>Feature sequence001 886 278 gene locus_tag LOCUS_00010 886 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1695 1021 gene locus_tag LOCUS_00020 1695 1021 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 protein_id gnl|my_center|LOCUS_00020 1896 3038 gene locus_tag LOCUS_00030 1896 3038 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925832.1 protein_id gnl|my_center|LOCUS_00030 3192 4517 gene locus_tag LOCUS_00040 3192 4517 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_00040 6222 4822 gene locus_tag LOCUS_00050 6222 4822 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 protein_id gnl|my_center|LOCUS_00050 6541 7008 gene locus_tag LOCUS_00060 6541 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7259 7804 gene locus_tag LOCUS_00070 gene apt 7259 7804 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072096.1 protein_id gnl|my_center|LOCUS_00070 7918 9930 gene locus_tag LOCUS_00080 gene dnaX 7918 9930 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 protein_id gnl|my_center|LOCUS_00080 9962 10294 gene locus_tag LOCUS_00090 9962 10294 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467102.1 protein_id gnl|my_center|LOCUS_00090 10294 10896 gene locus_tag LOCUS_00100 gene recR 10294 10896 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072099.1 protein_id gnl|my_center|LOCUS_00100 12081 13115 gene locus_tag LOCUS_00110 gene astE 12081 13115 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072329.1 protein_id gnl|my_center|LOCUS_00110 13129 14325 gene locus_tag LOCUS_00120 13129 14325 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_00120 14330 15307 gene locus_tag LOCUS_00130 14330 15307 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_00130 15340 16608 gene locus_tag LOCUS_00140 15340 16608 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218311097.1 protein_id gnl|my_center|LOCUS_00140 17553 16651 gene locus_tag LOCUS_00150 gene cdd 17553 16651 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072724.1 protein_id gnl|my_center|LOCUS_00150 19001 17577 gene locus_tag LOCUS_00160 gene sbcB 19001 17577 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_00160 19096 19848 gene locus_tag LOCUS_00170 gene deoC 19096 19848 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 protein_id gnl|my_center|LOCUS_00170 19948 20670 gene locus_tag LOCUS_00180 gene deoD 19948 20670 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422471.1 protein_id gnl|my_center|LOCUS_00180 23122 20705 gene locus_tag LOCUS_00190 23122 20705 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071453.1 protein_id gnl|my_center|LOCUS_00190 23250 25271 gene locus_tag LOCUS_00200 gene tkt 23250 25271 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477253.1 protein_id gnl|my_center|LOCUS_00200 25317 26342 gene locus_tag LOCUS_00210 gene epd 25317 26342 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635047.1 protein_id gnl|my_center|LOCUS_00210 26346 27491 gene locus_tag LOCUS_00220 26346 27491 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206584.1 protein_id gnl|my_center|LOCUS_00220 29110 27488 gene locus_tag LOCUS_00230 gene ushA 29110 27488 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816863.1 protein_id gnl|my_center|LOCUS_00230 29962 29267 gene locus_tag LOCUS_00240 29962 29267 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072391.1 protein_id gnl|my_center|LOCUS_00240 30704 29985 gene locus_tag LOCUS_00250 30704 29985 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072390.1 protein_id gnl|my_center|LOCUS_00250 >Feature sequence002 146 1525 gene locus_tag LOCUS_00260 146 1525 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478601.1 protein_id gnl|my_center|LOCUS_00260 1548 2132 gene locus_tag LOCUS_00270 gene rimJ 1548 2132 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263577.1 protein_id gnl|my_center|LOCUS_00270 2277 2113 gene locus_tag LOCUS_00280 2277 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 2994 2302 gene locus_tag LOCUS_00290 2994 2302 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 protein_id gnl|my_center|LOCUS_00290 4154 2988 gene locus_tag LOCUS_00300 gene dapE 4154 2988 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072438.1 protein_id gnl|my_center|LOCUS_00300 4488 4147 gene locus_tag LOCUS_00310 4488 4147 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532857.1 protein_id gnl|my_center|LOCUS_00310 4979 4503 gene locus_tag LOCUS_00320 gene crr 4979 4503 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861316.1 protein_id gnl|my_center|LOCUS_00320 5875 5147 gene locus_tag LOCUS_00330 gene cysZ 5875 5147 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167408.1 protein_id gnl|my_center|LOCUS_00330 6748 5957 gene locus_tag LOCUS_00340 6748 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 6915 8372 gene locus_tag LOCUS_00350 6915 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071222.1 protein_id gnl|my_center|LOCUS_00350 9229 8378 gene locus_tag LOCUS_00360 9229 8378 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262219.1 protein_id gnl|my_center|LOCUS_00360 12434 9321 gene locus_tag LOCUS_00370 12434 9321 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_00370 13724 12438 gene locus_tag LOCUS_00380 13724 12438 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_00380 15014 13815 gene locus_tag LOCUS_00390 gene srmB 15014 13815 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071227.1 protein_id gnl|my_center|LOCUS_00390 15225 16538 gene locus_tag LOCUS_00400 gene brnQ 15225 16538 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925629.1 protein_id gnl|my_center|LOCUS_00400 16545 17465 gene locus_tag LOCUS_00410 gene xerD 16545 17465 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071230.1 protein_id gnl|my_center|LOCUS_00410 17499 18305 gene locus_tag LOCUS_00420 gene dsbC 17499 18305 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_00420 18398 20149 gene locus_tag LOCUS_00430 gene recJ 18398 20149 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071232.1 protein_id gnl|my_center|LOCUS_00430 20274 21350 gene locus_tag LOCUS_00440 gene prfB 20274 21350 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925631.1 protein_id gnl|my_center|LOCUS_00440 21364 22857 gene locus_tag LOCUS_00450 gene lysS 21364 22857 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128764.1 protein_id gnl|my_center|LOCUS_00450 22964 24196 gene locus_tag LOCUS_00460 22964 24196 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 protein_id gnl|my_center|LOCUS_00460 24372 25004 gene locus_tag LOCUS_00470 24372 25004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 25024 25755 gene locus_tag LOCUS_00480 25024 25755 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071054.1 protein_id gnl|my_center|LOCUS_00480 26496 25759 gene locus_tag LOCUS_00490 26496 25759 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_00490 27463 26570 gene locus_tag LOCUS_00500 27463 26570 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_00500 28531 27584 gene locus_tag LOCUS_00510 gene ygfZ 28531 27584 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071151.1 protein_id gnl|my_center|LOCUS_00510 29200 28547 gene locus_tag LOCUS_00520 29200 28547 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314628.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence003 2940 805 gene locus_tag LOCUS_00530 gene flgK 2940 805 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_00530 5199 2974 gene locus_tag LOCUS_00540 gene flgK 5199 2974 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_00540 6163 5225 gene locus_tag LOCUS_00550 gene flgJ 6163 5225 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609502.1 protein_id gnl|my_center|LOCUS_00550 7288 6176 gene locus_tag LOCUS_00560 7288 6176 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073126.1 protein_id gnl|my_center|LOCUS_00560 7962 7297 gene locus_tag LOCUS_00570 gene flgH 7962 7297 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073127.1 protein_id gnl|my_center|LOCUS_00570 8766 7978 gene locus_tag LOCUS_00580 gene flgG 8766 7978 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073128.1 protein_id gnl|my_center|LOCUS_00580 9554 8796 gene locus_tag LOCUS_00590 gene flgF 9554 8796 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073129.1 protein_id gnl|my_center|LOCUS_00590 11230 9659 gene locus_tag LOCUS_00600 11230 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13954 11294 gene locus_tag LOCUS_00610 13954 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 14776 14063 gene locus_tag LOCUS_00620 gene flgD 14776 14063 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073131.1 protein_id gnl|my_center|LOCUS_00620 15297 14791 gene locus_tag LOCUS_00630 gene flgC 15297 14791 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_00630 15695 15294 gene locus_tag LOCUS_00640 gene flgB 15695 15294 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706644.1 protein_id gnl|my_center|LOCUS_00640 16640 15810 gene locus_tag LOCUS_00650 16640 15810 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925741.1 protein_id gnl|my_center|LOCUS_00650 17673 16705 gene locus_tag LOCUS_00660 17673 16705 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_00660 18140 18541 gene locus_tag LOCUS_00670 18140 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 18637 18981 gene locus_tag LOCUS_00680 18637 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 18978 19400 gene locus_tag LOCUS_00690 18978 19400 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073138.1 protein_id gnl|my_center|LOCUS_00690 19864 19478 gene locus_tag LOCUS_00700 19864 19478 CDS product LPP20 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 protein_id gnl|my_center|LOCUS_00700 20660 19980 gene locus_tag LOCUS_00710 20660 19980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 21939 20779 gene locus_tag LOCUS_00720 21939 20779 CDS product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073141.1 protein_id gnl|my_center|LOCUS_00720 23926 22031 gene locus_tag LOCUS_00730 23926 22031 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 protein_id gnl|my_center|LOCUS_00730 25074 23998 gene locus_tag LOCUS_00740 25074 23998 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925592.1 protein_id gnl|my_center|LOCUS_00740 25219 25725 gene locus_tag LOCUS_00750 25219 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 26066 25722 gene locus_tag LOCUS_00760 26066 25722 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816169.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence004 1539 1123 gene locus_tag LOCUS_00770 1539 1123 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263167.1 protein_id gnl|my_center|LOCUS_00770 2633 1680 gene locus_tag LOCUS_00780 gene rluC 2633 1680 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072718.1 protein_id gnl|my_center|LOCUS_00780 3566 2646 gene locus_tag LOCUS_00790 gene holB 3566 2646 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072561.1 protein_id gnl|my_center|LOCUS_00790 4195 3560 gene locus_tag LOCUS_00800 gene tmk 4195 3560 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170710.1 protein_id gnl|my_center|LOCUS_00800 5259 4198 gene locus_tag LOCUS_00810 gene mltG 5259 4198 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217396.1 protein_id gnl|my_center|LOCUS_00810 5938 5333 gene locus_tag LOCUS_00820 gene dcd 5938 5333 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072565.1 protein_id gnl|my_center|LOCUS_00820 6593 5952 gene locus_tag LOCUS_00830 gene udk 6593 5952 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072566.1 protein_id gnl|my_center|LOCUS_00830 7734 6601 gene locus_tag LOCUS_00840 gene apbC 7734 6601 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072567.1 protein_id gnl|my_center|LOCUS_00840 8223 7846 gene locus_tag LOCUS_00850 8223 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 10203 8245 gene locus_tag LOCUS_00860 10203 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 12515 10200 gene locus_tag LOCUS_00870 12515 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 13057 15066 gene locus_tag LOCUS_00880 gene metG 13057 15066 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_00880 15939 15067 gene locus_tag LOCUS_00890 15939 15067 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072538.1 protein_id gnl|my_center|LOCUS_00890 16713 15952 gene locus_tag LOCUS_00900 16713 15952 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 protein_id gnl|my_center|LOCUS_00900 17034 16714 gene locus_tag LOCUS_00910 17034 16714 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072973.1 protein_id gnl|my_center|LOCUS_00910 17539 17012 gene locus_tag LOCUS_00920 17539 17012 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457675.1 protein_id gnl|my_center|LOCUS_00920 18614 17529 gene locus_tag LOCUS_00930 gene aroC 18614 17529 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 protein_id gnl|my_center|LOCUS_00930 19542 18604 gene locus_tag LOCUS_00940 gene prmB 19542 18604 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302029.1 protein_id gnl|my_center|LOCUS_00940 19612 20187 gene locus_tag LOCUS_00950 gene smrB 19612 20187 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041521.1 protein_id gnl|my_center|LOCUS_00950 24074 20184 gene locus_tag LOCUS_00960 gene hrpA 24074 20184 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 protein_id gnl|my_center|LOCUS_00960 24597 24184 gene locus_tag LOCUS_00970 24597 24184 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706073.1 protein_id gnl|my_center|LOCUS_00970 25048 24761 gene locus_tag LOCUS_00980 gene rplY 25048 24761 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072175.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence005 <1 1119 gene locus_tag LOCUS_00990 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073645.1:DNA topoisomerase IV subunit B 1138 3390 gene locus_tag LOCUS_01000 gene parC 1138 3390 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073643.1 protein_id gnl|my_center|LOCUS_01000 3497 4219 gene locus_tag LOCUS_01010 3497 4219 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070907.1 protein_id gnl|my_center|LOCUS_01010 4243 4638 gene locus_tag LOCUS_01020 gene rraB 4243 4638 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070908.1 protein_id gnl|my_center|LOCUS_01020 5092 5006 gene locus_tag LOCUS_t00010 5092 5006 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5233 5724 gene locus_tag LOCUS_01030 5233 5724 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 protein_id gnl|my_center|LOCUS_01030 6828 5758 gene locus_tag LOCUS_01040 gene lptG 6828 5758 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261204.1 protein_id gnl|my_center|LOCUS_01040 7922 6825 gene locus_tag LOCUS_01050 gene lptF 7922 6825 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_01050 8032 9534 gene locus_tag LOCUS_01060 gene pepA 8032 9534 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071577.1 protein_id gnl|my_center|LOCUS_01060 9635 12532 gene locus_tag LOCUS_01070 9635 12532 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073282.1 protein_id gnl|my_center|LOCUS_01070 12605 13471 gene locus_tag LOCUS_01080 gene galU 12605 13471 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168324.1 protein_id gnl|my_center|LOCUS_01080 15378 13498 gene locus_tag LOCUS_01090 gene mlp37 15378 13498 CDS product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 protein_id gnl|my_center|LOCUS_01090 17300 15414 gene locus_tag LOCUS_01100 gene mlp37 17300 15414 CDS product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 protein_id gnl|my_center|LOCUS_01100 19248 17365 gene locus_tag LOCUS_01110 gene mlp37 19248 17365 CDS product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 protein_id gnl|my_center|LOCUS_01110 19938 19279 gene locus_tag LOCUS_01120 19938 19279 CDS product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073639.1 protein_id gnl|my_center|LOCUS_01120 21102 20086 gene locus_tag LOCUS_01130 21102 20086 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071121.1 protein_id gnl|my_center|LOCUS_01130 22100 21132 gene locus_tag LOCUS_01140 gene gshB 22100 21132 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071123.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence006 1092 541 gene locus_tag LOCUS_01150 1092 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 2087 1650 gene locus_tag LOCUS_01160 2087 1650 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_01160 3100 2087 gene locus_tag LOCUS_01170 gene ruvB 3100 2087 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072404.1 protein_id gnl|my_center|LOCUS_01170 3731 3132 gene locus_tag LOCUS_01180 gene ruvA 3731 3132 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 protein_id gnl|my_center|LOCUS_01180 4283 3750 gene locus_tag LOCUS_01190 gene ruvC 4283 3750 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365988.1 protein_id gnl|my_center|LOCUS_01190 5035 4283 gene locus_tag LOCUS_01200 5035 4283 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 protein_id gnl|my_center|LOCUS_01200 6885 5113 gene locus_tag LOCUS_01210 gene aspS 6885 5113 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072408.1 protein_id gnl|my_center|LOCUS_01210 6961 7821 gene locus_tag LOCUS_01220 gene cmoA 6961 7821 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 protein_id gnl|my_center|LOCUS_01220 7818 8789 gene locus_tag LOCUS_01230 gene cmoB 7818 8789 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072411.1 protein_id gnl|my_center|LOCUS_01230 8798 9085 gene locus_tag LOCUS_01240 8798 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9132 9830 gene locus_tag LOCUS_01250 9132 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 9867 10832 gene locus_tag LOCUS_01260 9867 10832 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_01260 10804 12384 gene locus_tag LOCUS_01270 10804 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 12408 14132 gene locus_tag LOCUS_01280 12408 14132 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073193.1 protein_id gnl|my_center|LOCUS_01280 15051 14182 gene locus_tag LOCUS_01290 gene htpX 15051 14182 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072672.1 protein_id gnl|my_center|LOCUS_01290 15612 15127 gene locus_tag LOCUS_01300 15612 15127 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910415.1 protein_id gnl|my_center|LOCUS_01300 16922 15636 gene locus_tag LOCUS_01310 gene serS 16922 15636 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072310.1 protein_id gnl|my_center|LOCUS_01310 17439 17068 gene locus_tag LOCUS_01320 gene crcB 17439 17068 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819067.1 protein_id gnl|my_center|LOCUS_01320 18077 17442 gene locus_tag LOCUS_01330 gene lolA 18077 17442 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211338.1 protein_id gnl|my_center|LOCUS_01330 20760 18070 gene locus_tag LOCUS_01340 20760 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence007 800 1180 gene locus_tag LOCUS_01350 gene folX 800 1180 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 protein_id gnl|my_center|LOCUS_01350 1185 2081 gene locus_tag LOCUS_01360 1185 2081 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072827.1 protein_id gnl|my_center|LOCUS_01360 2173 2769 gene locus_tag LOCUS_01370 2173 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3682 2792 gene locus_tag LOCUS_01380 gene sucD 3682 2792 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 protein_id gnl|my_center|LOCUS_01380 4856 3684 gene locus_tag LOCUS_01390 gene sucC 4856 3684 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705801.1 protein_id gnl|my_center|LOCUS_01390 6620 5109 gene locus_tag LOCUS_01400 gene odhB 6620 5109 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455502.1 protein_id gnl|my_center|LOCUS_01400 9454 6638 gene locus_tag LOCUS_01410 gene sucA 9454 6638 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072030.1 protein_id gnl|my_center|LOCUS_01410 10249 9542 gene locus_tag LOCUS_01420 10249 9542 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072029.1 protein_id gnl|my_center|LOCUS_01420 12036 10261 gene locus_tag LOCUS_01430 gene sdhA 12036 10261 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072028.1 protein_id gnl|my_center|LOCUS_01430 12384 12037 gene locus_tag LOCUS_01440 gene sdhD 12384 12037 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072027.1 protein_id gnl|my_center|LOCUS_01440 12755 12375 gene locus_tag LOCUS_01450 gene sdhC 12755 12375 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072026.1 protein_id gnl|my_center|LOCUS_01450 13160 14443 gene locus_tag LOCUS_01460 13160 14443 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072025.1 protein_id gnl|my_center|LOCUS_01460 15418 14498 gene locus_tag LOCUS_01470 15418 14498 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706465.1 protein_id gnl|my_center|LOCUS_01470 16735 15545 gene locus_tag LOCUS_01480 16735 15545 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence008 1059 277 gene locus_tag LOCUS_01490 gene fliR 1059 277 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073100.1 protein_id gnl|my_center|LOCUS_01490 1331 1062 gene locus_tag LOCUS_01500 gene fliQ 1331 1062 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 protein_id gnl|my_center|LOCUS_01500 2095 1349 gene locus_tag LOCUS_01510 gene fliP 2095 1349 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_01510 2466 2092 gene locus_tag LOCUS_01520 gene fliO 2466 2092 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298795.1 protein_id gnl|my_center|LOCUS_01520 2880 2479 gene locus_tag LOCUS_01530 gene fliN 2880 2479 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073104.1 protein_id gnl|my_center|LOCUS_01530 3957 2935 gene locus_tag LOCUS_01540 gene fliM 3957 2935 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420346.1 protein_id gnl|my_center|LOCUS_01540 4432 3983 gene locus_tag LOCUS_01550 4432 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 6625 4457 gene locus_tag LOCUS_01560 6625 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 7177 6731 gene locus_tag LOCUS_01570 7177 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8517 7174 gene locus_tag LOCUS_01580 gene fliI 8517 7174 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073109.1 protein_id gnl|my_center|LOCUS_01580 9539 8514 gene locus_tag LOCUS_01590 9539 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 10594 9539 gene locus_tag LOCUS_01600 gene fliG 10594 9539 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073111.1 protein_id gnl|my_center|LOCUS_01600 12524 10620 gene locus_tag LOCUS_01610 12524 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 12873 12547 gene locus_tag LOCUS_01620 gene fliE 12873 12547 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073113.1 protein_id gnl|my_center|LOCUS_01620 14326 12968 gene locus_tag LOCUS_01630 14326 12968 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_01630 15365 14316 gene locus_tag LOCUS_01640 15365 14316 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073115.1 protein_id gnl|my_center|LOCUS_01640 16581 15487 gene locus_tag LOCUS_01650 16581 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 17451 16738 gene locus_tag LOCUS_01660 17451 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence009 368 1252 gene locus_tag LOCUS_01670 368 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1249 1857 gene locus_tag LOCUS_01680 1249 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1854 2516 gene locus_tag LOCUS_01690 1854 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 2533 2805 gene locus_tag LOCUS_01700 2533 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 2831 4429 gene locus_tag LOCUS_01710 gene mshL 2831 4429 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_01710 4547 5218 gene locus_tag LOCUS_01720 4547 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 5206 6939 gene locus_tag LOCUS_01730 5206 6939 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_01730 6958 8169 gene locus_tag LOCUS_01740 6958 8169 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_01740 8377 8820 gene locus_tag LOCUS_01750 8377 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9388 8852 gene locus_tag LOCUS_01760 9388 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9576 9758 gene locus_tag LOCUS_01770 9576 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 9837 10361 gene locus_tag LOCUS_01780 9837 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 10361 10825 gene locus_tag LOCUS_01790 10361 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 10867 11379 gene locus_tag LOCUS_01800 10867 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 11363 11926 gene locus_tag LOCUS_01810 11363 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 11926 12801 gene locus_tag LOCUS_01820 11926 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 12794 13237 gene locus_tag LOCUS_01830 12794 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 13425 14471 gene locus_tag LOCUS_01840 13425 14471 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_01840 14507 15376 gene locus_tag LOCUS_01850 gene mreC 14507 15376 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073801.1 protein_id gnl|my_center|LOCUS_01850 15377 15862 gene locus_tag LOCUS_01860 gene mreD 15377 15862 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073800.1 protein_id gnl|my_center|LOCUS_01860 15908 16438 gene locus_tag LOCUS_01870 15908 16438 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence010 413 39 gene locus_tag LOCUS_01880 gene rpsL 413 39 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070612.1 protein_id gnl|my_center|LOCUS_01880 4860 649 gene locus_tag LOCUS_01890 gene rpoC 4860 649 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070611.1 protein_id gnl|my_center|LOCUS_01890 8977 4937 gene locus_tag LOCUS_01900 gene rpoB 8977 4937 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070610.1 protein_id gnl|my_center|LOCUS_01900 9571 9206 gene locus_tag LOCUS_01910 gene rplL 9571 9206 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028973.1 protein_id gnl|my_center|LOCUS_01910 10113 9625 gene locus_tag LOCUS_01920 gene rplJ 10113 9625 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 protein_id gnl|my_center|LOCUS_01920 11039 10338 gene locus_tag LOCUS_01930 gene rplA 11039 10338 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 protein_id gnl|my_center|LOCUS_01930 11472 11044 gene locus_tag LOCUS_01940 gene rplK 11472 11044 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489784.1 protein_id gnl|my_center|LOCUS_01940 12112 11567 gene locus_tag LOCUS_01950 gene nusG 12112 11567 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 protein_id gnl|my_center|LOCUS_01950 12499 12122 gene locus_tag LOCUS_01960 gene secE 12499 12122 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070605.1 protein_id gnl|my_center|LOCUS_01960 12754 12679 gene locus_tag LOCUS_t00020 12754 12679 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12846 12772 gene locus_tag LOCUS_t00030 12846 12772 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12935 12851 gene locus_tag LOCUS_t00040 12935 12851 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 13018 12943 gene locus_tag LOCUS_t00050 13018 12943 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13227 14102 gene locus_tag LOCUS_01970 gene coaA 13227 14102 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667563.1 protein_id gnl|my_center|LOCUS_01970 15071 14016 gene locus_tag LOCUS_01980 gene birA 15071 14016 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070602.1 protein_id gnl|my_center|LOCUS_01980 16062 15028 gene locus_tag LOCUS_01990 gene murB 16062 15028 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016699.1 protein_id gnl|my_center|LOCUS_01990 <16680 16069 gene locus_tag LOCUS_02000 <16680 16069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208975.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence011 <1 2241 gene locus_tag LOCUS_02010 <1 2241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072719.1:ribonuclease E 2349 3200 gene locus_tag LOCUS_02020 2349 3200 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262215.1 protein_id gnl|my_center|LOCUS_02020 3262 4125 gene locus_tag LOCUS_02030 gene ylqF 3262 4125 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_02030 4460 4176 gene locus_tag LOCUS_02040 4460 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5141 4476 gene locus_tag LOCUS_02050 5141 4476 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 protein_id gnl|my_center|LOCUS_02050 5392 5847 gene locus_tag LOCUS_02060 5392 5847 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_02060 6564 5800 gene locus_tag LOCUS_02070 gene elyC 6564 5800 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457224.1 protein_id gnl|my_center|LOCUS_02070 6565 7491 gene locus_tag LOCUS_02080 6565 7491 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_02080 8110 7484 gene locus_tag LOCUS_02090 gene upp 8110 7484 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302745.1 protein_id gnl|my_center|LOCUS_02090 8929 8171 gene locus_tag LOCUS_02100 8929 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 9505 9161 gene locus_tag LOCUS_02110 gene ihfB 9505 9161 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072380.1 protein_id gnl|my_center|LOCUS_02110 11244 9577 gene locus_tag LOCUS_02120 gene rpsA 11244 9577 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072381.1 protein_id gnl|my_center|LOCUS_02120 12027 11344 gene locus_tag LOCUS_02130 gene cmk 12027 11344 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_02130 13365 12067 gene locus_tag LOCUS_02140 gene aroA 13365 12067 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211325.1 protein_id gnl|my_center|LOCUS_02140 14470 13370 gene locus_tag LOCUS_02150 gene serC 14470 13370 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072388.1 protein_id gnl|my_center|LOCUS_02150 <16209 14510 gene locus_tag LOCUS_02160 <16209 14510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815974.1:DNA topoisomerase (ATP-hydrolyzing) subunit A >Feature sequence012 1971 1222 gene locus_tag LOCUS_02170 gene rlmB 1971 1222 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_02170 4538 2073 gene locus_tag LOCUS_02180 gene rnr 4538 2073 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073678.1 protein_id gnl|my_center|LOCUS_02180 5382 4711 gene locus_tag LOCUS_02190 5382 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6178 5450 gene locus_tag LOCUS_02200 6178 5450 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762952.1 protein_id gnl|my_center|LOCUS_02200 6890 6240 gene locus_tag LOCUS_02210 gene syd 6890 6240 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194668.1 protein_id gnl|my_center|LOCUS_02210 9844 6971 gene locus_tag LOCUS_02220 gene gcvP 9844 6971 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705609.1 protein_id gnl|my_center|LOCUS_02220 10264 9872 gene locus_tag LOCUS_02230 gene gcvH 10264 9872 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_02230 11388 10288 gene locus_tag LOCUS_02240 gene gcvT 11388 10288 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068693.1 protein_id gnl|my_center|LOCUS_02240 12394 11624 gene locus_tag LOCUS_02250 12394 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 13373 12669 gene locus_tag LOCUS_02260 13373 12669 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456110.1 protein_id gnl|my_center|LOCUS_02260 14131 13403 gene locus_tag LOCUS_02270 14131 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14575 14144 gene locus_tag LOCUS_02280 14575 14144 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847608.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence013 1371 3017 gene locus_tag LOCUS_02290 1371 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3810 3034 gene locus_tag LOCUS_02300 3810 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4619 3837 gene locus_tag LOCUS_02310 4619 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7548 4738 gene locus_tag LOCUS_02320 7548 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 7787 8026 gene locus_tag LOCUS_02330 7787 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 9303 8527 gene locus_tag LOCUS_02340 9303 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 10094 9303 gene locus_tag LOCUS_02350 10094 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 12387 10102 gene locus_tag LOCUS_02360 12387 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12728 13675 gene locus_tag LOCUS_02370 12728 13675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 13679 14008 gene locus_tag LOCUS_02380 13679 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14009 14371 gene locus_tag LOCUS_02390 14009 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 14368 15042 gene locus_tag LOCUS_02400 14368 15042 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217218.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence014 1457 171 gene locus_tag LOCUS_02410 1457 171 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261375.1 protein_id gnl|my_center|LOCUS_02410 1634 2377 gene locus_tag LOCUS_02420 1634 2377 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389886.1 protein_id gnl|my_center|LOCUS_02420 2751 2374 gene locus_tag LOCUS_02430 2751 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 4008 2992 gene locus_tag LOCUS_02440 4008 2992 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_02440 4227 4868 gene locus_tag LOCUS_02450 4227 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5048 6211 gene locus_tag LOCUS_02460 5048 6211 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_02460 6233 9328 gene locus_tag LOCUS_02470 6233 9328 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_02470 10298 9369 gene locus_tag LOCUS_02480 10298 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 10451 10885 gene locus_tag LOCUS_02490 gene dtd 10451 10885 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 protein_id gnl|my_center|LOCUS_02490 10907 11773 gene locus_tag LOCUS_02500 10907 11773 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_02500 11820 12746 gene locus_tag LOCUS_02510 11820 12746 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_02510 13579 12779 gene locus_tag LOCUS_02520 13579 12779 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_02520 14069 13587 gene locus_tag LOCUS_02530 gene folK 14069 13587 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_02530 14419 14066 gene locus_tag LOCUS_02540 gene folB 14419 14066 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071504.1 protein_id gnl|my_center|LOCUS_02540 14611 14444 gene locus_tag LOCUS_02550 14611 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 14592 15167 gene locus_tag LOCUS_02560 gene plsY 14592 15167 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence015 <1 1052 gene locus_tag LOCUS_02570 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073663.1:replicative DNA helicase 1054 2133 gene locus_tag LOCUS_02580 gene alr 1054 2133 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704045.1 protein_id gnl|my_center|LOCUS_02580 4137 2137 gene locus_tag LOCUS_02590 4137 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5273 4482 gene locus_tag LOCUS_02600 5273 4482 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_02600 5389 5865 gene locus_tag LOCUS_02610 5389 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 7645 5927 gene locus_tag LOCUS_02620 7645 5927 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073749.1 protein_id gnl|my_center|LOCUS_02620 10630 7808 gene locus_tag LOCUS_02630 gene uvrA 10630 7808 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073746.1 protein_id gnl|my_center|LOCUS_02630 10813 12165 gene locus_tag LOCUS_02640 10813 12165 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_02640 12211 12780 gene locus_tag LOCUS_02650 gene ssb 12211 12780 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073744.1 protein_id gnl|my_center|LOCUS_02650 12802 13449 gene locus_tag LOCUS_02660 12802 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 13451 14260 gene locus_tag LOCUS_02670 13451 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 <14995 14257 gene locus_tag LOCUS_02680 <14995 14257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205909.1:pyridoxal-phosphate dependent enzyme >Feature sequence016 214 2139 gene locus_tag LOCUS_02690 214 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2742 2191 gene locus_tag LOCUS_02700 2742 2191 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_02700 3456 2749 gene locus_tag LOCUS_02710 3456 2749 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 protein_id gnl|my_center|LOCUS_02710 3942 3532 gene locus_tag LOCUS_02720 gene ruvX 3942 3532 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073217.1 protein_id gnl|my_center|LOCUS_02720 4500 3943 gene locus_tag LOCUS_02730 4500 3943 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073216.1 protein_id gnl|my_center|LOCUS_02730 4848 4522 gene locus_tag LOCUS_02740 gene yciH 4848 4522 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073215.1 protein_id gnl|my_center|LOCUS_02740 5280 4978 gene locus_tag LOCUS_02750 5280 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5438 6244 gene locus_tag LOCUS_02760 5438 6244 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073121.1 protein_id gnl|my_center|LOCUS_02760 6289 6951 gene locus_tag LOCUS_02770 gene queE 6289 6951 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209379.1 protein_id gnl|my_center|LOCUS_02770 7054 6970 gene locus_tag LOCUS_t00060 7054 6970 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7184 7660 gene locus_tag LOCUS_02780 7184 7660 CDS product VC2046/SO_2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072465.1 protein_id gnl|my_center|LOCUS_02780 8676 7657 gene locus_tag LOCUS_02790 8676 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 10757 9756 gene locus_tag LOCUS_02800 10757 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 11350 11126 gene locus_tag LOCUS_02810 11350 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02810 11647 11354 gene locus_tag LOCUS_02820 11647 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02820 11828 13153 gene locus_tag LOCUS_02830 gene pssA 11828 13153 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072370.1 protein_id gnl|my_center|LOCUS_02830 13483 13157 gene locus_tag LOCUS_02840 13483 13157 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693989.1 protein_id gnl|my_center|LOCUS_02840 13763 13488 gene locus_tag LOCUS_02850 13763 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 14124 13765 gene locus_tag LOCUS_02860 gene tusC 14124 13765 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817321.1 protein_id gnl|my_center|LOCUS_02860 14516 14124 gene locus_tag LOCUS_02870 gene tusD 14516 14124 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803703.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence017 3136 1229 gene locus_tag LOCUS_02880 3136 1229 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060992245.1 protein_id gnl|my_center|LOCUS_02880 4889 3234 gene locus_tag LOCUS_02890 gene glnS 4889 3234 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287154.1 protein_id gnl|my_center|LOCUS_02890 7273 5033 gene locus_tag LOCUS_02900 gene feoB 7273 5033 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071907.1 protein_id gnl|my_center|LOCUS_02900 7500 7270 gene locus_tag LOCUS_02910 7500 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 7820 8527 gene locus_tag LOCUS_02920 gene fadR 7820 8527 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072796.1 protein_id gnl|my_center|LOCUS_02920 10792 8738 gene locus_tag LOCUS_02930 gene prc 10792 8738 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925720.1 protein_id gnl|my_center|LOCUS_02930 11453 10821 gene locus_tag LOCUS_02940 gene proQ 11453 10821 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072551.1 protein_id gnl|my_center|LOCUS_02940 11674 12450 gene locus_tag LOCUS_02950 11674 12450 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072559.1 protein_id gnl|my_center|LOCUS_02950 14081 12660 gene locus_tag LOCUS_02960 gene rsmF 14081 12660 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927794.1 protein_id gnl|my_center|LOCUS_02960 <14906 14144 gene locus_tag LOCUS_02970 <14906 14144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072396.1:NADPH-dependent 2,4-dienoyl-CoA reductase >Feature sequence018 245 844 gene locus_tag LOCUS_02980 245 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1317 956 gene locus_tag LOCUS_tm00010 1317 956 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1856 1365 gene locus_tag LOCUS_02990 gene smpB 1856 1365 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705343.1 protein_id gnl|my_center|LOCUS_02990 1989 2423 gene locus_tag LOCUS_03000 1989 2423 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_03000 2420 2749 gene locus_tag LOCUS_03010 2420 2749 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_03010 2749 3558 gene locus_tag LOCUS_03020 2749 3558 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384626.1 protein_id gnl|my_center|LOCUS_03020 3668 3877 gene locus_tag LOCUS_03030 3668 3877 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_03030 4032 4916 gene locus_tag LOCUS_03040 gene tesB 4032 4916 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 protein_id gnl|my_center|LOCUS_03040 4948 5340 gene locus_tag LOCUS_03050 4948 5340 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072015.1 protein_id gnl|my_center|LOCUS_03050 5474 6670 gene locus_tag LOCUS_03060 5474 6670 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_03060 6682 7827 gene locus_tag LOCUS_03070 6682 7827 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_03070 7832 8965 gene locus_tag LOCUS_03080 7832 8965 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_03080 9069 9827 gene locus_tag LOCUS_03090 9069 9827 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071833.1 protein_id gnl|my_center|LOCUS_03090 9875 10084 gene locus_tag LOCUS_03100 9875 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10077 11525 gene locus_tag LOCUS_03110 gene panF 10077 11525 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210065.1 protein_id gnl|my_center|LOCUS_03110 11512 12018 gene locus_tag LOCUS_03120 gene tadA 11512 12018 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050413802.1 protein_id gnl|my_center|LOCUS_03120 12828 12184 gene locus_tag LOCUS_03130 12828 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 14180 12825 gene locus_tag LOCUS_03140 14180 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 <14856 14223 gene locus_tag LOCUS_03150 <14856 14223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073169.1:membrane-bound lytic murein transglycosylase MltF >Feature sequence019 111 3743 gene locus_tag LOCUS_03160 111 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3963 4187 gene locus_tag LOCUS_03170 3963 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5737 4544 gene locus_tag LOCUS_03180 5737 4544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347061.1 protein_id gnl|my_center|LOCUS_03180 6418 5837 gene locus_tag LOCUS_03190 6418 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6469 6666 gene locus_tag LOCUS_03200 6469 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7492 6839 gene locus_tag LOCUS_03210 7492 6839 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_03210 8280 7537 gene locus_tag LOCUS_03220 8280 7537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127634.1 protein_id gnl|my_center|LOCUS_03220 8712 8293 gene locus_tag LOCUS_03230 8712 8293 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 protein_id gnl|my_center|LOCUS_03230 8900 8751 gene locus_tag LOCUS_03240 8900 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9827 8913 gene locus_tag LOCUS_03250 9827 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 11295 10537 gene locus_tag LOCUS_03260 11295 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 12044 11319 gene locus_tag LOCUS_03270 12044 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence020 244 62 gene locus_tag LOCUS_03280 gene csrA 244 62 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213314.1 protein_id gnl|my_center|LOCUS_03280 699 454 gene locus_tag LOCUS_03290 699 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1442 696 gene locus_tag LOCUS_03300 1442 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 1510 1827 gene locus_tag LOCUS_03310 1510 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2190 2348 gene locus_tag LOCUS_03320 2190 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 4438 2918 gene locus_tag LOCUS_03330 4438 2918 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262276.1 protein_id gnl|my_center|LOCUS_03330 6252 5356 gene locus_tag LOCUS_03340 6252 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 7427 6531 gene locus_tag LOCUS_03350 7427 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 7612 7815 gene locus_tag LOCUS_03360 7612 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 8404 7853 gene locus_tag LOCUS_03370 8404 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 8499 9644 gene locus_tag LOCUS_03380 gene emrD3 8499 9644 CDS product multidrug efflux MFS transporter EmrD-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850833.1 protein_id gnl|my_center|LOCUS_03380 9748 13116 gene locus_tag LOCUS_03390 9748 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence021 63 512 gene locus_tag LOCUS_03400 gene ccmE 63 512 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 protein_id gnl|my_center|LOCUS_03400 1671 535 gene locus_tag LOCUS_03410 1671 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1865 3835 gene locus_tag LOCUS_03420 1865 3835 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 protein_id gnl|my_center|LOCUS_03420 3832 4392 gene locus_tag LOCUS_03430 3832 4392 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 protein_id gnl|my_center|LOCUS_03430 4431 4886 gene locus_tag LOCUS_03440 gene nrfF 4431 4886 CDS product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070642.1 protein_id gnl|my_center|LOCUS_03440 7105 4883 gene locus_tag LOCUS_03450 7105 4883 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074225.1 protein_id gnl|my_center|LOCUS_03450 7186 7671 gene locus_tag LOCUS_03460 gene greB 7186 7671 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074226.1 protein_id gnl|my_center|LOCUS_03460 7747 8574 gene locus_tag LOCUS_03470 7747 8574 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479170.1 protein_id gnl|my_center|LOCUS_03470 9896 8631 gene locus_tag LOCUS_03480 gene rho 9896 8631 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 protein_id gnl|my_center|LOCUS_03480 10384 10058 gene locus_tag LOCUS_03490 gene trxA 10384 10058 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 protein_id gnl|my_center|LOCUS_03490 10595 11851 gene locus_tag LOCUS_03500 gene rhlB 10595 11851 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750771.1 protein_id gnl|my_center|LOCUS_03500 12556 11915 gene locus_tag LOCUS_03510 12556 11915 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098761.1 protein_id gnl|my_center|LOCUS_03510 <13853 12600 gene locus_tag LOCUS_03520 <13853 12600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073547.1:inorganic phosphate transporter >Feature sequence022 <1 2026 gene locus_tag LOCUS_03530 <1 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073287.1:DNA mismatch repair protein MutS 2146 3450 gene locus_tag LOCUS_03540 2146 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4414 3458 gene locus_tag LOCUS_03550 gene rpoS 4414 3458 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073288.1 protein_id gnl|my_center|LOCUS_03550 5390 4557 gene locus_tag LOCUS_03560 5390 4557 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_03560 6282 5503 gene locus_tag LOCUS_03570 gene surE 6282 5503 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 protein_id gnl|my_center|LOCUS_03570 7334 6309 gene locus_tag LOCUS_03580 7334 6309 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073292.1 protein_id gnl|my_center|LOCUS_03580 7813 7328 gene locus_tag LOCUS_03590 gene ispF 7813 7328 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_03590 8527 7817 gene locus_tag LOCUS_03600 gene ispD 8527 7817 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 protein_id gnl|my_center|LOCUS_03600 8821 8540 gene locus_tag LOCUS_03610 gene ftsB 8821 8540 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_03610 10164 8905 gene locus_tag LOCUS_03620 gene eno 10164 8905 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_03620 11880 10249 gene locus_tag LOCUS_03630 11880 10249 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073297.1 protein_id gnl|my_center|LOCUS_03630 13851 12049 gene locus_tag LOCUS_03640 gene relA 13851 12049 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073302.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence023 <1 1216 gene locus_tag LOCUS_03650 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071500.1:DNA primase 1494 3314 gene locus_tag LOCUS_03660 gene rpoD 1494 3314 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071499.1 protein_id gnl|my_center|LOCUS_03660 3503 3579 gene locus_tag LOCUS_t00070 3503 3579 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4165 3608 gene locus_tag LOCUS_03670 4165 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 5845 5018 gene locus_tag LOCUS_03680 5845 5018 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073528.1 protein_id gnl|my_center|LOCUS_03680 6080 7513 gene locus_tag LOCUS_03690 gene hldE 6080 7513 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420990.1 protein_id gnl|my_center|LOCUS_03690 8964 7585 gene locus_tag LOCUS_03700 8964 7585 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_03700 9256 8981 gene locus_tag LOCUS_03710 9256 8981 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_03710 10411 9257 gene locus_tag LOCUS_03720 10411 9257 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_03720 11202 10675 gene locus_tag LOCUS_03730 gene ppa 11202 10675 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056163.1 protein_id gnl|my_center|LOCUS_03730 12489 11284 gene locus_tag LOCUS_03740 12489 11284 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071333.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence024 42 521 gene locus_tag LOCUS_03750 42 521 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_03750 518 2911 gene locus_tag LOCUS_03760 518 2911 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072346.1 protein_id gnl|my_center|LOCUS_03760 2912 3100 gene locus_tag LOCUS_03770 gene ccoS 2912 3100 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300771.1 protein_id gnl|my_center|LOCUS_03770 3078 3770 gene locus_tag LOCUS_03780 3078 3770 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_03780 3802 4740 gene locus_tag LOCUS_03790 gene uspE 3802 4740 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_03790 4907 6787 gene locus_tag LOCUS_03800 4907 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6869 7723 gene locus_tag LOCUS_03810 6869 7723 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_03810 7734 8549 gene locus_tag LOCUS_03820 7734 8549 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_03820 8597 9196 gene locus_tag LOCUS_03830 8597 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9352 10245 gene locus_tag LOCUS_03840 9352 10245 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036727.1 protein_id gnl|my_center|LOCUS_03840 10296 10928 gene locus_tag LOCUS_03850 10296 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 11401 10964 gene locus_tag LOCUS_03860 11401 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 11621 11409 gene locus_tag LOCUS_03870 11621 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12811 11723 gene locus_tag LOCUS_03880 12811 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 12972 13059 gene locus_tag LOCUS_t00080 12972 13059 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 1498 1253 gene locus_tag LOCUS_03890 1498 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1727 2674 gene locus_tag LOCUS_03900 gene corA 1727 2674 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072039.1 protein_id gnl|my_center|LOCUS_03900 2969 2760 gene locus_tag LOCUS_03910 2969 2760 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_03910 5359 3323 gene locus_tag LOCUS_03920 gene ligA 5359 3323 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072805.1 protein_id gnl|my_center|LOCUS_03920 6122 5430 gene locus_tag LOCUS_03930 6122 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7896 6229 gene locus_tag LOCUS_03940 7896 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 9303 7936 gene locus_tag LOCUS_03950 gene radA 9303 7936 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071454.1 protein_id gnl|my_center|LOCUS_03950 10363 9374 gene locus_tag LOCUS_03960 10363 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence026 326 562 gene locus_tag LOCUS_03970 326 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1417 536 gene locus_tag LOCUS_03980 1417 536 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_03980 1955 1443 gene locus_tag LOCUS_03990 1955 1443 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_03990 3588 1957 gene locus_tag LOCUS_04000 gene ctaD 3588 1957 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_04000 4724 3600 gene locus_tag LOCUS_04010 4724 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 5032 6132 gene locus_tag LOCUS_04020 gene trmA 5032 6132 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186987.1 protein_id gnl|my_center|LOCUS_04020 8242 6170 gene locus_tag LOCUS_04030 gene glyS 8242 6170 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 protein_id gnl|my_center|LOCUS_04030 9172 8246 gene locus_tag LOCUS_04040 gene glyQ 9172 8246 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 protein_id gnl|my_center|LOCUS_04040 9418 9257 gene locus_tag LOCUS_04050 9418 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 10916 9744 gene locus_tag LOCUS_04060 gene fadA 10916 9744 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070436.1 protein_id gnl|my_center|LOCUS_04060 <12973 10927 gene locus_tag LOCUS_04070 <12973 10927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070437.1:fatty acid oxidation complex subunit alpha FadB >Feature sequence027 1327 581 gene locus_tag LOCUS_04080 1327 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1959 1477 gene locus_tag LOCUS_04090 1959 1477 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_04090 2567 2361 gene locus_tag LOCUS_04100 2567 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2819 2616 gene locus_tag LOCUS_04110 2819 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3985 4539 gene locus_tag LOCUS_04120 3985 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4690 6075 gene locus_tag LOCUS_04130 4690 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04130 6172 6981 gene locus_tag LOCUS_04140 6172 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04140 7430 7122 gene locus_tag LOCUS_04150 7430 7122 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167082.1 protein_id gnl|my_center|LOCUS_04150 9062 7626 gene locus_tag LOCUS_04160 9062 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 11499 9466 gene locus_tag LOCUS_04170 11499 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 11676 11939 gene locus_tag LOCUS_04180 11676 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence028 475 179 gene locus_tag LOCUS_04190 475 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 589 900 gene locus_tag LOCUS_04200 589 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 1753 1112 gene locus_tag LOCUS_04210 gene folE 1753 1112 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016195.1 protein_id gnl|my_center|LOCUS_04210 4210 2672 gene locus_tag LOCUS_04220 gene glpK 4210 2672 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073911.1 protein_id gnl|my_center|LOCUS_04220 5205 4363 gene locus_tag LOCUS_04230 gene dapD 5205 4363 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071781.1 protein_id gnl|my_center|LOCUS_04230 6184 5348 gene locus_tag LOCUS_04240 gene map 6184 5348 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023305.1 protein_id gnl|my_center|LOCUS_04240 6552 7271 gene locus_tag LOCUS_04250 gene rpsB 6552 7271 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071784.1 protein_id gnl|my_center|LOCUS_04250 7395 8270 gene locus_tag LOCUS_04260 gene tsf 7395 8270 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705094.1 protein_id gnl|my_center|LOCUS_04260 8344 9090 gene locus_tag LOCUS_04270 gene pyrH 8344 9090 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071786.1 protein_id gnl|my_center|LOCUS_04270 9095 9652 gene locus_tag LOCUS_04280 gene frr 9095 9652 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456723.1 protein_id gnl|my_center|LOCUS_04280 9697 10455 gene locus_tag LOCUS_04290 gene uppS 9697 10455 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071788.1 protein_id gnl|my_center|LOCUS_04290 10471 11304 gene locus_tag LOCUS_04300 10471 11304 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071789.1 protein_id gnl|my_center|LOCUS_04300 11308 12507 gene locus_tag LOCUS_04310 gene ispC 11308 12507 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071790.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence029 52 1497 gene locus_tag LOCUS_04320 52 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1576 3222 gene locus_tag LOCUS_04330 1576 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4622 3315 gene locus_tag LOCUS_04340 4622 3315 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_04340 5382 4651 gene locus_tag LOCUS_04350 5382 4651 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 protein_id gnl|my_center|LOCUS_04350 6623 5379 gene locus_tag LOCUS_04360 6623 5379 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073248.1 protein_id gnl|my_center|LOCUS_04360 7188 6661 gene locus_tag LOCUS_04370 7188 6661 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463837.1 protein_id gnl|my_center|LOCUS_04370 8086 7253 gene locus_tag LOCUS_04380 8086 7253 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560714.1 protein_id gnl|my_center|LOCUS_04380 9099 8080 gene locus_tag LOCUS_04390 9099 8080 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819447.1 protein_id gnl|my_center|LOCUS_04390 9743 9177 gene locus_tag LOCUS_04400 9743 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 10232 9801 gene locus_tag LOCUS_04410 10232 9801 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 protein_id gnl|my_center|LOCUS_04410 11743 10418 gene locus_tag LOCUS_04420 11743 10418 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence030 <1 629 gene locus_tag LOCUS_04430 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071399.1:penicillin-binding protein 2 626 1735 gene locus_tag LOCUS_04440 gene rodA 626 1735 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_04440 1737 2726 gene locus_tag LOCUS_04450 gene mltB 1737 2726 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071397.1 protein_id gnl|my_center|LOCUS_04450 2713 3474 gene locus_tag LOCUS_04460 2713 3474 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261453.1 protein_id gnl|my_center|LOCUS_04460 3626 4834 gene locus_tag LOCUS_04470 3626 4834 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071395.1 protein_id gnl|my_center|LOCUS_04470 4925 5191 gene locus_tag LOCUS_04480 gene ybeD 4925 5191 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071394.1 protein_id gnl|my_center|LOCUS_04480 5195 5872 gene locus_tag LOCUS_04490 gene lipB 5195 5872 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_04490 5865 6830 gene locus_tag LOCUS_04500 gene lipA 5865 6830 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071392.1 protein_id gnl|my_center|LOCUS_04500 7095 6844 gene locus_tag LOCUS_04510 7095 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 8783 7203 gene locus_tag LOCUS_04520 gene lnt 8783 7203 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071408.1 protein_id gnl|my_center|LOCUS_04520 9650 8793 gene locus_tag LOCUS_04530 gene corC 9650 8793 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 protein_id gnl|my_center|LOCUS_04530 10131 9676 gene locus_tag LOCUS_04540 gene ybeY 10131 9676 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707018.1 protein_id gnl|my_center|LOCUS_04540 11151 10153 gene locus_tag LOCUS_04550 11151 10153 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210345.1 protein_id gnl|my_center|LOCUS_04550 <12356 11169 gene locus_tag LOCUS_04560 <12356 11169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005649877.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence031 802 158 gene locus_tag LOCUS_04570 802 158 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 protein_id gnl|my_center|LOCUS_04570 2653 809 gene locus_tag LOCUS_04580 gene edd 2653 809 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_04580 3364 2666 gene locus_tag LOCUS_04590 gene pgl 3364 2666 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_04590 4826 3357 gene locus_tag LOCUS_04600 gene zwf 4826 3357 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072454.1 protein_id gnl|my_center|LOCUS_04600 5225 6085 gene locus_tag LOCUS_04610 5225 6085 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072455.1 protein_id gnl|my_center|LOCUS_04610 6150 7598 gene locus_tag LOCUS_04620 gene pyk 6150 7598 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072456.1 protein_id gnl|my_center|LOCUS_04620 9942 7660 gene locus_tag LOCUS_04630 9942 7660 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072457.1 protein_id gnl|my_center|LOCUS_04630 10527 9970 gene locus_tag LOCUS_04640 gene gmhB 10527 9970 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095680.1 protein_id gnl|my_center|LOCUS_04640 10718 10539 gene locus_tag LOCUS_04650 10718 10539 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072733.1 protein_id gnl|my_center|LOCUS_04650 11655 10708 gene locus_tag LOCUS_04660 gene lpxK 11655 10708 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072734.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence032 <1 1897 gene locus_tag LOCUS_04670 <1 1897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072589.1:FAD-binding and (Fe-S)-binding domain-containing protein 1941 4193 gene locus_tag LOCUS_04680 1941 4193 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_04680 5313 4258 gene locus_tag LOCUS_04690 5313 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6435 5386 gene locus_tag LOCUS_04700 6435 5386 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_04700 7244 8710 gene locus_tag LOCUS_04710 7244 8710 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_04710 9384 8707 gene locus_tag LOCUS_04720 9384 8707 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_04720 10088 9384 gene locus_tag LOCUS_04730 10088 9384 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071999.1 protein_id gnl|my_center|LOCUS_04730 11001 10078 gene locus_tag LOCUS_04740 11001 10078 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 protein_id gnl|my_center|LOCUS_04740 <12048 10998 gene locus_tag LOCUS_04750 <12048 10998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925856.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence033 816 40 gene locus_tag LOCUS_04760 816 40 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486862.1 protein_id gnl|my_center|LOCUS_04760 1141 911 gene locus_tag LOCUS_04770 1141 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2061 1156 gene locus_tag LOCUS_04780 2061 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3189 2086 gene locus_tag LOCUS_04790 gene aroB 3189 2086 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070659.1 protein_id gnl|my_center|LOCUS_04790 3719 3204 gene locus_tag LOCUS_04800 gene aroK 3719 3204 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070658.1 protein_id gnl|my_center|LOCUS_04800 4383 6884 gene locus_tag LOCUS_04810 4383 6884 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 protein_id gnl|my_center|LOCUS_04810 7068 7727 gene locus_tag LOCUS_04820 7068 7727 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 protein_id gnl|my_center|LOCUS_04820 8747 8094 gene locus_tag LOCUS_04830 8747 8094 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070698.1 protein_id gnl|my_center|LOCUS_04830 9789 8812 gene locus_tag LOCUS_04840 9789 8812 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070712.1 protein_id gnl|my_center|LOCUS_04840 10675 9782 gene locus_tag LOCUS_04850 10675 9782 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070713.1 protein_id gnl|my_center|LOCUS_04850 <12036 10735 gene locus_tag LOCUS_04860 <12036 10735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074260.1:DNA polymerase I >Feature sequence034 <1 868 gene locus_tag LOCUS_04870 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073099.1:flagellar biosynthesis protein FlhB 947 3043 gene locus_tag LOCUS_04880 gene flhA 947 3043 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073098.1 protein_id gnl|my_center|LOCUS_04880 3053 4528 gene locus_tag LOCUS_04890 gene flhF 3053 4528 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073097.1 protein_id gnl|my_center|LOCUS_04890 4533 5417 gene locus_tag LOCUS_04900 4533 5417 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 protein_id gnl|my_center|LOCUS_04900 5410 6144 gene locus_tag LOCUS_04910 5410 6144 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073095.1 protein_id gnl|my_center|LOCUS_04910 6171 6554 gene locus_tag LOCUS_04920 gene cheY 6171 6554 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_04920 6568 7329 gene locus_tag LOCUS_04930 6568 7329 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073094.1 protein_id gnl|my_center|LOCUS_04930 7350 9395 gene locus_tag LOCUS_04940 7350 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 9446 10543 gene locus_tag LOCUS_04950 9446 10543 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073092.1 protein_id gnl|my_center|LOCUS_04950 10677 11471 gene locus_tag LOCUS_04960 10677 11471 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence035 271 1728 gene locus_tag LOCUS_04970 271 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 2191 3426 gene locus_tag LOCUS_04980 2191 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 3607 4035 gene locus_tag LOCUS_04990 3607 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4106 4723 gene locus_tag LOCUS_05000 4106 4723 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887115.1 protein_id gnl|my_center|LOCUS_05000 4724 6859 gene locus_tag LOCUS_05010 4724 6859 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_05010 7320 6856 gene locus_tag LOCUS_05020 7320 6856 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528320.1 protein_id gnl|my_center|LOCUS_05020 9415 7430 gene locus_tag LOCUS_05030 9415 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9619 10110 gene locus_tag LOCUS_05040 gene def 9619 10110 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279461.1 protein_id gnl|my_center|LOCUS_05040 10199 10435 gene locus_tag LOCUS_05050 10199 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 11371 10463 gene locus_tag LOCUS_05060 11371 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence036 3 449 gene locus_tag LOCUS_05070 3 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 482 985 gene locus_tag LOCUS_05080 gene cvpA 482 985 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262102.1 protein_id gnl|my_center|LOCUS_05080 1026 1787 gene locus_tag LOCUS_05090 gene miaE 1026 1787 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262075.1 protein_id gnl|my_center|LOCUS_05090 2535 1732 gene locus_tag LOCUS_05100 2535 1732 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071911.1 protein_id gnl|my_center|LOCUS_05100 3032 2535 gene locus_tag LOCUS_05110 3032 2535 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_05110 3225 4601 gene locus_tag LOCUS_05120 gene cysS 3225 4601 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071913.1 protein_id gnl|my_center|LOCUS_05120 5438 4632 gene locus_tag LOCUS_05130 5438 4632 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261672.1 protein_id gnl|my_center|LOCUS_05130 6592 5603 gene locus_tag LOCUS_05140 gene sohB 6592 5603 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925731.1 protein_id gnl|my_center|LOCUS_05140 7304 6726 gene locus_tag LOCUS_05150 gene sodB 7304 6726 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072792.1 protein_id gnl|my_center|LOCUS_05150 7663 8001 gene locus_tag LOCUS_05160 7663 8001 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010673955.1 protein_id gnl|my_center|LOCUS_05160 9393 8068 gene locus_tag LOCUS_05170 9393 8068 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072696.1 protein_id gnl|my_center|LOCUS_05170 9699 10304 gene locus_tag LOCUS_05180 9699 10304 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_05180 11126 10470 gene locus_tag LOCUS_05190 gene rnt 11126 10470 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300258.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence037 3408 643 gene locus_tag LOCUS_05200 3408 643 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_05200 4769 3489 gene locus_tag LOCUS_05210 4769 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 5020 4944 gene locus_tag LOCUS_t00090 5020 4944 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5136 5045 gene locus_tag LOCUS_t00100 5136 5045 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5615 5367 gene locus_tag LOCUS_05220 5615 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8672 5943 gene locus_tag LOCUS_05230 gene alaS 8672 5943 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073284.1 protein_id gnl|my_center|LOCUS_05230 9317 8862 gene locus_tag LOCUS_05240 gene recX 9317 8862 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 protein_id gnl|my_center|LOCUS_05240 10370 9333 gene locus_tag LOCUS_05250 gene recA 10370 9333 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence038 1491 31 gene locus_tag LOCUS_05260 gene murC 1491 31 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073899.1 protein_id gnl|my_center|LOCUS_05260 2580 1513 gene locus_tag LOCUS_05270 gene murG 2580 1513 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073900.1 protein_id gnl|my_center|LOCUS_05270 3766 2597 gene locus_tag LOCUS_05280 gene ftsW 3766 2597 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073901.1 protein_id gnl|my_center|LOCUS_05280 5085 3763 gene locus_tag LOCUS_05290 gene murD 5085 3763 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073902.1 protein_id gnl|my_center|LOCUS_05290 6186 5101 gene locus_tag LOCUS_05300 gene mraY 6186 5101 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073903.1 protein_id gnl|my_center|LOCUS_05300 7562 6180 gene locus_tag LOCUS_05310 gene murF 7562 6180 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073904.1 protein_id gnl|my_center|LOCUS_05310 9019 7559 gene locus_tag LOCUS_05320 gene murE 9019 7559 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073905.1 protein_id gnl|my_center|LOCUS_05320 10807 9035 gene locus_tag LOCUS_05330 10807 9035 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence039 704 138 gene locus_tag LOCUS_05340 704 138 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_05340 1680 715 gene locus_tag LOCUS_05350 gene thiL 1680 715 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073311.1 protein_id gnl|my_center|LOCUS_05350 2257 1826 gene locus_tag LOCUS_05360 gene nusB 2257 1826 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073312.1 protein_id gnl|my_center|LOCUS_05360 2742 2254 gene locus_tag LOCUS_05370 gene ribE 2742 2254 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073313.1 protein_id gnl|my_center|LOCUS_05370 3484 2852 gene locus_tag LOCUS_05380 3484 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4615 3512 gene locus_tag LOCUS_05390 gene ribD 4615 3512 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073316.1 protein_id gnl|my_center|LOCUS_05390 5103 4624 gene locus_tag LOCUS_05400 gene nrdR 5103 4624 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073317.1 protein_id gnl|my_center|LOCUS_05400 6486 5227 gene locus_tag LOCUS_05410 6486 5227 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073318.1 protein_id gnl|my_center|LOCUS_05410 6678 8342 gene locus_tag LOCUS_05420 gene ettA 6678 8342 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073319.1 protein_id gnl|my_center|LOCUS_05420 9209 8364 gene locus_tag LOCUS_05430 9209 8364 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073084.1 protein_id gnl|my_center|LOCUS_05430 9636 9202 gene locus_tag LOCUS_05440 9636 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10124 9636 gene locus_tag LOCUS_05450 10124 9636 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_05450 <11014 10152 gene locus_tag LOCUS_05460 <11014 10152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073089.1:chemotaxis protein CheW >Feature sequence040 390 677 gene locus_tag LOCUS_05470 390 677 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073689.1 protein_id gnl|my_center|LOCUS_05470 679 942 gene locus_tag LOCUS_05480 679 942 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073688.1 protein_id gnl|my_center|LOCUS_05480 950 2239 gene locus_tag LOCUS_05490 gene murA 950 2239 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073687.1 protein_id gnl|my_center|LOCUS_05490 3644 2298 gene locus_tag LOCUS_05500 gene degQ 3644 2298 CDS product Do family serine endopeptidase DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073684.1 protein_id gnl|my_center|LOCUS_05500 4108 3713 gene locus_tag LOCUS_05510 4108 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4219 5310 gene locus_tag LOCUS_05520 gene zapE 4219 5310 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073683.1 protein_id gnl|my_center|LOCUS_05520 5556 5984 gene locus_tag LOCUS_05530 gene rplM 5556 5984 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_05530 5998 6390 gene locus_tag LOCUS_05540 gene rpsI 5998 6390 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829824.1 protein_id gnl|my_center|LOCUS_05540 6681 7274 gene locus_tag LOCUS_05550 gene petA 6681 7274 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070938.1 protein_id gnl|my_center|LOCUS_05550 7271 8485 gene locus_tag LOCUS_05560 7271 8485 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070939.1 protein_id gnl|my_center|LOCUS_05560 8482 9189 gene locus_tag LOCUS_05570 8482 9189 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_05570 9281 9916 gene locus_tag LOCUS_05580 gene sspA 9281 9916 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_05580 9913 10329 gene locus_tag LOCUS_05590 9913 10329 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070942.1 protein_id gnl|my_center|LOCUS_05590 <10908 10383 gene locus_tag LOCUS_05600 <10908 10383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005693234.1:protein-disulfide reductase DsbD >Feature sequence041 616 788 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcatcagcttgttcatttaatg 2741 2352 gene locus_tag LOCUS_05610 2741 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3839 2829 gene locus_tag LOCUS_05620 3839 2829 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072968.1 protein_id gnl|my_center|LOCUS_05620 4984 3857 gene locus_tag LOCUS_05630 4984 3857 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072969.1 protein_id gnl|my_center|LOCUS_05630 6208 4994 gene locus_tag LOCUS_05640 gene fabB 6208 4994 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925736.1 protein_id gnl|my_center|LOCUS_05640 6310 8217 gene locus_tag LOCUS_05650 gene mnmC 6310 8217 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706179.1 protein_id gnl|my_center|LOCUS_05650 8391 9920 gene locus_tag LOCUS_05660 8391 9920 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140233811.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence042 1137 526 gene locus_tag LOCUS_05670 1137 526 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705475.1 protein_id gnl|my_center|LOCUS_05670 2560 1247 gene locus_tag LOCUS_05680 2560 1247 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071361.1 protein_id gnl|my_center|LOCUS_05680 4329 2617 gene locus_tag LOCUS_05690 4329 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5799 4492 gene locus_tag LOCUS_05700 gene ompN 5799 4492 CDS product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837937.1 protein_id gnl|my_center|LOCUS_05700 6113 8173 gene locus_tag LOCUS_05710 gene dinG 6113 8173 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 protein_id gnl|my_center|LOCUS_05710 9027 8170 gene locus_tag LOCUS_05720 gene nlpI 9027 8170 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071440.1 protein_id gnl|my_center|LOCUS_05720 <10705 9125 gene locus_tag LOCUS_05730 <10705 9125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071439.1:polyribonucleotide nucleotidyltransferase >Feature sequence043 291 49 gene locus_tag LOCUS_05740 291 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 490 332 gene locus_tag LOCUS_05750 490 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 1234 653 gene locus_tag LOCUS_05760 1234 653 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753206.1 protein_id gnl|my_center|LOCUS_05760 1724 1221 gene locus_tag LOCUS_05770 1724 1221 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_05770 1858 2679 gene locus_tag LOCUS_05780 gene queF 1858 2679 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071765.1 protein_id gnl|my_center|LOCUS_05780 2764 3672 gene locus_tag LOCUS_05790 2764 3672 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263064.1 protein_id gnl|my_center|LOCUS_05790 3682 4131 gene locus_tag LOCUS_05800 3682 4131 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454539.1 protein_id gnl|my_center|LOCUS_05800 4155 4337 gene locus_tag LOCUS_05810 4155 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4501 9798 gene locus_tag LOCUS_05820 4501 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence044 2053 2241 gene locus_tag LOCUS_05830 2053 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3515 2265 gene locus_tag LOCUS_05840 gene umuC 3515 2265 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816146.1 protein_id gnl|my_center|LOCUS_05840 3979 3515 gene locus_tag LOCUS_05850 gene umuD 3979 3515 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705912.1 protein_id gnl|my_center|LOCUS_05850 4218 7103 gene locus_tag LOCUS_05860 4218 7103 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_05860 8769 7180 gene locus_tag LOCUS_05870 8769 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence045 <1 524 gene locus_tag LOCUS_05880 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074252.1:class I SAM-dependent methyltransferase 2005 578 gene locus_tag LOCUS_05890 gene lpdA 2005 578 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 protein_id gnl|my_center|LOCUS_05890 3713 2145 gene locus_tag LOCUS_05900 gene aceF 3713 2145 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070783.1 protein_id gnl|my_center|LOCUS_05900 6395 3726 gene locus_tag LOCUS_05910 gene aceE 6395 3726 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070782.1 protein_id gnl|my_center|LOCUS_05910 7672 6965 gene locus_tag LOCUS_05920 7672 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8429 7845 gene locus_tag LOCUS_05930 gene ampD 8429 7845 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070779.1 protein_id gnl|my_center|LOCUS_05930 8668 9516 gene locus_tag LOCUS_05940 gene nadC 8668 9516 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence046 780 1283 gene locus_tag LOCUS_05950 780 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2075 1293 gene locus_tag LOCUS_05960 2075 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2270 3121 gene locus_tag LOCUS_05970 2270 3121 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246662.1 protein_id gnl|my_center|LOCUS_05970 3239 3958 gene locus_tag LOCUS_05980 3239 3958 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_05980 3958 5388 gene locus_tag LOCUS_05990 3958 5388 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945973.1 protein_id gnl|my_center|LOCUS_05990 5385 6914 gene locus_tag LOCUS_06000 5385 6914 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 protein_id gnl|my_center|LOCUS_06000 6971 8197 gene locus_tag LOCUS_06010 6971 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 8481 8212 gene locus_tag LOCUS_06020 8481 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 9535 8642 gene locus_tag LOCUS_06030 9535 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence047 530 1699 gene locus_tag LOCUS_06040 530 1699 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071414.1 protein_id gnl|my_center|LOCUS_06040 1815 2423 gene locus_tag LOCUS_06050 gene pth 1815 2423 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693775.1 protein_id gnl|my_center|LOCUS_06050 2445 3536 gene locus_tag LOCUS_06060 gene ychF 2445 3536 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418193.1 protein_id gnl|my_center|LOCUS_06060 3685 3761 gene locus_tag LOCUS_t00110 3685 3761 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3774 3858 gene locus_tag LOCUS_t00120 3774 3858 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3872 3946 gene locus_tag LOCUS_t00130 3872 3946 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3988 4062 gene locus_tag LOCUS_t00140 3988 4062 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5598 4108 gene locus_tag LOCUS_06070 5598 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 7379 5676 gene locus_tag LOCUS_06080 7379 5676 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261689.1 protein_id gnl|my_center|LOCUS_06080 8484 7519 gene locus_tag LOCUS_06090 8484 7519 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073601.1 protein_id gnl|my_center|LOCUS_06090 9430 8573 gene locus_tag LOCUS_06100 gene ispE 9430 8573 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073600.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence048 247 1590 gene locus_tag LOCUS_06110 gene pmbA 247 1590 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073785.1 protein_id gnl|my_center|LOCUS_06110 1966 1679 gene locus_tag LOCUS_06120 gene hpf 1966 1679 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_06120 3355 1982 gene locus_tag LOCUS_06130 3355 1982 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 protein_id gnl|my_center|LOCUS_06130 4203 3472 gene locus_tag LOCUS_06140 gene lptB 4203 3472 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_06140 4685 4203 gene locus_tag LOCUS_06150 gene lptA 4685 4203 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467803.1 protein_id gnl|my_center|LOCUS_06150 5241 4690 gene locus_tag LOCUS_06160 5241 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5795 5238 gene locus_tag LOCUS_06170 gene kdsC 5795 5238 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_06170 6798 5797 gene locus_tag LOCUS_06180 6798 5797 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073694.1 protein_id gnl|my_center|LOCUS_06180 7728 6814 gene locus_tag LOCUS_06190 7728 6814 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_06190 7950 8756 gene locus_tag LOCUS_06200 gene mlaF 7950 8756 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_06200 8753 9532 gene locus_tag LOCUS_06210 gene mlaE 8753 9532 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073692.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence049 128 997 gene locus_tag LOCUS_06220 gene hslO 128 997 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070560.1 protein_id gnl|my_center|LOCUS_06220 1019 2482 gene locus_tag LOCUS_06230 gene ubiD 1019 2482 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070851.1 protein_id gnl|my_center|LOCUS_06230 2508 3191 gene locus_tag LOCUS_06240 gene fre 2508 3191 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070849.1 protein_id gnl|my_center|LOCUS_06240 4082 3213 gene locus_tag LOCUS_06250 gene ubiA 4082 3213 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772835.1 protein_id gnl|my_center|LOCUS_06250 6267 4093 gene locus_tag LOCUS_06260 gene uvrD 6267 4093 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070819.1 protein_id gnl|my_center|LOCUS_06260 7085 6378 gene locus_tag LOCUS_06270 7085 6378 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073964.1 protein_id gnl|my_center|LOCUS_06270 8007 7054 gene locus_tag LOCUS_06280 gene xerC 8007 7054 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925924.1 protein_id gnl|my_center|LOCUS_06280 8653 8000 gene locus_tag LOCUS_06290 8653 8000 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084657.1 protein_id gnl|my_center|LOCUS_06290 9518 8664 gene locus_tag LOCUS_06300 gene dapF 9518 8664 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence050 505 915 gene locus_tag LOCUS_06310 505 915 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070600.1 protein_id gnl|my_center|LOCUS_06310 1728 916 gene locus_tag LOCUS_06320 gene murI 1728 916 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070599.1 protein_id gnl|my_center|LOCUS_06320 1957 4329 gene locus_tag LOCUS_06330 gene plsB 1957 4329 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074199.1 protein_id gnl|my_center|LOCUS_06330 4929 4381 gene locus_tag LOCUS_06340 4929 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5130 5552 gene locus_tag LOCUS_06350 5130 5552 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070537.1 protein_id gnl|my_center|LOCUS_06350 6421 5549 gene locus_tag LOCUS_06360 gene glpG 6421 5549 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_06360 6708 6400 gene locus_tag LOCUS_06370 6708 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6849 8093 gene locus_tag LOCUS_06380 6849 8093 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_06380 8626 8123 gene locus_tag LOCUS_06390 gene coaD 8626 8123 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_06390 <9572 8673 gene locus_tag LOCUS_06400 <9572 8673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070528.1:mechanosensitive ion channel >Feature sequence051 <1 575 gene locus_tag LOCUS_06410 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001282345.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 1207 584 gene locus_tag LOCUS_06420 1207 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 1544 1359 gene locus_tag LOCUS_06430 1544 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1774 3660 gene locus_tag LOCUS_06440 gene mnmG 1774 3660 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074340.1 protein_id gnl|my_center|LOCUS_06440 3690 4310 gene locus_tag LOCUS_06450 gene rsmG 3690 4310 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074339.1 protein_id gnl|my_center|LOCUS_06450 4337 5146 gene locus_tag LOCUS_06460 4337 5146 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_06460 5137 6030 gene locus_tag LOCUS_06470 5137 6030 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 protein_id gnl|my_center|LOCUS_06470 6585 7385 gene locus_tag LOCUS_06480 gene atpB 6585 7385 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_06480 7429 7686 gene locus_tag LOCUS_06490 gene atpE 7429 7686 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083840.1 protein_id gnl|my_center|LOCUS_06490 7706 8176 gene locus_tag LOCUS_06500 gene atpF 7706 8176 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074334.1 protein_id gnl|my_center|LOCUS_06500 8191 8724 gene locus_tag LOCUS_06510 gene atpH 8191 8724 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074333.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence052 3273 2335 gene locus_tag LOCUS_06520 gene ribF 3273 2335 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_06520 4964 3408 gene locus_tag LOCUS_06530 gene murJ 4964 3408 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 protein_id gnl|my_center|LOCUS_06530 5254 5517 gene locus_tag LOCUS_06540 gene rpsT 5254 5517 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 protein_id gnl|my_center|LOCUS_06540 7016 5592 gene locus_tag LOCUS_06550 7016 5592 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262527.1 protein_id gnl|my_center|LOCUS_06550 7500 8462 gene locus_tag LOCUS_06560 gene tal 7500 8462 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073375.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence053 707 534 gene locus_tag LOCUS_06570 707 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1211 951 gene locus_tag LOCUS_06580 1211 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1285 2562 gene locus_tag LOCUS_06590 1285 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3834 2653 gene locus_tag LOCUS_06600 3834 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4102 4551 gene locus_tag LOCUS_06610 4102 4551 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267595.1 protein_id gnl|my_center|LOCUS_06610 4548 5795 gene locus_tag LOCUS_06620 4548 5795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003039182.1 protein_id gnl|my_center|LOCUS_06620 5896 6279 gene locus_tag LOCUS_06630 5896 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6535 7716 gene locus_tag LOCUS_06640 6535 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 8263 8081 gene locus_tag LOCUS_06650 8263 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence054 1397 381 gene locus_tag LOCUS_06660 1397 381 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_06660 1591 1505 gene locus_tag LOCUS_t00150 1591 1505 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1687 1614 gene locus_tag LOCUS_t00160 1687 1614 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2420 1803 gene locus_tag LOCUS_06670 2420 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2573 3706 gene locus_tag LOCUS_06680 gene queG 2573 3706 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386325.1 protein_id gnl|my_center|LOCUS_06680 4487 3708 gene locus_tag LOCUS_06690 gene btuF 4487 3708 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461204.1 protein_id gnl|my_center|LOCUS_06690 5128 4550 gene locus_tag LOCUS_06700 5128 4550 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188471799.1 protein_id gnl|my_center|LOCUS_06700 6739 5153 gene locus_tag LOCUS_06710 6739 5153 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_06710 7977 7042 gene locus_tag LOCUS_06720 7977 7042 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946658.1 protein_id gnl|my_center|LOCUS_06720 8726 7977 gene locus_tag LOCUS_06730 8726 7977 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073035.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence055 340 576 gene locus_tag LOCUS_06740 gene xseB 340 576 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071706.1 protein_id gnl|my_center|LOCUS_06740 573 1466 gene locus_tag LOCUS_06750 gene ispA 573 1466 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071705.1 protein_id gnl|my_center|LOCUS_06750 1483 3348 gene locus_tag LOCUS_06760 gene dxs 1483 3348 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071704.1 protein_id gnl|my_center|LOCUS_06760 3793 3359 gene locus_tag LOCUS_06770 gene fur 3793 3359 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705427.1 protein_id gnl|my_center|LOCUS_06770 4253 5446 gene locus_tag LOCUS_06780 gene ackA 4253 5446 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072820.1 protein_id gnl|my_center|LOCUS_06780 5467 7599 gene locus_tag LOCUS_06790 gene pta 5467 7599 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072821.1 protein_id gnl|my_center|LOCUS_06790 7701 8126 gene locus_tag LOCUS_06800 7701 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 <9036 8194 gene locus_tag LOCUS_06810 <9036 8194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000141537.1:type I restriction endonuclease subunit R >Feature sequence056 20 96 gene locus_tag LOCUS_t00170 20 96 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 247 2853 gene locus_tag LOCUS_06820 gene pepN 247 2853 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193826.1 protein_id gnl|my_center|LOCUS_06820 2873 3100 gene locus_tag LOCUS_06830 2873 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3250 8094 gene locus_tag LOCUS_06840 3250 8094 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence057 747 1937 gene locus_tag LOCUS_06850 747 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4659 1987 gene locus_tag LOCUS_06860 4659 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5210 6070 gene locus_tag LOCUS_06870 5210 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence058 528 4172 gene locus_tag LOCUS_06880 528 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4329 4589 gene locus_tag LOCUS_06890 4329 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 4608 4838 gene locus_tag LOCUS_06900 4608 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5178 4855 gene locus_tag LOCUS_06910 5178 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5610 6938 gene locus_tag LOCUS_06920 5610 6938 CDS product serine/threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706270.1 protein_id gnl|my_center|LOCUS_06920 7271 6993 gene locus_tag LOCUS_06930 7271 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7416 7340 gene locus_tag LOCUS_t00180 7416 7340 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7498 7423 gene locus_tag LOCUS_t00190 7498 7423 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7607 7533 gene locus_tag LOCUS_t00200 7607 7533 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <8803 7715 gene locus_tag LOCUS_06940 <8803 7715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073984.1:DNA helicase Rep >Feature sequence059 665 589 gene locus_tag LOCUS_t00210 665 589 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 870 2972 gene locus_tag LOCUS_06950 gene rlmKL 870 2972 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071965.1 protein_id gnl|my_center|LOCUS_06950 2986 3198 gene locus_tag LOCUS_06960 2986 3198 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 protein_id gnl|my_center|LOCUS_06960 3195 5090 gene locus_tag LOCUS_06970 3195 5090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071967.1 protein_id gnl|my_center|LOCUS_06970 6418 5087 gene locus_tag LOCUS_06980 gene xseA 6418 5087 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073173.1 protein_id gnl|my_center|LOCUS_06980 7943 6537 gene locus_tag LOCUS_06990 7943 6537 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882045.1 protein_id gnl|my_center|LOCUS_06990 8316 8065 gene locus_tag LOCUS_07000 8316 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence060 1498 2367 gene locus_tag LOCUS_07010 1498 2367 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_07010 2360 3178 gene locus_tag LOCUS_07020 2360 3178 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 protein_id gnl|my_center|LOCUS_07020 3269 3871 gene locus_tag LOCUS_07030 3269 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3890 4195 gene locus_tag LOCUS_07040 3890 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5062 4199 gene locus_tag LOCUS_07050 gene folD 5062 4199 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 protein_id gnl|my_center|LOCUS_07050 5749 5069 gene locus_tag LOCUS_07060 gene nth 5749 5069 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706455.1 protein_id gnl|my_center|LOCUS_07060 6442 5753 gene locus_tag LOCUS_07070 6442 5753 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261584.1 protein_id gnl|my_center|LOCUS_07070 7068 6448 gene locus_tag LOCUS_07080 gene rsxG 7068 6448 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954368.1 protein_id gnl|my_center|LOCUS_07080 8101 7073 gene locus_tag LOCUS_07090 gene rsxD 8101 7073 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210599.1 protein_id gnl|my_center|LOCUS_07090 <8750 8098 gene locus_tag LOCUS_07100 <8750 8098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_124232787.1:electron transport complex subunit RsxC >Feature sequence061 805 125 gene locus_tag LOCUS_07110 805 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1813 809 gene locus_tag LOCUS_07120 1813 809 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 protein_id gnl|my_center|LOCUS_07120 2113 2847 gene locus_tag LOCUS_07130 2113 2847 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 protein_id gnl|my_center|LOCUS_07130 3795 2839 gene locus_tag LOCUS_07140 gene dusA 3795 2839 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_07140 6251 3948 gene locus_tag LOCUS_07150 6251 3948 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073768.1 protein_id gnl|my_center|LOCUS_07150 6459 6737 gene locus_tag LOCUS_07160 gene metJ 6459 6737 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005432736.1 protein_id gnl|my_center|LOCUS_07160 7183 6815 gene locus_tag LOCUS_07170 7183 6815 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071536.1 protein_id gnl|my_center|LOCUS_07170 7545 8462 gene locus_tag LOCUS_07180 gene folE2 7545 8462 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408083.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence062 1149 73 gene locus_tag LOCUS_07190 gene queA 1149 73 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073010.1 protein_id gnl|my_center|LOCUS_07190 1330 2244 gene locus_tag LOCUS_07200 gene rdgC 1330 2244 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071725.1 protein_id gnl|my_center|LOCUS_07200 2410 3471 gene locus_tag LOCUS_07210 2410 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3496 4842 gene locus_tag LOCUS_07220 gene ppnN 3496 4842 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071722.1 protein_id gnl|my_center|LOCUS_07220 4852 5547 gene locus_tag LOCUS_07230 4852 5547 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_07230 5986 5552 gene locus_tag LOCUS_07240 gene ndk 5986 5552 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 protein_id gnl|my_center|LOCUS_07240 6535 6194 gene locus_tag LOCUS_07250 gene fdx 6535 6194 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004713939.1 protein_id gnl|my_center|LOCUS_07250 8402 6543 gene locus_tag LOCUS_07260 gene hscA 8402 6543 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072280.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence063 106 684 gene locus_tag LOCUS_07270 gene nfuA 106 684 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458964.1 protein_id gnl|my_center|LOCUS_07270 1922 681 gene locus_tag LOCUS_07280 1922 681 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 protein_id gnl|my_center|LOCUS_07280 2806 2054 gene locus_tag LOCUS_07290 2806 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3930 2908 gene locus_tag LOCUS_07300 gene rpoH 3930 2908 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159621.1 protein_id gnl|my_center|LOCUS_07300 4908 3958 gene locus_tag LOCUS_07310 gene ftsX 4908 3958 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074182.1 protein_id gnl|my_center|LOCUS_07310 5578 4895 gene locus_tag LOCUS_07320 gene ftsE 5578 4895 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 protein_id gnl|my_center|LOCUS_07320 6956 5583 gene locus_tag LOCUS_07330 gene ftsY 6956 5583 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099141.1 protein_id gnl|my_center|LOCUS_07330 7099 7710 gene locus_tag LOCUS_07340 gene rsmD 7099 7710 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074185.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence064 435 1184 gene locus_tag LOCUS_07350 435 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1944 1153 gene locus_tag LOCUS_07360 1944 1153 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210870.1 protein_id gnl|my_center|LOCUS_07360 2103 2585 gene locus_tag LOCUS_07370 2103 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3452 2589 gene locus_tag LOCUS_07380 3452 2589 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419994.1 protein_id gnl|my_center|LOCUS_07380 3790 6393 gene locus_tag LOCUS_07390 gene acnB 3790 6393 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070790.1 protein_id gnl|my_center|LOCUS_07390 6915 6445 gene locus_tag LOCUS_07400 6915 6445 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_07400 7209 8282 gene locus_tag LOCUS_07410 gene hemE 7209 8282 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095015.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence065 2 913 gene locus_tag LOCUS_07420 2 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1328 888 gene locus_tag LOCUS_07430 1328 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2437 1331 gene locus_tag LOCUS_07440 2437 1331 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705680.1 protein_id gnl|my_center|LOCUS_07440 2789 2517 gene locus_tag LOCUS_07450 2789 2517 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928379.1 protein_id gnl|my_center|LOCUS_07450 4194 2791 gene locus_tag LOCUS_07460 gene trkA 4194 2791 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070445.1 protein_id gnl|my_center|LOCUS_07460 5489 4191 gene locus_tag LOCUS_07470 gene rsmB 5489 4191 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070446.1 protein_id gnl|my_center|LOCUS_07470 6439 5486 gene locus_tag LOCUS_07480 gene fmt 6439 5486 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 protein_id gnl|my_center|LOCUS_07480 6974 6462 gene locus_tag LOCUS_07490 gene def 6974 6462 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070448.1 protein_id gnl|my_center|LOCUS_07490 7277 7750 gene locus_tag LOCUS_07500 7277 7750 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070451.1 protein_id gnl|my_center|LOCUS_07500 8120 7818 gene locus_tag LOCUS_07510 gene scyA 8120 7818 CDS product monoheme cytochrome c5 ScyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence066 378 1412 gene locus_tag LOCUS_07520 gene tdh 378 1412 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_07520 2224 1409 gene locus_tag LOCUS_07530 gene mutM 2224 1409 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074312.1 protein_id gnl|my_center|LOCUS_07530 2696 2250 gene locus_tag LOCUS_07540 2696 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 2792 3646 gene locus_tag LOCUS_07550 2792 3646 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074090.1 protein_id gnl|my_center|LOCUS_07550 3785 5380 gene locus_tag LOCUS_07560 3785 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5461 6156 gene locus_tag LOCUS_07570 5461 6156 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168613.1 protein_id gnl|my_center|LOCUS_07570 7469 6171 gene locus_tag LOCUS_07580 7469 6171 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070644.1 protein_id gnl|my_center|LOCUS_07580 7557 8126 gene locus_tag LOCUS_07590 7557 8126 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444481.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence067 249 560 gene locus_tag LOCUS_07600 gene cyaY 249 560 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073970.1 protein_id gnl|my_center|LOCUS_07600 2977 617 gene locus_tag LOCUS_07610 2977 617 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459083.1 protein_id gnl|my_center|LOCUS_07610 3123 4055 gene locus_tag LOCUS_07620 gene hemC 3123 4055 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 protein_id gnl|my_center|LOCUS_07620 4064 4807 gene locus_tag LOCUS_07630 4064 4807 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 protein_id gnl|my_center|LOCUS_07630 4825 5865 gene locus_tag LOCUS_07640 4825 5865 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995370.1 protein_id gnl|my_center|LOCUS_07640 5868 7073 gene locus_tag LOCUS_07650 5868 7073 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073975.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence068 <1 1025 gene locus_tag LOCUS_07660 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073009.1:tRNA guanosine(34) transglycosylase Tgt 1029 1361 gene locus_tag LOCUS_07670 gene yajC 1029 1361 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 protein_id gnl|my_center|LOCUS_07670 1383 3224 gene locus_tag LOCUS_07680 gene secD 1383 3224 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073007.1 protein_id gnl|my_center|LOCUS_07680 3234 4169 gene locus_tag LOCUS_07690 gene secF 3234 4169 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073006.1 protein_id gnl|my_center|LOCUS_07690 4287 4889 gene locus_tag LOCUS_07700 4287 4889 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073871.1 protein_id gnl|my_center|LOCUS_07700 6496 4886 gene locus_tag LOCUS_07710 6496 4886 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence069 555 238 gene locus_tag LOCUS_07720 555 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07720 1299 571 gene locus_tag LOCUS_07730 1299 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07730 1672 1971 gene locus_tag LOCUS_07740 gene iss 1672 1971 CDS product increased serum survival lipoprotein Iss inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 protein_id gnl|my_center|LOCUS_07740 2086 2250 gene locus_tag LOCUS_07750 2086 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2628 2320 gene locus_tag LOCUS_07760 2628 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2982 3716 gene locus_tag LOCUS_07770 2982 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 3912 5525 gene locus_tag LOCUS_07780 3912 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6201 5584 gene locus_tag LOCUS_07790 6201 5584 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444579.1 protein_id gnl|my_center|LOCUS_07790 6863 6195 gene locus_tag LOCUS_07800 6863 6195 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705474.1 protein_id gnl|my_center|LOCUS_07800 7680 6925 gene locus_tag LOCUS_07810 7680 6925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482853.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence070 1423 1704 gene locus_tag LOCUS_07820 1423 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2129 2506 gene locus_tag LOCUS_07830 2129 2506 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261698.1 protein_id gnl|my_center|LOCUS_07830 3316 2555 gene locus_tag LOCUS_07840 gene panC 3316 2555 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948362.1 protein_id gnl|my_center|LOCUS_07840 4134 3313 gene locus_tag LOCUS_07850 gene panB 4134 3313 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029629.1 protein_id gnl|my_center|LOCUS_07850 4878 4150 gene locus_tag LOCUS_07860 gene panG 4878 4150 CDS product 2-dehydropantoate 2-reductase PanG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022186.1 protein_id gnl|my_center|LOCUS_07860 7787 4971 gene locus_tag LOCUS_07870 7787 4971 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence071 1090 479 gene locus_tag LOCUS_07880 1090 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 1455 2234 gene locus_tag LOCUS_07890 gene kdsB 1455 2234 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_07890 4057 2231 gene locus_tag LOCUS_07900 4057 2231 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_07900 4488 4862 gene locus_tag LOCUS_07910 4488 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5687 4926 gene locus_tag LOCUS_07920 5687 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6986 6192 gene locus_tag LOCUS_07930 6986 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence072 <1 1444 gene locus_tag LOCUS_07940 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071022.1:chaperonin GroEL 1580 2038 gene locus_tag LOCUS_07950 1580 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2171 2716 gene locus_tag LOCUS_07960 2171 2716 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_07960 2765 4108 gene locus_tag LOCUS_07970 2765 4108 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_07970 4105 5109 gene locus_tag LOCUS_07980 4105 5109 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984106.1 protein_id gnl|my_center|LOCUS_07980 5554 5117 gene locus_tag LOCUS_07990 5554 5117 CDS product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019821.1 protein_id gnl|my_center|LOCUS_07990 6619 5579 gene locus_tag LOCUS_08000 6619 5579 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402542.1 protein_id gnl|my_center|LOCUS_08000 7708 6620 gene locus_tag LOCUS_08010 7708 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence073 2064 877 gene locus_tag LOCUS_08020 gene bamB 2064 877 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073185.1 protein_id gnl|my_center|LOCUS_08020 2689 2078 gene locus_tag LOCUS_08030 2689 2078 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073186.1 protein_id gnl|my_center|LOCUS_08030 3989 2694 gene locus_tag LOCUS_08040 gene hisS 3989 2694 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073187.1 protein_id gnl|my_center|LOCUS_08040 5130 4021 gene locus_tag LOCUS_08050 gene ispG 5130 4021 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073188.1 protein_id gnl|my_center|LOCUS_08050 6038 5154 gene locus_tag LOCUS_08060 6038 5154 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261365.1 protein_id gnl|my_center|LOCUS_08060 7388 6264 gene locus_tag LOCUS_08070 7388 6264 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073191.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence074 2079 1621 gene locus_tag LOCUS_08080 2079 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2351 3961 gene locus_tag LOCUS_08090 gene nadB 2351 3961 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071550.1 protein_id gnl|my_center|LOCUS_08090 4228 3971 gene locus_tag LOCUS_08100 4228 3971 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071548.1 protein_id gnl|my_center|LOCUS_08100 5048 4254 gene locus_tag LOCUS_08110 gene thyA 5048 4254 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071544.1 protein_id gnl|my_center|LOCUS_08110 5884 5045 gene locus_tag LOCUS_08120 gene lgt 5884 5045 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071543.1 protein_id gnl|my_center|LOCUS_08120 6412 5897 gene locus_tag LOCUS_08130 gene rppH 6412 5897 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071540.1 protein_id gnl|my_center|LOCUS_08130 6572 7249 gene locus_tag LOCUS_08140 gene mutH 6572 7249 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261234.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence075 895 50 gene locus_tag LOCUS_08150 895 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1662 3551 gene locus_tag LOCUS_08160 1662 3551 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706983.1 protein_id gnl|my_center|LOCUS_08160 3580 5487 gene locus_tag LOCUS_08170 3580 5487 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706983.1 protein_id gnl|my_center|LOCUS_08170 5567 6667 gene locus_tag LOCUS_08180 gene hemH 5567 6667 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence076 1733 501 gene locus_tag LOCUS_08190 1733 501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 protein_id gnl|my_center|LOCUS_08190 2416 1730 gene locus_tag LOCUS_08200 2416 1730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261130.1 protein_id gnl|my_center|LOCUS_08200 2519 3157 gene locus_tag LOCUS_08210 2519 3157 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621857.1 protein_id gnl|my_center|LOCUS_08210 4257 3199 gene locus_tag LOCUS_08220 4257 3199 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261916.1 protein_id gnl|my_center|LOCUS_08220 5035 4262 gene locus_tag LOCUS_08230 gene potC 5035 4262 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 protein_id gnl|my_center|LOCUS_08230 5898 5032 gene locus_tag LOCUS_08240 gene potB 5898 5032 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911544.1 protein_id gnl|my_center|LOCUS_08240 7000 5891 gene locus_tag LOCUS_08250 gene potA 7000 5891 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531577.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence077 <1 1195 gene locus_tag LOCUS_08260 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005163997.1:proline--tRNA ligase 1308 1478 gene locus_tag LOCUS_08270 1308 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08270 1593 2426 gene locus_tag LOCUS_08280 1593 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08280 4368 2428 gene locus_tag LOCUS_08290 4368 2428 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_08290 4669 4881 gene locus_tag LOCUS_08300 4669 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5640 4972 gene locus_tag LOCUS_08310 5640 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6364 5756 gene locus_tag LOCUS_08320 6364 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6635 6507 gene locus_tag LOCUS_08330 6635 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7309 6650 gene locus_tag LOCUS_08340 7309 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence078 1873 470 gene locus_tag LOCUS_08350 gene tolB 1873 470 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072687.1 protein_id gnl|my_center|LOCUS_08350 2786 1884 gene locus_tag LOCUS_08360 gene tolA 2786 1884 CDS product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072688.1 protein_id gnl|my_center|LOCUS_08360 3207 2776 gene locus_tag LOCUS_08370 gene tolR 3207 2776 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_08370 3917 3225 gene locus_tag LOCUS_08380 gene tolQ 3917 3225 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072690.1 protein_id gnl|my_center|LOCUS_08380 4317 3907 gene locus_tag LOCUS_08390 gene ybgC 4317 3907 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261599.1 protein_id gnl|my_center|LOCUS_08390 4506 5036 gene locus_tag LOCUS_08400 4506 5036 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072938.1 protein_id gnl|my_center|LOCUS_08400 5064 5891 gene locus_tag LOCUS_08410 gene xthA 5064 5891 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072940.1 protein_id gnl|my_center|LOCUS_08410 7249 5945 gene locus_tag LOCUS_08420 7249 5945 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072104.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence079 1200 1124 gene locus_tag LOCUS_t00220 1200 1124 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1294 1218 gene locus_tag LOCUS_t00230 1294 1218 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2750 1386 gene locus_tag LOCUS_08430 2750 1386 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072297.1 protein_id gnl|my_center|LOCUS_08430 2856 3470 gene locus_tag LOCUS_08440 2856 3470 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262006.1 protein_id gnl|my_center|LOCUS_08440 4222 3467 gene locus_tag LOCUS_08450 4222 3467 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_08450 4444 6372 gene locus_tag LOCUS_08460 gene thrS 4444 6372 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261833.1 protein_id gnl|my_center|LOCUS_08460 6481 6924 gene locus_tag LOCUS_08470 gene infC 6481 6924 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001700733.1 protein_id gnl|my_center|LOCUS_08470 6998 7195 gene locus_tag LOCUS_08480 gene rpmI 6998 7195 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence080 2199 1414 gene locus_tag LOCUS_08490 2199 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2781 2326 gene locus_tag LOCUS_08500 2781 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4153 3080 gene locus_tag LOCUS_08510 4153 3080 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 protein_id gnl|my_center|LOCUS_08510 4353 5066 gene locus_tag LOCUS_08520 4353 5066 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074268.1 protein_id gnl|my_center|LOCUS_08520 6230 5052 gene locus_tag LOCUS_08530 gene waaA 6230 5052 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074267.1 protein_id gnl|my_center|LOCUS_08530 6269 6484 gene locus_tag LOCUS_08540 6269 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence081 1297 401 gene locus_tag LOCUS_08550 1297 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1655 1308 gene locus_tag LOCUS_08560 1655 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4873 1709 gene locus_tag LOCUS_08570 4873 1709 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_08570 6630 4888 gene locus_tag LOCUS_08580 6630 4888 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence082 982 35 gene locus_tag LOCUS_08590 gene rsmH 982 35 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073908.1 protein_id gnl|my_center|LOCUS_08590 1192 1377 gene locus_tag LOCUS_08600 1192 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1507 1752 gene locus_tag LOCUS_08610 1507 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3155 2304 gene locus_tag LOCUS_08620 gene rsmI 3155 2304 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070673.1 protein_id gnl|my_center|LOCUS_08620 3349 5025 gene locus_tag LOCUS_08630 3349 5025 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070672.1 protein_id gnl|my_center|LOCUS_08630 5503 5231 gene locus_tag LOCUS_08640 5503 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08640 6134 6715 gene locus_tag LOCUS_08650 6134 6715 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070670.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence083 1217 411 gene locus_tag LOCUS_08660 1217 411 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071349.1 protein_id gnl|my_center|LOCUS_08660 2412 1210 gene locus_tag LOCUS_08670 2412 1210 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071348.1 protein_id gnl|my_center|LOCUS_08670 3752 2412 gene locus_tag LOCUS_08680 3752 2412 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071347.1 protein_id gnl|my_center|LOCUS_08680 4394 4098 gene locus_tag LOCUS_08690 4394 4098 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 protein_id gnl|my_center|LOCUS_08690 4543 5118 gene locus_tag LOCUS_08700 4543 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5221 6618 gene locus_tag LOCUS_08710 5221 6618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence084 1292 399 gene locus_tag LOCUS_08720 1292 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1658 1311 gene locus_tag LOCUS_08730 1658 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4858 1697 gene locus_tag LOCUS_08740 4858 1697 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_08740 6628 4874 gene locus_tag LOCUS_08750 6628 4874 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence085 <1 664 gene locus_tag LOCUS_08760 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208073.1:tetratricopeptide repeat protein 1450 1034 gene locus_tag LOCUS_08770 1450 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2118 1450 gene locus_tag LOCUS_08780 2118 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4058 2259 gene locus_tag LOCUS_08790 4058 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4269 4027 gene locus_tag LOCUS_08800 4269 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5297 4266 gene locus_tag LOCUS_08810 5297 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6385 6549 gene locus_tag LOCUS_08820 6385 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence086 <1 734 gene locus_tag LOCUS_08830 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819268.1:sodium:proton antiporter 3379 851 gene locus_tag LOCUS_08840 gene fadE 3379 851 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072493.1 protein_id gnl|my_center|LOCUS_08840 4282 3491 gene locus_tag LOCUS_08850 4282 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 6303 4285 gene locus_tag LOCUS_08860 6303 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence087 244 1071 gene locus_tag LOCUS_08870 gene cysQ 244 1071 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106799.1 protein_id gnl|my_center|LOCUS_08870 1225 2160 gene locus_tag LOCUS_08880 gene mdh 1225 2160 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704623.1 protein_id gnl|my_center|LOCUS_08880 3152 2184 gene locus_tag LOCUS_08890 gene ispB 3152 2184 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 protein_id gnl|my_center|LOCUS_08890 3381 3698 gene locus_tag LOCUS_08900 gene rplU 3381 3698 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383096.1 protein_id gnl|my_center|LOCUS_08900 3717 3971 gene locus_tag LOCUS_08910 gene rpmA 3717 3971 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_08910 4086 5249 gene locus_tag LOCUS_08920 gene cgtA 4086 5249 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073450.1 protein_id gnl|my_center|LOCUS_08920 5276 5797 gene locus_tag LOCUS_08930 gene folA 5276 5797 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_08930 6605 5730 gene locus_tag LOCUS_08940 6605 5730 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073444.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence088 606 2531 gene locus_tag LOCUS_08950 606 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2641 3843 gene locus_tag LOCUS_08960 2641 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 4076 4750 gene locus_tag LOCUS_08970 4076 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 5276 6049 gene locus_tag LOCUS_08980 5276 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6236 6069 gene locus_tag LOCUS_08990 6236 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 6767 6411 gene locus_tag LOCUS_09000 6767 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence089 1542 688 gene locus_tag LOCUS_09010 1542 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2240 1539 gene locus_tag LOCUS_09020 2240 1539 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_09020 3984 2251 gene locus_tag LOCUS_09030 3984 2251 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880885.1 protein_id gnl|my_center|LOCUS_09030 4182 4958 gene locus_tag LOCUS_09040 4182 4958 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071221.1 protein_id gnl|my_center|LOCUS_09040 5326 6126 gene locus_tag LOCUS_09050 5326 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence090 <1 582 gene locus_tag LOCUS_09060 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206598.1:uracil-DNA glycosylase 638 1129 gene locus_tag LOCUS_09070 638 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1317 1649 gene locus_tag LOCUS_09080 1317 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1938 1594 gene locus_tag LOCUS_09090 1938 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071573.1 protein_id gnl|my_center|LOCUS_09090 2497 2150 gene locus_tag LOCUS_09100 gene rplS 2497 2150 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 protein_id gnl|my_center|LOCUS_09100 3266 2490 gene locus_tag LOCUS_09110 gene trmD 3266 2490 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_09110 3814 3284 gene locus_tag LOCUS_09120 gene rimM 3814 3284 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704630.1 protein_id gnl|my_center|LOCUS_09120 4095 3847 gene locus_tag LOCUS_09130 gene rpsP 4095 3847 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 protein_id gnl|my_center|LOCUS_09130 5591 4233 gene locus_tag LOCUS_09140 gene ffh 5591 4233 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071565.1 protein_id gnl|my_center|LOCUS_09140 5938 6636 gene locus_tag LOCUS_09150 gene ccsA 5938 6636 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071564.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence091 1307 528 gene locus_tag LOCUS_09160 gene zomB 1307 528 CDS product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072596.1 protein_id gnl|my_center|LOCUS_09160 2823 1423 gene locus_tag LOCUS_09170 2823 1423 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072262.1 protein_id gnl|my_center|LOCUS_09170 2845 3864 gene locus_tag LOCUS_09180 gene nagZ 2845 3864 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072263.1 protein_id gnl|my_center|LOCUS_09180 4628 3861 gene locus_tag LOCUS_09190 4628 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 <6617 4625 gene locus_tag LOCUS_09200 <6617 4625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072267.1:transcription-repair coupling factor >Feature sequence092 2754 1261 gene locus_tag LOCUS_09210 2754 1261 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 protein_id gnl|my_center|LOCUS_09210 3360 3683 gene locus_tag LOCUS_09220 3360 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3680 4921 gene locus_tag LOCUS_09230 3680 4921 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_09230 5861 5196 gene locus_tag LOCUS_09240 5861 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence093 117 932 gene locus_tag LOCUS_09250 117 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1026 1913 gene locus_tag LOCUS_09260 gene tus 1026 1913 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816298.1 protein_id gnl|my_center|LOCUS_09260 2018 2554 gene locus_tag LOCUS_09270 2018 2554 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 protein_id gnl|my_center|LOCUS_09270 2563 3819 gene locus_tag LOCUS_09280 2563 3819 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 protein_id gnl|my_center|LOCUS_09280 3823 4779 gene locus_tag LOCUS_09290 3823 4779 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245995.1 protein_id gnl|my_center|LOCUS_09290 4760 5011 gene locus_tag LOCUS_09300 gene tusA 4760 5011 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070435.1 protein_id gnl|my_center|LOCUS_09300 5008 5586 gene locus_tag LOCUS_09310 5008 5586 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917909.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence094 779 2065 gene locus_tag LOCUS_09320 gene hemL 779 2065 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071513.1 protein_id gnl|my_center|LOCUS_09320 2575 4059 gene locus_tag LOCUS_09330 2575 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 6266 4056 gene locus_tag LOCUS_09340 gene mrcB 6266 4056 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070960.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence095 2687 651 gene locus_tag LOCUS_09350 2687 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4121 2856 gene locus_tag LOCUS_09360 4121 2856 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071444.1 protein_id gnl|my_center|LOCUS_09360 5971 4391 gene locus_tag LOCUS_09370 gene prfC 5971 4391 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261269.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence096 1198 2412 gene locus_tag LOCUS_09380 1198 2412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_09380 2402 2923 gene locus_tag LOCUS_09390 2402 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence097 454 960 gene locus_tag LOCUS_09400 454 960 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_09400 2208 970 gene locus_tag LOCUS_09410 gene lolE 2208 970 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072271.1 protein_id gnl|my_center|LOCUS_09410 2890 2210 gene locus_tag LOCUS_09420 gene lolD 2890 2210 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925702.1 protein_id gnl|my_center|LOCUS_09420 4109 2883 gene locus_tag LOCUS_09430 4109 2883 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072269.1 protein_id gnl|my_center|LOCUS_09430 4195 4755 gene locus_tag LOCUS_09440 4195 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072268.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence098 159 1451 gene locus_tag LOCUS_09450 gene tig 159 1451 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071915.1 protein_id gnl|my_center|LOCUS_09450 1537 2172 gene locus_tag LOCUS_09460 gene clpP 1537 2172 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891956.1 protein_id gnl|my_center|LOCUS_09460 2401 3669 gene locus_tag LOCUS_09470 gene clpX 2401 3669 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 protein_id gnl|my_center|LOCUS_09470 3769 6129 gene locus_tag LOCUS_09480 gene lon 3769 6129 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence099 <1 1554 gene locus_tag LOCUS_09490 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074085.1:electron transfer flavoprotein-ubiquinone oxidoreductase 2413 1544 gene locus_tag LOCUS_09500 2413 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4532 2460 gene locus_tag LOCUS_09510 gene recG 4532 2460 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678442.1 protein_id gnl|my_center|LOCUS_09510 <6073 4609 gene locus_tag LOCUS_09520 <6073 4609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070720.1:AMP-binding protein >Feature sequence100 1655 798 gene locus_tag LOCUS_09530 1655 798 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072101.1 protein_id gnl|my_center|LOCUS_09530 3652 1739 gene locus_tag LOCUS_09540 gene htpG 3652 1739 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072100.1 protein_id gnl|my_center|LOCUS_09540 3996 3910 gene locus_tag LOCUS_t00240 3996 3910 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4682 4134 gene locus_tag LOCUS_09550 gene pgsA 4682 4134 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071974.1 protein_id gnl|my_center|LOCUS_09550 <6053 4731 gene locus_tag LOCUS_09560 <6053 4731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071973.1:excinuclease ABC subunit UvrC >Feature sequence101 367 185 gene locus_tag LOCUS_09570 367 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1477 698 gene locus_tag LOCUS_09580 1477 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2239 1856 gene locus_tag LOCUS_09590 2239 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3691 2453 gene locus_tag LOCUS_09600 3691 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4499 5782 gene locus_tag LOCUS_09610 4499 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence102 1483 4356 gene locus_tag LOCUS_09620 gene rapA 1483 4356 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070913.1 protein_id gnl|my_center|LOCUS_09620 4610 5587 gene locus_tag LOCUS_09630 gene dusB 4610 5587 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070754.1 protein_id gnl|my_center|LOCUS_09630 5602 5904 gene locus_tag LOCUS_09640 gene fis 5602 5904 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083371.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence103 2521 902 gene locus_tag LOCUS_09650 gene yidC 2521 902 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070420.1 protein_id gnl|my_center|LOCUS_09650 3069 2743 gene locus_tag LOCUS_09660 gene rnpA 3069 2743 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070422.1 protein_id gnl|my_center|LOCUS_09660 3695 5128 gene locus_tag LOCUS_09670 gene dnaA 3695 5128 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence104 1490 930 gene locus_tag LOCUS_09680 gene tsaC 1490 930 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 protein_id gnl|my_center|LOCUS_09680 1579 1764 gene locus_tag LOCUS_09690 1579 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3461 2157 gene locus_tag LOCUS_09700 gene fliB 3461 2157 CDS product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816588.1 protein_id gnl|my_center|LOCUS_09700 3663 4112 gene locus_tag LOCUS_09710 3663 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5363 4098 gene locus_tag LOCUS_09720 gene fliB 5363 4098 CDS product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073855.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence105 112 36 gene locus_tag LOCUS_t00250 112 36 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1569 262 gene locus_tag LOCUS_09730 1569 262 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925880.1 protein_id gnl|my_center|LOCUS_09730 2305 1571 gene locus_tag LOCUS_09740 gene dnaQ 2305 1571 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098051.1 protein_id gnl|my_center|LOCUS_09740 2356 2829 gene locus_tag LOCUS_09750 gene rnhA 2356 2829 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 protein_id gnl|my_center|LOCUS_09750 3536 2826 gene locus_tag LOCUS_09760 3536 2826 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 protein_id gnl|my_center|LOCUS_09760 3619 4395 gene locus_tag LOCUS_09770 gene gloB 3619 4395 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence106 50 463 gene locus_tag LOCUS_09780 50 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 466 1176 gene locus_tag LOCUS_09790 466 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1965 1159 gene locus_tag LOCUS_09800 gene panC 1965 1159 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262612.1 protein_id gnl|my_center|LOCUS_09800 2633 2235 gene locus_tag LOCUS_09810 gene folK 2633 2235 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156774.1 protein_id gnl|my_center|LOCUS_09810 4006 2723 gene locus_tag LOCUS_09820 4006 2723 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024044.1 protein_id gnl|my_center|LOCUS_09820 5012 4140 gene locus_tag LOCUS_09830 gene gluQRS 5012 4140 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925826.1 protein_id gnl|my_center|LOCUS_09830 5501 5058 gene locus_tag LOCUS_09840 gene dksA 5501 5058 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644947.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence107 179 2014 gene locus_tag LOCUS_09850 gene ftsH 179 2014 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925641.1 protein_id gnl|my_center|LOCUS_09850 2078 2923 gene locus_tag LOCUS_09860 gene folP 2078 2923 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071428.1 protein_id gnl|my_center|LOCUS_09860 2923 4272 gene locus_tag LOCUS_09870 gene glmM 2923 4272 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071429.1 protein_id gnl|my_center|LOCUS_09870 4326 5111 gene locus_tag LOCUS_09880 gene tpiA 4326 5111 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019651.1 protein_id gnl|my_center|LOCUS_09880 5114 5425 gene locus_tag LOCUS_09890 gene secG 5114 5425 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071431.1 protein_id gnl|my_center|LOCUS_09890 5436 5520 gene locus_tag LOCUS_t00260 5436 5520 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5632 5708 gene locus_tag LOCUS_t00270 5632 5708 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence108 69 461 gene locus_tag LOCUS_09900 69 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 625 1572 gene locus_tag LOCUS_09910 gene ttcA 625 1572 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 protein_id gnl|my_center|LOCUS_09910 1582 1842 gene locus_tag LOCUS_09920 1582 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1933 2649 gene locus_tag LOCUS_09930 gene trmB 1933 2649 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073235.1 protein_id gnl|my_center|LOCUS_09930 2713 3633 gene locus_tag LOCUS_09940 gene glsB 2713 3633 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073233.1 protein_id gnl|my_center|LOCUS_09940 4808 3663 gene locus_tag LOCUS_09950 gene hemW 4808 3663 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073228.1 protein_id gnl|my_center|LOCUS_09950 5412 4801 gene locus_tag LOCUS_09960 5412 4801 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence109 1759 968 gene locus_tag LOCUS_09970 1759 968 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072002.1 protein_id gnl|my_center|LOCUS_09970 3379 1772 gene locus_tag LOCUS_09980 3379 1772 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 protein_id gnl|my_center|LOCUS_09980 4570 3392 gene locus_tag LOCUS_09990 4570 3392 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_09990 4708 5268 gene locus_tag LOCUS_10000 4708 5268 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence110 <1 632 gene locus_tag LOCUS_10010 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070533.1:metal transporter 751 1089 gene locus_tag LOCUS_10020 751 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2459 1095 gene locus_tag LOCUS_10030 gene gorA 2459 1095 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 protein_id gnl|my_center|LOCUS_10030 2705 4753 gene locus_tag LOCUS_10040 gene prlC 2705 4753 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_10040 4786 5532 gene locus_tag LOCUS_10050 4786 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence111 <1 1343 gene locus_tag LOCUS_10060 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077392314.1:leucine--tRNA ligase 1349 1840 gene locus_tag LOCUS_10070 1349 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1849 2886 gene locus_tag LOCUS_10080 gene holA 1849 2886 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071403.1 protein_id gnl|my_center|LOCUS_10080 2877 3518 gene locus_tag LOCUS_10090 gene nadD 2877 3518 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071402.1 protein_id gnl|my_center|LOCUS_10090 3623 3928 gene locus_tag LOCUS_10100 gene rsfS 3623 3928 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071401.1 protein_id gnl|my_center|LOCUS_10100 3916 4404 gene locus_tag LOCUS_10110 gene rlmH 3916 4404 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071400.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence112 211 1494 gene locus_tag LOCUS_10120 211 1494 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976357.1 protein_id gnl|my_center|LOCUS_10120 1648 1866 gene locus_tag LOCUS_10130 gene infA 1648 1866 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_10130 4327 2066 gene locus_tag LOCUS_10140 gene clpA 4327 2066 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072574.1 protein_id gnl|my_center|LOCUS_10140 4663 4346 gene locus_tag LOCUS_10150 gene clpS 4663 4346 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420184.1 protein_id gnl|my_center|LOCUS_10150 4842 5054 gene locus_tag LOCUS_10160 gene cspD 4842 5054 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence113 3274 425 gene locus_tag LOCUS_10170 3274 425 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986599.1 protein_id gnl|my_center|LOCUS_10170 3677 3285 gene locus_tag LOCUS_10180 3677 3285 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_10180 4109 4231 gene locus_tag LOCUS_10190 4109 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4420 5037 gene locus_tag LOCUS_10200 4420 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence114 1455 508 gene locus_tag LOCUS_10210 1455 508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_10210 1639 3585 gene locus_tag LOCUS_10220 1639 3585 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 protein_id gnl|my_center|LOCUS_10220 3753 5114 gene locus_tag LOCUS_10230 gene rlmD 3753 5114 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073303.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence115 2707 2782 gene locus_tag LOCUS_t00280 2707 2782 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2787 2862 gene locus_tag LOCUS_t00290 2787 2862 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2957 3568 gene locus_tag LOCUS_10240 2957 3568 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_10240 4479 3565 gene locus_tag LOCUS_10250 4479 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence116 <1 2718 gene locus_tag LOCUS_10260 <1 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072201.1:exodeoxyribonuclease V subunit beta 2712 4586 gene locus_tag LOCUS_10270 gene recD 2712 4586 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925866.1 protein_id gnl|my_center|LOCUS_10270 4735 5367 gene locus_tag LOCUS_10280 4735 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence117 394 2211 gene locus_tag LOCUS_10290 gene argS 394 2211 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073824.1 protein_id gnl|my_center|LOCUS_10290 2214 2741 gene locus_tag LOCUS_10300 2214 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2809 3333 gene locus_tag LOCUS_10310 gene hslV 2809 3333 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455873.1 protein_id gnl|my_center|LOCUS_10310 3361 4689 gene locus_tag LOCUS_10320 gene hslU 3361 4689 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073857.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence118 1722 277 gene locus_tag LOCUS_10330 gene tldD 1722 277 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073795.1 protein_id gnl|my_center|LOCUS_10330 <5478 1780 gene locus_tag LOCUS_10340 <5478 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073797.1:YhdP family protein >Feature sequence119 1475 1627 gene locus_tag LOCUS_10350 1475 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1763 3415 gene locus_tag LOCUS_10360 1763 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3865 4044 gene locus_tag LOCUS_10370 3865 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence120 1634 648 gene locus_tag LOCUS_10380 gene pdxA 1634 648 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 protein_id gnl|my_center|LOCUS_10380 2918 1638 gene locus_tag LOCUS_10390 gene surA 2918 1638 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073440.1 protein_id gnl|my_center|LOCUS_10390 5173 2966 gene locus_tag LOCUS_10400 gene lptD 5173 2966 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073439.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence121 567 373 gene locus_tag LOCUS_10410 567 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1019 816 gene locus_tag LOCUS_10420 1019 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1229 1996 gene locus_tag LOCUS_10430 1229 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1981 2238 gene locus_tag LOCUS_10440 1981 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2484 2669 gene locus_tag LOCUS_10450 gene csrA 2484 2669 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957970.1 protein_id gnl|my_center|LOCUS_10450 3909 4955 gene locus_tag LOCUS_10460 3909 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence122 97 1734 gene locus_tag LOCUS_10470 97 1734 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_10470 1725 2735 gene locus_tag LOCUS_10480 gene hemB 1725 2735 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073891.1 protein_id gnl|my_center|LOCUS_10480 2871 4316 gene locus_tag LOCUS_10490 gene nhaD 2871 4316 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence123 <1 1480 gene locus_tag LOCUS_10500 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073402.1:methyl-accepting chemotaxis protein 1574 2038 gene locus_tag LOCUS_10510 gene trmL 1574 2038 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 protein_id gnl|my_center|LOCUS_10510 3984 2155 gene locus_tag LOCUS_10520 gene glmS 3984 2155 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074325.1 protein_id gnl|my_center|LOCUS_10520 <5230 4013 gene locus_tag LOCUS_10530 <5230 4013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934853.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence124 1448 369 gene locus_tag LOCUS_10540 1448 369 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071524.1 protein_id gnl|my_center|LOCUS_10540 2772 1468 gene locus_tag LOCUS_10550 2772 1468 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_10550 2884 4089 gene locus_tag LOCUS_10560 gene tyrS 2884 4089 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_10560 4745 4113 gene locus_tag LOCUS_10570 4745 4113 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071529.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence125 <1 1635 gene locus_tag LOCUS_10580 <1 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338082.1:DEAD/DEAH box helicase 3372 2092 gene locus_tag LOCUS_10590 gene dcm 3372 2092 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_10590 3474 4202 gene locus_tag LOCUS_10600 3474 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence126 <1 572 gene locus_tag LOCUS_10610 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072714.1:phosphate acyltransferase PlsX 569 1528 gene locus_tag LOCUS_10620 569 1528 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072713.1 protein_id gnl|my_center|LOCUS_10620 1536 2486 gene locus_tag LOCUS_10630 gene fabD 1536 2486 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072712.1 protein_id gnl|my_center|LOCUS_10630 2471 3223 gene locus_tag LOCUS_10640 gene fabG 2471 3223 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_10640 3355 3588 gene locus_tag LOCUS_10650 gene acpP 3355 3588 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 protein_id gnl|my_center|LOCUS_10650 3651 4892 gene locus_tag LOCUS_10660 gene fabF 3651 4892 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence127 2252 930 gene locus_tag LOCUS_10670 2252 930 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073680.1 protein_id gnl|my_center|LOCUS_10670 3402 2512 gene locus_tag LOCUS_10680 gene hflC 3402 2512 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070937.1 protein_id gnl|my_center|LOCUS_10680 4548 3406 gene locus_tag LOCUS_10690 gene hflK 4548 3406 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070936.1 protein_id gnl|my_center|LOCUS_10690 <5129 4594 gene locus_tag LOCUS_10700 <5129 4594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070935.1:GTPase HflX >Feature sequence128 2177 1395 gene locus_tag LOCUS_10710 2177 1395 CDS product CTP:phosphoglutamine cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858404.1 protein_id gnl|my_center|LOCUS_10710 2803 2174 gene locus_tag LOCUS_10720 2803 2174 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201881088.1 protein_id gnl|my_center|LOCUS_10720 <5046 2804 gene locus_tag LOCUS_10730 <5046 2804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891934.1:PEP-utilizing enzyme >Feature sequence129 769 341 gene locus_tag LOCUS_10740 769 341 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 protein_id gnl|my_center|LOCUS_10740 942 2513 gene locus_tag LOCUS_10750 gene gpmM 942 2513 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070464.1 protein_id gnl|my_center|LOCUS_10750 2518 3645 gene locus_tag LOCUS_10760 2518 3645 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_10760 3683 4525 gene locus_tag LOCUS_10770 3683 4525 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100327.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence130 2120 990 gene locus_tag LOCUS_10780 2120 990 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072583.1 protein_id gnl|my_center|LOCUS_10780 3506 2130 gene locus_tag LOCUS_10790 gene purB 3506 2130 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816141.1 protein_id gnl|my_center|LOCUS_10790 4129 3524 gene locus_tag LOCUS_10800 gene hflD 4129 3524 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334622.1 protein_id gnl|my_center|LOCUS_10800 <5003 4122 gene locus_tag LOCUS_10810 <5003 4122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001441929.1:tRNA 2-thiouridine(34) synthase MnmA