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000118818.1:8-amino-7-oxononanoate synthase >Feature sequence512 <1 1065 gene locus_tag LOCUS_41210 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001350335.1:histidinol dehydrogenase 1062 2132 gene locus_tag LOCUS_41220 gene hisC 1062 2132 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108941.1 protein_id gnl|my_center|LOCUS_41220 >Feature sequence513 >Feature sequence514 95 1135 gene locus_tag LOCUS_41230 gene pstS 95 1135 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 protein_id gnl|my_center|LOCUS_41230 1221 2180 gene locus_tag LOCUS_41240 gene pstC 1221 2180 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence515 >Feature sequence516 >Feature sequence517 93 956 gene locus_tag LOCUS_41250 93 956 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 protein_id gnl|my_center|LOCUS_41250 >Feature sequence518 347 1201 gene locus_tag LOCUS_41260 gene rpoH 347 1201 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 protein_id gnl|my_center|LOCUS_41260 >Feature sequence519 <1 925 gene locus_tag LOCUS_41270 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000438591.1:mannonate dehydratase >Feature sequence520 >Feature sequence521 287 132 gene locus_tag LOCUS_41280 287 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 706 329 gene locus_tag LOCUS_41290 706 329 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072317.1 protein_id gnl|my_center|LOCUS_41290 984 709 gene locus_tag LOCUS_41300 984 709 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226307.1 protein_id gnl|my_center|LOCUS_41300 1363 974 gene locus_tag LOCUS_41310 1363 974 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096310.1 protein_id gnl|my_center|LOCUS_41310 1905 1831 gene locus_tag LOCUS_t00640 1905 1831 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1984 1909 gene locus_tag LOCUS_t00650 1984 1909 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2063 1987 gene locus_tag LOCUS_t00660 2063 1987 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2140 2065 gene locus_tag LOCUS_t00670 2140 2065 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence522 >Feature sequence523 503 54 gene locus_tag LOCUS_41320 gene rplI 503 54 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 protein_id gnl|my_center|LOCUS_41320 772 545 gene locus_tag LOCUS_41330 gene rpsR 772 545 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_41330 1493 1098 gene locus_tag LOCUS_41340 gene rpsF 1493 1098 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 protein_id gnl|my_center|LOCUS_41340 1820 2095 gene locus_tag LOCUS_41350 1820 2095 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 protein_id gnl|my_center|LOCUS_41350 >Feature sequence524 1292 702 gene locus_tag LOCUS_41360 gene hisH 1292 702 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 protein_id gnl|my_center|LOCUS_41360 <2152 1292 gene locus_tag LOCUS_41370 <2152 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000080068.1:bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB >Feature sequence525 1133 603 gene locus_tag LOCUS_41380 gene kefF 1133 603 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 protein_id gnl|my_center|LOCUS_41380 2128 1244 gene locus_tag LOCUS_41390 2128 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 >Feature sequence526 2006 1176 gene locus_tag LOCUS_41400 2006 1176 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497942.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence527 483 184 gene locus_tag LOCUS_41410 483 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557473.1 protein_id gnl|my_center|LOCUS_41410 2044 638 gene locus_tag LOCUS_41420 2044 638 CDS product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096327.1 protein_id gnl|my_center|LOCUS_41420 >Feature sequence528 707 1018 gene locus_tag LOCUS_41430 gene yqfB 707 1018 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182957.1 protein_id gnl|my_center|LOCUS_41430 1182 1841 gene locus_tag LOCUS_41440 1182 1841 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 protein_id gnl|my_center|LOCUS_41440 >Feature sequence529 1337 111 gene locus_tag LOCUS_41450 gene rtcB 1337 111 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105504.1 protein_id gnl|my_center|LOCUS_41450 >Feature sequence530 <1 900 gene locus_tag LOCUS_41460 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249348.1:type II secretion system ATPase GspE >Feature sequence531 >Feature sequence532 2 322 gene locus_tag LOCUS_41470 2 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 467 964 gene locus_tag LOCUS_41480 gene pncC 467 964 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_41480 >Feature sequence533 53 1201 gene locus_tag LOCUS_41490 gene carA 53 1201 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 protein_id gnl|my_center|LOCUS_41490 >Feature sequence534 170 742 gene locus_tag LOCUS_41500 170 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 811 1047 gene locus_tag LOCUS_41510 811 1047 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958091.1 protein_id gnl|my_center|LOCUS_41510 1746 1258 gene locus_tag LOCUS_41520 1746 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence535 1344 1030 gene locus_tag LOCUS_41530 1344 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 1892 1332 gene locus_tag LOCUS_41540 1892 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 >Feature sequence536 <2054 1301 gene locus_tag LOCUS_41550 <2054 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001194635.1:anthranilate synthase component I >Feature sequence537 41 469 gene locus_tag LOCUS_41560 41 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 462 1784 gene locus_tag LOCUS_41570 462 1784 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291471.1 protein_id gnl|my_center|LOCUS_41570 >Feature sequence538 238 1599 gene locus_tag LOCUS_41580 gene trpCF 238 1599 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983893.1 protein_id gnl|my_center|LOCUS_41580 >Feature sequence539 996 265 gene locus_tag LOCUS_41590 gene artJ 996 265 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756569.1 protein_id gnl|my_center|LOCUS_41590 1814 1014 gene locus_tag LOCUS_41600 gene artP 1814 1014 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027205.1 protein_id gnl|my_center|LOCUS_41600 >Feature sequence540 <1 516 gene locus_tag LOCUS_41610 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000168475.1:acetolactate synthase large subunit 520 810 gene locus_tag LOCUS_41620 gene ilvN 520 810 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 protein_id gnl|my_center|LOCUS_41620 885 1475 gene locus_tag LOCUS_41630 gene uhpA 885 1475 CDS product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 protein_id gnl|my_center|LOCUS_41630 >Feature sequence541 <1 559 gene locus_tag LOCUS_41640 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000952737.1:NAD-dependent protein deacylase 1466 678 gene locus_tag LOCUS_41650 1466 678 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713462.1 protein_id gnl|my_center|LOCUS_41650 1924 1463 gene locus_tag LOCUS_41660 1924 1463 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076376.1 protein_id gnl|my_center|LOCUS_41660