>Feature sequence001 2100 1516 gene locus_tag LOCUS_00010 2100 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 5053 2114 gene locus_tag LOCUS_00020 5053 2114 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_00020 5358 5140 gene locus_tag LOCUS_00030 5358 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8861 5355 gene locus_tag LOCUS_00040 8861 5355 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_00040 9722 13003 gene locus_tag LOCUS_00050 9722 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 13069 16431 gene locus_tag LOCUS_00060 13069 16431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 16542 17903 gene locus_tag LOCUS_00070 16542 17903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 18079 20661 gene locus_tag LOCUS_00080 18079 20661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 23236 20912 gene locus_tag LOCUS_00090 23236 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 23435 24700 gene locus_tag LOCUS_00100 23435 24700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 24719 25633 gene locus_tag LOCUS_00110 24719 25633 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_00110 25766 26029 gene locus_tag LOCUS_00120 25766 26029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 26020 26427 gene locus_tag LOCUS_00130 26020 26427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 27427 26828 gene locus_tag LOCUS_00140 27427 26828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 29220 27715 gene locus_tag LOCUS_00150 29220 27715 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_00150 29857 31269 gene locus_tag LOCUS_00160 29857 31269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_00160 31311 32384 gene locus_tag LOCUS_00170 31311 32384 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032887275.1 protein_id gnl|my_center|LOCUS_00170 32496 33917 gene locus_tag LOCUS_00180 32496 33917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 35529 34033 gene locus_tag LOCUS_00190 35529 34033 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_00190 36128 36931 gene locus_tag LOCUS_00200 36128 36931 CDS product DUF2806 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279526.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00200 36967 37206 gene locus_tag LOCUS_00210 36967 37206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 37411 38763 gene locus_tag LOCUS_00220 37411 38763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 38926 40170 gene locus_tag LOCUS_00230 38926 40170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 40715 42385 gene locus_tag LOCUS_00240 40715 42385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 43081 43419 gene locus_tag LOCUS_00250 43081 43419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 43424 44038 gene locus_tag LOCUS_00260 43424 44038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 44149 44499 gene locus_tag LOCUS_00270 44149 44499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 44973 47450 gene locus_tag LOCUS_00280 44973 47450 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_00280 49422 47629 gene locus_tag LOCUS_00290 49422 47629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 50522 49623 gene locus_tag LOCUS_00300 50522 49623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 50792 51694 gene locus_tag LOCUS_00310 50792 51694 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_00310 52804 51752 gene locus_tag LOCUS_00320 52804 51752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 53086 53229 gene locus_tag LOCUS_00330 53086 53229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 54711 53281 gene locus_tag LOCUS_00340 54711 53281 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_00340 55674 54763 gene locus_tag LOCUS_00350 55674 54763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 55783 58518 gene locus_tag LOCUS_00360 55783 58518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 58840 60624 gene locus_tag LOCUS_00370 58840 60624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 60975 61490 gene locus_tag LOCUS_00380 60975 61490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 62018 61557 gene locus_tag LOCUS_00390 62018 61557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 62415 63722 gene locus_tag LOCUS_00400 62415 63722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_00400 67121 63855 gene locus_tag LOCUS_00410 67121 63855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 67397 68923 gene locus_tag LOCUS_00420 67397 68923 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_00420 69083 69313 gene locus_tag LOCUS_00430 69083 69313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 69449 72067 gene locus_tag LOCUS_00440 69449 72067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 72097 73293 gene locus_tag LOCUS_00450 72097 73293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 73831 73382 gene locus_tag LOCUS_00460 73831 73382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 74137 73835 gene locus_tag LOCUS_00470 74137 73835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 74325 74537 gene locus_tag LOCUS_00480 74325 74537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 75171 74785 gene locus_tag LOCUS_00490 75171 74785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 75751 77859 gene locus_tag LOCUS_00500 75751 77859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 78296 78105 gene locus_tag LOCUS_00510 78296 78105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 78549 78316 gene locus_tag LOCUS_00520 78549 78316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 81011 78930 gene locus_tag LOCUS_00530 81011 78930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 83852 82005 gene locus_tag LOCUS_00540 83852 82005 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_00540 86399 83994 gene locus_tag LOCUS_00550 86399 83994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 86910 86524 gene locus_tag LOCUS_00560 86910 86524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 88475 87204 gene locus_tag LOCUS_00570 88475 87204 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_00570 88830 88645 gene locus_tag LOCUS_00580 88830 88645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 89890 88877 gene locus_tag LOCUS_00590 89890 88877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 92882 90009 gene locus_tag LOCUS_00600 92882 90009 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_00600 94970 92919 gene locus_tag LOCUS_00610 94970 92919 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119585.1 protein_id gnl|my_center|LOCUS_00610 95366 94989 gene locus_tag LOCUS_00620 95366 94989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 95668 97221 gene locus_tag LOCUS_00630 95668 97221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 99416 97338 gene locus_tag LOCUS_00640 99416 97338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 100742 99474 gene locus_tag LOCUS_00650 100742 99474 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_00650 103238 100818 gene locus_tag LOCUS_00660 103238 100818 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_00660 104143 103235 gene locus_tag LOCUS_00670 104143 103235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 105881 104436 gene locus_tag LOCUS_00680 105881 104436 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_00680 106321 109896 gene locus_tag LOCUS_00690 106321 109896 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_00690 111201 110479 gene locus_tag LOCUS_00700 111201 110479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 114302 111198 gene locus_tag LOCUS_00710 114302 111198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 114816 114304 gene locus_tag LOCUS_00720 114816 114304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 117862 115493 gene locus_tag LOCUS_00730 117862 115493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_00730 118766 117924 gene locus_tag LOCUS_00740 118766 117924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 119056 120870 gene locus_tag LOCUS_00750 119056 120870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 121002 121976 gene locus_tag LOCUS_00760 121002 121976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 122002 123816 gene locus_tag LOCUS_00770 122002 123816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 123813 124331 gene locus_tag LOCUS_00780 123813 124331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 127402 124871 gene locus_tag LOCUS_00790 127402 124871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 127923 127414 gene locus_tag LOCUS_00800 127923 127414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 129204 127960 gene locus_tag LOCUS_00810 129204 127960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 131626 129356 gene locus_tag LOCUS_00820 131626 129356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 133256 131709 gene locus_tag LOCUS_00830 133256 131709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 133794 133480 gene locus_tag LOCUS_00840 133794 133480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 134492 133704 gene locus_tag LOCUS_00850 134492 133704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 135537 134482 gene locus_tag LOCUS_00860 135537 134482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 138182 135534 gene locus_tag LOCUS_00870 138182 135534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 140008 138185 gene locus_tag LOCUS_00880 140008 138185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 142863 140044 gene locus_tag LOCUS_00890 142863 140044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 145493 142983 gene locus_tag LOCUS_00900 145493 142983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 147445 145490 gene locus_tag LOCUS_00910 147445 145490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 149065 147524 gene locus_tag LOCUS_00920 149065 147524 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119147.1 protein_id gnl|my_center|LOCUS_00920 149136 149354 gene locus_tag LOCUS_00930 149136 149354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 150145 149351 gene locus_tag LOCUS_00940 150145 149351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 150676 150906 gene locus_tag LOCUS_00950 150676 150906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 150980 152971 gene locus_tag LOCUS_00960 150980 152971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 153831 153337 gene locus_tag LOCUS_00970 153831 153337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 155467 153908 gene locus_tag LOCUS_00980 155467 153908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 157193 155568 gene locus_tag LOCUS_00990 157193 155568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 157123 157326 gene locus_tag LOCUS_01000 157123 157326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 157755 157327 gene locus_tag LOCUS_01010 157755 157327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 157985 159250 gene locus_tag LOCUS_01020 157985 159250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 159533 159300 gene locus_tag LOCUS_01030 159533 159300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 160757 161146 gene locus_tag LOCUS_01040 160757 161146 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664252.1 protein_id gnl|my_center|LOCUS_01040 161143 163893 gene locus_tag LOCUS_01050 161143 163893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 163939 164799 gene locus_tag LOCUS_01060 163939 164799 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_01060 165402 167543 gene locus_tag LOCUS_01070 165402 167543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 168033 168338 gene locus_tag LOCUS_01080 168033 168338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 168354 168902 gene locus_tag LOCUS_01090 168354 168902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 169375 169088 gene locus_tag LOCUS_01100 169375 169088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 169398 169535 gene locus_tag LOCUS_01110 169398 169535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 169759 171705 gene locus_tag LOCUS_01120 169759 171705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 174240 171847 gene locus_tag LOCUS_01130 174240 171847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 175722 174247 gene locus_tag LOCUS_01140 175722 174247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 177593 176280 gene locus_tag LOCUS_01150 177593 176280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 181351 178280 gene locus_tag LOCUS_01160 181351 178280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 181812 182867 gene locus_tag LOCUS_01170 181812 182867 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_01170 184948 183149 gene locus_tag LOCUS_01180 184948 183149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 186613 185411 gene locus_tag LOCUS_01190 186613 185411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01190 186843 186589 gene locus_tag LOCUS_01200 186843 186589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 187517 187215 gene locus_tag LOCUS_01210 187517 187215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 190864 187586 gene locus_tag LOCUS_01220 190864 187586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 193042 191375 gene locus_tag LOCUS_01230 193042 191375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 195681 193189 gene locus_tag LOCUS_01240 195681 193189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 196292 195813 gene locus_tag LOCUS_01250 196292 195813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 196639 196292 gene locus_tag LOCUS_01260 196639 196292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 196908 196525 gene locus_tag LOCUS_01270 196908 196525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 197981 196905 gene locus_tag LOCUS_01280 197981 196905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 198183 197998 gene locus_tag LOCUS_01290 198183 197998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 198361 198900 gene locus_tag LOCUS_01300 198361 198900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 198916 200313 gene locus_tag LOCUS_01310 198916 200313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 200424 202235 gene locus_tag LOCUS_01320 200424 202235 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_01320 202963 203352 gene locus_tag LOCUS_01330 202963 203352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993823.1 protein_id gnl|my_center|LOCUS_01330 203386 203598 gene locus_tag LOCUS_01340 203386 203598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 203870 203661 gene locus_tag LOCUS_01350 203870 203661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 204185 204796 gene locus_tag LOCUS_01360 204185 204796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 207076 205178 gene locus_tag LOCUS_01370 207076 205178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 208862 207093 gene locus_tag LOCUS_01380 208862 207093 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_01380 212293 208859 gene locus_tag LOCUS_01390 212293 208859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 214007 212418 gene locus_tag LOCUS_01400 214007 212418 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_01400 216326 214050 gene locus_tag LOCUS_01410 216326 214050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 217765 216335 gene locus_tag LOCUS_01420 217765 216335 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_01420 219882 217762 gene locus_tag LOCUS_01430 219882 217762 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_01430 221159 220728 gene locus_tag LOCUS_01440 221159 220728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 221571 221200 gene locus_tag LOCUS_01450 221571 221200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 222794 221565 gene locus_tag LOCUS_01460 222794 221565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 222738 222980 gene locus_tag LOCUS_01470 222738 222980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence002 6107 2178 gene locus_tag LOCUS_01480 6107 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7234 6251 gene locus_tag LOCUS_01490 7234 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8484 7423 gene locus_tag LOCUS_01500 8484 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 9414 8488 gene locus_tag LOCUS_01510 9414 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9983 9399 gene locus_tag LOCUS_01520 9983 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10262 11383 gene locus_tag LOCUS_01530 10262 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11399 12283 gene locus_tag LOCUS_01540 11399 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 12474 13100 gene locus_tag LOCUS_01550 12474 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 13220 14131 gene locus_tag LOCUS_01560 13220 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 14163 15314 gene locus_tag LOCUS_01570 14163 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 15357 16817 gene locus_tag LOCUS_01580 15357 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 17273 17665 gene locus_tag LOCUS_01590 17273 17665 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119729.1 protein_id gnl|my_center|LOCUS_01590 17726 19174 gene locus_tag LOCUS_01600 17726 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 19555 21048 gene locus_tag LOCUS_01610 19555 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 23203 21104 gene locus_tag LOCUS_01620 23203 21104 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_01620 23484 26048 gene locus_tag LOCUS_01630 23484 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 28176 26569 gene locus_tag LOCUS_01640 28176 26569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 30226 28325 gene locus_tag LOCUS_01650 30226 28325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 34366 30701 gene locus_tag LOCUS_01660 34366 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 35846 34569 gene locus_tag LOCUS_01670 35846 34569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 36333 37052 gene locus_tag LOCUS_01680 36333 37052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 38418 37114 gene locus_tag LOCUS_01690 38418 37114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 40084 38648 gene locus_tag LOCUS_01700 40084 38648 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_01700 40260 40661 gene locus_tag LOCUS_01710 40260 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 40961 40665 gene locus_tag LOCUS_01720 40961 40665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 40945 41421 gene locus_tag LOCUS_01730 40945 41421 CDS product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930463.1 protein_id gnl|my_center|LOCUS_01730 42300 41461 gene locus_tag LOCUS_01740 42300 41461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 42559 44520 gene locus_tag LOCUS_01750 42559 44520 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_01750 44689 46065 gene locus_tag LOCUS_01760 44689 46065 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_01760 46055 46348 gene locus_tag LOCUS_01770 46055 46348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 46838 46392 gene locus_tag LOCUS_01780 46838 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 47799 47152 gene locus_tag LOCUS_01790 47799 47152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 48559 47804 gene locus_tag LOCUS_01800 48559 47804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 49372 49656 gene locus_tag LOCUS_01810 49372 49656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 50252 49659 gene locus_tag LOCUS_01820 gene def 50252 49659 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_01820 50814 50254 gene locus_tag LOCUS_01830 gene pyrE 50814 50254 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_01830 52259 51003 gene locus_tag LOCUS_01840 52259 51003 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118352.1 protein_id gnl|my_center|LOCUS_01840 59410 52373 gene locus_tag LOCUS_01850 gene uvrA 59410 52373 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 protein_id gnl|my_center|LOCUS_01850 59944 60018 gene locus_tag LOCUS_t00010 59944 60018 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 60062 61393 gene locus_tag LOCUS_01860 60062 61393 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_01860 61518 62561 gene locus_tag LOCUS_01870 gene tgt 61518 62561 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_01870 62613 62810 gene locus_tag LOCUS_01880 62613 62810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 62794 63153 gene locus_tag LOCUS_01890 62794 63153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 63208 67941 gene locus_tag LOCUS_01900 63208 67941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 67946 68482 gene locus_tag LOCUS_01910 67946 68482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 69527 68640 gene locus_tag LOCUS_01920 69527 68640 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_01920 71953 69776 gene locus_tag LOCUS_01930 71953 69776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615598.1 protein_id gnl|my_center|LOCUS_01930 72653 72429 gene locus_tag LOCUS_01940 72653 72429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 74804 72930 gene locus_tag LOCUS_01950 74804 72930 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_01950 75178 78525 gene locus_tag LOCUS_01960 75178 78525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 79814 78576 gene locus_tag LOCUS_01970 79814 78576 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_01970 80121 82265 gene locus_tag LOCUS_01980 80121 82265 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_01980 82539 83531 gene locus_tag LOCUS_01990 82539 83531 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_01990 84667 83738 gene locus_tag LOCUS_02000 84667 83738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 85130 85204 gene locus_tag LOCUS_t00020 85130 85204 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 85449 85195 gene locus_tag LOCUS_02010 85449 85195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 85830 86081 gene locus_tag LOCUS_02020 85830 86081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 86068 86532 gene locus_tag LOCUS_02030 86068 86532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 86705 86529 gene locus_tag LOCUS_02040 86705 86529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 86793 88148 gene locus_tag LOCUS_02050 86793 88148 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_02050 88407 91130 gene locus_tag LOCUS_02060 88407 91130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 91262 91867 gene locus_tag LOCUS_02070 91262 91867 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_02070 92245 91943 gene locus_tag LOCUS_02080 92245 91943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 92487 92876 gene locus_tag LOCUS_02090 92487 92876 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664252.1 protein_id gnl|my_center|LOCUS_02090 92873 95683 gene locus_tag LOCUS_02100 92873 95683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 97196 95739 gene locus_tag LOCUS_02110 97196 95739 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_02110 97247 97585 gene locus_tag LOCUS_02120 97247 97585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 97889 97641 gene locus_tag LOCUS_02130 97889 97641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 97888 98970 gene locus_tag LOCUS_02140 97888 98970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 100794 99322 gene locus_tag LOCUS_02150 100794 99322 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_02150 102047 100923 gene locus_tag LOCUS_02160 102047 100923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 103140 102061 gene locus_tag LOCUS_02170 103140 102061 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_02170 103474 103893 gene locus_tag LOCUS_02180 103474 103893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 104502 104116 gene locus_tag LOCUS_02190 104502 104116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 104971 105306 gene locus_tag LOCUS_02200 104971 105306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 105322 105591 gene locus_tag LOCUS_02210 105322 105591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 105573 105833 gene locus_tag LOCUS_02220 105573 105833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 105950 106474 gene locus_tag LOCUS_02230 105950 106474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 106449 107195 gene locus_tag LOCUS_02240 106449 107195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 107341 108936 gene locus_tag LOCUS_02250 107341 108936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 108994 110619 gene locus_tag LOCUS_02260 108994 110619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 113456 110805 gene locus_tag LOCUS_02270 113456 110805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_02270 113978 113586 gene locus_tag LOCUS_02280 113978 113586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 115055 115672 gene locus_tag LOCUS_02290 115055 115672 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence003 925 293 gene locus_tag LOCUS_02300 925 293 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_02300 1966 941 gene locus_tag LOCUS_02310 1966 941 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_02310 2108 2848 gene locus_tag LOCUS_02320 2108 2848 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_02320 3624 2896 gene locus_tag LOCUS_02330 3624 2896 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_02330 5284 3665 gene locus_tag LOCUS_02340 5284 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5423 6676 gene locus_tag LOCUS_02350 5423 6676 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120906.1 protein_id gnl|my_center|LOCUS_02350 6808 7812 gene locus_tag LOCUS_02360 gene hemB 6808 7812 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389590.1 protein_id gnl|my_center|LOCUS_02360 7963 9249 gene locus_tag LOCUS_02370 gene hemL 7963 9249 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_02370 9704 9429 gene locus_tag LOCUS_02380 9704 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 10334 9708 gene locus_tag LOCUS_02390 10334 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 10631 11143 gene locus_tag LOCUS_02400 10631 11143 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941579.1 protein_id gnl|my_center|LOCUS_02400 11158 12993 gene locus_tag LOCUS_02410 11158 12993 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_02410 13043 14431 gene locus_tag LOCUS_02420 13043 14431 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_02420 14435 14662 gene locus_tag LOCUS_02430 14435 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 15041 18010 gene locus_tag LOCUS_02440 15041 18010 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_02440 18442 19386 gene locus_tag LOCUS_02450 18442 19386 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_02450 19597 21561 gene locus_tag LOCUS_02460 gene ftsH 19597 21561 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325413.1 protein_id gnl|my_center|LOCUS_02460 21617 23389 gene locus_tag LOCUS_02470 21617 23389 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120593.1 protein_id gnl|my_center|LOCUS_02470 24631 23465 gene locus_tag LOCUS_02480 gene dgt 24631 23465 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817450.1 protein_id gnl|my_center|LOCUS_02480 24737 26101 gene locus_tag LOCUS_02490 gene atoC 24737 26101 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_02490 26235 26540 gene locus_tag LOCUS_02500 26235 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 26582 27664 gene locus_tag LOCUS_02510 26582 27664 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122045.1 protein_id gnl|my_center|LOCUS_02510 28180 27887 gene locus_tag LOCUS_02520 28180 27887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 29293 28457 gene locus_tag LOCUS_02530 29293 28457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 30316 29402 gene locus_tag LOCUS_02540 30316 29402 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_02540 30612 30809 gene locus_tag LOCUS_02550 30612 30809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 31006 35085 gene locus_tag LOCUS_02560 31006 35085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 35274 36494 gene locus_tag LOCUS_02570 35274 36494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 36538 36918 gene locus_tag LOCUS_02580 36538 36918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 36806 37162 gene locus_tag LOCUS_02590 36806 37162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 37207 39639 gene locus_tag LOCUS_02600 37207 39639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 41252 39675 gene locus_tag LOCUS_02610 41252 39675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 41939 41331 gene locus_tag LOCUS_02620 41939 41331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 43760 42195 gene locus_tag LOCUS_02630 43760 42195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 45371 44124 gene locus_tag LOCUS_02640 45371 44124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 45682 47244 gene locus_tag LOCUS_02650 45682 47244 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_02650 48528 47254 gene locus_tag LOCUS_02660 48528 47254 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943657.1 protein_id gnl|my_center|LOCUS_02660 51018 48949 gene locus_tag LOCUS_02670 51018 48949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 53189 51135 gene locus_tag LOCUS_02680 53189 51135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 54631 53201 gene locus_tag LOCUS_02690 54631 53201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 54918 56111 gene locus_tag LOCUS_02700 54918 56111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 56098 57354 gene locus_tag LOCUS_02710 56098 57354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 57378 58346 gene locus_tag LOCUS_02720 gene akrN 57378 58346 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_02720 63211 58556 gene locus_tag LOCUS_02730 63211 58556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 63876 63214 gene locus_tag LOCUS_02740 63876 63214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 64797 69758 gene locus_tag LOCUS_02750 64797 69758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 69762 71033 gene locus_tag LOCUS_02760 69762 71033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 71055 73103 gene locus_tag LOCUS_02770 71055 73103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 73368 74885 gene locus_tag LOCUS_02780 73368 74885 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_02780 75358 77745 gene locus_tag LOCUS_02790 75358 77745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 77856 78050 gene locus_tag LOCUS_02800 77856 78050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 78037 78405 gene locus_tag LOCUS_02810 78037 78405 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256573.1 protein_id gnl|my_center|LOCUS_02810 78425 78658 gene locus_tag LOCUS_02820 78425 78658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 79019 85342 gene locus_tag LOCUS_02830 79019 85342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 86445 85360 gene locus_tag LOCUS_02840 86445 85360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 88770 86794 gene locus_tag LOCUS_02850 88770 86794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 91168 88775 gene locus_tag LOCUS_02860 91168 88775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 91134 92762 gene locus_tag LOCUS_02870 91134 92762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 92931 94025 gene locus_tag LOCUS_02880 92931 94025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 95390 94077 gene locus_tag LOCUS_02890 95390 94077 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_02890 96647 102376 gene locus_tag LOCUS_02900 96647 102376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 103748 102366 gene locus_tag LOCUS_02910 103748 102366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 104244 103897 gene locus_tag LOCUS_02920 104244 103897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 104496 104245 gene locus_tag LOCUS_02930 104496 104245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 106173 104632 gene locus_tag LOCUS_02940 106173 104632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 108344 106359 gene locus_tag LOCUS_02950 108344 106359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 110588 108588 gene locus_tag LOCUS_02960 110588 108588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 111760 110621 gene locus_tag LOCUS_02970 111760 110621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 113522 111798 gene locus_tag LOCUS_02980 113522 111798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence004 418 269 gene locus_tag LOCUS_02990 418 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1747 1349 gene locus_tag LOCUS_03000 1747 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 1879 3390 gene locus_tag LOCUS_03010 1879 3390 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921758.1 protein_id gnl|my_center|LOCUS_03010 3378 7067 gene locus_tag LOCUS_03020 3378 7067 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921757.1 protein_id gnl|my_center|LOCUS_03020 7169 7717 gene locus_tag LOCUS_03030 7169 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 9025 8006 gene locus_tag LOCUS_03040 gene dmeF 9025 8006 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389388.1 protein_id gnl|my_center|LOCUS_03040 10989 9157 gene locus_tag LOCUS_03050 10989 9157 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812952.1 protein_id gnl|my_center|LOCUS_03050 11082 11414 gene locus_tag LOCUS_03060 gene nirD 11082 11414 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_03060 12529 11603 gene locus_tag LOCUS_03070 12529 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 13706 12573 gene locus_tag LOCUS_03080 13706 12573 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_03080 13784 15916 gene locus_tag LOCUS_03090 13784 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 15913 18348 gene locus_tag LOCUS_03100 15913 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_03100 18476 18733 gene locus_tag LOCUS_03110 18476 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 18746 19081 gene locus_tag LOCUS_03120 18746 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 19123 22815 gene locus_tag LOCUS_03130 19123 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 22865 23629 gene locus_tag LOCUS_03140 22865 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 23719 24777 gene locus_tag LOCUS_03150 23719 24777 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_03150 24797 26074 gene locus_tag LOCUS_03160 24797 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 26083 27750 gene locus_tag LOCUS_03170 26083 27750 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922005.1 protein_id gnl|my_center|LOCUS_03170 27924 28295 gene locus_tag LOCUS_03180 27924 28295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 28282 28878 gene locus_tag LOCUS_03190 28282 28878 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427748.1 protein_id gnl|my_center|LOCUS_03190 29035 29475 gene locus_tag LOCUS_03200 29035 29475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 29631 30443 gene locus_tag LOCUS_03210 gene hisN 29631 30443 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_03210 31202 30462 gene locus_tag LOCUS_03220 gene ispD 31202 30462 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 protein_id gnl|my_center|LOCUS_03220 31404 33068 gene locus_tag LOCUS_03230 31404 33068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 33075 35036 gene locus_tag LOCUS_03240 33075 35036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 35074 35583 gene locus_tag LOCUS_03250 35074 35583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 35602 35946 gene locus_tag LOCUS_03260 35602 35946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 35989 36786 gene locus_tag LOCUS_03270 35989 36786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 36783 37265 gene locus_tag LOCUS_03280 36783 37265 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660073.1 protein_id gnl|my_center|LOCUS_03280 37832 37302 gene locus_tag LOCUS_03290 37832 37302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 40377 38140 gene locus_tag LOCUS_03300 40377 38140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 42103 40661 gene locus_tag LOCUS_03310 42103 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 42948 43409 gene locus_tag LOCUS_03320 42948 43409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 43728 44207 gene locus_tag LOCUS_03330 43728 44207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 44235 44564 gene locus_tag LOCUS_03340 44235 44564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 44736 45224 gene locus_tag LOCUS_03350 44736 45224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 46229 45234 gene locus_tag LOCUS_03360 46229 45234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 47701 48486 gene locus_tag LOCUS_03370 47701 48486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 48490 49239 gene locus_tag LOCUS_03380 48490 49239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 49356 49685 gene locus_tag LOCUS_03390 gene trxA 49356 49685 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_03390 51613 49688 gene locus_tag LOCUS_03400 51613 49688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 52541 51936 gene locus_tag LOCUS_03410 52541 51936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 53535 52594 gene locus_tag LOCUS_03420 gene ispE 53535 52594 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772094.1 protein_id gnl|my_center|LOCUS_03420 54110 54197 gene locus_tag LOCUS_t00030 54110 54197 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55230 54307 gene locus_tag LOCUS_03430 55230 54307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 56910 55321 gene locus_tag LOCUS_03440 56910 55321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 62071 57083 gene locus_tag LOCUS_03450 62071 57083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 62216 63532 gene locus_tag LOCUS_03460 62216 63532 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_03460 66144 63541 gene locus_tag LOCUS_03470 66144 63541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 66344 66628 gene locus_tag LOCUS_03480 66344 66628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 69674 66756 gene locus_tag LOCUS_03490 69674 66756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 73145 69831 gene locus_tag LOCUS_03500 73145 69831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 74425 73313 gene locus_tag LOCUS_03510 74425 73313 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_03510 78076 74807 gene locus_tag LOCUS_03520 78076 74807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 78635 78904 gene locus_tag LOCUS_03530 78635 78904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 79045 79425 gene locus_tag LOCUS_03540 79045 79425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 79914 79636 gene locus_tag LOCUS_03550 79914 79636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 83163 79996 gene locus_tag LOCUS_03560 83163 79996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 87577 83303 gene locus_tag LOCUS_03570 87577 83303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 89438 87828 gene locus_tag LOCUS_03580 89438 87828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 91647 89560 gene locus_tag LOCUS_03590 91647 89560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 91886 93820 gene locus_tag LOCUS_03600 91886 93820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 94328 93828 gene locus_tag LOCUS_03610 94328 93828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 94610 95968 gene locus_tag LOCUS_03620 94610 95968 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_03620 97998 96064 gene locus_tag LOCUS_03630 97998 96064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 99373 98000 gene locus_tag LOCUS_03640 99373 98000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 99565 100701 gene locus_tag LOCUS_03650 99565 100701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence005 658 359 gene locus_tag LOCUS_03660 658 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2057 936 gene locus_tag LOCUS_03670 2057 936 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_03670 2178 4442 gene locus_tag LOCUS_03680 2178 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 7285 4493 gene locus_tag LOCUS_03690 7285 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 8607 7387 gene locus_tag LOCUS_03700 8607 7387 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_03700 9194 8604 gene locus_tag LOCUS_03710 9194 8604 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333306.1 protein_id gnl|my_center|LOCUS_03710 9376 10290 gene locus_tag LOCUS_03720 9376 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664270.1 protein_id gnl|my_center|LOCUS_03720 12300 10435 gene locus_tag LOCUS_03730 12300 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 13287 12631 gene locus_tag LOCUS_03740 13287 12631 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_03740 13779 13342 gene locus_tag LOCUS_03750 13779 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 14173 13769 gene locus_tag LOCUS_03760 14173 13769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 14328 14143 gene locus_tag LOCUS_03770 14328 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 15161 14364 gene locus_tag LOCUS_03780 15161 14364 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672317.1 protein_id gnl|my_center|LOCUS_03780 17512 15179 gene locus_tag LOCUS_03790 17512 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 18243 17548 gene locus_tag LOCUS_03800 18243 17548 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_03800 19415 18273 gene locus_tag LOCUS_03810 19415 18273 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_03810 19790 19482 gene locus_tag LOCUS_03820 19790 19482 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_03820 19965 21803 gene locus_tag LOCUS_03830 19965 21803 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_03830 22018 22980 gene locus_tag LOCUS_03840 22018 22980 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324266.1 protein_id gnl|my_center|LOCUS_03840 22980 23189 gene locus_tag LOCUS_03850 22980 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 23200 25086 gene locus_tag LOCUS_03860 23200 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122284.1 protein_id gnl|my_center|LOCUS_03860 25744 25070 gene locus_tag LOCUS_03870 gene can 25744 25070 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_03870 26078 27829 gene locus_tag LOCUS_03880 26078 27829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 28208 28519 gene locus_tag LOCUS_03890 28208 28519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 28538 29449 gene locus_tag LOCUS_03900 28538 29449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 29660 31381 gene locus_tag LOCUS_03910 29660 31381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 31757 31467 gene locus_tag LOCUS_03920 31757 31467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 31987 31754 gene locus_tag LOCUS_03930 31987 31754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 32135 32437 gene locus_tag LOCUS_03940 32135 32437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 32551 34914 gene locus_tag LOCUS_03950 32551 34914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 34925 36580 gene locus_tag LOCUS_03960 34925 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 36653 38164 gene locus_tag LOCUS_03970 36653 38164 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_03970 38552 38340 gene locus_tag LOCUS_03980 38552 38340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 38839 38549 gene locus_tag LOCUS_03990 38839 38549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 38897 39100 gene locus_tag LOCUS_04000 38897 39100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 39267 40364 gene locus_tag LOCUS_04010 39267 40364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 40919 40593 gene locus_tag LOCUS_04020 40919 40593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 41177 40935 gene locus_tag LOCUS_04030 41177 40935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 41473 41655 gene locus_tag LOCUS_04040 41473 41655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 41916 45365 gene locus_tag LOCUS_04050 41916 45365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 45577 45870 gene locus_tag LOCUS_04060 45577 45870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 45867 47441 gene locus_tag LOCUS_04070 45867 47441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 47592 49637 gene locus_tag LOCUS_04080 47592 49637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 51347 49860 gene locus_tag LOCUS_04090 51347 49860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 51401 51589 gene locus_tag LOCUS_04100 51401 51589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 55156 52193 gene locus_tag LOCUS_04110 55156 52193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 55577 57820 gene locus_tag LOCUS_04120 55577 57820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 57896 59776 gene locus_tag LOCUS_04130 57896 59776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 59979 61601 gene locus_tag LOCUS_04140 59979 61601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 61733 63121 gene locus_tag LOCUS_04150 61733 63121 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_04150 63239 65686 gene locus_tag LOCUS_04160 63239 65686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 65967 66515 gene locus_tag LOCUS_04170 65967 66515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 66664 69126 gene locus_tag LOCUS_04180 66664 69126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 70400 69330 gene locus_tag LOCUS_04190 70400 69330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 72425 70617 gene locus_tag LOCUS_04200 gene rhgW 72425 70617 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_04200 72735 74216 gene locus_tag LOCUS_04210 72735 74216 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_04210 74716 76440 gene locus_tag LOCUS_04220 74716 76440 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030106.1 protein_id gnl|my_center|LOCUS_04220 76447 79110 gene locus_tag LOCUS_04230 76447 79110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 79148 79429 gene locus_tag LOCUS_04240 79148 79429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 79433 80188 gene locus_tag LOCUS_04250 79433 80188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 80285 81700 gene locus_tag LOCUS_04260 80285 81700 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_04260 82690 81824 gene locus_tag LOCUS_04270 82690 81824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 83121 82690 gene locus_tag LOCUS_04280 83121 82690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 83699 83349 gene locus_tag LOCUS_04290 83699 83349 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_04290 84102 83725 gene locus_tag LOCUS_04300 gene crcB 84102 83725 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938890.1 protein_id gnl|my_center|LOCUS_04300 84567 84337 gene locus_tag LOCUS_04310 84567 84337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 85828 84809 gene locus_tag LOCUS_04320 85828 84809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_04320 87563 85983 gene locus_tag LOCUS_04330 87563 85983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 88912 87575 gene locus_tag LOCUS_04340 88912 87575 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_04340 89941 89273 gene locus_tag LOCUS_04350 89941 89273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 90173 91639 gene locus_tag LOCUS_04360 90173 91639 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324689.1 protein_id gnl|my_center|LOCUS_04360 91885 92499 gene locus_tag LOCUS_04370 91885 92499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence006 1117 104 gene locus_tag LOCUS_04380 1117 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2984 1518 gene locus_tag LOCUS_04390 gene rfaE1 2984 1518 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_04390 6730 3011 gene locus_tag LOCUS_04400 6730 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7067 7882 gene locus_tag LOCUS_04410 7067 7882 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_04410 7863 9017 gene locus_tag LOCUS_04420 gene mqnC 7863 9017 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_04420 9053 10924 gene locus_tag LOCUS_04430 9053 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615842.1 protein_id gnl|my_center|LOCUS_04430 10957 11385 gene locus_tag LOCUS_04440 10957 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 11919 12275 gene locus_tag LOCUS_04450 11919 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 12307 13104 gene locus_tag LOCUS_04460 12307 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 13474 14307 gene locus_tag LOCUS_04470 gene larE 13474 14307 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_04470 15490 14324 gene locus_tag LOCUS_04480 15490 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 15914 15681 gene locus_tag LOCUS_04490 15914 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 16720 16139 gene locus_tag LOCUS_04500 16720 16139 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335404.1 protein_id gnl|my_center|LOCUS_04500 17078 17356 gene locus_tag LOCUS_04510 17078 17356 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_04510 17526 18956 gene locus_tag LOCUS_04520 17526 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19585 19040 gene locus_tag LOCUS_04530 19585 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 19867 20532 gene locus_tag LOCUS_04540 gene hypB 19867 20532 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007234.1 protein_id gnl|my_center|LOCUS_04540 20539 22869 gene locus_tag LOCUS_04550 gene hypF 20539 22869 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_04550 22838 23134 gene locus_tag LOCUS_04560 22838 23134 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_04560 23131 24231 gene locus_tag LOCUS_04570 gene hypD 23131 24231 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_04570 24473 25453 gene locus_tag LOCUS_04580 gene hypE 24473 25453 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_04580 36321 25513 gene locus_tag LOCUS_04590 36321 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 36621 38447 gene locus_tag LOCUS_04600 36621 38447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 39072 38458 gene locus_tag LOCUS_04610 39072 38458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 39144 44078 gene locus_tag LOCUS_04620 39144 44078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 46527 44161 gene locus_tag LOCUS_04630 46527 44161 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_04630 46858 47709 gene locus_tag LOCUS_04640 46858 47709 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_04640 47753 49513 gene locus_tag LOCUS_04650 47753 49513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 49510 50412 gene locus_tag LOCUS_04660 49510 50412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020382.1 protein_id gnl|my_center|LOCUS_04660 50430 51104 gene locus_tag LOCUS_04670 50430 51104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 51949 51113 gene locus_tag LOCUS_04680 51949 51113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 54570 51958 gene locus_tag LOCUS_04690 gene mutS 54570 51958 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_04690 55617 54622 gene locus_tag LOCUS_04700 55617 54622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_04700 56600 55851 gene locus_tag LOCUS_04710 gene rnc 56600 55851 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120177.1 protein_id gnl|my_center|LOCUS_04710 56760 57920 gene locus_tag LOCUS_04720 56760 57920 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615979.1 protein_id gnl|my_center|LOCUS_04720 57950 59362 gene locus_tag LOCUS_04730 gene mgtE 57950 59362 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118267.1 protein_id gnl|my_center|LOCUS_04730 61126 59471 gene locus_tag LOCUS_04740 61126 59471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 61721 61356 gene locus_tag LOCUS_04750 61721 61356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 62783 62043 gene locus_tag LOCUS_04760 62783 62043 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_04760 63052 62979 gene locus_tag LOCUS_t00040 63052 62979 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 63172 64173 gene locus_tag LOCUS_04770 63172 64173 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_04770 65172 64195 gene locus_tag LOCUS_04780 65172 64195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 65308 65847 gene locus_tag LOCUS_04790 65308 65847 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888916.1 protein_id gnl|my_center|LOCUS_04790 67126 65837 gene locus_tag LOCUS_04800 67126 65837 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_04800 68160 67231 gene locus_tag LOCUS_04810 68160 67231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 69084 68341 gene locus_tag LOCUS_04820 gene moeB 69084 68341 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393468.1 protein_id gnl|my_center|LOCUS_04820 69247 69588 gene locus_tag LOCUS_04830 69247 69588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 69968 69729 gene locus_tag LOCUS_04840 69968 69729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 70129 71265 gene locus_tag LOCUS_04850 70129 71265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 71280 71849 gene locus_tag LOCUS_04860 71280 71849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 72391 71846 gene locus_tag LOCUS_04870 72391 71846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 73171 72407 gene locus_tag LOCUS_04880 gene surE 73171 72407 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_04880 73439 75022 gene locus_tag LOCUS_04890 gene guaA 73439 75022 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_04890 76274 75138 gene locus_tag LOCUS_04900 gene dprA 76274 75138 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_04900 76520 77737 gene locus_tag LOCUS_04910 76520 77737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 77937 80069 gene locus_tag LOCUS_04920 77937 80069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 80243 81880 gene locus_tag LOCUS_04930 80243 81880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 82012 83088 gene locus_tag LOCUS_04940 82012 83088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145385480.1 protein_id gnl|my_center|LOCUS_04940 83424 84152 gene locus_tag LOCUS_04950 83424 84152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 84215 85546 gene locus_tag LOCUS_04960 84215 85546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 85563 87473 gene locus_tag LOCUS_04970 85563 87473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 87418 89814 gene locus_tag LOCUS_04980 gene nuoF 87418 89814 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_04980 90086 91729 gene locus_tag LOCUS_04990 90086 91729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 <92477 91855 gene locus_tag LOCUS_05000 <92477 91855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209832.1:Fe-S protein assembly chaperone HscA >Feature sequence007 1202 90 gene locus_tag LOCUS_05010 1202 90 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922099.1 protein_id gnl|my_center|LOCUS_05010 1722 2936 gene locus_tag LOCUS_05020 1722 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3071 4708 gene locus_tag LOCUS_05030 3071 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4947 6143 gene locus_tag LOCUS_05040 4947 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 6404 6907 gene locus_tag LOCUS_05050 6404 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6973 7941 gene locus_tag LOCUS_05060 6973 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 9536 7938 gene locus_tag LOCUS_05070 9536 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 12278 9885 gene locus_tag LOCUS_05080 12278 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 13746 12508 gene locus_tag LOCUS_05090 13746 12508 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_05090 14235 13828 gene locus_tag LOCUS_05100 14235 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 14578 14216 gene locus_tag LOCUS_05110 14578 14216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 17420 14793 gene locus_tag LOCUS_05120 17420 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 17661 18755 gene locus_tag LOCUS_05130 17661 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 20097 18805 gene locus_tag LOCUS_05140 20097 18805 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_05140 20423 21154 gene locus_tag LOCUS_05150 20423 21154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 21212 21364 gene locus_tag LOCUS_05160 21212 21364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 23722 21389 gene locus_tag LOCUS_05170 23722 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 27275 23868 gene locus_tag LOCUS_05180 27275 23868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 30451 27272 gene locus_tag LOCUS_05190 30451 27272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 33656 30486 gene locus_tag LOCUS_05200 33656 30486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 34332 34580 gene locus_tag LOCUS_05210 34332 34580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 34610 34906 gene locus_tag LOCUS_05220 34610 34906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 38361 35110 gene locus_tag LOCUS_05230 38361 35110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 38728 38474 gene locus_tag LOCUS_05240 38728 38474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 38957 38703 gene locus_tag LOCUS_05250 38957 38703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 41933 39033 gene locus_tag LOCUS_05260 41933 39033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 43430 41985 gene locus_tag LOCUS_05270 43430 41985 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_05270 44198 43482 gene locus_tag LOCUS_05280 44198 43482 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922660.1 protein_id gnl|my_center|LOCUS_05280 45542 44229 gene locus_tag LOCUS_05290 45542 44229 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_05290 48274 45734 gene locus_tag LOCUS_05300 48274 45734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 50674 48482 gene locus_tag LOCUS_05310 50674 48482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 54064 50864 gene locus_tag LOCUS_05320 54064 50864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 54405 57674 gene locus_tag LOCUS_05330 54405 57674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 57703 58776 gene locus_tag LOCUS_05340 57703 58776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 59201 59007 gene locus_tag LOCUS_05350 59201 59007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 59206 59607 gene locus_tag LOCUS_05360 59206 59607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 59789 60106 gene locus_tag LOCUS_05370 59789 60106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 60243 60575 gene locus_tag LOCUS_05380 60243 60575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 63558 60559 gene locus_tag LOCUS_05390 63558 60559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 65756 63762 gene locus_tag LOCUS_05400 65756 63762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 66980 66276 gene locus_tag LOCUS_05410 66980 66276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 67280 67059 gene locus_tag LOCUS_05420 67280 67059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 67323 67706 gene locus_tag LOCUS_05430 67323 67706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 69271 68291 gene locus_tag LOCUS_05440 69271 68291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 69492 69929 gene locus_tag LOCUS_05450 69492 69929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 70524 71312 gene locus_tag LOCUS_05460 70524 71312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 71449 71910 gene locus_tag LOCUS_05470 71449 71910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 73601 71982 gene locus_tag LOCUS_05480 73601 71982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 73829 74047 gene locus_tag LOCUS_05490 73829 74047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 75521 74781 gene locus_tag LOCUS_05500 75521 74781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 75835 77352 gene locus_tag LOCUS_05510 75835 77352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 78301 77414 gene locus_tag LOCUS_05520 78301 77414 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_05520 78880 78377 gene locus_tag LOCUS_05530 78880 78377 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838381.1 protein_id gnl|my_center|LOCUS_05530 79337 78933 gene locus_tag LOCUS_05540 79337 78933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 80715 79585 gene locus_tag LOCUS_05550 80715 79585 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039508.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence008 65 1546 gene locus_tag LOCUS_05560 65 1546 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_05560 1819 2997 gene locus_tag LOCUS_05570 gene dgoD 1819 2997 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_05570 2999 3940 gene locus_tag LOCUS_05580 2999 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4213 3950 gene locus_tag LOCUS_05590 4213 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4396 5664 gene locus_tag LOCUS_05600 4396 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6650 5676 gene locus_tag LOCUS_05610 6650 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 9626 6792 gene locus_tag LOCUS_05620 9626 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143140759.1 protein_id gnl|my_center|LOCUS_05620 10096 9803 gene locus_tag LOCUS_05630 10096 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10943 10620 gene locus_tag LOCUS_05640 10943 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11902 11270 gene locus_tag LOCUS_05650 11902 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 12373 11948 gene locus_tag LOCUS_05660 12373 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 13388 12321 gene locus_tag LOCUS_05670 13388 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121229.1 protein_id gnl|my_center|LOCUS_05670 14372 13506 gene locus_tag LOCUS_05680 gene lpxA 14372 13506 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_05680 14362 14640 gene locus_tag LOCUS_05690 14362 14640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14684 15019 gene locus_tag LOCUS_05700 14684 15019 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333113.1 protein_id gnl|my_center|LOCUS_05700 15144 15329 gene locus_tag LOCUS_05710 15144 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 16890 15352 gene locus_tag LOCUS_05720 16890 15352 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_05720 18513 17092 gene locus_tag LOCUS_05730 18513 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 18694 20055 gene locus_tag LOCUS_05740 18694 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 23383 20201 gene locus_tag LOCUS_05750 23383 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_05750 26937 23875 gene locus_tag LOCUS_05760 26937 23875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 28808 26934 gene locus_tag LOCUS_05770 28808 26934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 31609 29033 gene locus_tag LOCUS_05780 31609 29033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 31627 31842 gene locus_tag LOCUS_05790 31627 31842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 31862 34120 gene locus_tag LOCUS_05800 31862 34120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 38901 34396 gene locus_tag LOCUS_05810 38901 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 39652 39041 gene locus_tag LOCUS_05820 39652 39041 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_05820 39845 40060 gene locus_tag LOCUS_05830 39845 40060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 40176 40574 gene locus_tag LOCUS_05840 40176 40574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 40577 42292 gene locus_tag LOCUS_05850 40577 42292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 42669 42382 gene locus_tag LOCUS_05860 42669 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 43323 42676 gene locus_tag LOCUS_05870 43323 42676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 43789 44301 gene locus_tag LOCUS_05880 43789 44301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 44624 46003 gene locus_tag LOCUS_05890 44624 46003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 47077 46019 gene locus_tag LOCUS_05900 47077 46019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 47677 47330 gene locus_tag LOCUS_05910 47677 47330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 50422 47912 gene locus_tag LOCUS_05920 50422 47912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 50890 51105 gene locus_tag LOCUS_05930 50890 51105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 51269 52177 gene locus_tag LOCUS_05940 51269 52177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 52628 53134 gene locus_tag LOCUS_05950 52628 53134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 53562 56321 gene locus_tag LOCUS_05960 53562 56321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 56519 58633 gene locus_tag LOCUS_05970 56519 58633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_05970 58758 60056 gene locus_tag LOCUS_05980 58758 60056 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_05980 60228 61019 gene locus_tag LOCUS_05990 60228 61019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 61164 62543 gene locus_tag LOCUS_06000 61164 62543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 62579 63442 gene locus_tag LOCUS_06010 62579 63442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 63526 65235 gene locus_tag LOCUS_06020 63526 65235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 65383 66129 gene locus_tag LOCUS_06030 65383 66129 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_06030 67122 66289 gene locus_tag LOCUS_06040 67122 66289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 68931 67273 gene locus_tag LOCUS_06050 68931 67273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 69110 71059 gene locus_tag LOCUS_06060 69110 71059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 71727 71302 gene locus_tag LOCUS_06070 71727 71302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329468.1 protein_id gnl|my_center|LOCUS_06070 72117 72899 gene locus_tag LOCUS_06080 72117 72899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 73153 73458 gene locus_tag LOCUS_06090 73153 73458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 73707 73955 gene locus_tag LOCUS_06100 73707 73955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 75076 74114 gene locus_tag LOCUS_06110 75076 74114 CDS product DUF21 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324277.1 protein_id gnl|my_center|LOCUS_06110 76350 75073 gene locus_tag LOCUS_06120 76350 75073 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324278.1 protein_id gnl|my_center|LOCUS_06120 78216 76354 gene locus_tag LOCUS_06130 78216 76354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_06130 78358 79551 gene locus_tag LOCUS_06140 78358 79551 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_06140 79579 80115 gene locus_tag LOCUS_06150 79579 80115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence009 2449 1268 gene locus_tag LOCUS_06160 2449 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3738 2446 gene locus_tag LOCUS_06170 3738 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5007 3868 gene locus_tag LOCUS_06180 5007 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 6725 5058 gene locus_tag LOCUS_06190 6725 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7866 6787 gene locus_tag LOCUS_06200 7866 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 8947 7922 gene locus_tag LOCUS_06210 8947 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 9803 9027 gene locus_tag LOCUS_06220 9803 9027 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_06220 9781 9930 gene locus_tag LOCUS_06230 9781 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 10125 11225 gene locus_tag LOCUS_06240 10125 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 11247 11717 gene locus_tag LOCUS_06250 11247 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 14793 11689 gene locus_tag LOCUS_06260 14793 11689 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_06260 15913 14837 gene locus_tag LOCUS_06270 15913 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 16181 16522 gene locus_tag LOCUS_06280 16181 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 16523 16858 gene locus_tag LOCUS_06290 16523 16858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 18323 17055 gene locus_tag LOCUS_06300 18323 17055 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_06300 19808 18399 gene locus_tag LOCUS_06310 19808 18399 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218083104.1 protein_id gnl|my_center|LOCUS_06310 20009 21079 gene locus_tag LOCUS_06320 20009 21079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 27205 21101 gene locus_tag LOCUS_06330 27205 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 30035 27546 gene locus_tag LOCUS_06340 30035 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_06340 30613 30065 gene locus_tag LOCUS_06350 30613 30065 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_06350 30868 33255 gene locus_tag LOCUS_06360 30868 33255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 33400 36363 gene locus_tag LOCUS_06370 33400 36363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 37036 40317 gene locus_tag LOCUS_06380 37036 40317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 40343 44779 gene locus_tag LOCUS_06390 40343 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 44816 49378 gene locus_tag LOCUS_06400 44816 49378 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_06400 49933 49448 gene locus_tag LOCUS_06410 49933 49448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 50271 51248 gene locus_tag LOCUS_06420 50271 51248 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_06420 51327 53864 gene locus_tag LOCUS_06430 51327 53864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 53978 57160 gene locus_tag LOCUS_06440 53978 57160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 59941 57176 gene locus_tag LOCUS_06450 59941 57176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 60170 59943 gene locus_tag LOCUS_06460 60170 59943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 62457 60223 gene locus_tag LOCUS_06470 62457 60223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_06470 62620 64668 gene locus_tag LOCUS_06480 62620 64668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 65887 64910 gene locus_tag LOCUS_06490 65887 64910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 66035 66970 gene locus_tag LOCUS_06500 66035 66970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 <68428 67265 gene locus_tag LOCUS_06510 <68428 67265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615720.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence010 1646 1137 gene locus_tag LOCUS_06520 1646 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2814 1633 gene locus_tag LOCUS_06530 2814 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3065 3805 gene locus_tag LOCUS_06540 3065 3805 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_06540 3967 7863 gene locus_tag LOCUS_06550 3967 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 9689 7908 gene locus_tag LOCUS_06560 9689 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9950 11395 gene locus_tag LOCUS_06570 9950 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 11510 13636 gene locus_tag LOCUS_06580 11510 13636 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_06580 14705 13677 gene locus_tag LOCUS_06590 14705 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 15717 14761 gene locus_tag LOCUS_06600 15717 14761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 16029 15829 gene locus_tag LOCUS_06610 16029 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 16081 17799 gene locus_tag LOCUS_06620 16081 17799 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_06620 17787 17987 gene locus_tag LOCUS_06630 17787 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 18037 19140 gene locus_tag LOCUS_06640 18037 19140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 20905 19241 gene locus_tag LOCUS_06650 20905 19241 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122081.1 protein_id gnl|my_center|LOCUS_06650 21183 21800 gene locus_tag LOCUS_06660 21183 21800 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_06660 22473 21790 gene locus_tag LOCUS_06670 22473 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 26061 22510 gene locus_tag LOCUS_06680 26061 22510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 26257 29574 gene locus_tag LOCUS_06690 26257 29574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 30225 29611 gene locus_tag LOCUS_06700 30225 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 30273 30455 gene locus_tag LOCUS_06710 30273 30455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 30500 33982 gene locus_tag LOCUS_06720 30500 33982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 35790 34081 gene locus_tag LOCUS_06730 35790 34081 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_06730 39635 36156 gene locus_tag LOCUS_06740 39635 36156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 39723 40241 gene locus_tag LOCUS_06750 39723 40241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 40442 40266 gene locus_tag LOCUS_06760 40442 40266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 40575 42650 gene locus_tag LOCUS_06770 40575 42650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 42865 43689 gene locus_tag LOCUS_06780 42865 43689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 43888 43745 gene locus_tag LOCUS_06790 43888 43745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 44290 44057 gene locus_tag LOCUS_06800 44290 44057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 44327 46510 gene locus_tag LOCUS_06810 44327 46510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 46513 47814 gene locus_tag LOCUS_06820 46513 47814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 48518 51844 gene locus_tag LOCUS_06830 48518 51844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 51847 52827 gene locus_tag LOCUS_06840 51847 52827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428935.1 protein_id gnl|my_center|LOCUS_06840 52896 54017 gene locus_tag LOCUS_06850 52896 54017 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943943.1 protein_id gnl|my_center|LOCUS_06850 54399 56300 gene locus_tag LOCUS_06860 54399 56300 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664336.1 protein_id gnl|my_center|LOCUS_06860 56776 58521 gene locus_tag LOCUS_06870 56776 58521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 58635 59531 gene locus_tag LOCUS_06880 58635 59531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 59839 60174 gene locus_tag LOCUS_06890 59839 60174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 64946 60114 gene locus_tag LOCUS_06900 64946 60114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence011 829 2124 gene locus_tag LOCUS_06910 829 2124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_06910 2442 2954 gene locus_tag LOCUS_06920 2442 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3112 4431 gene locus_tag LOCUS_06930 3112 4431 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_06930 4979 4896 gene locus_tag LOCUS_t00050 4979 4896 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5497 7569 gene locus_tag LOCUS_06940 5497 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8065 10368 gene locus_tag LOCUS_06950 8065 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 11295 10840 gene locus_tag LOCUS_06960 11295 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 11480 12211 gene locus_tag LOCUS_06970 11480 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 12263 13108 gene locus_tag LOCUS_06980 12263 13108 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_06980 13122 14300 gene locus_tag LOCUS_06990 13122 14300 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_06990 14429 15469 gene locus_tag LOCUS_07000 gene arsS 14429 15469 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_07000 15979 16278 gene locus_tag LOCUS_07010 15979 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 16385 16708 gene locus_tag LOCUS_07020 16385 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 17516 16767 gene locus_tag LOCUS_07030 17516 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 18471 17509 gene locus_tag LOCUS_07040 18471 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 21698 18663 gene locus_tag LOCUS_07050 21698 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 23348 21798 gene locus_tag LOCUS_07060 23348 21798 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_07060 23600 23989 gene locus_tag LOCUS_07070 23600 23989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 24030 24239 gene locus_tag LOCUS_07080 24030 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 25279 24197 gene locus_tag LOCUS_07090 25279 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 26973 25450 gene locus_tag LOCUS_07100 26973 25450 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_07100 27950 26970 gene locus_tag LOCUS_07110 27950 26970 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_07110 29347 27968 gene locus_tag LOCUS_07120 29347 27968 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_07120 30833 29376 gene locus_tag LOCUS_07130 30833 29376 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_07130 31940 30834 gene locus_tag LOCUS_07140 31940 30834 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_07140 33235 31937 gene locus_tag LOCUS_07150 33235 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 34952 33678 gene locus_tag LOCUS_07160 34952 33678 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275917.1 protein_id gnl|my_center|LOCUS_07160 36061 34940 gene locus_tag LOCUS_07170 36061 34940 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_07170 37375 36068 gene locus_tag LOCUS_07180 37375 36068 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113721.1 protein_id gnl|my_center|LOCUS_07180 38586 37423 gene locus_tag LOCUS_07190 38586 37423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 40472 38667 gene locus_tag LOCUS_07200 40472 38667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 42697 40559 gene locus_tag LOCUS_07210 42697 40559 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_07210 43090 44058 gene locus_tag LOCUS_07220 43090 44058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 44043 45200 gene locus_tag LOCUS_07230 44043 45200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 45360 46265 gene locus_tag LOCUS_07240 45360 46265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 47223 46291 gene locus_tag LOCUS_07250 47223 46291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 47675 49738 gene locus_tag LOCUS_07260 gene asnB 47675 49738 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 protein_id gnl|my_center|LOCUS_07260 49745 50008 gene locus_tag LOCUS_07270 49745 50008 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061274.1 protein_id gnl|my_center|LOCUS_07270 50171 51724 gene locus_tag LOCUS_07280 50171 51724 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_07280 51721 52710 gene locus_tag LOCUS_07290 gene nadE 51721 52710 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533125.1 protein_id gnl|my_center|LOCUS_07290 52906 54699 gene locus_tag LOCUS_07300 52906 54699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 56435 54864 gene locus_tag LOCUS_07310 56435 54864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 56672 58117 gene locus_tag LOCUS_07320 gene cls 56672 58117 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034050559.1 protein_id gnl|my_center|LOCUS_07320 58383 59018 gene locus_tag LOCUS_07330 58383 59018 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359437.1 protein_id gnl|my_center|LOCUS_07330 59151 59702 gene locus_tag LOCUS_07340 59151 59702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 59997 60188 gene locus_tag LOCUS_07350 59997 60188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 60412 61065 gene locus_tag LOCUS_07360 60412 61065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 62199 61051 gene locus_tag LOCUS_07370 62199 61051 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612335.1 protein_id gnl|my_center|LOCUS_07370 63410 62211 gene locus_tag LOCUS_07380 63410 62211 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence012 1711 716 gene locus_tag LOCUS_07390 1711 716 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_07390 3156 1741 gene locus_tag LOCUS_07400 3156 1741 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_07400 3449 4510 gene locus_tag LOCUS_07410 3449 4510 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_07410 5619 4585 gene locus_tag LOCUS_07420 5619 4585 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699875.1 protein_id gnl|my_center|LOCUS_07420 8529 5695 gene locus_tag LOCUS_07430 gene leuS 8529 5695 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_07430 9159 8689 gene locus_tag LOCUS_07440 9159 8689 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_07440 9586 9431 gene locus_tag LOCUS_07450 9586 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 9708 11141 gene locus_tag LOCUS_07460 9708 11141 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_07460 12064 11255 gene locus_tag LOCUS_07470 12064 11255 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_07470 12297 13607 gene locus_tag LOCUS_07480 gene xylA 12297 13607 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_07480 37263 14074 gene locus_tag LOCUS_07490 37263 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 39604 38318 gene locus_tag LOCUS_07500 gene serS 39604 38318 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 protein_id gnl|my_center|LOCUS_07500 40980 39610 gene locus_tag LOCUS_07510 40980 39610 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_07510 41115 41474 gene locus_tag LOCUS_07520 41115 41474 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_07520 42442 41471 gene locus_tag LOCUS_07530 42442 41471 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665638.1 protein_id gnl|my_center|LOCUS_07530 42579 43361 gene locus_tag LOCUS_07540 42579 43361 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_07540 43522 45120 gene locus_tag LOCUS_07550 43522 45120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_07550 45184 46527 gene locus_tag LOCUS_07560 45184 46527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 47461 46532 gene locus_tag LOCUS_07570 gene rbsK 47461 46532 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_07570 48488 47493 gene locus_tag LOCUS_07580 48488 47493 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_07580 48878 50134 gene locus_tag LOCUS_07590 48878 50134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 50437 51123 gene locus_tag LOCUS_07600 50437 51123 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_07600 51271 52836 gene locus_tag LOCUS_07610 51271 52836 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_07610 53301 53789 gene locus_tag LOCUS_07620 53301 53789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 54482 54222 gene locus_tag LOCUS_07630 54482 54222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 54372 57437 gene locus_tag LOCUS_07640 54372 57437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence013 2 424 gene locus_tag LOCUS_07650 2 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4083 571 gene locus_tag LOCUS_07660 4083 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4315 4719 gene locus_tag LOCUS_07670 4315 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4967 5299 gene locus_tag LOCUS_07680 4967 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7450 5387 gene locus_tag LOCUS_07690 7450 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8559 7447 gene locus_tag LOCUS_07700 8559 7447 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921329.1 protein_id gnl|my_center|LOCUS_07700 12229 9038 gene locus_tag LOCUS_07710 12229 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 12471 15713 gene locus_tag LOCUS_07720 12471 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15852 16115 gene locus_tag LOCUS_07730 15852 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 17851 16313 gene locus_tag LOCUS_07740 17851 16313 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_07740 20333 17829 gene locus_tag LOCUS_07750 20333 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 21164 20532 gene locus_tag LOCUS_07760 21164 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 21392 23032 gene locus_tag LOCUS_07770 21392 23032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 24024 23068 gene locus_tag LOCUS_07780 gene epmB 24024 23068 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118269.1 protein_id gnl|my_center|LOCUS_07780 24176 24745 gene locus_tag LOCUS_07790 gene efp 24176 24745 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814655.1 protein_id gnl|my_center|LOCUS_07790 24824 25744 gene locus_tag LOCUS_07800 gene epmA 24824 25744 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_07800 25872 26846 gene locus_tag LOCUS_07810 25872 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 27327 26797 gene locus_tag LOCUS_07820 gene folA 27327 26797 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_07820 28287 27493 gene locus_tag LOCUS_07830 28287 27493 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_07830 28331 29530 gene locus_tag LOCUS_07840 28331 29530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120967.1 protein_id gnl|my_center|LOCUS_07840 30444 29527 gene locus_tag LOCUS_07850 30444 29527 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_07850 32496 30565 gene locus_tag LOCUS_07860 32496 30565 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_07860 32786 33871 gene locus_tag LOCUS_07870 gene aroB 32786 33871 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846185.1 protein_id gnl|my_center|LOCUS_07870 33899 34315 gene locus_tag LOCUS_07880 33899 34315 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_07880 34541 34912 gene locus_tag LOCUS_07890 34541 34912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 34945 35235 gene locus_tag LOCUS_07900 34945 35235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 36091 35279 gene locus_tag LOCUS_07910 36091 35279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 36671 36258 gene locus_tag LOCUS_07920 36671 36258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 37736 37233 gene locus_tag LOCUS_07930 37736 37233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 39273 37969 gene locus_tag LOCUS_07940 39273 37969 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_07940 39422 42925 gene locus_tag LOCUS_07950 39422 42925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922055.1 protein_id gnl|my_center|LOCUS_07950 42985 43082 gene locus_tag LOCUS_t00060 42985 43082 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 44031 43378 gene locus_tag LOCUS_07960 44031 43378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 44259 45068 gene locus_tag LOCUS_07970 44259 45068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 45445 45104 gene locus_tag LOCUS_07980 45445 45104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 45541 46026 gene locus_tag LOCUS_07990 45541 46026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 46016 46240 gene locus_tag LOCUS_08000 46016 46240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 47061 46807 gene locus_tag LOCUS_08010 47061 46807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 47134 47571 gene locus_tag LOCUS_08020 47134 47571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 48524 47610 gene locus_tag LOCUS_08030 48524 47610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 48715 48963 gene locus_tag LOCUS_08040 48715 48963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 49281 49057 gene locus_tag LOCUS_08050 49281 49057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 50210 49278 gene locus_tag LOCUS_08060 50210 49278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 50552 51205 gene locus_tag LOCUS_08070 gene pabA 50552 51205 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_08070 51306 52772 gene locus_tag LOCUS_08080 51306 52772 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_08080 52800 53384 gene locus_tag LOCUS_08090 52800 53384 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_08090 53427 54458 gene locus_tag LOCUS_08100 53427 54458 CDS product beta-ribofuranosylaminobenzene 5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119640.1 protein_id gnl|my_center|LOCUS_08100 58944 54460 gene locus_tag LOCUS_08110 58944 54460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 59099 59362 gene locus_tag LOCUS_08120 59099 59362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 <60413 59376 gene locus_tag LOCUS_08130 <60413 59376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942513.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence014 833 3013 gene locus_tag LOCUS_08140 833 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3756 4106 gene locus_tag LOCUS_08150 3756 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4187 5512 gene locus_tag LOCUS_08160 4187 5512 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_08160 5530 6744 gene locus_tag LOCUS_08170 5530 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8065 6749 gene locus_tag LOCUS_08180 8065 6749 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_08180 10465 8105 gene locus_tag LOCUS_08190 10465 8105 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_08190 11158 10697 gene locus_tag LOCUS_08200 11158 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 12329 11211 gene locus_tag LOCUS_08210 12329 11211 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392489.1 protein_id gnl|my_center|LOCUS_08210 15214 12692 gene locus_tag LOCUS_08220 15214 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 15860 15252 gene locus_tag LOCUS_08230 15860 15252 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_08230 16058 16429 gene locus_tag LOCUS_08240 16058 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 16548 17972 gene locus_tag LOCUS_08250 16548 17972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 18224 21364 gene locus_tag LOCUS_08260 18224 21364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 21515 22135 gene locus_tag LOCUS_08270 21515 22135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 23170 22226 gene locus_tag LOCUS_08280 23170 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 26204 23439 gene locus_tag LOCUS_08290 26204 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 26838 28490 gene locus_tag LOCUS_08300 26838 28490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 28591 31935 gene locus_tag LOCUS_08310 28591 31935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 34244 32055 gene locus_tag LOCUS_08320 34244 32055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 34598 34401 gene locus_tag LOCUS_08330 34598 34401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 34996 34589 gene locus_tag LOCUS_08340 34996 34589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_08340 35296 36114 gene locus_tag LOCUS_08350 35296 36114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 37057 36173 gene locus_tag LOCUS_08360 37057 36173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 38149 37235 gene locus_tag LOCUS_08370 38149 37235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 39692 38376 gene locus_tag LOCUS_08380 39692 38376 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_08380 43343 39870 gene locus_tag LOCUS_08390 43343 39870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 44623 43541 gene locus_tag LOCUS_08400 44623 43541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 45301 44681 gene locus_tag LOCUS_08410 45301 44681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 45429 47297 gene locus_tag LOCUS_08420 45429 47297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_08420 47457 48719 gene locus_tag LOCUS_08430 47457 48719 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_08430 48911 50308 gene locus_tag LOCUS_08440 gene xylE 48911 50308 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_08440 50602 51471 gene locus_tag LOCUS_08450 50602 51471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 51706 51482 gene locus_tag LOCUS_08460 51706 51482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 52065 53900 gene locus_tag LOCUS_08470 52065 53900 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_08470 53947 54999 gene locus_tag LOCUS_08480 53947 54999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 55230 56333 gene locus_tag LOCUS_08490 55230 56333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 56759 56607 gene locus_tag LOCUS_08500 56759 56607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 57199 56756 gene locus_tag LOCUS_08510 57199 56756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 58188 57376 gene locus_tag LOCUS_08520 58188 57376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 60116 58185 gene locus_tag LOCUS_08530 60116 58185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence015 189 737 gene locus_tag LOCUS_08540 189 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 860 2104 gene locus_tag LOCUS_08550 860 2104 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_08550 2264 2878 gene locus_tag LOCUS_08560 2264 2878 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 protein_id gnl|my_center|LOCUS_08560 2953 3726 gene locus_tag LOCUS_08570 2953 3726 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_08570 3859 5067 gene locus_tag LOCUS_08580 3859 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 5136 6584 gene locus_tag LOCUS_08590 5136 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7283 6804 gene locus_tag LOCUS_08600 7283 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 7609 8385 gene locus_tag LOCUS_08610 7609 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8442 8651 gene locus_tag LOCUS_08620 8442 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8816 9205 gene locus_tag LOCUS_08630 8816 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11233 9311 gene locus_tag LOCUS_08640 11233 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12502 11243 gene locus_tag LOCUS_08650 12502 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 13809 12655 gene locus_tag LOCUS_08660 13809 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 14481 14266 gene locus_tag LOCUS_08670 gene yaaA 14481 14266 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_08670 15447 14689 gene locus_tag LOCUS_08680 15447 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 15966 15574 gene locus_tag LOCUS_08690 15966 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 17453 16230 gene locus_tag LOCUS_08700 17453 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 18810 17710 gene locus_tag LOCUS_08710 18810 17710 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929138.1 protein_id gnl|my_center|LOCUS_08710 19668 19243 gene locus_tag LOCUS_08720 19668 19243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 19949 19665 gene locus_tag LOCUS_08730 19949 19665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 20288 20037 gene locus_tag LOCUS_08740 20288 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 20381 20722 gene locus_tag LOCUS_08750 20381 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 20917 20699 gene locus_tag LOCUS_08760 20917 20699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 22458 21196 gene locus_tag LOCUS_08770 22458 21196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 23611 22568 gene locus_tag LOCUS_08780 23611 22568 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_08780 23814 23608 gene locus_tag LOCUS_08790 23814 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 24170 24523 gene locus_tag LOCUS_08800 24170 24523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 24929 24687 gene locus_tag LOCUS_08810 24929 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 25371 25009 gene locus_tag LOCUS_08820 25371 25009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 25601 25368 gene locus_tag LOCUS_08830 25601 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 27003 25690 gene locus_tag LOCUS_08840 27003 25690 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_08840 27979 27095 gene locus_tag LOCUS_08850 27979 27095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 28908 28264 gene locus_tag LOCUS_08860 28908 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 30287 29004 gene locus_tag LOCUS_08870 30287 29004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 30655 31293 gene locus_tag LOCUS_08880 30655 31293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 31644 33455 gene locus_tag LOCUS_08890 31644 33455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 33548 34465 gene locus_tag LOCUS_08900 33548 34465 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141814429.1 protein_id gnl|my_center|LOCUS_08900 34497 35864 gene locus_tag LOCUS_08910 34497 35864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 36001 36723 gene locus_tag LOCUS_08920 36001 36723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 36818 37888 gene locus_tag LOCUS_08930 36818 37888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 38029 39405 gene locus_tag LOCUS_08940 38029 39405 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_08940 39436 40851 gene locus_tag LOCUS_08950 39436 40851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 41337 43646 gene locus_tag LOCUS_08960 41337 43646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 43649 44956 gene locus_tag LOCUS_08970 43649 44956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 45057 45605 gene locus_tag LOCUS_08980 45057 45605 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_08980 45625 46506 gene locus_tag LOCUS_08990 45625 46506 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_08990 46525 47931 gene locus_tag LOCUS_09000 46525 47931 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501515.1 protein_id gnl|my_center|LOCUS_09000 48157 49305 gene locus_tag LOCUS_09010 48157 49305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 49320 51071 gene locus_tag LOCUS_09020 49320 51071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 51076 51984 gene locus_tag LOCUS_09030 51076 51984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 52036 53205 gene locus_tag LOCUS_09040 52036 53205 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_09040 53352 54371 gene locus_tag LOCUS_09050 53352 54371 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_09050 54368 55633 gene locus_tag LOCUS_09060 54368 55633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 56058 55696 gene locus_tag LOCUS_09070 56058 55696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 56447 56058 gene locus_tag LOCUS_09080 56447 56058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 56918 56709 gene locus_tag LOCUS_09090 56918 56709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 56862 57473 gene locus_tag LOCUS_09100 56862 57473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 57470 58255 gene locus_tag LOCUS_09110 57470 58255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence016 1262 564 gene locus_tag LOCUS_09120 1262 564 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_09120 5845 1340 gene locus_tag LOCUS_09130 5845 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 6313 6525 gene locus_tag LOCUS_09140 gene csrA 6313 6525 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957970.1 protein_id gnl|my_center|LOCUS_09140 6542 7720 gene locus_tag LOCUS_09150 6542 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7926 8222 gene locus_tag LOCUS_09160 7926 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 8265 8552 gene locus_tag LOCUS_09170 8265 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8568 9029 gene locus_tag LOCUS_09180 8568 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9230 9475 gene locus_tag LOCUS_09190 9230 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 10756 9560 gene locus_tag LOCUS_09200 10756 9560 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_09200 12272 10884 gene locus_tag LOCUS_09210 12272 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 12398 13579 gene locus_tag LOCUS_09220 12398 13579 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970366.1 protein_id gnl|my_center|LOCUS_09220 13530 15071 gene locus_tag LOCUS_09230 13530 15071 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551866.1 protein_id gnl|my_center|LOCUS_09230 15460 15332 gene locus_tag LOCUS_09240 15460 15332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 22927 15761 gene locus_tag LOCUS_09250 22927 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 23412 23600 gene locus_tag LOCUS_09260 23412 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 23639 23950 gene locus_tag LOCUS_09270 23639 23950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 24700 23981 gene locus_tag LOCUS_09280 24700 23981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_09280 25148 24999 gene locus_tag LOCUS_09290 25148 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 25693 28425 gene locus_tag LOCUS_09300 25693 28425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 28908 28675 gene locus_tag LOCUS_09310 28908 28675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 29545 29985 gene locus_tag LOCUS_09320 29545 29985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 30036 30353 gene locus_tag LOCUS_09330 30036 30353 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975729.1 protein_id gnl|my_center|LOCUS_09330 30406 31026 gene locus_tag LOCUS_09340 gene tenA 30406 31026 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_09340 31326 32252 gene locus_tag LOCUS_09350 31326 32252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 32276 32461 gene locus_tag LOCUS_09360 32276 32461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 32489 33109 gene locus_tag LOCUS_09370 32489 33109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 33238 33636 gene locus_tag LOCUS_09380 33238 33636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 33861 33601 gene locus_tag LOCUS_09390 33861 33601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 35568 33985 gene locus_tag LOCUS_09400 35568 33985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 37167 35614 gene locus_tag LOCUS_09410 37167 35614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 37707 38777 gene locus_tag LOCUS_09420 37707 38777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 38873 40216 gene locus_tag LOCUS_09430 38873 40216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 40506 42062 gene locus_tag LOCUS_09440 40506 42062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 42172 43755 gene locus_tag LOCUS_09450 42172 43755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 45122 44382 gene locus_tag LOCUS_09460 45122 44382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 45378 45860 gene locus_tag LOCUS_09470 45378 45860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 45912 47387 gene locus_tag LOCUS_09480 45912 47387 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_09480 47635 48027 gene locus_tag LOCUS_09490 47635 48027 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444454.1 protein_id gnl|my_center|LOCUS_09490 48024 50270 gene locus_tag LOCUS_09500 48024 50270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 52543 50363 gene locus_tag LOCUS_09510 52543 50363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 54294 52873 gene locus_tag LOCUS_09520 54294 52873 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_09520 58561 54386 gene locus_tag LOCUS_09530 58561 54386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 58957 59373 gene locus_tag LOCUS_09540 58957 59373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence017 2409 13 gene locus_tag LOCUS_09550 2409 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2678 4111 gene locus_tag LOCUS_09560 2678 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615918.1 protein_id gnl|my_center|LOCUS_09560 6373 4808 gene locus_tag LOCUS_09570 6373 4808 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_09570 6685 6386 gene locus_tag LOCUS_09580 6685 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7101 7742 gene locus_tag LOCUS_09590 7101 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7747 8862 gene locus_tag LOCUS_09600 7747 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8878 9357 gene locus_tag LOCUS_09610 8878 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 9359 11218 gene locus_tag LOCUS_09620 9359 11218 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 protein_id gnl|my_center|LOCUS_09620 11930 13144 gene locus_tag LOCUS_09630 11930 13144 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904641.1 protein_id gnl|my_center|LOCUS_09630 17906 13305 gene locus_tag LOCUS_09640 17906 13305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 20050 17906 gene locus_tag LOCUS_09650 20050 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 22902 20905 gene locus_tag LOCUS_09660 22902 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 23612 23848 gene locus_tag LOCUS_09670 23612 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 23970 23740 gene locus_tag LOCUS_09680 23970 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09680 24942 23977 gene locus_tag LOCUS_09690 24942 23977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09690 28990 26420 gene locus_tag LOCUS_09700 28990 26420 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_09700 30761 29007 gene locus_tag LOCUS_09710 30761 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 32041 30758 gene locus_tag LOCUS_09720 32041 30758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 33018 32038 gene locus_tag LOCUS_09730 33018 32038 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_09730 33932 33018 gene locus_tag LOCUS_09740 33932 33018 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_09740 34882 34019 gene locus_tag LOCUS_09750 34882 34019 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_09750 35363 36046 gene locus_tag LOCUS_09760 35363 36046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_09760 36289 37296 gene locus_tag LOCUS_09770 36289 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 37293 38537 gene locus_tag LOCUS_09780 37293 38537 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008662935.1 protein_id gnl|my_center|LOCUS_09780 39552 38704 gene locus_tag LOCUS_09790 39552 38704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 41680 39746 gene locus_tag LOCUS_09800 41680 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 42875 41973 gene locus_tag LOCUS_09810 42875 41973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 46563 43459 gene locus_tag LOCUS_09820 46563 43459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 47283 46657 gene locus_tag LOCUS_09830 47283 46657 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_09830 48934 47618 gene locus_tag LOCUS_09840 48934 47618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 50995 49118 gene locus_tag LOCUS_09850 50995 49118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 52593 51088 gene locus_tag LOCUS_09860 52593 51088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 52737 53360 gene locus_tag LOCUS_09870 52737 53360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 53418 54908 gene locus_tag LOCUS_09880 53418 54908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 55062 55901 gene locus_tag LOCUS_09890 55062 55901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 55903 56856 gene locus_tag LOCUS_09900 55903 56856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 56951 57265 gene locus_tag LOCUS_09910 56951 57265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 57429 57872 gene locus_tag LOCUS_09920 57429 57872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence018 992 72 gene locus_tag LOCUS_09930 992 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2368 1064 gene locus_tag LOCUS_09940 2368 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4007 2529 gene locus_tag LOCUS_09950 4007 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5740 4154 gene locus_tag LOCUS_09960 5740 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 5904 9122 gene locus_tag LOCUS_09970 5904 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 12423 9169 gene locus_tag LOCUS_09980 12423 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 14480 12636 gene locus_tag LOCUS_09990 14480 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 14817 16253 gene locus_tag LOCUS_10000 14817 16253 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_10000 18664 16250 gene locus_tag LOCUS_10010 18664 16250 CDS product YidC/Oxa1 family insertase periplasmic-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615850.1 protein_id gnl|my_center|LOCUS_10010 19439 18690 gene locus_tag LOCUS_10020 19439 18690 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_10020 20219 19467 gene locus_tag LOCUS_10030 20219 19467 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_10030 22184 20427 gene locus_tag LOCUS_10040 22184 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 23409 22474 gene locus_tag LOCUS_10050 23409 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146458090.1 protein_id gnl|my_center|LOCUS_10050 23949 24974 gene locus_tag LOCUS_10060 23949 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_10060 25537 25818 gene locus_tag LOCUS_10070 25537 25818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 25922 26425 gene locus_tag LOCUS_10080 25922 26425 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_10080 26445 27077 gene locus_tag LOCUS_10090 26445 27077 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_10090 29326 27095 gene locus_tag LOCUS_10100 29326 27095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_10100 31726 29384 gene locus_tag LOCUS_10110 31726 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 33243 31798 gene locus_tag LOCUS_10120 33243 31798 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_10120 34920 33337 gene locus_tag LOCUS_10130 34920 33337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 35692 35186 gene locus_tag LOCUS_10140 35692 35186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 36104 35751 gene locus_tag LOCUS_10150 36104 35751 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_10150 36426 36091 gene locus_tag LOCUS_10160 36426 36091 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_10160 36764 37090 gene locus_tag LOCUS_10170 36764 37090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 37872 37081 gene locus_tag LOCUS_10180 gene lipA 37872 37081 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 protein_id gnl|my_center|LOCUS_10180 38810 37983 gene locus_tag LOCUS_10190 gene lipB 38810 37983 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_10190 39125 41929 gene locus_tag LOCUS_10200 39125 41929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 41926 42357 gene locus_tag LOCUS_10210 41926 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 42408 43541 gene locus_tag LOCUS_10220 42408 43541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 43937 44134 gene locus_tag LOCUS_10230 43937 44134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 44671 45042 gene locus_tag LOCUS_10240 44671 45042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 45385 45987 gene locus_tag LOCUS_10250 45385 45987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 45947 46177 gene locus_tag LOCUS_10260 45947 46177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 54506 46212 gene locus_tag LOCUS_10270 54506 46212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 54691 55839 gene locus_tag LOCUS_10280 54691 55839 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 protein_id gnl|my_center|LOCUS_10280 56261 55842 gene locus_tag LOCUS_10290 56261 55842 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_10290 56497 56258 gene locus_tag LOCUS_10300 56497 56258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence019 2515 1523 gene locus_tag LOCUS_10310 2515 1523 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_10310 2715 2512 gene locus_tag LOCUS_10320 2715 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2825 5848 gene locus_tag LOCUS_10330 2825 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6001 5807 gene locus_tag LOCUS_10340 6001 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6026 7354 gene locus_tag LOCUS_10350 6026 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 7642 8745 gene locus_tag LOCUS_10360 7642 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 8742 11726 gene locus_tag LOCUS_10370 8742 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 13216 11756 gene locus_tag LOCUS_10380 13216 11756 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_10380 13112 13321 gene locus_tag LOCUS_10390 13112 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 13331 14857 gene locus_tag LOCUS_10400 13331 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615582.1 protein_id gnl|my_center|LOCUS_10400 15051 16262 gene locus_tag LOCUS_10410 15051 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 18031 16487 gene locus_tag LOCUS_10420 18031 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 19644 18067 gene locus_tag LOCUS_10430 19644 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 20351 19914 gene locus_tag LOCUS_10440 20351 19914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 22279 20582 gene locus_tag LOCUS_10450 22279 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 22431 24635 gene locus_tag LOCUS_10460 22431 24635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 24897 27464 gene locus_tag LOCUS_10470 24897 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 27471 28079 gene locus_tag LOCUS_10480 27471 28079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 29450 28095 gene locus_tag LOCUS_10490 29450 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 29591 32908 gene locus_tag LOCUS_10500 29591 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 33024 33779 gene locus_tag LOCUS_10510 33024 33779 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_10510 34006 34254 gene locus_tag LOCUS_10520 34006 34254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 34251 34550 gene locus_tag LOCUS_10530 34251 34550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 34852 34727 gene locus_tag LOCUS_10540 34852 34727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 35150 35776 gene locus_tag LOCUS_10550 35150 35776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 35797 37983 gene locus_tag LOCUS_10560 35797 37983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 39277 38222 gene locus_tag LOCUS_10570 39277 38222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 43106 39639 gene locus_tag LOCUS_10580 43106 39639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 43343 44713 gene locus_tag LOCUS_10590 43343 44713 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_10590 44812 46197 gene locus_tag LOCUS_10600 44812 46197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 46194 47882 gene locus_tag LOCUS_10610 46194 47882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 47894 49588 gene locus_tag LOCUS_10620 47894 49588 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_10620 50973 49882 gene locus_tag LOCUS_10630 gene comC 50973 49882 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870943.1 protein_id gnl|my_center|LOCUS_10630 52459 51128 gene locus_tag LOCUS_10640 52459 51128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 54389 52479 gene locus_tag LOCUS_10650 54389 52479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 55662 54607 gene locus_tag LOCUS_10660 55662 54607 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_10660 56089 55844 gene locus_tag LOCUS_10670 56089 55844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence020 19 3513 gene locus_tag LOCUS_10680 19 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4307 3669 gene locus_tag LOCUS_10690 4307 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4529 4365 gene locus_tag LOCUS_10700 4529 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4542 7241 gene locus_tag LOCUS_10710 4542 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 8237 7575 gene locus_tag LOCUS_10720 8237 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 9264 8374 gene locus_tag LOCUS_10730 9264 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 13699 9335 gene locus_tag LOCUS_10740 13699 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 14905 13757 gene locus_tag LOCUS_10750 14905 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 15311 16036 gene locus_tag LOCUS_10760 15311 16036 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_10760 16473 18548 gene locus_tag LOCUS_10770 16473 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533167.1 protein_id gnl|my_center|LOCUS_10770 18545 21142 gene locus_tag LOCUS_10780 18545 21142 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107972.1 protein_id gnl|my_center|LOCUS_10780 21301 22620 gene locus_tag LOCUS_10790 21301 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 25441 22721 gene locus_tag LOCUS_10800 25441 22721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 28101 25594 gene locus_tag LOCUS_10810 28101 25594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 28406 29194 gene locus_tag LOCUS_10820 28406 29194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 29393 29608 gene locus_tag LOCUS_10830 29393 29608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 29661 30845 gene locus_tag LOCUS_10840 29661 30845 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_10840 31210 32058 gene locus_tag LOCUS_10850 31210 32058 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_10850 32120 33562 gene locus_tag LOCUS_10860 32120 33562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 33709 34605 gene locus_tag LOCUS_10870 33709 34605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 36094 34760 gene locus_tag LOCUS_10880 36094 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 36581 36111 gene locus_tag LOCUS_10890 36581 36111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 37846 36605 gene locus_tag LOCUS_10900 37846 36605 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_10900 38146 38628 gene locus_tag LOCUS_10910 38146 38628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 38718 40493 gene locus_tag LOCUS_10920 38718 40493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 41191 42534 gene locus_tag LOCUS_10930 41191 42534 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_10930 42527 43756 gene locus_tag LOCUS_10940 42527 43756 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_10940 43753 46869 gene locus_tag LOCUS_10950 43753 46869 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_10950 48131 51436 gene locus_tag LOCUS_10960 48131 51436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 52039 51614 gene locus_tag LOCUS_10970 52039 51614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 52191 51946 gene locus_tag LOCUS_10980 52191 51946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 52508 52257 gene locus_tag LOCUS_10990 52508 52257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 53101 52604 gene locus_tag LOCUS_11000 53101 52604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 53349 53101 gene locus_tag LOCUS_11010 53349 53101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 55687 53621 gene locus_tag LOCUS_11020 55687 53621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence021 4506 1210 gene locus_tag LOCUS_11030 4506 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4818 6200 gene locus_tag LOCUS_11040 4818 6200 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902277.1 protein_id gnl|my_center|LOCUS_11040 8786 6246 gene locus_tag LOCUS_11050 8786 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 10265 8967 gene locus_tag LOCUS_11060 10265 8967 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_11060 11697 10291 gene locus_tag LOCUS_11070 11697 10291 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615503.1 protein_id gnl|my_center|LOCUS_11070 13987 11846 gene locus_tag LOCUS_11080 13987 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 15405 14356 gene locus_tag LOCUS_11090 15405 14356 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331323.1 protein_id gnl|my_center|LOCUS_11090 15462 15710 gene locus_tag LOCUS_11100 15462 15710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 15723 16607 gene locus_tag LOCUS_11110 15723 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 17391 16621 gene locus_tag LOCUS_11120 17391 16621 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160148236.1 protein_id gnl|my_center|LOCUS_11120 17821 19038 gene locus_tag LOCUS_11130 17821 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 19208 19807 gene locus_tag LOCUS_11140 19208 19807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 22840 20024 gene locus_tag LOCUS_11150 22840 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 23889 22855 gene locus_tag LOCUS_11160 23889 22855 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_11160 24513 24361 gene locus_tag LOCUS_11170 24513 24361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 24878 25093 gene locus_tag LOCUS_11180 24878 25093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 25468 25220 gene locus_tag LOCUS_11190 25468 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 25610 28678 gene locus_tag LOCUS_11200 25610 28678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 28809 30770 gene locus_tag LOCUS_11210 28809 30770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 31529 30792 gene locus_tag LOCUS_11220 31529 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 32182 33576 gene locus_tag LOCUS_11230 32182 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 35204 33864 gene locus_tag LOCUS_11240 35204 33864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 36804 35209 gene locus_tag LOCUS_11250 36804 35209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 37706 36921 gene locus_tag LOCUS_11260 37706 36921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 37952 41095 gene locus_tag LOCUS_11270 37952 41095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 41174 42973 gene locus_tag LOCUS_11280 41174 42973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 43333 43103 gene locus_tag LOCUS_11290 43333 43103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 44956 43550 gene locus_tag LOCUS_11300 44956 43550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 46507 44993 gene locus_tag LOCUS_11310 46507 44993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_11310 46667 47731 gene locus_tag LOCUS_11320 46667 47731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 48700 47795 gene locus_tag LOCUS_11330 48700 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 48699 48920 gene locus_tag LOCUS_11340 48699 48920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 49316 51826 gene locus_tag LOCUS_11350 49316 51826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 51976 54933 gene locus_tag LOCUS_11360 51976 54933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 55330 55623 gene locus_tag LOCUS_11370 55330 55623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence022 1234 1160 gene locus_tag LOCUS_t00070 1234 1160 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1434 2111 gene locus_tag LOCUS_11380 1434 2111 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_11380 2438 3712 gene locus_tag LOCUS_11390 2438 3712 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_11390 3849 6755 gene locus_tag LOCUS_11400 3849 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6999 7856 gene locus_tag LOCUS_11410 6999 7856 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838432.1 protein_id gnl|my_center|LOCUS_11410 7878 8786 gene locus_tag LOCUS_11420 7878 8786 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403622.1 protein_id gnl|my_center|LOCUS_11420 9096 12725 gene locus_tag LOCUS_11430 9096 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 13212 15770 gene locus_tag LOCUS_11440 13212 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 15847 18702 gene locus_tag LOCUS_11450 15847 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 18882 19715 gene locus_tag LOCUS_11460 18882 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 20243 19896 gene locus_tag LOCUS_11470 20243 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 20762 20544 gene locus_tag LOCUS_11480 20762 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 20813 21904 gene locus_tag LOCUS_11490 20813 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 22074 24425 gene locus_tag LOCUS_11500 22074 24425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 24665 25780 gene locus_tag LOCUS_11510 24665 25780 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_11510 25815 26438 gene locus_tag LOCUS_11520 25815 26438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 26632 27078 gene locus_tag LOCUS_11530 26632 27078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 27269 28048 gene locus_tag LOCUS_11540 27269 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 28529 28056 gene locus_tag LOCUS_11550 28529 28056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 29487 28507 gene locus_tag LOCUS_11560 29487 28507 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_11560 29987 29508 gene locus_tag LOCUS_11570 29987 29508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 30429 30022 gene locus_tag LOCUS_11580 30429 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 31047 30601 gene locus_tag LOCUS_11590 31047 30601 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_11590 31477 35055 gene locus_tag LOCUS_11600 gene dnaE 31477 35055 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119187.1 protein_id gnl|my_center|LOCUS_11600 35448 36518 gene locus_tag LOCUS_11610 35448 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 36910 39714 gene locus_tag LOCUS_11620 36910 39714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 39798 41054 gene locus_tag LOCUS_11630 39798 41054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 41261 42952 gene locus_tag LOCUS_11640 41261 42952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 43203 43829 gene locus_tag LOCUS_11650 43203 43829 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727765.1 protein_id gnl|my_center|LOCUS_11650 43841 47749 gene locus_tag LOCUS_11660 43841 47749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 48726 47869 gene locus_tag LOCUS_11670 48726 47869 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_11670 49151 48723 gene locus_tag LOCUS_11680 49151 48723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 49822 49289 gene locus_tag LOCUS_11690 49822 49289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 50181 49819 gene locus_tag LOCUS_11700 50181 49819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 51629 50355 gene locus_tag LOCUS_11710 51629 50355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 52840 51662 gene locus_tag LOCUS_11720 gene gspF 52840 51662 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109555.1 protein_id gnl|my_center|LOCUS_11720 53938 52841 gene locus_tag LOCUS_11730 53938 52841 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226293.1 protein_id gnl|my_center|LOCUS_11730 54757 54981 gene locus_tag LOCUS_11740 54757 54981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence023 67 2430 gene locus_tag LOCUS_11750 67 2430 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_11750 3086 2580 gene locus_tag LOCUS_11760 3086 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5904 3340 gene locus_tag LOCUS_11770 5904 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5909 6097 gene locus_tag LOCUS_11780 5909 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6891 6139 gene locus_tag LOCUS_11790 6891 6139 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340094.1 protein_id gnl|my_center|LOCUS_11790 9100 6896 gene locus_tag LOCUS_11800 9100 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 9996 9100 gene locus_tag LOCUS_11810 9996 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 10383 10009 gene locus_tag LOCUS_11820 gene rbfA 10383 10009 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325039.1 protein_id gnl|my_center|LOCUS_11820 13335 10489 gene locus_tag LOCUS_11830 13335 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 15099 13540 gene locus_tag LOCUS_11840 15099 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 16642 15323 gene locus_tag LOCUS_11850 16642 15323 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_11850 17871 16768 gene locus_tag LOCUS_11860 17871 16768 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_11860 18500 18120 gene locus_tag LOCUS_11870 18500 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 19033 20739 gene locus_tag LOCUS_11880 gene groL 19033 20739 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_11880 20825 21124 gene locus_tag LOCUS_11890 gene groES 20825 21124 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_11890 21222 22841 gene locus_tag LOCUS_11900 gene groL 21222 22841 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_11900 22993 24126 gene locus_tag LOCUS_11910 gene dnaJ 22993 24126 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122091.1 protein_id gnl|my_center|LOCUS_11910 24127 24762 gene locus_tag LOCUS_11920 24127 24762 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337437.1 protein_id gnl|my_center|LOCUS_11920 24940 25254 gene locus_tag LOCUS_11930 24940 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 25256 25435 gene locus_tag LOCUS_11940 25256 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 25553 26812 gene locus_tag LOCUS_11950 25553 26812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 31104 26809 gene locus_tag LOCUS_11960 31104 26809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 32860 31487 gene locus_tag LOCUS_11970 32860 31487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 33098 34384 gene locus_tag LOCUS_11980 gene tyrS 33098 34384 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_11980 35332 34364 gene locus_tag LOCUS_11990 gene fliM 35332 34364 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334519.1 protein_id gnl|my_center|LOCUS_11990 36579 35368 gene locus_tag LOCUS_12000 36579 35368 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_12000 36915 37433 gene locus_tag LOCUS_12010 36915 37433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 37435 37977 gene locus_tag LOCUS_12020 37435 37977 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_12020 38000 38698 gene locus_tag LOCUS_12030 38000 38698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 38754 40508 gene locus_tag LOCUS_12040 38754 40508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 40505 41980 gene locus_tag LOCUS_12050 40505 41980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 41973 42356 gene locus_tag LOCUS_12060 41973 42356 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_12060 43378 42389 gene locus_tag LOCUS_12070 43378 42389 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_12070 44799 43525 gene locus_tag LOCUS_12080 gene hemA 44799 43525 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334460.1 protein_id gnl|my_center|LOCUS_12080 45692 44796 gene locus_tag LOCUS_12090 gene ccsA 45692 44796 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922278.1 protein_id gnl|my_center|LOCUS_12090 46768 45776 gene locus_tag LOCUS_12100 46768 45776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 47278 46790 gene locus_tag LOCUS_12110 47278 46790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326145.1 protein_id gnl|my_center|LOCUS_12110 47430 48437 gene locus_tag LOCUS_12120 gene ispH 47430 48437 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_12120 48791 49186 gene locus_tag LOCUS_12130 48791 49186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 49510 50328 gene locus_tag LOCUS_12140 49510 50328 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_12140 50337 52820 gene locus_tag LOCUS_12150 50337 52820 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121496.1 protein_id gnl|my_center|LOCUS_12150 52955 54940 gene locus_tag LOCUS_12160 52955 54940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence024 729 1019 gene locus_tag LOCUS_12170 729 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1275 1117 gene locus_tag LOCUS_12180 1275 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1901 4183 gene locus_tag LOCUS_12190 1901 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4202 5656 gene locus_tag LOCUS_12200 4202 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_12200 5712 9086 gene locus_tag LOCUS_12210 5712 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9288 11246 gene locus_tag LOCUS_12220 9288 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 13281 11311 gene locus_tag LOCUS_12230 13281 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 16912 13322 gene locus_tag LOCUS_12240 16912 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 17197 18147 gene locus_tag LOCUS_12250 17197 18147 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_12250 18448 19539 gene locus_tag LOCUS_12260 18448 19539 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_12260 20408 19560 gene locus_tag LOCUS_12270 20408 19560 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_12270 22263 20419 gene locus_tag LOCUS_12280 22263 20419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 23486 22542 gene locus_tag LOCUS_12290 23486 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 23779 26001 gene locus_tag LOCUS_12300 23779 26001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 26134 28110 gene locus_tag LOCUS_12310 26134 28110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 28567 30108 gene locus_tag LOCUS_12320 28567 30108 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_12320 30105 31646 gene locus_tag LOCUS_12330 30105 31646 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_12330 31941 33368 gene locus_tag LOCUS_12340 31941 33368 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_12340 33352 34701 gene locus_tag LOCUS_12350 33352 34701 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_12350 34849 37974 gene locus_tag LOCUS_12360 34849 37974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 38611 37985 gene locus_tag LOCUS_12370 38611 37985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 38951 42061 gene locus_tag LOCUS_12380 38951 42061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 42125 43396 gene locus_tag LOCUS_12390 42125 43396 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_12390 44599 43562 gene locus_tag LOCUS_12400 44599 43562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 45137 44592 gene locus_tag LOCUS_12410 45137 44592 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_12410 45363 46349 gene locus_tag LOCUS_12420 45363 46349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 46506 48044 gene locus_tag LOCUS_12430 46506 48044 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333750.1 protein_id gnl|my_center|LOCUS_12430 49925 48180 gene locus_tag LOCUS_12440 49925 48180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 50233 50036 gene locus_tag LOCUS_12450 50233 50036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 50580 50317 gene locus_tag LOCUS_12460 50580 50317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 53857 51074 gene locus_tag LOCUS_12470 53857 51074 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence025 <1 2795 gene locus_tag LOCUS_12480 <1 2795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:efflux RND transporter permease subunit 2946 6200 gene locus_tag LOCUS_12490 2946 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6355 7341 gene locus_tag LOCUS_12500 6355 7341 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_12500 7516 9411 gene locus_tag LOCUS_12510 7516 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 9408 10376 gene locus_tag LOCUS_12520 9408 10376 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_12520 10616 11494 gene locus_tag LOCUS_12530 10616 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 11675 18016 gene locus_tag LOCUS_12540 11675 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 18390 19364 gene locus_tag LOCUS_12550 gene ala 18390 19364 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_12550 19728 20585 gene locus_tag LOCUS_12560 19728 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 21865 21179 gene locus_tag LOCUS_12570 21865 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 21999 24662 gene locus_tag LOCUS_12580 21999 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 24985 25680 gene locus_tag LOCUS_12590 24985 25680 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_12590 25753 26280 gene locus_tag LOCUS_12600 25753 26280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 26273 28603 gene locus_tag LOCUS_12610 26273 28603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 32127 28831 gene locus_tag LOCUS_12620 32127 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 32606 32289 gene locus_tag LOCUS_12630 32606 32289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 33248 32871 gene locus_tag LOCUS_12640 33248 32871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 33824 33297 gene locus_tag LOCUS_12650 33824 33297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 35288 33843 gene locus_tag LOCUS_12660 35288 33843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 35514 35212 gene locus_tag LOCUS_12670 35514 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 35513 36142 gene locus_tag LOCUS_12680 35513 36142 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_12680 36139 38598 gene locus_tag LOCUS_12690 36139 38598 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616162.1 protein_id gnl|my_center|LOCUS_12690 43164 38719 gene locus_tag LOCUS_12700 43164 38719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 43398 44822 gene locus_tag LOCUS_12710 43398 44822 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_12710 45061 46479 gene locus_tag LOCUS_12720 45061 46479 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_12720 46492 46821 gene locus_tag LOCUS_12730 46492 46821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 49511 46905 gene locus_tag LOCUS_12740 49511 46905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 49776 50618 gene locus_tag LOCUS_12750 49776 50618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 50628 51701 gene locus_tag LOCUS_12760 50628 51701 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_12760 52248 54356 gene locus_tag LOCUS_12770 52248 54356 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence026 1933 224 gene locus_tag LOCUS_12780 1933 224 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_12780 2219 2698 gene locus_tag LOCUS_12790 2219 2698 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259161.1 protein_id gnl|my_center|LOCUS_12790 4140 3283 gene locus_tag LOCUS_12800 4140 3283 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_12800 4362 4565 gene locus_tag LOCUS_12810 4362 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4632 6080 gene locus_tag LOCUS_12820 gene zwf 4632 6080 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_12820 6077 6742 gene locus_tag LOCUS_12830 gene pgl 6077 6742 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_12830 6951 10697 gene locus_tag LOCUS_12840 6951 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 10960 11919 gene locus_tag LOCUS_12850 10960 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 13386 12040 gene locus_tag LOCUS_12860 gene nhaA 13386 12040 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_12860 14526 13489 gene locus_tag LOCUS_12870 14526 13489 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_12870 14687 15931 gene locus_tag LOCUS_12880 14687 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 17363 16035 gene locus_tag LOCUS_12890 gene mgtE 17363 16035 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_12890 20886 17479 gene locus_tag LOCUS_12900 20886 17479 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 protein_id gnl|my_center|LOCUS_12900 22176 20899 gene locus_tag LOCUS_12910 22176 20899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 22632 23873 gene locus_tag LOCUS_12920 22632 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 25590 24064 gene locus_tag LOCUS_12930 25590 24064 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_12930 26879 25965 gene locus_tag LOCUS_12940 26879 25965 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_12940 28116 27028 gene locus_tag LOCUS_12950 28116 27028 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_12950 28633 28875 gene locus_tag LOCUS_12960 28633 28875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 29165 29974 gene locus_tag LOCUS_12970 29165 29974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 31152 31316 gene locus_tag LOCUS_12980 31152 31316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 31345 32448 gene locus_tag LOCUS_12990 31345 32448 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 protein_id gnl|my_center|LOCUS_12990 33324 32572 gene locus_tag LOCUS_13000 gene hpaI 33324 32572 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889550.1 protein_id gnl|my_center|LOCUS_13000 34465 33446 gene locus_tag LOCUS_13010 gene dmpG 34465 33446 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_13010 35482 34616 gene locus_tag LOCUS_13020 35482 34616 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393277.1 protein_id gnl|my_center|LOCUS_13020 36994 35657 gene locus_tag LOCUS_13030 36994 35657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 37176 36991 gene locus_tag LOCUS_13040 37176 36991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 40336 37277 gene locus_tag LOCUS_13050 40336 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 42293 40458 gene locus_tag LOCUS_13060 42293 40458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 44307 42364 gene locus_tag LOCUS_13070 44307 42364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 44413 46320 gene locus_tag LOCUS_13080 44413 46320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 46960 46367 gene locus_tag LOCUS_13090 46960 46367 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390014.1 protein_id gnl|my_center|LOCUS_13090 48616 46964 gene locus_tag LOCUS_13100 48616 46964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 48602 48871 gene locus_tag LOCUS_13110 48602 48871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 51007 49310 gene locus_tag LOCUS_13120 51007 49310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence027 1689 145 gene locus_tag LOCUS_13130 1689 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3412 1697 gene locus_tag LOCUS_13140 3412 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4446 3580 gene locus_tag LOCUS_13150 4446 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 5881 4658 gene locus_tag LOCUS_13160 5881 4658 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_13160 8340 6133 gene locus_tag LOCUS_13170 8340 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 9751 8474 gene locus_tag LOCUS_13180 9751 8474 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_13180 9793 10020 gene locus_tag LOCUS_13190 9793 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 12391 9956 gene locus_tag LOCUS_13200 12391 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 13700 12423 gene locus_tag LOCUS_13210 13700 12423 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_13210 16339 13742 gene locus_tag LOCUS_13220 16339 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 17731 16388 gene locus_tag LOCUS_13230 17731 16388 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_13230 18058 17783 gene locus_tag LOCUS_13240 18058 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 19741 18071 gene locus_tag LOCUS_13250 19741 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 20153 19944 gene locus_tag LOCUS_13260 20153 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 21047 20307 gene locus_tag LOCUS_13270 21047 20307 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401997.1 protein_id gnl|my_center|LOCUS_13270 21160 22359 gene locus_tag LOCUS_13280 21160 22359 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_13280 22366 23391 gene locus_tag LOCUS_13290 22366 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 23517 23424 gene locus_tag LOCUS_t00080 23517 23424 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23664 24542 gene locus_tag LOCUS_13300 23664 24542 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846539.1 protein_id gnl|my_center|LOCUS_13300 24615 25592 gene locus_tag LOCUS_13310 24615 25592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 25821 25573 gene locus_tag LOCUS_13320 25821 25573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 26145 27122 gene locus_tag LOCUS_13330 26145 27122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 30702 27208 gene locus_tag LOCUS_13340 30702 27208 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_13340 32126 30699 gene locus_tag LOCUS_13350 32126 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 32807 32181 gene locus_tag LOCUS_13360 32807 32181 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073379.1 protein_id gnl|my_center|LOCUS_13360 33109 33603 gene locus_tag LOCUS_13370 33109 33603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 37135 33614 gene locus_tag LOCUS_13380 37135 33614 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_13380 37300 37605 gene locus_tag LOCUS_13390 37300 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 37770 38069 gene locus_tag LOCUS_13400 37770 38069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442631.1 protein_id gnl|my_center|LOCUS_13400 38496 38083 gene locus_tag LOCUS_13410 38496 38083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 39572 38631 gene locus_tag LOCUS_13420 gene cysK 39572 38631 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324150.1 protein_id gnl|my_center|LOCUS_13420 40017 41558 gene locus_tag LOCUS_13430 gene lysS 40017 41558 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_13430 41579 43246 gene locus_tag LOCUS_13440 41579 43246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_13440 43582 44421 gene locus_tag LOCUS_13450 43582 44421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_13450 44630 45487 gene locus_tag LOCUS_13460 gene ilvE 44630 45487 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_13460 45487 46536 gene locus_tag LOCUS_13470 45487 46536 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_13470 46664 47698 gene locus_tag LOCUS_13480 46664 47698 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_13480 47835 49094 gene locus_tag LOCUS_13490 47835 49094 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_13490 49399 50712 gene locus_tag LOCUS_13500 49399 50712 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence028 505 2832 gene locus_tag LOCUS_13510 505 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2846 3925 gene locus_tag LOCUS_13520 2846 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4209 5414 gene locus_tag LOCUS_13530 4209 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6416 5508 gene locus_tag LOCUS_13540 6416 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6644 6925 gene locus_tag LOCUS_13550 6644 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6974 8380 gene locus_tag LOCUS_13560 6974 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8999 8430 gene locus_tag LOCUS_13570 8999 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 11434 9383 gene locus_tag LOCUS_13580 11434 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 13965 11569 gene locus_tag LOCUS_13590 13965 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 16904 14079 gene locus_tag LOCUS_13600 16904 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 18782 17001 gene locus_tag LOCUS_13610 18782 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 19967 18894 gene locus_tag LOCUS_13620 19967 18894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 20220 19990 gene locus_tag LOCUS_13630 20220 19990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 21370 20342 gene locus_tag LOCUS_13640 21370 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 23070 21589 gene locus_tag LOCUS_13650 23070 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 24628 23156 gene locus_tag LOCUS_13660 24628 23156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 26188 24869 gene locus_tag LOCUS_13670 26188 24869 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_13670 29307 26440 gene locus_tag LOCUS_13680 29307 26440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 29530 31518 gene locus_tag LOCUS_13690 29530 31518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 31582 32424 gene locus_tag LOCUS_13700 31582 32424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 32434 33987 gene locus_tag LOCUS_13710 32434 33987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 34683 34114 gene locus_tag LOCUS_13720 34683 34114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 34944 35552 gene locus_tag LOCUS_13730 34944 35552 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_13730 35732 38338 gene locus_tag LOCUS_13740 35732 38338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 38617 39429 gene locus_tag LOCUS_13750 38617 39429 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_13750 41208 39628 gene locus_tag LOCUS_13760 41208 39628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 42523 41210 gene locus_tag LOCUS_13770 42523 41210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 42776 42967 gene locus_tag LOCUS_13780 42776 42967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 43207 42989 gene locus_tag LOCUS_13790 43207 42989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 43461 43204 gene locus_tag LOCUS_13800 43461 43204 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_13800 43793 46474 gene locus_tag LOCUS_13810 43793 46474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 46622 47815 gene locus_tag LOCUS_13820 46622 47815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 49019 47853 gene locus_tag LOCUS_13830 49019 47853 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_13830 50585 49155 gene locus_tag LOCUS_13840 gene araE 50585 49155 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_13840 51443 50601 gene locus_tag LOCUS_13850 gene fabG 51443 50601 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_13850 51875 51453 gene locus_tag LOCUS_13860 51875 51453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence029 3633 5870 gene locus_tag LOCUS_13870 3633 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6723 6046 gene locus_tag LOCUS_13880 6723 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7530 7099 gene locus_tag LOCUS_13890 7530 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 8227 7655 gene locus_tag LOCUS_13900 8227 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 9867 8860 gene locus_tag LOCUS_13910 9867 8860 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_13910 10311 11624 gene locus_tag LOCUS_13920 10311 11624 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_13920 11721 13289 gene locus_tag LOCUS_13930 11721 13289 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112533.1 protein_id gnl|my_center|LOCUS_13930 13286 13525 gene locus_tag LOCUS_13940 13286 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13573 16236 gene locus_tag LOCUS_13950 13573 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 16257 20117 gene locus_tag LOCUS_13960 16257 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 21390 20377 gene locus_tag LOCUS_13970 21390 20377 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_13970 21584 21877 gene locus_tag LOCUS_13980 21584 21877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 23740 21839 gene locus_tag LOCUS_13990 23740 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 25054 23819 gene locus_tag LOCUS_14000 25054 23819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 25140 26249 gene locus_tag LOCUS_14010 25140 26249 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_14010 26855 26253 gene locus_tag LOCUS_14020 26855 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 27241 27813 gene locus_tag LOCUS_14030 27241 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 27981 28448 gene locus_tag LOCUS_14040 27981 28448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 28445 28828 gene locus_tag LOCUS_14050 28445 28828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 28992 30491 gene locus_tag LOCUS_14060 28992 30491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 30913 32967 gene locus_tag LOCUS_14070 30913 32967 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_14070 33049 34422 gene locus_tag LOCUS_14080 33049 34422 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_14080 34484 36535 gene locus_tag LOCUS_14090 34484 36535 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_14090 36593 37831 gene locus_tag LOCUS_14100 36593 37831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 37969 38181 gene locus_tag LOCUS_14110 37969 38181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 40004 38406 gene locus_tag LOCUS_14120 40004 38406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 41098 40022 gene locus_tag LOCUS_14130 41098 40022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 41583 41242 gene locus_tag LOCUS_14140 41583 41242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 42936 41659 gene locus_tag LOCUS_14150 42936 41659 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_14150 43234 43046 gene locus_tag LOCUS_14160 43234 43046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 43476 43282 gene locus_tag LOCUS_14170 43476 43282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 44956 43484 gene locus_tag LOCUS_14180 44956 43484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 47460 45067 gene locus_tag LOCUS_14190 47460 45067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 48180 47527 gene locus_tag LOCUS_14200 48180 47527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 49968 48346 gene locus_tag LOCUS_14210 49968 48346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 50883 50251 gene locus_tag LOCUS_14220 50883 50251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence030 275 1543 gene locus_tag LOCUS_14230 gene glcF 275 1543 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_14230 3148 1544 gene locus_tag LOCUS_14240 3148 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3385 4935 gene locus_tag LOCUS_14250 3385 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 4950 5957 gene locus_tag LOCUS_14260 4950 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6055 7275 gene locus_tag LOCUS_14270 6055 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8606 7506 gene locus_tag LOCUS_14280 8606 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 13769 8895 gene locus_tag LOCUS_14290 13769 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 14090 15523 gene locus_tag LOCUS_14300 gene tssK 14090 15523 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616050.1 protein_id gnl|my_center|LOCUS_14300 15520 16158 gene locus_tag LOCUS_14310 15520 16158 CDS product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922257.1 protein_id gnl|my_center|LOCUS_14310 16186 17820 gene locus_tag LOCUS_14320 16186 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 18059 18451 gene locus_tag LOCUS_14330 18059 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 18448 19167 gene locus_tag LOCUS_14340 18448 19167 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_14340 19394 20545 gene locus_tag LOCUS_14350 gene tssA 19394 20545 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_14350 20624 21145 gene locus_tag LOCUS_14360 gene tssB 20624 21145 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463809.1 protein_id gnl|my_center|LOCUS_14360 21145 22641 gene locus_tag LOCUS_14370 gene tssC 21145 22641 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_14370 22845 24443 gene locus_tag LOCUS_14380 gene tssC 22845 24443 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521953.1 protein_id gnl|my_center|LOCUS_14380 24627 25439 gene locus_tag LOCUS_14390 24627 25439 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205359.1 protein_id gnl|my_center|LOCUS_14390 25447 25938 gene locus_tag LOCUS_14400 gene tssE 25447 25938 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315898.1 protein_id gnl|my_center|LOCUS_14400 25938 27776 gene locus_tag LOCUS_14410 gene tssF 25938 27776 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_14410 27740 28852 gene locus_tag LOCUS_14420 gene tssG 27740 28852 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_14420 28971 31706 gene locus_tag LOCUS_14430 gene tssH 28971 31706 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_14430 32014 32991 gene locus_tag LOCUS_14440 gene nifU 32014 32991 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_14440 33035 34261 gene locus_tag LOCUS_14450 gene nifS 33035 34261 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_14450 35202 34294 gene locus_tag LOCUS_14460 35202 34294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 36457 35384 gene locus_tag LOCUS_14470 36457 35384 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_14470 37771 36587 gene locus_tag LOCUS_14480 37771 36587 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_14480 39428 37791 gene locus_tag LOCUS_14490 39428 37791 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_14490 39838 41136 gene locus_tag LOCUS_14500 39838 41136 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_14500 42024 41155 gene locus_tag LOCUS_14510 42024 41155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 42170 42266 gene locus_tag LOCUS_t00090 42170 42266 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43016 42381 gene locus_tag LOCUS_14520 gene clpP 43016 42381 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_14520 43669 43031 gene locus_tag LOCUS_14530 43669 43031 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_14530 45431 43869 gene locus_tag LOCUS_14540 gene tig 45431 43869 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_14540 48835 46127 gene locus_tag LOCUS_14550 48835 46127 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 protein_id gnl|my_center|LOCUS_14550 50691 49516 gene locus_tag LOCUS_14560 50691 49516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence031 <1 1089 gene locus_tag LOCUS_14570 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122785.1:hemolysin D 1436 2692 gene locus_tag LOCUS_14580 1436 2692 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_14580 2732 4159 gene locus_tag LOCUS_14590 2732 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7827 4156 gene locus_tag LOCUS_14600 7827 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 11094 8092 gene locus_tag LOCUS_14610 11094 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 12960 11242 gene locus_tag LOCUS_14620 12960 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 13180 13446 gene locus_tag LOCUS_14630 13180 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13519 14373 gene locus_tag LOCUS_14640 13519 14373 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333051.1 protein_id gnl|my_center|LOCUS_14640 14380 14904 gene locus_tag LOCUS_14650 14380 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 15511 15050 gene locus_tag LOCUS_14660 15511 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 19077 15922 gene locus_tag LOCUS_14670 gene lacZ 19077 15922 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_14670 19219 19479 gene locus_tag LOCUS_14680 19219 19479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 19480 19779 gene locus_tag LOCUS_14690 19480 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 22090 19847 gene locus_tag LOCUS_14700 22090 19847 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_14700 22761 22387 gene locus_tag LOCUS_14710 22761 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 23783 22785 gene locus_tag LOCUS_14720 23783 22785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 25496 23793 gene locus_tag LOCUS_14730 25496 23793 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_14730 27393 25534 gene locus_tag LOCUS_14740 27393 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 27712 27383 gene locus_tag LOCUS_14750 27712 27383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 28932 27709 gene locus_tag LOCUS_14760 28932 27709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_14760 30208 28955 gene locus_tag LOCUS_14770 30208 28955 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123851.1 protein_id gnl|my_center|LOCUS_14770 31675 30284 gene locus_tag LOCUS_14780 gene nrfD 31675 30284 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_14780 34706 31659 gene locus_tag LOCUS_14790 34706 31659 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922552.1 protein_id gnl|my_center|LOCUS_14790 35386 34703 gene locus_tag LOCUS_14800 35386 34703 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_14800 36012 36410 gene locus_tag LOCUS_14810 36012 36410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 36971 37546 gene locus_tag LOCUS_14820 36971 37546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 38873 37668 gene locus_tag LOCUS_14830 38873 37668 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_14830 39223 40689 gene locus_tag LOCUS_14840 39223 40689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 40882 42261 gene locus_tag LOCUS_14850 40882 42261 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_14850 42493 44694 gene locus_tag LOCUS_14860 42493 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 46022 44703 gene locus_tag LOCUS_14870 46022 44703 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765774.1 protein_id gnl|my_center|LOCUS_14870 46404 46165 gene locus_tag LOCUS_14880 46404 46165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 46773 46405 gene locus_tag LOCUS_14890 gene rnpA 46773 46405 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121387.1 protein_id gnl|my_center|LOCUS_14890 47183 46770 gene locus_tag LOCUS_14900 47183 46770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 48121 47177 gene locus_tag LOCUS_14910 48121 47177 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_14910 49447 48314 gene locus_tag LOCUS_14920 49447 48314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence032 27 716 gene locus_tag LOCUS_14930 27 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1177 968 gene locus_tag LOCUS_14940 1177 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1760 1443 gene locus_tag LOCUS_14950 1760 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5723 2496 gene locus_tag LOCUS_14960 5723 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 8336 5907 gene locus_tag LOCUS_14970 8336 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8835 8509 gene locus_tag LOCUS_14980 8835 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 8726 9925 gene locus_tag LOCUS_14990 8726 9925 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_14990 10270 10061 gene locus_tag LOCUS_15000 10270 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 10236 11468 gene locus_tag LOCUS_15010 10236 11468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_15010 11505 12647 gene locus_tag LOCUS_15020 11505 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 12927 16136 gene locus_tag LOCUS_15030 12927 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 16334 19597 gene locus_tag LOCUS_15040 16334 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 19632 20819 gene locus_tag LOCUS_15050 19632 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 20816 21325 gene locus_tag LOCUS_15060 20816 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 21352 22824 gene locus_tag LOCUS_15070 21352 22824 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266795.1 protein_id gnl|my_center|LOCUS_15070 22834 24150 gene locus_tag LOCUS_15080 22834 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 24416 25561 gene locus_tag LOCUS_15090 24416 25561 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_15090 26975 25614 gene locus_tag LOCUS_15100 26975 25614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 27285 28766 gene locus_tag LOCUS_15110 gene ggt 27285 28766 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_15110 28966 30615 gene locus_tag LOCUS_15120 28966 30615 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817390.1 protein_id gnl|my_center|LOCUS_15120 30881 32866 gene locus_tag LOCUS_15130 30881 32866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 32963 36295 gene locus_tag LOCUS_15140 32963 36295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 36436 36687 gene locus_tag LOCUS_15150 36436 36687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 36916 37134 gene locus_tag LOCUS_15160 36916 37134 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_15160 37139 37384 gene locus_tag LOCUS_15170 37139 37384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 37644 38630 gene locus_tag LOCUS_15180 37644 38630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 38702 42058 gene locus_tag LOCUS_15190 38702 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 42447 45221 gene locus_tag LOCUS_15200 42447 45221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 45398 46921 gene locus_tag LOCUS_15210 45398 46921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 <49720 47002 gene locus_tag LOCUS_15220 <49720 47002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein >Feature sequence033 1714 29 gene locus_tag LOCUS_15230 1714 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1800 3677 gene locus_tag LOCUS_15240 gene gor 1800 3677 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868698.1 protein_id gnl|my_center|LOCUS_15240 3743 4660 gene locus_tag LOCUS_15250 3743 4660 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122454.1 protein_id gnl|my_center|LOCUS_15250 4716 6914 gene locus_tag LOCUS_15260 4716 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 7077 7793 gene locus_tag LOCUS_15270 7077 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 11721 7807 gene locus_tag LOCUS_15280 gene hrpA 11721 7807 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_15280 11860 12189 gene locus_tag LOCUS_15290 11860 12189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 15744 12313 gene locus_tag LOCUS_15300 15744 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 18486 15922 gene locus_tag LOCUS_15310 18486 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 20870 18483 gene locus_tag LOCUS_15320 20870 18483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 22856 21396 gene locus_tag LOCUS_15330 22856 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 23357 22989 gene locus_tag LOCUS_15340 23357 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 23966 24352 gene locus_tag LOCUS_15350 23966 24352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 25165 25872 gene locus_tag LOCUS_15360 25165 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 26078 27610 gene locus_tag LOCUS_15370 26078 27610 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_15370 27810 27577 gene locus_tag LOCUS_15380 27810 27577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 29235 27811 gene locus_tag LOCUS_15390 29235 27811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 29635 29982 gene locus_tag LOCUS_15400 29635 29982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 32125 30239 gene locus_tag LOCUS_15410 32125 30239 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_15410 32528 35902 gene locus_tag LOCUS_15420 32528 35902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 35920 39597 gene locus_tag LOCUS_15430 35920 39597 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210762640.1 protein_id gnl|my_center|LOCUS_15430 41050 39788 gene locus_tag LOCUS_15440 41050 39788 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_15440 41238 42059 gene locus_tag LOCUS_15450 41238 42059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 42517 42080 gene locus_tag LOCUS_15460 42517 42080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 42961 42545 gene locus_tag LOCUS_15470 42961 42545 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_15470 43529 44398 gene locus_tag LOCUS_15480 43529 44398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 45017 45973 gene locus_tag LOCUS_15490 45017 45973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 46113 48179 gene locus_tag LOCUS_15500 46113 48179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 48273 49196 gene locus_tag LOCUS_15510 48273 49196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence034 158 733 gene locus_tag LOCUS_15520 158 733 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073958.1 protein_id gnl|my_center|LOCUS_15520 915 2753 gene locus_tag LOCUS_15530 915 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2805 3203 gene locus_tag LOCUS_15540 2805 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3226 4542 gene locus_tag LOCUS_15550 3226 4542 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_15550 5437 4553 gene locus_tag LOCUS_15560 5437 4553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_15560 6763 5585 gene locus_tag LOCUS_15570 6763 5585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_15570 10344 6769 gene locus_tag LOCUS_15580 10344 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 10688 10479 gene locus_tag LOCUS_15590 10688 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 10824 10645 gene locus_tag LOCUS_15600 10824 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 11090 12481 gene locus_tag LOCUS_15610 11090 12481 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_15610 12792 14495 gene locus_tag LOCUS_15620 12792 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 14690 16054 gene locus_tag LOCUS_15630 14690 16054 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_15630 16302 18542 gene locus_tag LOCUS_15640 16302 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 21860 18777 gene locus_tag LOCUS_15650 21860 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 22815 22126 gene locus_tag LOCUS_15660 22815 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 24287 23076 gene locus_tag LOCUS_15670 24287 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 24540 28514 gene locus_tag LOCUS_15680 24540 28514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 28727 28518 gene locus_tag LOCUS_15690 28727 28518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 28747 29340 gene locus_tag LOCUS_15700 28747 29340 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_15700 29321 29692 gene locus_tag LOCUS_15710 29321 29692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 30020 32695 gene locus_tag LOCUS_15720 30020 32695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 32716 35178 gene locus_tag LOCUS_15730 32716 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 35568 38150 gene locus_tag LOCUS_15740 35568 38150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 38228 40642 gene locus_tag LOCUS_15750 38228 40642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 40845 41267 gene locus_tag LOCUS_15760 40845 41267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 41539 41961 gene locus_tag LOCUS_15770 41539 41961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 42397 45033 gene locus_tag LOCUS_15780 42397 45033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 48084 45907 gene locus_tag LOCUS_15790 48084 45907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 48680 48222 gene locus_tag LOCUS_15800 48680 48222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 49524 48907 gene locus_tag LOCUS_15810 49524 48907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence035 2697 490 gene locus_tag LOCUS_15820 2697 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5174 2730 gene locus_tag LOCUS_15830 5174 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5421 8432 gene locus_tag LOCUS_15840 5421 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 8754 10817 gene locus_tag LOCUS_15850 8754 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 12231 10825 gene locus_tag LOCUS_15860 12231 10825 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_15860 14837 12552 gene locus_tag LOCUS_15870 14837 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 16169 14856 gene locus_tag LOCUS_15880 16169 14856 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_15880 17915 16341 gene locus_tag LOCUS_15890 17915 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 21452 18087 gene locus_tag LOCUS_15900 21452 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 22139 21705 gene locus_tag LOCUS_15910 22139 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 22633 22184 gene locus_tag LOCUS_15920 22633 22184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 23172 24536 gene locus_tag LOCUS_15930 23172 24536 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921961.1 protein_id gnl|my_center|LOCUS_15930 24866 24630 gene locus_tag LOCUS_15940 24866 24630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679683.1 protein_id gnl|my_center|LOCUS_15940 25291 24863 gene locus_tag LOCUS_15950 25291 24863 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_15950 26678 25362 gene locus_tag LOCUS_15960 26678 25362 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_15960 27865 26705 gene locus_tag LOCUS_15970 27865 26705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 27864 28046 gene locus_tag LOCUS_15980 27864 28046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 28211 29686 gene locus_tag LOCUS_15990 28211 29686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 29719 30279 gene locus_tag LOCUS_16000 29719 30279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 30481 31770 gene locus_tag LOCUS_16010 30481 31770 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_16010 31849 32502 gene locus_tag LOCUS_16020 31849 32502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 32499 33128 gene locus_tag LOCUS_16030 32499 33128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 33106 33567 gene locus_tag LOCUS_16040 33106 33567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 33707 35851 gene locus_tag LOCUS_16050 33707 35851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 34004 34078 gene locus_tag LOCUS_t00100 34004 34078 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35868 37193 gene locus_tag LOCUS_16060 35868 37193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 38582 37224 gene locus_tag LOCUS_16070 38582 37224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 39347 38595 gene locus_tag LOCUS_16080 39347 38595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 40716 39349 gene locus_tag LOCUS_16090 40716 39349 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326269.1 protein_id gnl|my_center|LOCUS_16090 41982 40792 gene locus_tag LOCUS_16100 41982 40792 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_16100 42776 42009 gene locus_tag LOCUS_16110 gene hisF 42776 42009 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_16110 43722 43372 gene locus_tag LOCUS_16120 43722 43372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 43874 43722 gene locus_tag LOCUS_16130 43874 43722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 44860 44246 gene locus_tag LOCUS_16140 44860 44246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 45188 45039 gene locus_tag LOCUS_16150 45188 45039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 47461 45164 gene locus_tag LOCUS_16160 47461 45164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 48496 47684 gene locus_tag LOCUS_16170 48496 47684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence036 229 1488 gene locus_tag LOCUS_16180 229 1488 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_16180 1630 2919 gene locus_tag LOCUS_16190 1630 2919 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_16190 3092 4252 gene locus_tag LOCUS_16200 3092 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4262 7435 gene locus_tag LOCUS_16210 4262 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 7589 8647 gene locus_tag LOCUS_16220 7589 8647 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_16220 8915 10852 gene locus_tag LOCUS_16230 8915 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 11039 11746 gene locus_tag LOCUS_16240 11039 11746 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_16240 11743 13650 gene locus_tag LOCUS_16250 11743 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 14638 13634 gene locus_tag LOCUS_16260 14638 13634 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_16260 15352 14663 gene locus_tag LOCUS_16270 15352 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 16048 15476 gene locus_tag LOCUS_16280 16048 15476 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_16280 19178 16596 gene locus_tag LOCUS_16290 19178 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 19614 19180 gene locus_tag LOCUS_16300 19614 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 20036 19620 gene locus_tag LOCUS_16310 20036 19620 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_16310 20930 20067 gene locus_tag LOCUS_16320 20930 20067 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_16320 22085 20943 gene locus_tag LOCUS_16330 22085 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 23157 22117 gene locus_tag LOCUS_16340 23157 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 23416 24900 gene locus_tag LOCUS_16350 23416 24900 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_16350 25086 27968 gene locus_tag LOCUS_16360 25086 27968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 29179 28010 gene locus_tag LOCUS_16370 29179 28010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 29630 29391 gene locus_tag LOCUS_16380 29630 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 31128 29923 gene locus_tag LOCUS_16390 31128 29923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 32364 31177 gene locus_tag LOCUS_16400 32364 31177 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_16400 32828 33961 gene locus_tag LOCUS_16410 32828 33961 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_16410 34768 34028 gene locus_tag LOCUS_16420 34768 34028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 36009 34954 gene locus_tag LOCUS_16430 36009 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 37198 36086 gene locus_tag LOCUS_16440 37198 36086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 37850 37557 gene locus_tag LOCUS_16450 37850 37557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 38955 38197 gene locus_tag LOCUS_16460 38955 38197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 39526 39080 gene locus_tag LOCUS_16470 39526 39080 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_16470 40447 39542 gene locus_tag LOCUS_16480 40447 39542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 41468 40464 gene locus_tag LOCUS_16490 41468 40464 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_16490 42699 41458 gene locus_tag LOCUS_16500 42699 41458 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 protein_id gnl|my_center|LOCUS_16500 43531 42743 gene locus_tag LOCUS_16510 43531 42743 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_16510 43714 44361 gene locus_tag LOCUS_16520 43714 44361 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_16520 44419 45168 gene locus_tag LOCUS_16530 44419 45168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence037 <1 2136 gene locus_tag LOCUS_16540 <1 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922984.1:DUF5060 domain-containing protein 2145 3059 gene locus_tag LOCUS_16550 2145 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3508 3924 gene locus_tag LOCUS_16560 3508 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4084 4419 gene locus_tag LOCUS_16570 4084 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 5938 4439 gene locus_tag LOCUS_16580 5938 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 6325 7866 gene locus_tag LOCUS_16590 6325 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 8399 11518 gene locus_tag LOCUS_16600 8399 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 13821 11752 gene locus_tag LOCUS_16610 13821 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 16074 14812 gene locus_tag LOCUS_16620 16074 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 16965 16267 gene locus_tag LOCUS_16630 16965 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 18249 17062 gene locus_tag LOCUS_16640 18249 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 19889 18477 gene locus_tag LOCUS_16650 19889 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 20594 22417 gene locus_tag LOCUS_16660 20594 22417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 22484 23524 gene locus_tag LOCUS_16670 22484 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 26853 23677 gene locus_tag LOCUS_16680 26853 23677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 27326 29098 gene locus_tag LOCUS_16690 27326 29098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 29271 30665 gene locus_tag LOCUS_16700 29271 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 30719 31948 gene locus_tag LOCUS_16710 30719 31948 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_16710 33575 33363 gene locus_tag LOCUS_16720 33575 33363 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_16720 34805 34125 gene locus_tag LOCUS_16730 34805 34125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 35467 35066 gene locus_tag LOCUS_16740 35467 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 35741 35574 gene locus_tag LOCUS_16750 35741 35574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 35740 37794 gene locus_tag LOCUS_16760 35740 37794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 37898 38830 gene locus_tag LOCUS_16770 37898 38830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 42252 38971 gene locus_tag LOCUS_16780 42252 38971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 45404 42867 gene locus_tag LOCUS_16790 45404 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 45727 45605 gene locus_tag LOCUS_16800 45727 45605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 45805 46884 gene locus_tag LOCUS_16810 45805 46884 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_16810 47004 48392 gene locus_tag LOCUS_16820 47004 48392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence038 1190 951 gene locus_tag LOCUS_16830 1190 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5258 1272 gene locus_tag LOCUS_16840 5258 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 7268 5334 gene locus_tag LOCUS_16850 7268 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7491 8729 gene locus_tag LOCUS_16860 7491 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 9198 8770 gene locus_tag LOCUS_16870 9198 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 9173 9829 gene locus_tag LOCUS_16880 9173 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 11703 9871 gene locus_tag LOCUS_16890 11703 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 13325 11817 gene locus_tag LOCUS_16900 13325 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 13405 13584 gene locus_tag LOCUS_16910 13405 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 13629 14645 gene locus_tag LOCUS_16920 13629 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 15855 14803 gene locus_tag LOCUS_16930 15855 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 16652 15948 gene locus_tag LOCUS_16940 16652 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 17133 18911 gene locus_tag LOCUS_16950 17133 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 19819 21009 gene locus_tag LOCUS_16960 19819 21009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 21463 21272 gene locus_tag LOCUS_16970 21463 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 21860 21546 gene locus_tag LOCUS_16980 21860 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 22152 21742 gene locus_tag LOCUS_16990 22152 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 26979 22390 gene locus_tag LOCUS_17000 26979 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 28151 28675 gene locus_tag LOCUS_17010 28151 28675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 28755 29501 gene locus_tag LOCUS_17020 28755 29501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116468607.1 protein_id gnl|my_center|LOCUS_17020 30404 30201 gene locus_tag LOCUS_17030 30404 30201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 30931 31977 gene locus_tag LOCUS_17040 30931 31977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 32213 34222 gene locus_tag LOCUS_17050 32213 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 34394 36376 gene locus_tag LOCUS_17060 34394 36376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 36567 37148 gene locus_tag LOCUS_17070 36567 37148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 37680 40460 gene locus_tag LOCUS_17080 37680 40460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 40536 40841 gene locus_tag LOCUS_17090 40536 40841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 40876 42810 gene locus_tag LOCUS_17100 40876 42810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 42896 45544 gene locus_tag LOCUS_17110 42896 45544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence039 299 496 gene locus_tag LOCUS_17120 299 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 672 3212 gene locus_tag LOCUS_17130 672 3212 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_17130 3448 3576 gene locus_tag LOCUS_17140 3448 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4114 6438 gene locus_tag LOCUS_17150 4114 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6479 8986 gene locus_tag LOCUS_17160 6479 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 9832 9086 gene locus_tag LOCUS_17170 9832 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 10089 13091 gene locus_tag LOCUS_17180 10089 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 15464 13224 gene locus_tag LOCUS_17190 15464 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 16139 15501 gene locus_tag LOCUS_17200 16139 15501 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158375.1 protein_id gnl|my_center|LOCUS_17200 16514 17857 gene locus_tag LOCUS_17210 gene fucP 16514 17857 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764988.1 protein_id gnl|my_center|LOCUS_17210 19665 18223 gene locus_tag LOCUS_17220 19665 18223 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_17220 20025 21440 gene locus_tag LOCUS_17230 20025 21440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 21658 23220 gene locus_tag LOCUS_17240 21658 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 23364 25541 gene locus_tag LOCUS_17250 23364 25541 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_17250 25538 26557 gene locus_tag LOCUS_17260 25538 26557 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_17260 26554 26673 gene locus_tag LOCUS_17270 26554 26673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 26670 27881 gene locus_tag LOCUS_17280 26670 27881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 28051 28287 gene locus_tag LOCUS_17290 28051 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 28875 30731 gene locus_tag LOCUS_17300 28875 30731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 30939 30745 gene locus_tag LOCUS_17310 30939 30745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 31947 30985 gene locus_tag LOCUS_17320 31947 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 34813 31988 gene locus_tag LOCUS_17330 34813 31988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 34976 35206 gene locus_tag LOCUS_17340 34976 35206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 35311 35745 gene locus_tag LOCUS_17350 35311 35745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 37326 35785 gene locus_tag LOCUS_17360 37326 35785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 37349 37618 gene locus_tag LOCUS_17370 37349 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 40014 37888 gene locus_tag LOCUS_17380 40014 37888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 40421 40014 gene locus_tag LOCUS_17390 40421 40014 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331759.1 protein_id gnl|my_center|LOCUS_17390 40802 41719 gene locus_tag LOCUS_17400 40802 41719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 41789 43075 gene locus_tag LOCUS_17410 41789 43075 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_17410 43080 44498 gene locus_tag LOCUS_17420 43080 44498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 44580 44750 gene locus_tag LOCUS_17430 44580 44750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 46038 44842 gene locus_tag LOCUS_17440 46038 44842 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence040 <1 663 gene locus_tag LOCUS_17450 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615657.1:sialidase family protein 1421 660 gene locus_tag LOCUS_17460 1421 660 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_17460 2134 1619 gene locus_tag LOCUS_17470 2134 1619 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_17470 2333 2115 gene locus_tag LOCUS_17480 2333 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3300 2425 gene locus_tag LOCUS_17490 3300 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4715 3354 gene locus_tag LOCUS_17500 4715 3354 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_17500 5315 4914 gene locus_tag LOCUS_17510 5315 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5611 8238 gene locus_tag LOCUS_17520 5611 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 9305 8259 gene locus_tag LOCUS_17530 9305 8259 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_17530 9505 12441 gene locus_tag LOCUS_17540 9505 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 12973 12608 gene locus_tag LOCUS_17550 12973 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 13939 13079 gene locus_tag LOCUS_17560 gene fabG 13939 13079 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_17560 14105 15688 gene locus_tag LOCUS_17570 14105 15688 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_17570 15778 17883 gene locus_tag LOCUS_17580 15778 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 17954 19132 gene locus_tag LOCUS_17590 17954 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 20986 19895 gene locus_tag LOCUS_17600 20986 19895 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_17600 22113 23372 gene locus_tag LOCUS_17610 22113 23372 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_17610 23372 26857 gene locus_tag LOCUS_17620 23372 26857 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_17620 26902 27111 gene locus_tag LOCUS_17630 26902 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 27511 28899 gene locus_tag LOCUS_17640 27511 28899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 29107 29463 gene locus_tag LOCUS_17650 29107 29463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 29757 29957 gene locus_tag LOCUS_17660 29757 29957 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_17660 30154 30822 gene locus_tag LOCUS_17670 30154 30822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616116.1 protein_id gnl|my_center|LOCUS_17670 31366 31082 gene locus_tag LOCUS_17680 31366 31082 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145122455.1 protein_id gnl|my_center|LOCUS_17680 31619 31371 gene locus_tag LOCUS_17690 31619 31371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 34577 31941 gene locus_tag LOCUS_17700 34577 31941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 35003 36130 gene locus_tag LOCUS_17710 35003 36130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 36611 36171 gene locus_tag LOCUS_17720 36611 36171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 37192 36608 gene locus_tag LOCUS_17730 37192 36608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 39761 37248 gene locus_tag LOCUS_17740 39761 37248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 41804 40182 gene locus_tag LOCUS_17750 41804 40182 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_17750 42191 42844 gene locus_tag LOCUS_17760 gene nth 42191 42844 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_17760 42934 45666 gene locus_tag LOCUS_17770 42934 45666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 46197 46538 gene locus_tag LOCUS_17780 46197 46538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 47149 46700 gene locus_tag LOCUS_17790 47149 46700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 47593 48426 gene locus_tag LOCUS_17800 47593 48426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence041 1 633 gene locus_tag LOCUS_17810 1 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1791 787 gene locus_tag LOCUS_17820 1791 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2704 1817 gene locus_tag LOCUS_17830 gene galU 2704 1817 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_17830 3048 4217 gene locus_tag LOCUS_17840 gene proB 3048 4217 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331575.1 protein_id gnl|my_center|LOCUS_17840 4387 5403 gene locus_tag LOCUS_17850 gene hisC 4387 5403 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_17850 5407 6000 gene locus_tag LOCUS_17860 gene hisB 5407 6000 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 protein_id gnl|my_center|LOCUS_17860 6009 7685 gene locus_tag LOCUS_17870 gene ettA 6009 7685 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_17870 8415 7687 gene locus_tag LOCUS_17880 8415 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 8752 9342 gene locus_tag LOCUS_17890 8752 9342 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870431.1 protein_id gnl|my_center|LOCUS_17890 9994 11172 gene locus_tag LOCUS_17900 9994 11172 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122832.1 protein_id gnl|my_center|LOCUS_17900 12044 11358 gene locus_tag LOCUS_17910 12044 11358 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_17910 12121 12507 gene locus_tag LOCUS_17920 12121 12507 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_17920 13913 12504 gene locus_tag LOCUS_17930 13913 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 14205 16298 gene locus_tag LOCUS_17940 gene recG 14205 16298 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921377.1 protein_id gnl|my_center|LOCUS_17940 16407 17888 gene locus_tag LOCUS_17950 16407 17888 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_17950 18665 17928 gene locus_tag LOCUS_17960 18665 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 18862 20649 gene locus_tag LOCUS_17970 18862 20649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 22967 20655 gene locus_tag LOCUS_17980 22967 20655 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121337.1 protein_id gnl|my_center|LOCUS_17980 23446 23688 gene locus_tag LOCUS_17990 23446 23688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 23779 24105 gene locus_tag LOCUS_18000 23779 24105 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 protein_id gnl|my_center|LOCUS_18000 25402 24140 gene locus_tag LOCUS_18010 25402 24140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121090.1 protein_id gnl|my_center|LOCUS_18010 26084 27751 gene locus_tag LOCUS_18020 26084 27751 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_18020 27944 28019 gene locus_tag LOCUS_t00110 27944 28019 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 28099 28181 gene locus_tag LOCUS_t00120 28099 28181 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 28246 28317 gene locus_tag LOCUS_t00130 28246 28317 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28358 28431 gene locus_tag LOCUS_t00140 28358 28431 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 28537 29730 gene locus_tag LOCUS_18030 gene tuf 28537 29730 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_18030 29743 29818 gene locus_tag LOCUS_t00150 29743 29818 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 29932 30399 gene locus_tag LOCUS_18040 gene secE 29932 30399 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324991.1 protein_id gnl|my_center|LOCUS_18040 30415 31308 gene locus_tag LOCUS_18050 30415 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 31356 31781 gene locus_tag LOCUS_18060 gene rplK 31356 31781 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_18060 31861 32541 gene locus_tag LOCUS_18070 gene rplA 31861 32541 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_18070 32616 33140 gene locus_tag LOCUS_18080 gene rplJ 32616 33140 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_18080 33257 33670 gene locus_tag LOCUS_18090 gene rplL 33257 33670 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 protein_id gnl|my_center|LOCUS_18090 33900 37631 gene locus_tag LOCUS_18100 gene rpoB 33900 37631 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_18100 37694 42085 gene locus_tag LOCUS_18110 gene rpoC 37694 42085 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_18110 42151 42516 gene locus_tag LOCUS_18120 gene rpsL 42151 42516 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326865.1 protein_id gnl|my_center|LOCUS_18120 42567 43037 gene locus_tag LOCUS_18130 gene rpsG 42567 43037 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_18130 43091 45175 gene locus_tag LOCUS_18140 gene fusA 43091 45175 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_18140 45861 45172 gene locus_tag LOCUS_18150 45861 45172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 46055 47347 gene locus_tag LOCUS_18160 gene hcp 46055 47347 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391685.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence042 5718 7028 gene locus_tag LOCUS_18170 5718 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 8783 7155 gene locus_tag LOCUS_18180 8783 7155 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_18180 10225 8861 gene locus_tag LOCUS_18190 10225 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 10318 11322 gene locus_tag LOCUS_18200 10318 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 12053 11325 gene locus_tag LOCUS_18210 12053 11325 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_18210 14011 12092 gene locus_tag LOCUS_18220 14011 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 15804 14296 gene locus_tag LOCUS_18230 15804 14296 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_18230 16014 18338 gene locus_tag LOCUS_18240 16014 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 20055 18553 gene locus_tag LOCUS_18250 20055 18553 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_18250 20321 22729 gene locus_tag LOCUS_18260 20321 22729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 24860 22716 gene locus_tag LOCUS_18270 24860 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 26615 24930 gene locus_tag LOCUS_18280 26615 24930 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_18280 26743 28296 gene locus_tag LOCUS_18290 26743 28296 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203528.1 protein_id gnl|my_center|LOCUS_18290 28354 30864 gene locus_tag LOCUS_18300 28354 30864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 32725 30869 gene locus_tag LOCUS_18310 32725 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 34129 32759 gene locus_tag LOCUS_18320 34129 32759 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_18320 34167 34382 gene locus_tag LOCUS_18330 34167 34382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 34398 35798 gene locus_tag LOCUS_18340 34398 35798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 35795 38434 gene locus_tag LOCUS_18350 35795 38434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 40907 38535 gene locus_tag LOCUS_18360 40907 38535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 41562 41122 gene locus_tag LOCUS_18370 41562 41122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence043 <1 4941 gene locus_tag LOCUS_18380 <1 4941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966116.1:FecR domain-containing protein 5272 4985 gene locus_tag LOCUS_18390 5272 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 8522 5373 gene locus_tag LOCUS_18400 8522 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 9508 8606 gene locus_tag LOCUS_18410 9508 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 12450 9589 gene locus_tag LOCUS_18420 12450 9589 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_18420 13572 12493 gene locus_tag LOCUS_18430 gene rhaT 13572 12493 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099333.1 protein_id gnl|my_center|LOCUS_18430 14546 13620 gene locus_tag LOCUS_18440 14546 13620 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_18440 16054 14630 gene locus_tag LOCUS_18450 16054 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 19911 16219 gene locus_tag LOCUS_18460 19911 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 21025 19958 gene locus_tag LOCUS_18470 21025 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 21173 22762 gene locus_tag LOCUS_18480 21173 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 24836 22740 gene locus_tag LOCUS_18490 24836 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 25114 26214 gene locus_tag LOCUS_18500 25114 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 26226 27905 gene locus_tag LOCUS_18510 26226 27905 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920642.1 protein_id gnl|my_center|LOCUS_18510 28399 28058 gene locus_tag LOCUS_18520 28399 28058 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326321.1 protein_id gnl|my_center|LOCUS_18520 28594 30363 gene locus_tag LOCUS_18530 28594 30363 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922605.1 protein_id gnl|my_center|LOCUS_18530 30434 31864 gene locus_tag LOCUS_18540 30434 31864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_18540 34984 32003 gene locus_tag LOCUS_18550 34984 32003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 35463 35275 gene locus_tag LOCUS_18560 35463 35275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 35806 38019 gene locus_tag LOCUS_18570 35806 38019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 38111 44866 gene locus_tag LOCUS_18580 38111 44866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 44943 45356 gene locus_tag LOCUS_18590 44943 45356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 45387 45680 gene locus_tag LOCUS_18600 45387 45680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18600 45622 46515 gene locus_tag LOCUS_18610 45622 46515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18610 46592 47008 gene locus_tag LOCUS_18620 46592 47008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence044 1 1227 gene locus_tag LOCUS_18630 1 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3575 1278 gene locus_tag LOCUS_18640 3575 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4286 3582 gene locus_tag LOCUS_18650 4286 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4597 5652 gene locus_tag LOCUS_18660 4597 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 6070 7131 gene locus_tag LOCUS_18670 6070 7131 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545100.1 protein_id gnl|my_center|LOCUS_18670 7131 7466 gene locus_tag LOCUS_18680 7131 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 7447 8025 gene locus_tag LOCUS_18690 gene lepB 7447 8025 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112364.1 protein_id gnl|my_center|LOCUS_18690 8220 8753 gene locus_tag LOCUS_18700 8220 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 12205 8765 gene locus_tag LOCUS_18710 12205 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 14727 12415 gene locus_tag LOCUS_18720 14727 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 16132 15065 gene locus_tag LOCUS_18730 16132 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 16593 20564 gene locus_tag LOCUS_18740 16593 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 20611 21075 gene locus_tag LOCUS_18750 20611 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 21180 22028 gene locus_tag LOCUS_18760 21180 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 23197 22037 gene locus_tag LOCUS_18770 gene cysK 23197 22037 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_18770 23214 23597 gene locus_tag LOCUS_18780 23214 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 23879 23655 gene locus_tag LOCUS_18790 23879 23655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 24247 23876 gene locus_tag LOCUS_18800 24247 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 26337 24451 gene locus_tag LOCUS_18810 26337 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 26572 28182 gene locus_tag LOCUS_18820 26572 28182 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615426.1 protein_id gnl|my_center|LOCUS_18820 28187 29326 gene locus_tag LOCUS_18830 28187 29326 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665225.1 protein_id gnl|my_center|LOCUS_18830 29440 30744 gene locus_tag LOCUS_18840 29440 30744 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_18840 30806 31009 gene locus_tag LOCUS_18850 30806 31009 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496483.1 protein_id gnl|my_center|LOCUS_18850 33126 31048 gene locus_tag LOCUS_18860 33126 31048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 35003 33357 gene locus_tag LOCUS_18870 35003 33357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122320.1 protein_id gnl|my_center|LOCUS_18870 35960 35034 gene locus_tag LOCUS_18880 35960 35034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_18880 38426 36138 gene locus_tag LOCUS_18890 38426 36138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122316.1 protein_id gnl|my_center|LOCUS_18890 38770 38537 gene locus_tag LOCUS_18900 38770 38537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 40445 39009 gene locus_tag LOCUS_18910 40445 39009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 40752 41969 gene locus_tag LOCUS_18920 gene trpB 40752 41969 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_18920 42000 42803 gene locus_tag LOCUS_18930 gene trpA 42000 42803 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_18930 42805 43014 gene locus_tag LOCUS_18940 42805 43014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 44070 43378 gene locus_tag LOCUS_18950 44070 43378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 44630 44469 gene locus_tag LOCUS_18960 44630 44469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 44983 46653 gene locus_tag LOCUS_18970 gene xrtU 44983 46653 CDS product exosortase U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921531.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence045 <1 3185 gene locus_tag LOCUS_18980 <1 3185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105203.1:alpha-2-macroglobulin 3845 3249 gene locus_tag LOCUS_18990 3845 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 4645 3842 gene locus_tag LOCUS_19000 4645 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 4942 6243 gene locus_tag LOCUS_19010 4942 6243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_19010 7685 6309 gene locus_tag LOCUS_19020 7685 6309 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_19020 8097 12029 gene locus_tag LOCUS_19030 8097 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 14055 12220 gene locus_tag LOCUS_19040 14055 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 14115 14333 gene locus_tag LOCUS_19050 14115 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 14436 20669 gene locus_tag LOCUS_19060 14436 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 22196 20685 gene locus_tag LOCUS_19070 22196 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 22586 22335 gene locus_tag LOCUS_19080 gene trxA 22586 22335 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871903.1 protein_id gnl|my_center|LOCUS_19080 26552 23097 gene locus_tag LOCUS_19090 26552 23097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 27200 26625 gene locus_tag LOCUS_19100 27200 26625 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_19100 27552 28199 gene locus_tag LOCUS_19110 gene wrbA 27552 28199 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013898.1 protein_id gnl|my_center|LOCUS_19110 28307 29482 gene locus_tag LOCUS_19120 28307 29482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 29485 32916 gene locus_tag LOCUS_19130 29485 32916 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_19130 35491 33281 gene locus_tag LOCUS_19140 35491 33281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 35618 35899 gene locus_tag LOCUS_19150 35618 35899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 35892 36428 gene locus_tag LOCUS_19160 35892 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_19160 40372 36482 gene locus_tag LOCUS_19170 40372 36482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 43087 40553 gene locus_tag LOCUS_19180 43087 40553 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_19180 45230 43245 gene locus_tag LOCUS_19190 45230 43245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 46498 45557 gene locus_tag LOCUS_19200 gene ylqF 46498 45557 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263367.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence046 431 1420 gene locus_tag LOCUS_19210 431 1420 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141944.1 protein_id gnl|my_center|LOCUS_19210 1773 3251 gene locus_tag LOCUS_19220 1773 3251 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_19220 3498 3283 gene locus_tag LOCUS_19230 3498 3283 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293303.1 protein_id gnl|my_center|LOCUS_19230 3969 4643 gene locus_tag LOCUS_19240 3969 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 8637 4849 gene locus_tag LOCUS_19250 8637 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 12617 9096 gene locus_tag LOCUS_19260 12617 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 13168 13632 gene locus_tag LOCUS_19270 13168 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 15057 13642 gene locus_tag LOCUS_19280 15057 13642 CDS product BNR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229191.1 protein_id gnl|my_center|LOCUS_19280 15253 17652 gene locus_tag LOCUS_19290 15253 17652 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_19290 17877 20897 gene locus_tag LOCUS_19300 17877 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 21436 20996 gene locus_tag LOCUS_19310 21436 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 21758 22507 gene locus_tag LOCUS_19320 21758 22507 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_19320 25273 22655 gene locus_tag LOCUS_19330 25273 22655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 26832 25372 gene locus_tag LOCUS_19340 26832 25372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 27575 26964 gene locus_tag LOCUS_19350 27575 26964 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_19350 28225 27677 gene locus_tag LOCUS_19360 28225 27677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 29224 28241 gene locus_tag LOCUS_19370 29224 28241 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_19370 29371 31872 gene locus_tag LOCUS_19380 29371 31872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 32948 31866 gene locus_tag LOCUS_19390 32948 31866 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_19390 33905 33393 gene locus_tag LOCUS_19400 33905 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 34190 34378 gene locus_tag LOCUS_19410 34190 34378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 34387 36549 gene locus_tag LOCUS_19420 34387 36549 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 protein_id gnl|my_center|LOCUS_19420 37722 36715 gene locus_tag LOCUS_19430 37722 36715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 39320 38016 gene locus_tag LOCUS_19440 39320 38016 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_19440 39714 39412 gene locus_tag LOCUS_19450 39714 39412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 40008 39751 gene locus_tag LOCUS_19460 40008 39751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 40464 40889 gene locus_tag LOCUS_19470 40464 40889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 41318 41530 gene locus_tag LOCUS_19480 41318 41530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 42183 41497 gene locus_tag LOCUS_19490 42183 41497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 42419 42189 gene locus_tag LOCUS_19500 42419 42189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 42950 42696 gene locus_tag LOCUS_19510 42950 42696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 44787 43213 gene locus_tag LOCUS_19520 44787 43213 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_19520 45837 44971 gene locus_tag LOCUS_19530 45837 44971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence047 350 1666 gene locus_tag LOCUS_19540 350 1666 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_19540 1986 3044 gene locus_tag LOCUS_19550 gene argC 1986 3044 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_19550 3132 4604 gene locus_tag LOCUS_19560 3132 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5094 7928 gene locus_tag LOCUS_19570 5094 7928 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427763.1 protein_id gnl|my_center|LOCUS_19570 7933 9942 gene locus_tag LOCUS_19580 7933 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 10246 11130 gene locus_tag LOCUS_19590 10246 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407616.1 protein_id gnl|my_center|LOCUS_19590 11167 13995 gene locus_tag LOCUS_19600 11167 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 14220 13939 gene locus_tag LOCUS_19610 14220 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 15329 14253 gene locus_tag LOCUS_19620 15329 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 15572 15871 gene locus_tag LOCUS_19630 15572 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 15865 16050 gene locus_tag LOCUS_19640 15865 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 17784 16084 gene locus_tag LOCUS_19650 17784 16084 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_19650 20026 17813 gene locus_tag LOCUS_19660 20026 17813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_19660 20025 20714 gene locus_tag LOCUS_19670 20025 20714 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528654.1 protein_id gnl|my_center|LOCUS_19670 21337 24984 gene locus_tag LOCUS_19680 21337 24984 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921428.1 protein_id gnl|my_center|LOCUS_19680 26694 25072 gene locus_tag LOCUS_19690 26694 25072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122556.1 protein_id gnl|my_center|LOCUS_19690 26881 27357 gene locus_tag LOCUS_19700 26881 27357 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_19700 29273 27489 gene locus_tag LOCUS_19710 29273 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 29379 31529 gene locus_tag LOCUS_19720 29379 31529 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_19720 31593 32705 gene locus_tag LOCUS_19730 gene ribD 31593 32705 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921938.1 protein_id gnl|my_center|LOCUS_19730 32718 33221 gene locus_tag LOCUS_19740 32718 33221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 34049 33357 gene locus_tag LOCUS_19750 34049 33357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 34226 35455 gene locus_tag LOCUS_19760 34226 35455 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_19760 35515 36297 gene locus_tag LOCUS_19770 35515 36297 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_19770 36299 37231 gene locus_tag LOCUS_19780 36299 37231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 37420 37731 gene locus_tag LOCUS_19790 37420 37731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 37728 38090 gene locus_tag LOCUS_19800 37728 38090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 38886 38191 gene locus_tag LOCUS_19810 38886 38191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 41040 38953 gene locus_tag LOCUS_19820 41040 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 42257 41040 gene locus_tag LOCUS_19830 42257 41040 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_19830 43146 42322 gene locus_tag LOCUS_19840 43146 42322 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_19840 43288 44844 gene locus_tag LOCUS_19850 43288 44844 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_19850 <46095 44967 gene locus_tag LOCUS_19860 <46095 44967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925439.1:acetate--CoA ligase family protein >Feature sequence048 124 303 gene locus_tag LOCUS_19870 124 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 236 1819 gene locus_tag LOCUS_19880 236 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2154 3281 gene locus_tag LOCUS_19890 2154 3281 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_19890 3688 5007 gene locus_tag LOCUS_19900 3688 5007 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327499.1 protein_id gnl|my_center|LOCUS_19900 5045 6571 gene locus_tag LOCUS_19910 5045 6571 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339602.1 protein_id gnl|my_center|LOCUS_19910 7285 7109 gene locus_tag LOCUS_19920 7285 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 7212 7538 gene locus_tag LOCUS_19930 7212 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7962 7792 gene locus_tag LOCUS_19940 7962 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 8631 8804 gene locus_tag LOCUS_19950 8631 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 8783 9382 gene locus_tag LOCUS_19960 8783 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 12099 9436 gene locus_tag LOCUS_19970 12099 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 13408 12269 gene locus_tag LOCUS_19980 13408 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13819 13640 gene locus_tag LOCUS_19990 13819 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 13752 14681 gene locus_tag LOCUS_20000 13752 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 15010 15888 gene locus_tag LOCUS_20010 15010 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 16137 16952 gene locus_tag LOCUS_20020 16137 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 17274 18188 gene locus_tag LOCUS_20030 17274 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 19917 18265 gene locus_tag LOCUS_20040 19917 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 20480 19968 gene locus_tag LOCUS_20050 20480 19968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 23315 20943 gene locus_tag LOCUS_20060 23315 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 23428 27669 gene locus_tag LOCUS_20070 23428 27669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 27676 28776 gene locus_tag LOCUS_20080 27676 28776 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_20080 28773 30146 gene locus_tag LOCUS_20090 gene rocD 28773 30146 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868785.1 protein_id gnl|my_center|LOCUS_20090 30419 31303 gene locus_tag LOCUS_20100 30419 31303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 32888 31572 gene locus_tag LOCUS_20110 32888 31572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_20110 32965 33324 gene locus_tag LOCUS_20120 32965 33324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 33650 34624 gene locus_tag LOCUS_20130 33650 34624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 34643 36031 gene locus_tag LOCUS_20140 34643 36031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 36500 36234 gene locus_tag LOCUS_20150 36500 36234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 36766 37179 gene locus_tag LOCUS_20160 36766 37179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 37172 37609 gene locus_tag LOCUS_20170 37172 37609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 39204 37879 gene locus_tag LOCUS_20180 39204 37879 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_20180 39769 40527 gene locus_tag LOCUS_20190 39769 40527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 41909 40578 gene locus_tag LOCUS_20200 41909 40578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 43050 41926 gene locus_tag LOCUS_20210 43050 41926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 43569 44939 gene locus_tag LOCUS_20220 43569 44939 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence049 2708 2262 gene locus_tag LOCUS_20230 2708 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3630 2734 gene locus_tag LOCUS_20240 3630 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 5410 3719 gene locus_tag LOCUS_20250 5410 3719 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_20250 6050 5835 gene locus_tag LOCUS_20260 6050 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 6631 6170 gene locus_tag LOCUS_20270 6631 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 6657 7028 gene locus_tag LOCUS_20280 6657 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 7263 7712 gene locus_tag LOCUS_20290 7263 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8432 7725 gene locus_tag LOCUS_20300 8432 7725 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_20300 8845 8429 gene locus_tag LOCUS_20310 8845 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 9395 8868 gene locus_tag LOCUS_20320 9395 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 9754 9413 gene locus_tag LOCUS_20330 9754 9413 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089489.1 protein_id gnl|my_center|LOCUS_20330 9999 10391 gene locus_tag LOCUS_20340 9999 10391 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_20340 10388 11335 gene locus_tag LOCUS_20350 10388 11335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_20350 11329 12012 gene locus_tag LOCUS_20360 11329 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 12165 13985 gene locus_tag LOCUS_20370 12165 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 14491 14270 gene locus_tag LOCUS_20380 14491 14270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 14490 15266 gene locus_tag LOCUS_20390 14490 15266 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976215.1 protein_id gnl|my_center|LOCUS_20390 15268 16662 gene locus_tag LOCUS_20400 15268 16662 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_20400 16702 17982 gene locus_tag LOCUS_20410 16702 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 17979 18773 gene locus_tag LOCUS_20420 17979 18773 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_20420 18869 20515 gene locus_tag LOCUS_20430 18869 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 22013 20823 gene locus_tag LOCUS_20440 22013 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 23654 22254 gene locus_tag LOCUS_20450 23654 22254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 protein_id gnl|my_center|LOCUS_20450 25060 23738 gene locus_tag LOCUS_20460 25060 23738 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_20460 25154 25459 gene locus_tag LOCUS_20470 25154 25459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20470 26092 25595 gene locus_tag LOCUS_20480 26092 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 26405 27910 gene locus_tag LOCUS_20490 26405 27910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 29956 28429 gene locus_tag LOCUS_r00010 29956 28429 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 30417 30926 gene locus_tag LOCUS_20500 30417 30926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 32917 30944 gene locus_tag LOCUS_20510 32917 30944 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 protein_id gnl|my_center|LOCUS_20510 33266 34723 gene locus_tag LOCUS_20520 33266 34723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 34880 35794 gene locus_tag LOCUS_20530 34880 35794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 36754 35813 gene locus_tag LOCUS_20540 36754 35813 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326488.1 protein_id gnl|my_center|LOCUS_20540 37087 37356 gene locus_tag LOCUS_20550 37087 37356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 37638 38924 gene locus_tag LOCUS_20560 gene clpX 37638 38924 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_20560 39547 39428 gene locus_tag LOCUS_20570 39547 39428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 40312 39617 gene locus_tag LOCUS_20580 40312 39617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 40664 41029 gene locus_tag LOCUS_20590 40664 41029 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_20590 41032 43824 gene locus_tag LOCUS_20600 41032 43824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 44199 43831 gene locus_tag LOCUS_20610 44199 43831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 44090 44299 gene locus_tag LOCUS_20620 44090 44299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 <45403 44534 gene locus_tag LOCUS_20630 <45403 44534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922453.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence050 177 1799 gene locus_tag LOCUS_20640 gene dop 177 1799 CDS product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908269.1 protein_id gnl|my_center|LOCUS_20640 1901 2104 gene locus_tag LOCUS_20650 1901 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2289 4619 gene locus_tag LOCUS_20660 2289 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4600 4833 gene locus_tag LOCUS_20670 4600 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4845 6200 gene locus_tag LOCUS_20680 4845 6200 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_20680 6265 6495 gene locus_tag LOCUS_20690 6265 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7382 6498 gene locus_tag LOCUS_20700 7382 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 10951 7463 gene locus_tag LOCUS_20710 10951 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 11639 11914 gene locus_tag LOCUS_20720 gene rpsR 11639 11914 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236620859.1 protein_id gnl|my_center|LOCUS_20720 11922 12407 gene locus_tag LOCUS_20730 11922 12407 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_20730 13513 12461 gene locus_tag LOCUS_20740 gene ltaE 13513 12461 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_20740 13707 15071 gene locus_tag LOCUS_20750 gene hisD 13707 15071 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_20750 16608 15163 gene locus_tag LOCUS_20760 16608 15163 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_20760 18098 16605 gene locus_tag LOCUS_20770 18098 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 18713 19447 gene locus_tag LOCUS_20780 18713 19447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 20282 19608 gene locus_tag LOCUS_20790 20282 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 20536 21726 gene locus_tag LOCUS_20800 20536 21726 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804458.1 protein_id gnl|my_center|LOCUS_20800 21859 25791 gene locus_tag LOCUS_20810 21859 25791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 25858 27204 gene locus_tag LOCUS_20820 25858 27204 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_20820 27253 28548 gene locus_tag LOCUS_20830 27253 28548 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_20830 28610 30037 gene locus_tag LOCUS_20840 28610 30037 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726980.1 protein_id gnl|my_center|LOCUS_20840 30268 32292 gene locus_tag LOCUS_20850 30268 32292 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_20850 33734 32310 gene locus_tag LOCUS_20860 33734 32310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 35554 33857 gene locus_tag LOCUS_20870 35554 33857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 36934 35597 gene locus_tag LOCUS_20880 36934 35597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 39165 37435 gene locus_tag LOCUS_20890 39165 37435 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_20890 41591 39237 gene locus_tag LOCUS_20900 41591 39237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 42317 41796 gene locus_tag LOCUS_20910 42317 41796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 43064 42534 gene locus_tag LOCUS_20920 43064 42534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 43640 43122 gene locus_tag LOCUS_20930 43640 43122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 44189 43827 gene locus_tag LOCUS_20940 44189 43827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 <45286 44369 gene locus_tag LOCUS_20950 <45286 44369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence051 <1 945 gene locus_tag LOCUS_20960 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391669.1:3-methyl-2-oxobutanoate hydroxymethyltransferase 997 1887 gene locus_tag LOCUS_20970 gene metF 997 1887 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_20970 2285 3658 gene locus_tag LOCUS_20980 2285 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3679 4680 gene locus_tag LOCUS_20990 3679 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4684 6555 gene locus_tag LOCUS_21000 4684 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 7085 6573 gene locus_tag LOCUS_21010 7085 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7355 7996 gene locus_tag LOCUS_21020 7355 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7993 8868 gene locus_tag LOCUS_21030 7993 8868 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_21030 8981 10984 gene locus_tag LOCUS_21040 gene hdrA 8981 10984 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_21040 10977 11483 gene locus_tag LOCUS_21050 10977 11483 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842401.1 protein_id gnl|my_center|LOCUS_21050 11483 12460 gene locus_tag LOCUS_21060 11483 12460 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_21060 12479 13948 gene locus_tag LOCUS_21070 12479 13948 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_21070 14973 14224 gene locus_tag LOCUS_21080 14973 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 15930 15085 gene locus_tag LOCUS_21090 15930 15085 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 protein_id gnl|my_center|LOCUS_21090 16493 15930 gene locus_tag LOCUS_21100 gene frr 16493 15930 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_21100 17277 16516 gene locus_tag LOCUS_21110 gene pyrH 17277 16516 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_21110 18351 17518 gene locus_tag LOCUS_21120 gene tsf 18351 17518 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880428.1 protein_id gnl|my_center|LOCUS_21120 19265 18495 gene locus_tag LOCUS_21130 gene rpsB 19265 18495 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_21130 19526 20287 gene locus_tag LOCUS_21140 19526 20287 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_21140 20400 21785 gene locus_tag LOCUS_21150 20400 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 22061 23164 gene locus_tag LOCUS_21160 22061 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119757.1 protein_id gnl|my_center|LOCUS_21160 23270 24661 gene locus_tag LOCUS_21170 gene asnS 23270 24661 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337912.1 protein_id gnl|my_center|LOCUS_21170 24808 26349 gene locus_tag LOCUS_21180 24808 26349 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922090.1 protein_id gnl|my_center|LOCUS_21180 26563 26396 gene locus_tag LOCUS_21190 26563 26396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 26658 27275 gene locus_tag LOCUS_21200 gene rpsD 26658 27275 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846140.1 protein_id gnl|my_center|LOCUS_21200 27465 28886 gene locus_tag LOCUS_21210 gene lpdA 27465 28886 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_21210 29125 31845 gene locus_tag LOCUS_21220 gene aceE 29125 31845 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_21220 31838 33223 gene locus_tag LOCUS_21230 31838 33223 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119355.1 protein_id gnl|my_center|LOCUS_21230 33906 33343 gene locus_tag LOCUS_21240 33906 33343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 35683 34250 gene locus_tag LOCUS_21250 35683 34250 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_21250 37023 35665 gene locus_tag LOCUS_21260 37023 35665 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_21260 38310 37033 gene locus_tag LOCUS_21270 38310 37033 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948513.1 protein_id gnl|my_center|LOCUS_21270 41202 38422 gene locus_tag LOCUS_21280 41202 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 42734 41202 gene locus_tag LOCUS_21290 42734 41202 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_21290 44368 42848 gene locus_tag LOCUS_21300 44368 42848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 <45156 44365 gene locus_tag LOCUS_21310 <45156 44365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776226.1:amidohydrolase >Feature sequence052 3140 5275 gene locus_tag LOCUS_21320 3140 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 6266 5358 gene locus_tag LOCUS_21330 6266 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 8659 6392 gene locus_tag LOCUS_21340 8659 6392 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_21340 8603 8848 gene locus_tag LOCUS_21350 8603 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 9025 11655 gene locus_tag LOCUS_21360 9025 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 11681 14956 gene locus_tag LOCUS_21370 11681 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 15027 16397 gene locus_tag LOCUS_21380 15027 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 17744 16479 gene locus_tag LOCUS_21390 17744 16479 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_21390 18050 18532 gene locus_tag LOCUS_21400 18050 18532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_21400 18620 19606 gene locus_tag LOCUS_21410 18620 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 19760 21115 gene locus_tag LOCUS_21420 19760 21115 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_21420 22620 21259 gene locus_tag LOCUS_21430 22620 21259 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121818.1 protein_id gnl|my_center|LOCUS_21430 24348 22909 gene locus_tag LOCUS_21440 24348 22909 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_21440 26428 24377 gene locus_tag LOCUS_21450 26428 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 26600 26791 gene locus_tag LOCUS_21460 26600 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 26733 27173 gene locus_tag LOCUS_21470 26733 27173 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_21470 27236 28636 gene locus_tag LOCUS_21480 27236 28636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 28732 29820 gene locus_tag LOCUS_21490 28732 29820 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_21490 29894 31321 gene locus_tag LOCUS_21500 gene purB 29894 31321 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_21500 31415 31663 gene locus_tag LOCUS_21510 31415 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 34489 31670 gene locus_tag LOCUS_21520 gene uvrA 34489 31670 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986847.1 protein_id gnl|my_center|LOCUS_21520 35336 34560 gene locus_tag LOCUS_21530 35336 34560 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_21530 35495 36700 gene locus_tag LOCUS_21540 35495 36700 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_21540 36847 38631 gene locus_tag LOCUS_21550 36847 38631 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_21550 38799 39116 gene locus_tag LOCUS_21560 38799 39116 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329747.1 protein_id gnl|my_center|LOCUS_21560 39402 40496 gene locus_tag LOCUS_21570 39402 40496 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_21570 40675 42354 gene locus_tag LOCUS_21580 40675 42354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 42426 43628 gene locus_tag LOCUS_21590 42426 43628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence053 997 2484 gene locus_tag LOCUS_21600 997 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3805 2516 gene locus_tag LOCUS_21610 3805 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4193 6736 gene locus_tag LOCUS_21620 4193 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 7169 6786 gene locus_tag LOCUS_21630 7169 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 7374 7162 gene locus_tag LOCUS_21640 7374 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8818 7481 gene locus_tag LOCUS_21650 8818 7481 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_21650 9445 9786 gene locus_tag LOCUS_21660 9445 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 10129 12051 gene locus_tag LOCUS_21670 10129 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 13542 12190 gene locus_tag LOCUS_21680 13542 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 13814 16417 gene locus_tag LOCUS_21690 13814 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 16500 17795 gene locus_tag LOCUS_21700 16500 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 20495 17802 gene locus_tag LOCUS_21710 20495 17802 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_21710 21969 21394 gene locus_tag LOCUS_21720 21969 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 22122 22445 gene locus_tag LOCUS_21730 22122 22445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21730 23443 22784 gene locus_tag LOCUS_21740 23443 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 23825 26524 gene locus_tag LOCUS_21750 gene ppdK 23825 26524 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_21750 26705 27796 gene locus_tag LOCUS_21760 26705 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 27858 28523 gene locus_tag LOCUS_21770 27858 28523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 28507 29892 gene locus_tag LOCUS_21780 28507 29892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 30316 30053 gene locus_tag LOCUS_21790 30316 30053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 30282 30728 gene locus_tag LOCUS_21800 30282 30728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 30941 31918 gene locus_tag LOCUS_21810 30941 31918 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_21810 32041 33042 gene locus_tag LOCUS_21820 32041 33042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 33386 37492 gene locus_tag LOCUS_21830 33386 37492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 37511 40606 gene locus_tag LOCUS_21840 37511 40606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence054 353 105 gene locus_tag LOCUS_21850 353 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 523 2235 gene locus_tag LOCUS_21860 523 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2232 4442 gene locus_tag LOCUS_21870 2232 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4501 5994 gene locus_tag LOCUS_21880 4501 5994 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_21880 7320 6004 gene locus_tag LOCUS_21890 7320 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 9777 7333 gene locus_tag LOCUS_21900 9777 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 11466 9988 gene locus_tag LOCUS_21910 11466 9988 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_21910 12971 11463 gene locus_tag LOCUS_21920 12971 11463 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_21920 15554 12996 gene locus_tag LOCUS_21930 15554 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 17139 15559 gene locus_tag LOCUS_21940 17139 15559 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_21940 18898 17144 gene locus_tag LOCUS_21950 18898 17144 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813188.1 protein_id gnl|my_center|LOCUS_21950 19087 18908 gene locus_tag LOCUS_21960 19087 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 20784 19126 gene locus_tag LOCUS_21970 20784 19126 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_21970 22313 20781 gene locus_tag LOCUS_21980 22313 20781 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_21980 23921 22371 gene locus_tag LOCUS_21990 23921 22371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 25447 24077 gene locus_tag LOCUS_22000 25447 24077 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921360.1 protein_id gnl|my_center|LOCUS_22000 25971 25444 gene locus_tag LOCUS_22010 25971 25444 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668449.1 protein_id gnl|my_center|LOCUS_22010 26982 26668 gene locus_tag LOCUS_22020 26982 26668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 28187 26970 gene locus_tag LOCUS_22030 28187 26970 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040114520.1 protein_id gnl|my_center|LOCUS_22030 29049 29609 gene locus_tag LOCUS_22040 29049 29609 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120964.1 protein_id gnl|my_center|LOCUS_22040 29606 31069 gene locus_tag LOCUS_22050 29606 31069 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_22050 31073 32437 gene locus_tag LOCUS_22060 31073 32437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 32604 35171 gene locus_tag LOCUS_22070 32604 35171 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_22070 35247 38561 gene locus_tag LOCUS_22080 35247 38561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 38600 40012 gene locus_tag LOCUS_22090 38600 40012 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_22090 40131 42368 gene locus_tag LOCUS_22100 40131 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_22100 43957 43118 gene locus_tag LOCUS_22110 43957 43118 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence055 313 1419 gene locus_tag LOCUS_22120 gene purC 313 1419 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050052.1 protein_id gnl|my_center|LOCUS_22120 1512 1733 gene locus_tag LOCUS_22130 1512 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1821 2726 gene locus_tag LOCUS_22140 1821 2726 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664024.1 protein_id gnl|my_center|LOCUS_22140 2826 3083 gene locus_tag LOCUS_22150 2826 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3389 3940 gene locus_tag LOCUS_22160 3389 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099663.1 protein_id gnl|my_center|LOCUS_22160 4055 4444 gene locus_tag LOCUS_22170 4055 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 4445 6199 gene locus_tag LOCUS_22180 4445 6199 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_22180 6186 8252 gene locus_tag LOCUS_22190 6186 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 8371 8865 gene locus_tag LOCUS_22200 8371 8865 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_22200 8862 9332 gene locus_tag LOCUS_22210 8862 9332 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_22210 9503 9700 gene locus_tag LOCUS_22220 9503 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 9697 10257 gene locus_tag LOCUS_22230 9697 10257 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_22230 13704 10468 gene locus_tag LOCUS_22240 13704 10468 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_22240 15393 13720 gene locus_tag LOCUS_22250 15393 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 15741 15968 gene locus_tag LOCUS_22260 15741 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 15985 16140 gene locus_tag LOCUS_22270 15985 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 18123 16366 gene locus_tag LOCUS_22280 18123 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 18400 19950 gene locus_tag LOCUS_22290 18400 19950 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_22290 19907 20200 gene locus_tag LOCUS_22300 19907 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 21564 20296 gene locus_tag LOCUS_22310 21564 20296 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092007.1 protein_id gnl|my_center|LOCUS_22310 23012 21552 gene locus_tag LOCUS_22320 23012 21552 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_22320 24539 23163 gene locus_tag LOCUS_22330 24539 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_22330 25342 25109 gene locus_tag LOCUS_22340 25342 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 25341 27779 gene locus_tag LOCUS_22350 25341 27779 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_22350 27836 28939 gene locus_tag LOCUS_22360 gene rfbB 27836 28939 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_22360 28955 29878 gene locus_tag LOCUS_22370 gene rfbA 28955 29878 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419145.1 protein_id gnl|my_center|LOCUS_22370 31262 29907 gene locus_tag LOCUS_22380 31262 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_22380 31867 31376 gene locus_tag LOCUS_22390 31867 31376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 33275 32895 gene locus_tag LOCUS_22400 33275 32895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 33964 35556 gene locus_tag LOCUS_22410 33964 35556 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816828.1 protein_id gnl|my_center|LOCUS_22410 37027 35708 gene locus_tag LOCUS_22420 37027 35708 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_22420 37461 37060 gene locus_tag LOCUS_22430 37461 37060 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_22430 37820 37458 gene locus_tag LOCUS_22440 37820 37458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 39079 37901 gene locus_tag LOCUS_22450 39079 37901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 41570 39144 gene locus_tag LOCUS_22460 41570 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 42075 41833 gene locus_tag LOCUS_22470 42075 41833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 43210 42050 gene locus_tag LOCUS_22480 43210 42050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 43858 44022 gene locus_tag LOCUS_22490 43858 44022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence056 544 176 gene locus_tag LOCUS_22500 544 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 789 541 gene locus_tag LOCUS_22510 789 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4557 1171 gene locus_tag LOCUS_22520 4557 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 5088 4681 gene locus_tag LOCUS_22530 5088 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 5447 5085 gene locus_tag LOCUS_22540 5447 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 5700 7547 gene locus_tag LOCUS_22550 5700 7547 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_22550 7599 11090 gene locus_tag LOCUS_22560 7599 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 12613 11210 gene locus_tag LOCUS_22570 12613 11210 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_22570 13653 12610 gene locus_tag LOCUS_22580 13653 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 15247 13886 gene locus_tag LOCUS_22590 15247 13886 CDS product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776792.1 protein_id gnl|my_center|LOCUS_22590 16209 15385 gene locus_tag LOCUS_22600 16209 15385 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776793.1 protein_id gnl|my_center|LOCUS_22600 17054 16212 gene locus_tag LOCUS_22610 17054 16212 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870012.1 protein_id gnl|my_center|LOCUS_22610 17345 17100 gene locus_tag LOCUS_22620 17345 17100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 17366 18274 gene locus_tag LOCUS_22630 17366 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_22630 19772 18435 gene locus_tag LOCUS_22640 19772 18435 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730531.1 protein_id gnl|my_center|LOCUS_22640 20278 19844 gene locus_tag LOCUS_22650 20278 19844 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092129.1 protein_id gnl|my_center|LOCUS_22650 21538 20465 gene locus_tag LOCUS_22660 21538 20465 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_22660 23210 21543 gene locus_tag LOCUS_22670 23210 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 25509 23317 gene locus_tag LOCUS_22680 25509 23317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 25942 26355 gene locus_tag LOCUS_22690 25942 26355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 26516 27061 gene locus_tag LOCUS_22700 26516 27061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 27098 27182 gene locus_tag LOCUS_t00160 27098 27182 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28869 27430 gene locus_tag LOCUS_22710 gene xylB 28869 27430 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_22710 29523 28945 gene locus_tag LOCUS_22720 29523 28945 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_22720 29674 29991 gene locus_tag LOCUS_22730 29674 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 31302 29995 gene locus_tag LOCUS_22740 31302 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 31736 31542 gene locus_tag LOCUS_22750 31736 31542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 32821 32036 gene locus_tag LOCUS_22760 32821 32036 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_22760 33488 33129 gene locus_tag LOCUS_22770 33488 33129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 34334 34002 gene locus_tag LOCUS_22780 34334 34002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 35064 35375 gene locus_tag LOCUS_22790 35064 35375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 35831 35469 gene locus_tag LOCUS_22800 35831 35469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 36630 35767 gene locus_tag LOCUS_22810 36630 35767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 39532 37817 gene locus_tag LOCUS_22820 gene xrtU 39532 37817 CDS product exosortase U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921531.1 protein_id gnl|my_center|LOCUS_22820 40336 39647 gene locus_tag LOCUS_22830 40336 39647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 42063 40678 gene locus_tag LOCUS_22840 42063 40678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 43525 42068 gene locus_tag LOCUS_22850 43525 42068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence057 1183 2337 gene locus_tag LOCUS_22860 1183 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2340 3023 gene locus_tag LOCUS_22870 2340 3023 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331623.1 protein_id gnl|my_center|LOCUS_22870 7075 3101 gene locus_tag LOCUS_22880 7075 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 7389 7141 gene locus_tag LOCUS_22890 7389 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 7388 9421 gene locus_tag LOCUS_22900 7388 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 10517 9465 gene locus_tag LOCUS_22910 gene galT 10517 9465 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 protein_id gnl|my_center|LOCUS_22910 11766 10534 gene locus_tag LOCUS_22920 gene galK 11766 10534 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053415.1 protein_id gnl|my_center|LOCUS_22920 11847 12113 gene locus_tag LOCUS_22930 11847 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 12223 13230 gene locus_tag LOCUS_22940 12223 13230 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536378.1 protein_id gnl|my_center|LOCUS_22940 14563 13400 gene locus_tag LOCUS_22950 14563 13400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_22950 16917 14560 gene locus_tag LOCUS_22960 16917 14560 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_22960 20558 16914 gene locus_tag LOCUS_22970 20558 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_22970 22677 20560 gene locus_tag LOCUS_22980 22677 20560 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_22980 23672 22674 gene locus_tag LOCUS_22990 23672 22674 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_22990 24682 23669 gene locus_tag LOCUS_23000 24682 23669 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_23000 25638 24811 gene locus_tag LOCUS_23010 25638 24811 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_23010 28214 25635 gene locus_tag LOCUS_23020 28214 25635 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_23020 29241 28333 gene locus_tag LOCUS_23030 29241 28333 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_23030 32636 29325 gene locus_tag LOCUS_23040 32636 29325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 33015 32737 gene locus_tag LOCUS_23050 33015 32737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 33179 33015 gene locus_tag LOCUS_23060 33179 33015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 33400 33750 gene locus_tag LOCUS_23070 33400 33750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 34148 39043 gene locus_tag LOCUS_23080 34148 39043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 39048 39995 gene locus_tag LOCUS_23090 39048 39995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 40028 40822 gene locus_tag LOCUS_23100 40028 40822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 41133 42032 gene locus_tag LOCUS_23110 41133 42032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 43715 42213 gene locus_tag LOCUS_23120 43715 42213 CDS product DNRLRE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120060.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence058 318 1589 gene locus_tag LOCUS_23130 318 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1589 2878 gene locus_tag LOCUS_23140 1589 2878 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_23140 3226 3029 gene locus_tag LOCUS_23150 3226 3029 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_23150 3701 4150 gene locus_tag LOCUS_23160 3701 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4667 4218 gene locus_tag LOCUS_23170 4667 4218 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_23170 6358 4739 gene locus_tag LOCUS_23180 6358 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 7161 6355 gene locus_tag LOCUS_23190 7161 6355 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_23190 7298 7158 gene locus_tag LOCUS_23200 7298 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 7443 7303 gene locus_tag LOCUS_23210 7443 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 8410 7571 gene locus_tag LOCUS_23220 8410 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142942.1 protein_id gnl|my_center|LOCUS_23220 9191 8463 gene locus_tag LOCUS_23230 9191 8463 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_23230 12051 9181 gene locus_tag LOCUS_23240 12051 9181 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_23240 13502 12348 gene locus_tag LOCUS_23250 13502 12348 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_23250 13867 13502 gene locus_tag LOCUS_23260 13867 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 15945 13864 gene locus_tag LOCUS_23270 15945 13864 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23270 16453 17502 gene locus_tag LOCUS_23280 16453 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 17499 19709 gene locus_tag LOCUS_23290 17499 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 19942 21351 gene locus_tag LOCUS_23300 19942 21351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 21655 22065 gene locus_tag LOCUS_23310 21655 22065 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072501.1 protein_id gnl|my_center|LOCUS_23310 22201 22563 gene locus_tag LOCUS_23320 22201 22563 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816964.1 protein_id gnl|my_center|LOCUS_23320 23026 22811 gene locus_tag LOCUS_23330 23026 22811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 24105 22909 gene locus_tag LOCUS_23340 24105 22909 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024696621.1 protein_id gnl|my_center|LOCUS_23340 24088 24270 gene locus_tag LOCUS_23350 24088 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 24279 25094 gene locus_tag LOCUS_23360 24279 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 26200 25307 gene locus_tag LOCUS_23370 26200 25307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 27292 26309 gene locus_tag LOCUS_23380 27292 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120905.1 protein_id gnl|my_center|LOCUS_23380 28092 27487 gene locus_tag LOCUS_23390 28092 27487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 28045 28227 gene locus_tag LOCUS_23400 28045 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 29282 28479 gene locus_tag LOCUS_23410 29282 28479 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_23410 29539 30543 gene locus_tag LOCUS_23420 29539 30543 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120566.1 protein_id gnl|my_center|LOCUS_23420 30702 31253 gene locus_tag LOCUS_23430 30702 31253 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_23430 32366 31254 gene locus_tag LOCUS_23440 32366 31254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 33014 32415 gene locus_tag LOCUS_23450 33014 32415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 34296 33328 gene locus_tag LOCUS_23460 34296 33328 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_23460 35280 34309 gene locus_tag LOCUS_23470 35280 34309 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324233.1 protein_id gnl|my_center|LOCUS_23470 36603 35281 gene locus_tag LOCUS_23480 36603 35281 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_23480 38037 36814 gene locus_tag LOCUS_23490 38037 36814 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_23490 40017 38329 gene locus_tag LOCUS_23500 40017 38329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 40147 40305 gene locus_tag LOCUS_23510 40147 40305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 41291 40284 gene locus_tag LOCUS_23520 gene cpaB 41291 40284 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120310.1 protein_id gnl|my_center|LOCUS_23520 41622 41323 gene locus_tag LOCUS_23530 41622 41323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 42399 41833 gene locus_tag LOCUS_23540 42399 41833 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_23540 42977 43951 gene locus_tag LOCUS_23550 42977 43951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence059 4656 1489 gene locus_tag LOCUS_23560 4656 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 5139 4714 gene locus_tag LOCUS_23570 5139 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 8340 5302 gene locus_tag LOCUS_23580 8340 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 9313 8438 gene locus_tag LOCUS_23590 9313 8438 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_23590 10887 9349 gene locus_tag LOCUS_23600 10887 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 11389 14460 gene locus_tag LOCUS_23610 11389 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 17341 14444 gene locus_tag LOCUS_23620 17341 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 19510 17357 gene locus_tag LOCUS_23630 19510 17357 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_23630 22965 19693 gene locus_tag LOCUS_23640 gene carB 22965 19693 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_23640 23170 23745 gene locus_tag LOCUS_23650 23170 23745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 26333 23751 gene locus_tag LOCUS_23660 26333 23751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 27329 27153 gene locus_tag LOCUS_23670 27329 27153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 27653 27423 gene locus_tag LOCUS_23680 27653 27423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 27811 28602 gene locus_tag LOCUS_23690 27811 28602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 28685 30541 gene locus_tag LOCUS_23700 28685 30541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 30547 31839 gene locus_tag LOCUS_23710 30547 31839 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_23710 31947 32111 gene locus_tag LOCUS_23720 31947 32111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 32148 34904 gene locus_tag LOCUS_23730 32148 34904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 37971 35005 gene locus_tag LOCUS_23740 37971 35005 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_23740 38431 39933 gene locus_tag LOCUS_23750 38431 39933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 40067 41518 gene locus_tag LOCUS_23760 40067 41518 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_23760 41629 42435 gene locus_tag LOCUS_23770 41629 42435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 42556 43659 gene locus_tag LOCUS_23780 42556 43659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence060 2381 1353 gene locus_tag LOCUS_23790 2381 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3040 2567 gene locus_tag LOCUS_23800 3040 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3631 3041 gene locus_tag LOCUS_23810 3631 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 4271 3744 gene locus_tag LOCUS_23820 gene gspG 4271 3744 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_23820 5561 4356 gene locus_tag LOCUS_23830 5561 4356 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_23830 7270 5573 gene locus_tag LOCUS_23840 7270 5573 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_23840 8736 7579 gene locus_tag LOCUS_23850 8736 7579 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_23850 10080 8749 gene locus_tag LOCUS_23860 10080 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 10361 14347 gene locus_tag LOCUS_23870 10361 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 14668 16128 gene locus_tag LOCUS_23880 14668 16128 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495579.1 protein_id gnl|my_center|LOCUS_23880 16136 16972 gene locus_tag LOCUS_23890 16136 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 17828 17046 gene locus_tag LOCUS_23900 17828 17046 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_23900 18803 17973 gene locus_tag LOCUS_23910 18803 17973 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_23910 19302 18838 gene locus_tag LOCUS_23920 19302 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 19976 19530 gene locus_tag LOCUS_23930 19976 19530 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870471.1 protein_id gnl|my_center|LOCUS_23930 21239 20058 gene locus_tag LOCUS_23940 21239 20058 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_23940 21681 22235 gene locus_tag LOCUS_23950 21681 22235 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_23950 22383 23096 gene locus_tag LOCUS_23960 22383 23096 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_23960 23093 24259 gene locus_tag LOCUS_23970 23093 24259 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 protein_id gnl|my_center|LOCUS_23970 24431 25420 gene locus_tag LOCUS_23980 24431 25420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 27621 25615 gene locus_tag LOCUS_23990 27621 25615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 30406 27878 gene locus_tag LOCUS_24000 30406 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 32067 30526 gene locus_tag LOCUS_24010 32067 30526 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665727.1 protein_id gnl|my_center|LOCUS_24010 33216 32104 gene locus_tag LOCUS_24020 33216 32104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 33534 34673 gene locus_tag LOCUS_24030 33534 34673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 34768 35874 gene locus_tag LOCUS_24040 34768 35874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 35884 38700 gene locus_tag LOCUS_24050 35884 38700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 39665 38766 gene locus_tag LOCUS_24060 39665 38766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 39880 39686 gene locus_tag LOCUS_24070 39880 39686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 39914 40807 gene locus_tag LOCUS_24080 39914 40807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_24080 41773 41057 gene locus_tag LOCUS_24090 41773 41057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 43394 42009 gene locus_tag LOCUS_24100 43394 42009 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence061 1244 789 gene locus_tag LOCUS_24110 gene aroH 1244 789 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_24110 2386 1331 gene locus_tag LOCUS_24120 2386 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2579 3376 gene locus_tag LOCUS_24130 gene map 2579 3376 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328287.1 protein_id gnl|my_center|LOCUS_24130 3469 4707 gene locus_tag LOCUS_24140 3469 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4907 5296 gene locus_tag LOCUS_24150 4907 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5333 7054 gene locus_tag LOCUS_24160 5333 7054 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_24160 8332 7178 gene locus_tag LOCUS_24170 8332 7178 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_24170 8656 8847 gene locus_tag LOCUS_24180 8656 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 8986 10311 gene locus_tag LOCUS_24190 8986 10311 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922235.1 protein_id gnl|my_center|LOCUS_24190 10463 12124 gene locus_tag LOCUS_24200 10463 12124 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122298.1 protein_id gnl|my_center|LOCUS_24200 12097 12187 gene locus_tag LOCUS_t00170 12097 12187 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12297 12983 gene locus_tag LOCUS_24210 12297 12983 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074040.1 protein_id gnl|my_center|LOCUS_24210 13098 14834 gene locus_tag LOCUS_24220 13098 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 16099 14924 gene locus_tag LOCUS_24230 16099 14924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 17052 16336 gene locus_tag LOCUS_24240 17052 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 17558 18466 gene locus_tag LOCUS_24250 17558 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 20127 18463 gene locus_tag LOCUS_24260 20127 18463 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_24260 20367 20531 gene locus_tag LOCUS_24270 20367 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 20584 22218 gene locus_tag LOCUS_24280 20584 22218 CDS product proteasome accessory factor PafA2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615993.1 protein_id gnl|my_center|LOCUS_24280 22659 22366 gene locus_tag LOCUS_24290 22659 22366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 22755 23141 gene locus_tag LOCUS_24300 22755 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 23380 24723 gene locus_tag LOCUS_24310 23380 24723 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_24310 27974 24720 gene locus_tag LOCUS_24320 27974 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 29715 28324 gene locus_tag LOCUS_24330 29715 28324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 32718 29893 gene locus_tag LOCUS_24340 32718 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 34102 32828 gene locus_tag LOCUS_24350 34102 32828 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_24350 34385 35830 gene locus_tag LOCUS_24360 34385 35830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 35866 37224 gene locus_tag LOCUS_24370 35866 37224 CDS product polysaccharide lyase 6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223691.1 protein_id gnl|my_center|LOCUS_24370 37257 38834 gene locus_tag LOCUS_24380 37257 38834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 39956 38859 gene locus_tag LOCUS_24390 39956 38859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 41412 40132 gene locus_tag LOCUS_24400 41412 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084388.1 protein_id gnl|my_center|LOCUS_24400 41773 42207 gene locus_tag LOCUS_24410 41773 42207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence062 4207 866 gene locus_tag LOCUS_24420 4207 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 4926 4315 gene locus_tag LOCUS_24430 4926 4315 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 protein_id gnl|my_center|LOCUS_24430 5417 6121 gene locus_tag LOCUS_24440 5417 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 6161 6862 gene locus_tag LOCUS_24450 6161 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 7326 7784 gene locus_tag LOCUS_24460 7326 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 8030 8449 gene locus_tag LOCUS_24470 8030 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 8658 10166 gene locus_tag LOCUS_24480 8658 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 10559 11257 gene locus_tag LOCUS_24490 10559 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 11311 11625 gene locus_tag LOCUS_24500 11311 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11723 12334 gene locus_tag LOCUS_24510 11723 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 12748 13047 gene locus_tag LOCUS_24520 12748 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 13066 13293 gene locus_tag LOCUS_24530 13066 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 14365 14778 gene locus_tag LOCUS_24540 14365 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 14950 15897 gene locus_tag LOCUS_24550 14950 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 15986 16651 gene locus_tag LOCUS_24560 15986 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 16813 17199 gene locus_tag LOCUS_24570 16813 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 18382 18600 gene locus_tag LOCUS_24580 18382 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 19517 18846 gene locus_tag LOCUS_24590 19517 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 19730 19954 gene locus_tag LOCUS_24600 19730 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 22142 19992 gene locus_tag LOCUS_24610 22142 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 26697 22522 gene locus_tag LOCUS_24620 26697 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 27092 29257 gene locus_tag LOCUS_24630 27092 29257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 29433 30386 gene locus_tag LOCUS_24640 29433 30386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 30383 33772 gene locus_tag LOCUS_24650 30383 33772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 33926 35824 gene locus_tag LOCUS_24660 gene ast 33926 35824 CDS product thermostable cytotonic enterotoxin Ast inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704753.1 protein_id gnl|my_center|LOCUS_24660 36318 35851 gene locus_tag LOCUS_24670 36318 35851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 36513 37127 gene locus_tag LOCUS_24680 36513 37127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 38249 37152 gene locus_tag LOCUS_24690 38249 37152 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_24690 39231 38260 gene locus_tag LOCUS_24700 39231 38260 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_24700 39726 39490 gene locus_tag LOCUS_24710 39726 39490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 40955 39615 gene locus_tag LOCUS_24720 40955 39615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence063 1573 209 gene locus_tag LOCUS_24730 1573 209 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_24730 3351 2011 gene locus_tag LOCUS_24740 gene der 3351 2011 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_24740 4703 3348 gene locus_tag LOCUS_24750 4703 3348 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816850.1 protein_id gnl|my_center|LOCUS_24750 6933 5149 gene locus_tag LOCUS_24760 6933 5149 CDS product IRE (iron responsive element) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922846.1 protein_id gnl|my_center|LOCUS_24760 8780 6930 gene locus_tag LOCUS_24770 8780 6930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_24770 9723 8785 gene locus_tag LOCUS_24780 9723 8785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_24780 11870 10155 gene locus_tag LOCUS_24790 11870 10155 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325471.1 protein_id gnl|my_center|LOCUS_24790 12787 13097 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctacacggtctgcaagcccgtct 13822 14016 gene locus_tag LOCUS_24800 13822 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 14362 16197 gene locus_tag LOCUS_24810 14362 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 16230 17666 gene locus_tag LOCUS_24820 16230 17666 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_24820 18460 18044 gene locus_tag LOCUS_24830 gene rnk 18460 18044 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_24830 18526 18828 gene locus_tag LOCUS_24840 18526 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 20614 19226 gene locus_tag LOCUS_24850 20614 19226 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922760.1 protein_id gnl|my_center|LOCUS_24850 21839 20607 gene locus_tag LOCUS_24860 21839 20607 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119450.1 protein_id gnl|my_center|LOCUS_24860 22297 21881 gene locus_tag LOCUS_24870 gene rnk 22297 21881 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_24870 22819 22559 gene locus_tag LOCUS_24880 22819 22559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 23014 24273 gene locus_tag LOCUS_24890 23014 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 27068 24504 gene locus_tag LOCUS_24900 27068 24504 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_24900 27676 28065 gene locus_tag LOCUS_24910 27676 28065 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871759.1 protein_id gnl|my_center|LOCUS_24910 28122 28304 gene locus_tag LOCUS_24920 28122 28304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 28511 30133 gene locus_tag LOCUS_24930 28511 30133 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_24930 30156 31388 gene locus_tag LOCUS_24940 30156 31388 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_24940 31497 33008 gene locus_tag LOCUS_24950 31497 33008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 32986 34419 gene locus_tag LOCUS_24960 32986 34419 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_24960 34639 35082 gene locus_tag LOCUS_24970 34639 35082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 35197 35691 gene locus_tag LOCUS_24980 35197 35691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 35762 36217 gene locus_tag LOCUS_24990 35762 36217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 36277 36831 gene locus_tag LOCUS_25000 36277 36831 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402050.1 protein_id gnl|my_center|LOCUS_25000 36838 37992 gene locus_tag LOCUS_25010 36838 37992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 38109 39002 gene locus_tag LOCUS_25020 38109 39002 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664024.1 protein_id gnl|my_center|LOCUS_25020 39054 39845 gene locus_tag LOCUS_25030 39054 39845 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_25030 39978 40166 gene locus_tag LOCUS_25040 39978 40166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 41238 41630 gene locus_tag LOCUS_25050 41238 41630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 41728 43155 gene locus_tag LOCUS_25060 41728 43155 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112884.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence064 763 296 gene locus_tag LOCUS_25070 763 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 1944 829 gene locus_tag LOCUS_25080 1944 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2481 4358 gene locus_tag LOCUS_25090 2481 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 4922 7264 gene locus_tag LOCUS_25100 4922 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 7563 8642 gene locus_tag LOCUS_25110 7563 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 9068 10753 gene locus_tag LOCUS_25120 9068 10753 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_25120 10889 12670 gene locus_tag LOCUS_25130 10889 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 12996 14315 gene locus_tag LOCUS_25140 12996 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 14366 16294 gene locus_tag LOCUS_25150 14366 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 16372 17850 gene locus_tag LOCUS_25160 16372 17850 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_25160 18226 19479 gene locus_tag LOCUS_25170 gene chrA 18226 19479 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_25170 19758 20165 gene locus_tag LOCUS_25180 19758 20165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 21942 20272 gene locus_tag LOCUS_25190 21942 20272 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_25190 24697 22583 gene locus_tag LOCUS_25200 24697 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 25415 24957 gene locus_tag LOCUS_25210 gene tadA 25415 24957 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_25210 25685 26119 gene locus_tag LOCUS_25220 25685 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 26944 26183 gene locus_tag LOCUS_25230 26944 26183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_25230 27311 28870 gene locus_tag LOCUS_25240 27311 28870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 30431 28911 gene locus_tag LOCUS_25250 30431 28911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 30759 30574 gene locus_tag LOCUS_25260 30759 30574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 32263 31058 gene locus_tag LOCUS_25270 32263 31058 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_25270 32528 32268 gene locus_tag LOCUS_25280 32528 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_25280 34601 32823 gene locus_tag LOCUS_25290 34601 32823 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_25290 34815 35639 gene locus_tag LOCUS_25300 34815 35639 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921566.1 protein_id gnl|my_center|LOCUS_25300 35850 36416 gene locus_tag LOCUS_25310 35850 36416 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_25310 38828 36531 gene locus_tag LOCUS_25320 38828 36531 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249708.1 protein_id gnl|my_center|LOCUS_25320 38944 39183 gene locus_tag LOCUS_25330 38944 39183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 41273 39180 gene locus_tag LOCUS_25340 gene fusA 41273 39180 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_25340 41924 41307 gene locus_tag LOCUS_25350 gene hisA 41924 41307 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_25350 42081 42299 gene locus_tag LOCUS_25360 42081 42299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence065 319 2112 gene locus_tag LOCUS_25370 319 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3699 5378 gene locus_tag LOCUS_25380 3699 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 12592 5540 gene locus_tag LOCUS_25390 12592 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 12785 14149 gene locus_tag LOCUS_25400 12785 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 14344 14520 gene locus_tag LOCUS_25410 14344 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 15421 16146 gene locus_tag LOCUS_25420 15421 16146 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_25420 16206 16343 gene locus_tag LOCUS_25430 16206 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 16395 17246 gene locus_tag LOCUS_25440 16395 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 17683 17865 gene locus_tag LOCUS_25450 17683 17865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 18008 18460 gene locus_tag LOCUS_25460 18008 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 18485 21694 gene locus_tag LOCUS_25470 18485 21694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 21730 23052 gene locus_tag LOCUS_25480 21730 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 24114 23152 gene locus_tag LOCUS_25490 24114 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 24328 24843 gene locus_tag LOCUS_25500 24328 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 24840 25172 gene locus_tag LOCUS_25510 24840 25172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 25325 28378 gene locus_tag LOCUS_25520 25325 28378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 29367 28693 gene locus_tag LOCUS_25530 29367 28693 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_25530 30446 29520 gene locus_tag LOCUS_25540 30446 29520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 32126 30837 gene locus_tag LOCUS_25550 32126 30837 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921329.1 protein_id gnl|my_center|LOCUS_25550 32380 32571 gene locus_tag LOCUS_25560 32380 32571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 32978 33457 gene locus_tag LOCUS_25570 32978 33457 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426725.1 protein_id gnl|my_center|LOCUS_25570 33864 34823 gene locus_tag LOCUS_25580 33864 34823 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922574.1 protein_id gnl|my_center|LOCUS_25580 36672 34996 gene locus_tag LOCUS_25590 36672 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 37303 37049 gene locus_tag LOCUS_25600 37303 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 37317 38264 gene locus_tag LOCUS_25610 37317 38264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 38598 38756 gene locus_tag LOCUS_25620 38598 38756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 40136 38916 gene locus_tag LOCUS_25630 40136 38916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 40956 40180 gene locus_tag LOCUS_25640 40956 40180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 41982 42188 gene locus_tag LOCUS_25650 41982 42188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence066 1102 719 gene locus_tag LOCUS_25660 1102 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1057 3642 gene locus_tag LOCUS_25670 1057 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 4971 3631 gene locus_tag LOCUS_25680 4971 3631 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_25680 8371 5045 gene locus_tag LOCUS_25690 8371 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 8549 9664 gene locus_tag LOCUS_25700 8549 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 9618 9788 gene locus_tag LOCUS_25710 9618 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 10452 10093 gene locus_tag LOCUS_25720 10452 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 12226 10550 gene locus_tag LOCUS_25730 12226 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 12805 12242 gene locus_tag LOCUS_25740 gene sbrI 12805 12242 CDS product ECF family RNA polymerase sigma factor SbrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_25740 15566 13908 gene locus_tag LOCUS_25750 15566 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 15964 15563 gene locus_tag LOCUS_25760 15964 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 17063 16794 gene locus_tag LOCUS_25770 17063 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921518.1 protein_id gnl|my_center|LOCUS_25770 18783 17191 gene locus_tag LOCUS_25780 18783 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 21239 19038 gene locus_tag LOCUS_25790 21239 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 21941 21351 gene locus_tag LOCUS_25800 21941 21351 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_25800 22158 23165 gene locus_tag LOCUS_25810 22158 23165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 23338 24816 gene locus_tag LOCUS_25820 23338 24816 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_25820 25198 25052 gene locus_tag LOCUS_25830 25198 25052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 25459 26508 gene locus_tag LOCUS_25840 25459 26508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 42522 26623 gene locus_tag LOCUS_25850 42522 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence067 245 1222 gene locus_tag LOCUS_25860 245 1222 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_25860 1331 2029 gene locus_tag LOCUS_25870 1331 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2107 2361 gene locus_tag LOCUS_25880 2107 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2748 3023 gene locus_tag LOCUS_25890 2748 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3498 4505 gene locus_tag LOCUS_25900 3498 4505 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 protein_id gnl|my_center|LOCUS_25900 4877 6805 gene locus_tag LOCUS_25910 gene dnaK 4877 6805 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_25910 6825 7046 gene locus_tag LOCUS_25920 6825 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 7303 8412 gene locus_tag LOCUS_25930 7303 8412 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_25930 8405 9904 gene locus_tag LOCUS_25940 gene cls 8405 9904 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034050559.1 protein_id gnl|my_center|LOCUS_25940 10385 10005 gene locus_tag LOCUS_25950 10385 10005 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246482.1 protein_id gnl|my_center|LOCUS_25950 10849 12078 gene locus_tag LOCUS_25960 10849 12078 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_25960 12098 13237 gene locus_tag LOCUS_25970 12098 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25970 13275 14279 gene locus_tag LOCUS_25980 13275 14279 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_25980 14377 14760 gene locus_tag LOCUS_25990 14377 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 14765 14938 gene locus_tag LOCUS_26000 14765 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 14966 15343 gene locus_tag LOCUS_26010 14966 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 15343 15552 gene locus_tag LOCUS_26020 15343 15552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 16060 16527 gene locus_tag LOCUS_26030 16060 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 16576 18189 gene locus_tag LOCUS_26040 gene groL 16576 18189 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_26040 18235 18642 gene locus_tag LOCUS_26050 18235 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921589.1 protein_id gnl|my_center|LOCUS_26050 18647 18946 gene locus_tag LOCUS_26060 18647 18946 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_26060 19012 19272 gene locus_tag LOCUS_26070 19012 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 19284 20858 gene locus_tag LOCUS_26080 19284 20858 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941361.1 protein_id gnl|my_center|LOCUS_26080 21600 21382 gene locus_tag LOCUS_26090 21600 21382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 21988 22209 gene locus_tag LOCUS_26100 21988 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 23007 22798 gene locus_tag LOCUS_26110 23007 22798 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_26110 24819 23620 gene locus_tag LOCUS_26120 24819 23620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 25048 26448 gene locus_tag LOCUS_26130 25048 26448 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_26130 26499 30275 gene locus_tag LOCUS_26140 26499 30275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 30272 31393 gene locus_tag LOCUS_26150 30272 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 31848 35420 gene locus_tag LOCUS_26160 31848 35420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 38265 35563 gene locus_tag LOCUS_26170 38265 35563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 38588 38962 gene locus_tag LOCUS_26180 38588 38962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 39174 39851 gene locus_tag LOCUS_26190 39174 39851 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_26190 40071 41744 gene locus_tag LOCUS_26200 40071 41744 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435129.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence068 1971 1339 gene locus_tag LOCUS_26210 1971 1339 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_26210 2650 2144 gene locus_tag LOCUS_26220 2650 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3999 2647 gene locus_tag LOCUS_26230 3999 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5005 4256 gene locus_tag LOCUS_26240 5005 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 5689 5117 gene locus_tag LOCUS_26250 5689 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 6734 5994 gene locus_tag LOCUS_26260 6734 5994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_26260 7664 6744 gene locus_tag LOCUS_26270 7664 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 9025 7697 gene locus_tag LOCUS_26280 9025 7697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_26280 11078 9231 gene locus_tag LOCUS_26290 11078 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 11964 12608 gene locus_tag LOCUS_26300 11964 12608 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_26300 12720 15608 gene locus_tag LOCUS_26310 12720 15608 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922396.1 protein_id gnl|my_center|LOCUS_26310 18212 15585 gene locus_tag LOCUS_26320 18212 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 18222 18419 gene locus_tag LOCUS_26330 18222 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 18379 18639 gene locus_tag LOCUS_26340 18379 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 18719 19372 gene locus_tag LOCUS_26350 18719 19372 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378484.1 protein_id gnl|my_center|LOCUS_26350 19488 22439 gene locus_tag LOCUS_26360 19488 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 24055 22436 gene locus_tag LOCUS_26370 24055 22436 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_26370 26130 24370 gene locus_tag LOCUS_26380 26130 24370 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_26380 26473 27990 gene locus_tag LOCUS_26390 26473 27990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 28151 29653 gene locus_tag LOCUS_26400 28151 29653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 29706 31232 gene locus_tag LOCUS_26410 29706 31232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 31258 32799 gene locus_tag LOCUS_26420 31258 32799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 32847 34364 gene locus_tag LOCUS_26430 32847 34364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 34422 35921 gene locus_tag LOCUS_26440 34422 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 35978 37480 gene locus_tag LOCUS_26450 35978 37480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 37477 38808 gene locus_tag LOCUS_26460 37477 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 39262 40935 gene locus_tag LOCUS_26470 39262 40935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence069 <1 3535 gene locus_tag LOCUS_26480 <1 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:TlpA disulfide reductase family protein 4564 5331 gene locus_tag LOCUS_26490 4564 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 5367 5786 gene locus_tag LOCUS_26500 5367 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 7399 5918 gene locus_tag LOCUS_26510 7399 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 7593 7405 gene locus_tag LOCUS_26520 7593 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 7833 8858 gene locus_tag LOCUS_26530 7833 8858 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_26530 8906 9688 gene locus_tag LOCUS_26540 8906 9688 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886798.1 protein_id gnl|my_center|LOCUS_26540 10800 9655 gene locus_tag LOCUS_26550 10800 9655 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_26550 11199 12545 gene locus_tag LOCUS_26560 gene bioF 11199 12545 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_26560 12567 14885 gene locus_tag LOCUS_26570 12567 14885 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_26570 15942 14839 gene locus_tag LOCUS_26580 15942 14839 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_26580 20842 16202 gene locus_tag LOCUS_26590 20842 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 22075 21002 gene locus_tag LOCUS_26600 22075 21002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 22319 23956 gene locus_tag LOCUS_26610 22319 23956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 23982 28052 gene locus_tag LOCUS_26620 23982 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 30050 28203 gene locus_tag LOCUS_26630 30050 28203 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_26630 31746 30214 gene locus_tag LOCUS_26640 31746 30214 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970032.1 protein_id gnl|my_center|LOCUS_26640 32451 31753 gene locus_tag LOCUS_26650 gene deoC 32451 31753 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970031.1 protein_id gnl|my_center|LOCUS_26650 33551 32610 gene locus_tag LOCUS_26660 33551 32610 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_26660 34442 33714 gene locus_tag LOCUS_26670 34442 33714 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_26670 35865 34579 gene locus_tag LOCUS_26680 35865 34579 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_26680 39465 36076 gene locus_tag LOCUS_26690 39465 36076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 39930 41426 gene locus_tag LOCUS_26700 gene pap 39930 41426 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_26700 42072 41518 gene locus_tag LOCUS_26710 42072 41518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence070 <1 2136 gene locus_tag LOCUS_26720 <1 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026825.1:glycoside hydrolase family 38 C-terminal domain-containing protein 3491 2355 gene locus_tag LOCUS_26730 3491 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 4250 3519 gene locus_tag LOCUS_26740 4250 3519 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_26740 7798 4298 gene locus_tag LOCUS_26750 7798 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 9216 7795 gene locus_tag LOCUS_26760 9216 7795 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_26760 9606 13907 gene locus_tag LOCUS_26770 9606 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 17280 14035 gene locus_tag LOCUS_26780 17280 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 18928 17564 gene locus_tag LOCUS_26790 18928 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 19257 19490 gene locus_tag LOCUS_26800 19257 19490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 19822 19484 gene locus_tag LOCUS_26810 19822 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 22886 20736 gene locus_tag LOCUS_26820 22886 20736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 24931 23537 gene locus_tag LOCUS_26830 24931 23537 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_26830 25281 26087 gene locus_tag LOCUS_26840 25281 26087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 26162 27493 gene locus_tag LOCUS_26850 26162 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 29042 27576 gene locus_tag LOCUS_26860 29042 27576 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663784.1 protein_id gnl|my_center|LOCUS_26860 33060 29284 gene locus_tag LOCUS_26870 33060 29284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 34094 33096 gene locus_tag LOCUS_26880 34094 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 35061 34150 gene locus_tag LOCUS_26890 35061 34150 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943779.1 protein_id gnl|my_center|LOCUS_26890 35166 36476 gene locus_tag LOCUS_26900 35166 36476 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_26900 36673 38055 gene locus_tag LOCUS_26910 36673 38055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 38097 40256 gene locus_tag LOCUS_26920 38097 40256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 40467 40661 gene locus_tag LOCUS_26930 40467 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence071 4479 3577 gene locus_tag LOCUS_26940 4479 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 4864 4562 gene locus_tag LOCUS_26950 4864 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 5224 4952 gene locus_tag LOCUS_26960 5224 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 5219 5824 gene locus_tag LOCUS_26970 5219 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 7392 6112 gene locus_tag LOCUS_26980 7392 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 7576 11121 gene locus_tag LOCUS_26990 7576 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 11331 13451 gene locus_tag LOCUS_27000 11331 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 13458 13670 gene locus_tag LOCUS_27010 13458 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 13700 14710 gene locus_tag LOCUS_27020 13700 14710 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922157.1 protein_id gnl|my_center|LOCUS_27020 14707 16806 gene locus_tag LOCUS_27030 14707 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 18147 16981 gene locus_tag LOCUS_27040 18147 16981 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_27040 18395 18817 gene locus_tag LOCUS_27050 18395 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 20728 18842 gene locus_tag LOCUS_27060 20728 18842 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_27060 21833 20799 gene locus_tag LOCUS_27070 gene xylA 21833 20799 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_27070 22951 21986 gene locus_tag LOCUS_27080 22951 21986 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_27080 23076 24563 gene locus_tag LOCUS_27090 23076 24563 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_27090 25899 24574 gene locus_tag LOCUS_27100 25899 24574 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_27100 27487 26108 gene locus_tag LOCUS_27110 27487 26108 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_27110 27588 27875 gene locus_tag LOCUS_27120 27588 27875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 32241 27844 gene locus_tag LOCUS_27130 32241 27844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 35422 32303 gene locus_tag LOCUS_27140 35422 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 39487 35474 gene locus_tag LOCUS_27150 39487 35474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 40522 39683 gene locus_tag LOCUS_27160 40522 39683 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922660.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence072 195 353 gene locus_tag LOCUS_27170 195 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 480 1337 gene locus_tag LOCUS_27180 480 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1504 1899 gene locus_tag LOCUS_27190 1504 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1938 3764 gene locus_tag LOCUS_27200 1938 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3761 6889 gene locus_tag LOCUS_27210 3761 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 7265 10021 gene locus_tag LOCUS_27220 7265 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 10018 10473 gene locus_tag LOCUS_27230 10018 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 10523 11890 gene locus_tag LOCUS_27240 10523 11890 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_27240 12000 13082 gene locus_tag LOCUS_27250 12000 13082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 13307 15223 gene locus_tag LOCUS_27260 13307 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 15269 17578 gene locus_tag LOCUS_27270 15269 17578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 17626 18975 gene locus_tag LOCUS_27280 17626 18975 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_27280 19064 20209 gene locus_tag LOCUS_27290 19064 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 20251 22467 gene locus_tag LOCUS_27300 20251 22467 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_27300 22735 23607 gene locus_tag LOCUS_27310 22735 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 23703 26948 gene locus_tag LOCUS_27320 23703 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 26945 28081 gene locus_tag LOCUS_27330 26945 28081 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_27330 28102 29190 gene locus_tag LOCUS_27340 28102 29190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 29314 30369 gene locus_tag LOCUS_27350 29314 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 30381 30857 gene locus_tag LOCUS_27360 30381 30857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 31525 30887 gene locus_tag LOCUS_27370 31525 30887 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_27370 34494 31588 gene locus_tag LOCUS_27380 34494 31588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 34522 34719 gene locus_tag LOCUS_27390 34522 34719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 37766 34974 gene locus_tag LOCUS_27400 37766 34974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 37905 38096 gene locus_tag LOCUS_27410 37905 38096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 38731 38201 gene locus_tag LOCUS_27420 38731 38201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 40101 38872 gene locus_tag LOCUS_27430 40101 38872 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_27430 40364 40098 gene locus_tag LOCUS_27440 40364 40098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 <41273 40668 gene locus_tag LOCUS_27450 <41273 40668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943575.1:double-cubane-cluster-containing anaerobic reductase >Feature sequence073 3699 1318 gene locus_tag LOCUS_27460 3699 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 4967 3966 gene locus_tag LOCUS_27470 4967 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 6506 4977 gene locus_tag LOCUS_27480 6506 4977 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442613.1 protein_id gnl|my_center|LOCUS_27480 7825 6554 gene locus_tag LOCUS_27490 7825 6554 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922154.1 protein_id gnl|my_center|LOCUS_27490 11116 7898 gene locus_tag LOCUS_27500 11116 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 13396 11126 gene locus_tag LOCUS_27510 13396 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 14878 13568 gene locus_tag LOCUS_27520 14878 13568 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_27520 15175 15402 gene locus_tag LOCUS_27530 15175 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 16689 15589 gene locus_tag LOCUS_27540 16689 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 18152 17160 gene locus_tag LOCUS_27550 18152 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 19937 18360 gene locus_tag LOCUS_27560 19937 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 20572 19934 gene locus_tag LOCUS_27570 20572 19934 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615971.1 protein_id gnl|my_center|LOCUS_27570 21146 24169 gene locus_tag LOCUS_27580 21146 24169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 24715 24446 gene locus_tag LOCUS_27590 24715 24446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 26021 24729 gene locus_tag LOCUS_27600 26021 24729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_27600 27928 26159 gene locus_tag LOCUS_27610 27928 26159 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922030.1 protein_id gnl|my_center|LOCUS_27610 29415 28096 gene locus_tag LOCUS_27620 29415 28096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_27620 31332 29521 gene locus_tag LOCUS_27630 31332 29521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 32871 31345 gene locus_tag LOCUS_27640 32871 31345 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_27640 34329 32884 gene locus_tag LOCUS_27650 34329 32884 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_27650 37294 34628 gene locus_tag LOCUS_27660 37294 34628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922069.1 protein_id gnl|my_center|LOCUS_27660 37574 39001 gene locus_tag LOCUS_27670 37574 39001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 40938 39127 gene locus_tag LOCUS_27680 40938 39127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence074 168 875 gene locus_tag LOCUS_27690 168 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1744 872 gene locus_tag LOCUS_27700 1744 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 6129 2107 gene locus_tag LOCUS_27710 6129 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 6229 6041 gene locus_tag LOCUS_27720 6229 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 7023 7610 gene locus_tag LOCUS_27730 7023 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 8398 7844 gene locus_tag LOCUS_27740 8398 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 8828 10174 gene locus_tag LOCUS_27750 gene thiC 8828 10174 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326663.1 protein_id gnl|my_center|LOCUS_27750 10413 11699 gene locus_tag LOCUS_27760 10413 11699 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122540.1 protein_id gnl|my_center|LOCUS_27760 11696 11872 gene locus_tag LOCUS_27770 11696 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 11902 12510 gene locus_tag LOCUS_27780 11902 12510 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_27780 12524 13309 gene locus_tag LOCUS_27790 12524 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 13890 13420 gene locus_tag LOCUS_27800 13890 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 14291 14575 gene locus_tag LOCUS_27810 14291 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 24260 14742 gene locus_tag LOCUS_27820 24260 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 24711 25343 gene locus_tag LOCUS_27830 24711 25343 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921328.1 protein_id gnl|my_center|LOCUS_27830 25340 28018 gene locus_tag LOCUS_27840 25340 28018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 28107 29159 gene locus_tag LOCUS_27850 28107 29159 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_27850 29245 29994 gene locus_tag LOCUS_27860 29245 29994 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121179.1 protein_id gnl|my_center|LOCUS_27860 30590 30006 gene locus_tag LOCUS_27870 30590 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 30854 32929 gene locus_tag LOCUS_27880 30854 32929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 33848 33237 gene locus_tag LOCUS_27890 33848 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 35150 33930 gene locus_tag LOCUS_27900 35150 33930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 38016 35401 gene locus_tag LOCUS_27910 38016 35401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 38756 38220 gene locus_tag LOCUS_27920 38756 38220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 38959 40296 gene locus_tag LOCUS_27930 38959 40296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence075 610 251 gene locus_tag LOCUS_27940 610 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 1516 647 gene locus_tag LOCUS_27950 1516 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27950 1777 1577 gene locus_tag LOCUS_27960 1777 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27960 2736 1939 gene locus_tag LOCUS_27970 2736 1939 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_27970 3313 4776 gene locus_tag LOCUS_27980 gene gguA 3313 4776 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_27980 4987 6336 gene locus_tag LOCUS_27990 4987 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 6516 7463 gene locus_tag LOCUS_28000 6516 7463 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975799.1 protein_id gnl|my_center|LOCUS_28000 10167 7720 gene locus_tag LOCUS_28010 10167 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 10675 11298 gene locus_tag LOCUS_28020 gene fixJ 10675 11298 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_28020 11947 13167 gene locus_tag LOCUS_28030 11947 13167 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022331.1 protein_id gnl|my_center|LOCUS_28030 13284 14405 gene locus_tag LOCUS_28040 13284 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 14670 14425 gene locus_tag LOCUS_28050 14670 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 14876 14691 gene locus_tag LOCUS_28060 14876 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 14990 15742 gene locus_tag LOCUS_28070 14990 15742 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_28070 19194 15847 gene locus_tag LOCUS_28080 19194 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 19873 19235 gene locus_tag LOCUS_28090 19873 19235 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921328.1 protein_id gnl|my_center|LOCUS_28090 20739 21377 gene locus_tag LOCUS_28100 20739 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 21379 21624 gene locus_tag LOCUS_28110 21379 21624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 21608 21994 gene locus_tag LOCUS_28120 21608 21994 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_28120 22134 23408 gene locus_tag LOCUS_28130 22134 23408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 26842 23420 gene locus_tag LOCUS_28140 26842 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 28185 26839 gene locus_tag LOCUS_28150 28185 26839 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922322.1 protein_id gnl|my_center|LOCUS_28150 28429 29517 gene locus_tag LOCUS_28160 28429 29517 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_28160 29720 29881 gene locus_tag LOCUS_28170 29720 29881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 30002 31003 gene locus_tag LOCUS_28180 gene dhaK 30002 31003 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494451.1 protein_id gnl|my_center|LOCUS_28180 31068 31703 gene locus_tag LOCUS_28190 gene dhaL 31068 31703 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_28190 31900 32787 gene locus_tag LOCUS_28200 gene lsrF 31900 32787 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774169.1 protein_id gnl|my_center|LOCUS_28200 33363 32923 gene locus_tag LOCUS_28210 33363 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 34334 33360 gene locus_tag LOCUS_28220 34334 33360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 34787 35689 gene locus_tag LOCUS_28230 34787 35689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 37285 35711 gene locus_tag LOCUS_28240 37285 35711 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427734.1 protein_id gnl|my_center|LOCUS_28240 38630 37290 gene locus_tag LOCUS_28250 gene trkA 38630 37290 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_28250 40640 38643 gene locus_tag LOCUS_28260 40640 38643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence076 2639 1815 gene locus_tag LOCUS_28270 2639 1815 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_28270 3896 2652 gene locus_tag LOCUS_28280 3896 2652 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_28280 4305 5429 gene locus_tag LOCUS_28290 4305 5429 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815495.1 protein_id gnl|my_center|LOCUS_28290 5709 6065 gene locus_tag LOCUS_28300 5709 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 6217 7548 gene locus_tag LOCUS_28310 6217 7548 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_28310 9020 7701 gene locus_tag LOCUS_28320 9020 7701 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_28320 9359 10123 gene locus_tag LOCUS_28330 9359 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 10788 10180 gene locus_tag LOCUS_28340 10788 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 11176 10814 gene locus_tag LOCUS_28350 11176 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 11604 13262 gene locus_tag LOCUS_28360 11604 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 13291 14067 gene locus_tag LOCUS_28370 13291 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 14444 14947 gene locus_tag LOCUS_28380 14444 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 16842 14944 gene locus_tag LOCUS_28390 16842 14944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 16946 18409 gene locus_tag LOCUS_28400 16946 18409 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_28400 18406 19689 gene locus_tag LOCUS_28410 18406 19689 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615469.1 protein_id gnl|my_center|LOCUS_28410 20396 21295 gene locus_tag LOCUS_28420 20396 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 21401 22525 gene locus_tag LOCUS_28430 21401 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326644.1 protein_id gnl|my_center|LOCUS_28430 22752 24038 gene locus_tag LOCUS_28440 22752 24038 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_28440 24283 24077 gene locus_tag LOCUS_28450 24283 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 25706 24306 gene locus_tag LOCUS_28460 25706 24306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_28460 27182 25860 gene locus_tag LOCUS_28470 27182 25860 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_28470 27461 28195 gene locus_tag LOCUS_28480 27461 28195 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_28480 28670 29677 gene locus_tag LOCUS_28490 28670 29677 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_28490 34548 29812 gene locus_tag LOCUS_28500 34548 29812 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922115.1 protein_id gnl|my_center|LOCUS_28500 35580 34744 gene locus_tag LOCUS_28510 35580 34744 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_28510 36611 35577 gene locus_tag LOCUS_28520 36611 35577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_28520 38200 36749 gene locus_tag LOCUS_28530 gene rimO 38200 36749 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_28530 39116 38286 gene locus_tag LOCUS_28540 39116 38286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 39951 39235 gene locus_tag LOCUS_28550 39951 39235 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence077 3567 3860 gene locus_tag LOCUS_28560 3567 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4032 7646 gene locus_tag LOCUS_28570 gene nifJ 4032 7646 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_28570 7643 8650 gene locus_tag LOCUS_28580 7643 8650 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_28580 8753 10039 gene locus_tag LOCUS_28590 gene lysA 8753 10039 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209846.1 protein_id gnl|my_center|LOCUS_28590 11677 10463 gene locus_tag LOCUS_28600 11677 10463 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813557.1 protein_id gnl|my_center|LOCUS_28600 12121 12963 gene locus_tag LOCUS_28610 12121 12963 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_28610 13147 13809 gene locus_tag LOCUS_28620 13147 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 13887 15395 gene locus_tag LOCUS_28630 gene trpE 13887 15395 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_28630 16600 15665 gene locus_tag LOCUS_28640 16600 15665 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_28640 17779 16721 gene locus_tag LOCUS_28650 17779 16721 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_28650 20315 17946 gene locus_tag LOCUS_28660 20315 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 20668 21192 gene locus_tag LOCUS_28670 20668 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 21868 21194 gene locus_tag LOCUS_28680 gene phoU 21868 21194 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880553.1 protein_id gnl|my_center|LOCUS_28680 22673 21873 gene locus_tag LOCUS_28690 gene pstB 22673 21873 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_28690 23425 22673 gene locus_tag LOCUS_28700 gene pstB 23425 22673 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_28700 24419 23433 gene locus_tag LOCUS_28710 gene pstA 24419 23433 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538554.1 protein_id gnl|my_center|LOCUS_28710 25365 24412 gene locus_tag LOCUS_28720 gene pstC 25365 24412 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_28720 26239 25358 gene locus_tag LOCUS_28730 26239 25358 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_28730 26678 28201 gene locus_tag LOCUS_28740 26678 28201 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_28740 28217 30334 gene locus_tag LOCUS_28750 gene ppk1 28217 30334 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 protein_id gnl|my_center|LOCUS_28750 30341 31255 gene locus_tag LOCUS_28760 30341 31255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 31273 31527 gene locus_tag LOCUS_28770 31273 31527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 34707 31609 gene locus_tag LOCUS_28780 34707 31609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 35732 34896 gene locus_tag LOCUS_28790 35732 34896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 36166 35900 gene locus_tag LOCUS_28800 36166 35900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 36404 36661 gene locus_tag LOCUS_28810 36404 36661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 36673 36933 gene locus_tag LOCUS_28820 36673 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 38664 37234 gene locus_tag LOCUS_28830 38664 37234 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_28830 38814 39002 gene locus_tag LOCUS_28840 38814 39002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence078 436 113 gene locus_tag LOCUS_28850 436 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1231 1449 gene locus_tag LOCUS_28860 1231 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1461 2540 gene locus_tag LOCUS_28870 1461 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2437 3861 gene locus_tag LOCUS_28880 2437 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3845 4612 gene locus_tag LOCUS_28890 gene istB 3845 4612 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_28890 4670 5674 gene locus_tag LOCUS_28900 4670 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5757 6203 gene locus_tag LOCUS_28910 5757 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6798 6250 gene locus_tag LOCUS_28920 6798 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 8099 7083 gene locus_tag LOCUS_28930 8099 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 8714 8208 gene locus_tag LOCUS_28940 8714 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 9109 10335 gene locus_tag LOCUS_28950 9109 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 10418 11545 gene locus_tag LOCUS_28960 10418 11545 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 protein_id gnl|my_center|LOCUS_28960 14561 11655 gene locus_tag LOCUS_28970 14561 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 16453 14579 gene locus_tag LOCUS_28980 16453 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 16888 18636 gene locus_tag LOCUS_28990 16888 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 18774 18571 gene locus_tag LOCUS_29000 18774 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 19081 18764 gene locus_tag LOCUS_29010 19081 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 20190 19078 gene locus_tag LOCUS_29020 20190 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 20464 21816 gene locus_tag LOCUS_29030 20464 21816 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_29030 23298 22078 gene locus_tag LOCUS_29040 23298 22078 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_29040 25403 23295 gene locus_tag LOCUS_29050 gene pta 25403 23295 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_29050 25613 26878 gene locus_tag LOCUS_29060 25613 26878 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_29060 26923 27885 gene locus_tag LOCUS_29070 26923 27885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 29230 27878 gene locus_tag LOCUS_29080 29230 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 29552 32680 gene locus_tag LOCUS_29090 29552 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 32706 35066 gene locus_tag LOCUS_29100 32706 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 36226 35087 gene locus_tag LOCUS_29110 36226 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 37524 36349 gene locus_tag LOCUS_29120 37524 36349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 39928 37835 gene locus_tag LOCUS_29130 39928 37835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence079 2670 3317 gene locus_tag LOCUS_29140 gene nth 2670 3317 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387915.1 protein_id gnl|my_center|LOCUS_29140 3320 4396 gene locus_tag LOCUS_29150 3320 4396 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414172.1 protein_id gnl|my_center|LOCUS_29150 4532 6379 gene locus_tag LOCUS_29160 4532 6379 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_29160 7042 6416 gene locus_tag LOCUS_29170 7042 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 11883 7564 gene locus_tag LOCUS_29180 11883 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 13105 12215 gene locus_tag LOCUS_29190 13105 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 13331 13095 gene locus_tag LOCUS_29200 13331 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 14044 13385 gene locus_tag LOCUS_29210 14044 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 14321 15085 gene locus_tag LOCUS_29220 14321 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 15127 16908 gene locus_tag LOCUS_29230 15127 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 16967 18553 gene locus_tag LOCUS_29240 16967 18553 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_29240 18540 18719 gene locus_tag LOCUS_29250 18540 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 18723 21311 gene locus_tag LOCUS_29260 18723 21311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 21377 23224 gene locus_tag LOCUS_29270 21377 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 23374 25128 gene locus_tag LOCUS_29280 23374 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 25748 26320 gene locus_tag LOCUS_29290 25748 26320 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_29290 26310 26906 gene locus_tag LOCUS_29300 26310 26906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 27568 27732 gene locus_tag LOCUS_29310 27568 27732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 29349 27907 gene locus_tag LOCUS_29320 29349 27907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 29667 30212 gene locus_tag LOCUS_29330 29667 30212 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922427.1 protein_id gnl|my_center|LOCUS_29330 30209 32257 gene locus_tag LOCUS_29340 30209 32257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 34762 32426 gene locus_tag LOCUS_29350 34762 32426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 35061 36518 gene locus_tag LOCUS_29360 35061 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_29360 36680 38953 gene locus_tag LOCUS_29370 36680 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence080 526 1359 gene locus_tag LOCUS_29380 526 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 2695 1493 gene locus_tag LOCUS_29390 2695 1493 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_29390 3282 3046 gene locus_tag LOCUS_29400 3282 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3281 3520 gene locus_tag LOCUS_29410 3281 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 4717 3743 gene locus_tag LOCUS_29420 4717 3743 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_29420 6049 4859 gene locus_tag LOCUS_29430 6049 4859 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_29430 6353 6066 gene locus_tag LOCUS_29440 gene porD 6353 6066 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_29440 6967 6350 gene locus_tag LOCUS_29450 6967 6350 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545865.1 protein_id gnl|my_center|LOCUS_29450 7083 9434 gene locus_tag LOCUS_29460 gene nagB 7083 9434 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074422.1 protein_id gnl|my_center|LOCUS_29460 13234 9488 gene locus_tag LOCUS_29470 13234 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 14614 13886 gene locus_tag LOCUS_29480 14614 13886 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976186.1 protein_id gnl|my_center|LOCUS_29480 14789 14601 gene locus_tag LOCUS_29490 14789 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 14885 17677 gene locus_tag LOCUS_29500 14885 17677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 17742 19424 gene locus_tag LOCUS_29510 17742 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 19799 21586 gene locus_tag LOCUS_29520 19799 21586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 21766 21927 gene locus_tag LOCUS_29530 21766 21927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 22689 22006 gene locus_tag LOCUS_29540 22689 22006 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_29540 22874 22686 gene locus_tag LOCUS_29550 22874 22686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 23382 23561 gene locus_tag LOCUS_29560 23382 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 23589 24497 gene locus_tag LOCUS_29570 23589 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 25103 27610 gene locus_tag LOCUS_29580 25103 27610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 27794 27979 gene locus_tag LOCUS_29590 27794 27979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 28314 30176 gene locus_tag LOCUS_29600 28314 30176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 31406 30537 gene locus_tag LOCUS_29610 31406 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 31745 33343 gene locus_tag LOCUS_29620 gene ggt 31745 33343 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_29620 34587 33340 gene locus_tag LOCUS_29630 gene glgC 34587 33340 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_29630 36565 34643 gene locus_tag LOCUS_29640 gene asnB 36565 34643 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_29640 37205 36672 gene locus_tag LOCUS_29650 37205 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 38262 37558 gene locus_tag LOCUS_29660 38262 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence081 894 3314 gene locus_tag LOCUS_29670 894 3314 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253280.1 protein_id gnl|my_center|LOCUS_29670 3364 4746 gene locus_tag LOCUS_29680 3364 4746 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_29680 4926 5909 gene locus_tag LOCUS_29690 4926 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7771 6086 gene locus_tag LOCUS_29700 7771 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 7991 7776 gene locus_tag LOCUS_29710 7991 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 9534 7921 gene locus_tag LOCUS_29720 9534 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 9795 10901 gene locus_tag LOCUS_29730 9795 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 11063 12421 gene locus_tag LOCUS_29740 11063 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_29740 15703 12467 gene locus_tag LOCUS_29750 15703 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 16732 15824 gene locus_tag LOCUS_29760 16732 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 17013 17162 gene locus_tag LOCUS_29770 17013 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 17290 18663 gene locus_tag LOCUS_29780 17290 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 18899 18549 gene locus_tag LOCUS_29790 18899 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 18997 19818 gene locus_tag LOCUS_29800 18997 19818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 20110 21936 gene locus_tag LOCUS_29810 20110 21936 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_29810 22218 21967 gene locus_tag LOCUS_29820 22218 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 24968 23505 gene locus_tag LOCUS_29830 24968 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 26635 25253 gene locus_tag LOCUS_29840 26635 25253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 26991 28370 gene locus_tag LOCUS_29850 26991 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 29651 28656 gene locus_tag LOCUS_29860 29651 28656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 29532 29789 gene locus_tag LOCUS_29870 29532 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 31257 30091 gene locus_tag LOCUS_29880 31257 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 31472 31320 gene locus_tag LOCUS_29890 31472 31320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 31668 31937 gene locus_tag LOCUS_29900 31668 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 32443 33837 gene locus_tag LOCUS_29910 32443 33837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_29910 36272 33942 gene locus_tag LOCUS_29920 36272 33942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 38204 37170 gene locus_tag LOCUS_29930 38204 37170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 38604 38299 gene locus_tag LOCUS_29940 38604 38299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 39403 39095 gene locus_tag LOCUS_29950 39403 39095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence082 1032 466 gene locus_tag LOCUS_29960 1032 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1878 1639 gene locus_tag LOCUS_29970 1878 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1996 2583 gene locus_tag LOCUS_29980 1996 2583 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_29980 2698 5271 gene locus_tag LOCUS_29990 2698 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 7119 5527 gene locus_tag LOCUS_30000 7119 5527 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122032.1 protein_id gnl|my_center|LOCUS_30000 7182 7397 gene locus_tag LOCUS_30010 7182 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 8100 12530 gene locus_tag LOCUS_30020 8100 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 12613 17985 gene locus_tag LOCUS_30030 12613 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 19247 17994 gene locus_tag LOCUS_30040 19247 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 19551 19769 gene locus_tag LOCUS_30050 19551 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 20599 19895 gene locus_tag LOCUS_30060 20599 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 21834 20632 gene locus_tag LOCUS_30070 21834 20632 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_30070 22283 22119 gene locus_tag LOCUS_30080 22283 22119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 23125 22217 gene locus_tag LOCUS_30090 gene sseA 23125 22217 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969352.1 protein_id gnl|my_center|LOCUS_30090 23276 25960 gene locus_tag LOCUS_30100 23276 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 29488 26081 gene locus_tag LOCUS_30110 29488 26081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 30925 29741 gene locus_tag LOCUS_30120 30925 29741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 32491 31184 gene locus_tag LOCUS_30130 32491 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 33613 32504 gene locus_tag LOCUS_30140 33613 32504 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_30140 36395 33615 gene locus_tag LOCUS_30150 36395 33615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 37267 36626 gene locus_tag LOCUS_30160 gene trmB 37267 36626 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_30160 37579 39045 gene locus_tag LOCUS_30170 37579 39045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence083 2562 1312 gene locus_tag LOCUS_30180 2562 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 4000 2681 gene locus_tag LOCUS_30190 4000 2681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_30190 4362 5654 gene locus_tag LOCUS_30200 gene pvdM 4362 5654 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_30200 6275 5763 gene locus_tag LOCUS_30210 6275 5763 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067265.1 protein_id gnl|my_center|LOCUS_30210 7288 6272 gene locus_tag LOCUS_30220 7288 6272 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_30220 7644 10298 gene locus_tag LOCUS_30230 7644 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 10927 10451 gene locus_tag LOCUS_30240 gene bcp 10927 10451 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337529.1 protein_id gnl|my_center|LOCUS_30240 11103 11459 gene locus_tag LOCUS_tm00010 11103 11459 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 11785 12999 gene locus_tag LOCUS_30250 11785 12999 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_30250 12996 14252 gene locus_tag LOCUS_30260 gene larA 12996 14252 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393426.1 protein_id gnl|my_center|LOCUS_30260 15122 14382 gene locus_tag LOCUS_30270 15122 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 17261 15132 gene locus_tag LOCUS_30280 17261 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 17829 17275 gene locus_tag LOCUS_30290 17829 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 17922 19271 gene locus_tag LOCUS_30300 17922 19271 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_30300 19790 19305 gene locus_tag LOCUS_30310 19790 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324288.1 protein_id gnl|my_center|LOCUS_30310 23245 19790 gene locus_tag LOCUS_30320 23245 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 23691 23927 gene locus_tag LOCUS_30330 23691 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 23941 24786 gene locus_tag LOCUS_30340 23941 24786 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_30340 24830 26695 gene locus_tag LOCUS_30350 24830 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 26720 27463 gene locus_tag LOCUS_30360 26720 27463 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_30360 27463 29676 gene locus_tag LOCUS_30370 27463 29676 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120937.1 protein_id gnl|my_center|LOCUS_30370 29839 30729 gene locus_tag LOCUS_30380 29839 30729 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_30380 30849 32522 gene locus_tag LOCUS_30390 30849 32522 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 protein_id gnl|my_center|LOCUS_30390 32522 34579 gene locus_tag LOCUS_30400 32522 34579 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_30400 35713 34889 gene locus_tag LOCUS_30410 35713 34889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 36118 35828 gene locus_tag LOCUS_30420 36118 35828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 36620 36219 gene locus_tag LOCUS_30430 36620 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 36958 36776 gene locus_tag LOCUS_30440 36958 36776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence084 364 870 gene locus_tag LOCUS_30450 364 870 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_30450 949 3156 gene locus_tag LOCUS_30460 949 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3407 6562 gene locus_tag LOCUS_30470 3407 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922202.1 protein_id gnl|my_center|LOCUS_30470 6692 7726 gene locus_tag LOCUS_30480 6692 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122118.1 protein_id gnl|my_center|LOCUS_30480 7830 8678 gene locus_tag LOCUS_30490 7830 8678 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228130.1 protein_id gnl|my_center|LOCUS_30490 8713 9153 gene locus_tag LOCUS_30500 8713 9153 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_30500 9199 9699 gene locus_tag LOCUS_30510 9199 9699 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 protein_id gnl|my_center|LOCUS_30510 9805 12468 gene locus_tag LOCUS_30520 9805 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 13413 12601 gene locus_tag LOCUS_30530 13413 12601 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_30530 14627 13665 gene locus_tag LOCUS_30540 gene cdhD 14627 13665 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_30540 15485 14718 gene locus_tag LOCUS_30550 15485 14718 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_30550 17517 15565 gene locus_tag LOCUS_30560 17517 15565 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_30560 18862 17525 gene locus_tag LOCUS_30570 gene acsC 18862 17525 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_30570 21235 19031 gene locus_tag LOCUS_30580 gene acsB 21235 19031 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_30580 23520 21484 gene locus_tag LOCUS_30590 gene cooS 23520 21484 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_30590 24383 23592 gene locus_tag LOCUS_30600 24383 23592 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_30600 24793 26217 gene locus_tag LOCUS_30610 24793 26217 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_30610 26295 26942 gene locus_tag LOCUS_30620 26295 26942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 27034 27675 gene locus_tag LOCUS_30630 27034 27675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 27893 28807 gene locus_tag LOCUS_30640 27893 28807 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261996.1 protein_id gnl|my_center|LOCUS_30640 28804 29502 gene locus_tag LOCUS_30650 28804 29502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_30650 29499 30125 gene locus_tag LOCUS_30660 29499 30125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 31296 30295 gene locus_tag LOCUS_30670 31296 30295 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_30670 31513 31758 gene locus_tag LOCUS_30680 31513 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 32424 31768 gene locus_tag LOCUS_30690 32424 31768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 35217 32524 gene locus_tag LOCUS_30700 gene fdhF 35217 32524 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061084.1 transl_except (pos:complement(34183..34185),aa:Sec) note codon on position 345 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_30700 37213 35309 gene locus_tag LOCUS_30710 37213 35309 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877158.1 protein_id gnl|my_center|LOCUS_30710 37685 37197 gene locus_tag LOCUS_30720 gene nuoE 37685 37197 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_30720 38431 37943 gene locus_tag LOCUS_30730 38431 37943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence085 3219 1762 gene locus_tag LOCUS_30740 gene mttB 3219 1762 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_30740 3472 4767 gene locus_tag LOCUS_30750 3472 4767 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_30750 5064 4837 gene locus_tag LOCUS_30760 5064 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 5263 5505 gene locus_tag LOCUS_30770 5263 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 5595 5425 gene locus_tag LOCUS_30780 5595 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 5718 6725 gene locus_tag LOCUS_30790 5718 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 7925 6759 gene locus_tag LOCUS_30800 7925 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 8137 9012 gene locus_tag LOCUS_30810 8137 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 9192 10013 gene locus_tag LOCUS_30820 9192 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 10038 11255 gene locus_tag LOCUS_30830 10038 11255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_30830 11259 11954 gene locus_tag LOCUS_30840 11259 11954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_30840 12187 12585 gene locus_tag LOCUS_30850 12187 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 13210 12650 gene locus_tag LOCUS_30860 13210 12650 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_30860 13375 13704 gene locus_tag LOCUS_30870 13375 13704 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140006.1 protein_id gnl|my_center|LOCUS_30870 13737 14942 gene locus_tag LOCUS_30880 gene arsB 13737 14942 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_30880 15218 15541 gene locus_tag LOCUS_30890 15218 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 15550 16971 gene locus_tag LOCUS_30900 15550 16971 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_30900 17019 17252 gene locus_tag LOCUS_30910 17019 17252 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_30910 17411 18121 gene locus_tag LOCUS_30920 17411 18121 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_30920 18168 18554 gene locus_tag LOCUS_30930 18168 18554 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_30930 18683 19774 gene locus_tag LOCUS_30940 18683 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 19932 20366 gene locus_tag LOCUS_30950 19932 20366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 20446 21198 gene locus_tag LOCUS_30960 20446 21198 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_30960 21308 22153 gene locus_tag LOCUS_30970 21308 22153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 22164 23375 gene locus_tag LOCUS_30980 22164 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 24467 23451 gene locus_tag LOCUS_30990 24467 23451 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339548.1 protein_id gnl|my_center|LOCUS_30990 25735 24608 gene locus_tag LOCUS_31000 25735 24608 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_31000 27386 26043 gene locus_tag LOCUS_31010 27386 26043 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_31010 27766 29910 gene locus_tag LOCUS_31020 27766 29910 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921493.1 protein_id gnl|my_center|LOCUS_31020 30025 30261 gene locus_tag LOCUS_31030 30025 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 30282 30467 gene locus_tag LOCUS_31040 30282 30467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 30782 30540 gene locus_tag LOCUS_31050 30782 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 31148 30786 gene locus_tag LOCUS_31060 31148 30786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 31227 31391 gene locus_tag LOCUS_31070 31227 31391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 31834 32466 gene locus_tag LOCUS_31080 31834 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 32787 33689 gene locus_tag LOCUS_31090 32787 33689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 33804 34730 gene locus_tag LOCUS_31100 33804 34730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 34737 35243 gene locus_tag LOCUS_31110 34737 35243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 35477 36025 gene locus_tag LOCUS_31120 35477 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 36164 36661 gene locus_tag LOCUS_31130 36164 36661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 36645 37727 gene locus_tag LOCUS_31140 36645 37727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence086 3667 1532 gene locus_tag LOCUS_31150 3667 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 6507 3664 gene locus_tag LOCUS_31160 6507 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 6812 10291 gene locus_tag LOCUS_31170 6812 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 12960 11845 gene locus_tag LOCUS_31180 12960 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 15054 12988 gene locus_tag LOCUS_31190 15054 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 15270 15686 gene locus_tag LOCUS_31200 15270 15686 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537487.1 protein_id gnl|my_center|LOCUS_31200 17020 15740 gene locus_tag LOCUS_31210 17020 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 18453 17059 gene locus_tag LOCUS_31220 18453 17059 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_31220 19658 18483 gene locus_tag LOCUS_31230 19658 18483 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_31230 20405 19719 gene locus_tag LOCUS_31240 20405 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 20858 20421 gene locus_tag LOCUS_31250 20858 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 20888 22474 gene locus_tag LOCUS_31260 20888 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 22548 24092 gene locus_tag LOCUS_31270 22548 24092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 24384 30113 gene locus_tag LOCUS_31280 24384 30113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 30117 30449 gene locus_tag LOCUS_31290 30117 30449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 32754 30514 gene locus_tag LOCUS_31300 32754 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 33277 34665 gene locus_tag LOCUS_31310 33277 34665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967480.1 protein_id gnl|my_center|LOCUS_31310 34847 36664 gene locus_tag LOCUS_31320 34847 36664 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222767.1 protein_id gnl|my_center|LOCUS_31320 36661 37272 gene locus_tag LOCUS_31330 36661 37272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence087 170 1330 gene locus_tag LOCUS_31340 170 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1483 3183 gene locus_tag LOCUS_31350 1483 3183 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_31350 4986 3295 gene locus_tag LOCUS_31360 4986 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 5486 7210 gene locus_tag LOCUS_31370 5486 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 7207 7884 gene locus_tag LOCUS_31380 7207 7884 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_31380 10621 8033 gene locus_tag LOCUS_31390 10621 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 10670 10963 gene locus_tag LOCUS_31400 10670 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 16941 10873 gene locus_tag LOCUS_31410 16941 10873 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119328.1 protein_id gnl|my_center|LOCUS_31410 18225 17179 gene locus_tag LOCUS_31420 18225 17179 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_31420 18631 18263 gene locus_tag LOCUS_31430 18631 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 19643 18792 gene locus_tag LOCUS_31440 19643 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 19719 20039 gene locus_tag LOCUS_31450 19719 20039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 20070 20717 gene locus_tag LOCUS_31460 20070 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 20929 21321 gene locus_tag LOCUS_31470 20929 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 23038 21344 gene locus_tag LOCUS_31480 23038 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 23456 23040 gene locus_tag LOCUS_31490 23456 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 23860 23543 gene locus_tag LOCUS_31500 23860 23543 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326213.1 protein_id gnl|my_center|LOCUS_31500 24180 23863 gene locus_tag LOCUS_31510 24180 23863 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_31510 25656 24343 gene locus_tag LOCUS_31520 gene sufD 25656 24343 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_31520 27223 25808 gene locus_tag LOCUS_31530 gene sufB 27223 25808 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_31530 28188 27400 gene locus_tag LOCUS_31540 gene sufC 28188 27400 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329802.1 protein_id gnl|my_center|LOCUS_31540 28930 28289 gene locus_tag LOCUS_31550 28930 28289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 29566 28949 gene locus_tag LOCUS_31560 29566 28949 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_31560 30243 29728 gene locus_tag LOCUS_31570 gene coaD 30243 29728 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_31570 31317 30259 gene locus_tag LOCUS_31580 31317 30259 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328412.1 protein_id gnl|my_center|LOCUS_31580 31929 31324 gene locus_tag LOCUS_31590 31929 31324 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332043.1 protein_id gnl|my_center|LOCUS_31590 33757 31988 gene locus_tag LOCUS_31600 gene ilvB 33757 31988 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_31600 36990 34066 gene locus_tag LOCUS_31610 36990 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 37347 37874 gene locus_tag LOCUS_31620 37347 37874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence088 4212 565 gene locus_tag LOCUS_31630 4212 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 5659 4286 gene locus_tag LOCUS_31640 5659 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 6592 5708 gene locus_tag LOCUS_31650 6592 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 7430 6597 gene locus_tag LOCUS_31660 7430 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 8679 7423 gene locus_tag LOCUS_31670 8679 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 10766 8820 gene locus_tag LOCUS_31680 10766 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11751 10837 gene locus_tag LOCUS_31690 11751 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 12431 12039 gene locus_tag LOCUS_31700 12431 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 12831 12613 gene locus_tag LOCUS_31710 12831 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 15072 13117 gene locus_tag LOCUS_31720 15072 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 16500 15088 gene locus_tag LOCUS_31730 16500 15088 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_31730 18938 16596 gene locus_tag LOCUS_31740 18938 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 19644 20081 gene locus_tag LOCUS_31750 19644 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 20191 23754 gene locus_tag LOCUS_31760 20191 23754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 24468 23848 gene locus_tag LOCUS_31770 24468 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 25483 24665 gene locus_tag LOCUS_31780 25483 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 25807 26430 gene locus_tag LOCUS_31790 25807 26430 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_31790 26909 30595 gene locus_tag LOCUS_31800 26909 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 31906 30845 gene locus_tag LOCUS_31810 31906 30845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 32371 34944 gene locus_tag LOCUS_31820 32371 34944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 35084 35260 gene locus_tag LOCUS_31830 35084 35260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 35481 37787 gene locus_tag LOCUS_31840 35481 37787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence089 1741 1178 gene locus_tag LOCUS_31850 1741 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2548 3942 gene locus_tag LOCUS_31860 2548 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3957 4541 gene locus_tag LOCUS_31870 3957 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4538 5230 gene locus_tag LOCUS_31880 4538 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5380 5712 gene locus_tag LOCUS_31890 5380 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 5709 6608 gene locus_tag LOCUS_31900 5709 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 7522 6671 gene locus_tag LOCUS_31910 7522 6671 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_31910 7901 8707 gene locus_tag LOCUS_31920 7901 8707 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_31920 10025 8985 gene locus_tag LOCUS_31930 10025 8985 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615530.1 protein_id gnl|my_center|LOCUS_31930 10271 11233 gene locus_tag LOCUS_31940 10271 11233 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122268.1 protein_id gnl|my_center|LOCUS_31940 14889 11284 gene locus_tag LOCUS_31950 14889 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 16392 15082 gene locus_tag LOCUS_31960 16392 15082 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804458.1 protein_id gnl|my_center|LOCUS_31960 17438 16440 gene locus_tag LOCUS_31970 17438 16440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 17736 18017 gene locus_tag LOCUS_31980 17736 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 18362 21235 gene locus_tag LOCUS_31990 18362 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 24415 21344 gene locus_tag LOCUS_32000 24415 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 24687 26795 gene locus_tag LOCUS_32010 24687 26795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 27002 27232 gene locus_tag LOCUS_32020 27002 27232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706168.1 protein_id gnl|my_center|LOCUS_32020 27245 27496 gene locus_tag LOCUS_32030 27245 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 27959 27552 gene locus_tag LOCUS_32040 gene mce 27959 27552 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_32040 29699 28026 gene locus_tag LOCUS_32050 29699 28026 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_32050 30730 29708 gene locus_tag LOCUS_32060 gene meaB 30730 29708 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_32060 31134 30727 gene locus_tag LOCUS_32070 31134 30727 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_32070 33038 31173 gene locus_tag LOCUS_32080 33038 31173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127588486.1 protein_id gnl|my_center|LOCUS_32080 34768 33200 gene locus_tag LOCUS_32090 34768 33200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 35622 34765 gene locus_tag LOCUS_32100 35622 34765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 37838 35658 gene locus_tag LOCUS_32110 37838 35658 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258633.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence090 1 288 gene locus_tag LOCUS_32120 1 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 432 1475 gene locus_tag LOCUS_32130 432 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 3039 1516 gene locus_tag LOCUS_32140 3039 1516 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_32140 3398 4483 gene locus_tag LOCUS_32150 3398 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 4915 4724 gene locus_tag LOCUS_32160 4915 4724 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015104.1 protein_id gnl|my_center|LOCUS_32160 5770 5594 gene locus_tag LOCUS_32170 5770 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 5849 7504 gene locus_tag LOCUS_32180 5849 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 7604 9277 gene locus_tag LOCUS_32190 7604 9277 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_32190 9267 12125 gene locus_tag LOCUS_32200 9267 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 12142 13338 gene locus_tag LOCUS_32210 12142 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 13335 14801 gene locus_tag LOCUS_32220 13335 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 15776 14979 gene locus_tag LOCUS_32230 gene hpaI 15776 14979 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251843.1 protein_id gnl|my_center|LOCUS_32230 16807 15956 gene locus_tag LOCUS_32240 16807 15956 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922089.1 protein_id gnl|my_center|LOCUS_32240 17756 18514 gene locus_tag LOCUS_32250 17756 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 18587 18892 gene locus_tag LOCUS_32260 18587 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 19376 19173 gene locus_tag LOCUS_32270 19376 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 21220 19376 gene locus_tag LOCUS_32280 21220 19376 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 protein_id gnl|my_center|LOCUS_32280 23567 21441 gene locus_tag LOCUS_32290 23567 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32290 24302 23730 gene locus_tag LOCUS_32300 24302 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32300 24733 24305 gene locus_tag LOCUS_32310 24733 24305 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_32310 27793 24749 gene locus_tag LOCUS_32320 27793 24749 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_32320 28306 28587 gene locus_tag LOCUS_32330 28306 28587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 28592 28909 gene locus_tag LOCUS_32340 28592 28909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 29792 29511 gene locus_tag LOCUS_32350 29792 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 30102 29887 gene locus_tag LOCUS_32360 30102 29887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 30130 31014 gene locus_tag LOCUS_32370 gene panC 30130 31014 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148756109.1 protein_id gnl|my_center|LOCUS_32370 31018 32334 gene locus_tag LOCUS_32380 31018 32334 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258899.1 protein_id gnl|my_center|LOCUS_32380 32785 33633 gene locus_tag LOCUS_32390 32785 33633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 33921 37592 gene locus_tag LOCUS_32400 33921 37592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence091 1015 692 gene locus_tag LOCUS_32410 1015 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922168.1 protein_id gnl|my_center|LOCUS_32410 1649 1287 gene locus_tag LOCUS_32420 1649 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 1969 3039 gene locus_tag LOCUS_32430 1969 3039 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_32430 3008 3910 gene locus_tag LOCUS_32440 3008 3910 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_32440 4035 6359 gene locus_tag LOCUS_32450 4035 6359 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 protein_id gnl|my_center|LOCUS_32450 6359 9142 gene locus_tag LOCUS_32460 6359 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118534.1 protein_id gnl|my_center|LOCUS_32460 9283 11703 gene locus_tag LOCUS_32470 9283 11703 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921470.1 protein_id gnl|my_center|LOCUS_32470 11841 13577 gene locus_tag LOCUS_32480 11841 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 13589 14629 gene locus_tag LOCUS_32490 13589 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615992.1 protein_id gnl|my_center|LOCUS_32490 14736 15932 gene locus_tag LOCUS_32500 14736 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 15929 17944 gene locus_tag LOCUS_32510 15929 17944 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_32510 17998 19059 gene locus_tag LOCUS_32520 17998 19059 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 protein_id gnl|my_center|LOCUS_32520 19152 21128 gene locus_tag LOCUS_32530 19152 21128 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260110.1 protein_id gnl|my_center|LOCUS_32530 22162 21440 gene locus_tag LOCUS_32540 22162 21440 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122318.1 protein_id gnl|my_center|LOCUS_32540 23177 22494 gene locus_tag LOCUS_32550 23177 22494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 23305 24753 gene locus_tag LOCUS_32560 23305 24753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 25062 24772 gene locus_tag LOCUS_32570 25062 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 26466 25168 gene locus_tag LOCUS_32580 26466 25168 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_32580 26629 27114 gene locus_tag LOCUS_32590 26629 27114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 27114 27725 gene locus_tag LOCUS_32600 27114 27725 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040168.1 protein_id gnl|my_center|LOCUS_32600 27908 28888 gene locus_tag LOCUS_32610 27908 28888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 29147 29854 gene locus_tag LOCUS_32620 29147 29854 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_32620 29868 30836 gene locus_tag LOCUS_32630 29868 30836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 31051 30863 gene locus_tag LOCUS_32640 31051 30863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 32037 31072 gene locus_tag LOCUS_32650 32037 31072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 32538 33035 gene locus_tag LOCUS_32660 32538 33035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 33060 33758 gene locus_tag LOCUS_32670 gene ung 33060 33758 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_32670 34096 33851 gene locus_tag LOCUS_32680 34096 33851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 34627 35340 gene locus_tag LOCUS_32690 34627 35340 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922660.1 protein_id gnl|my_center|LOCUS_32690 35498 36481 gene locus_tag LOCUS_32700 35498 36481 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_32700 36666 37541 gene locus_tag LOCUS_32710 36666 37541 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021671.1 protein_id gnl|my_center|LOCUS_32710 >Feature sequence092 3299 2559 gene locus_tag LOCUS_32720 3299 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3542 4042 gene locus_tag LOCUS_32730 3542 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 4270 5463 gene locus_tag LOCUS_32740 4270 5463 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121840.1 protein_id gnl|my_center|LOCUS_32740 5500 6576 gene locus_tag LOCUS_32750 5500 6576 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121839.1 protein_id gnl|my_center|LOCUS_32750 6813 9257 gene locus_tag LOCUS_32760 6813 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 9331 10440 gene locus_tag LOCUS_32770 9331 10440 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_32770 11048 10467 gene locus_tag LOCUS_32780 11048 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 12900 11089 gene locus_tag LOCUS_32790 12900 11089 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_32790 16498 13031 gene locus_tag LOCUS_32800 16498 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 16832 17464 gene locus_tag LOCUS_32810 16832 17464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 17467 18411 gene locus_tag LOCUS_32820 17467 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 19637 18345 gene locus_tag LOCUS_32830 19637 18345 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_32830 19899 20132 gene locus_tag LOCUS_32840 19899 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 20286 21053 gene locus_tag LOCUS_32850 20286 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 22072 21263 gene locus_tag LOCUS_32860 22072 21263 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_32860 22354 24963 gene locus_tag LOCUS_32870 22354 24963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 26329 24974 gene locus_tag LOCUS_32880 26329 24974 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_32880 28008 27001 gene locus_tag LOCUS_32890 28008 27001 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_32890 29231 28050 gene locus_tag LOCUS_32900 29231 28050 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615968.1 protein_id gnl|my_center|LOCUS_32900 30255 29344 gene locus_tag LOCUS_32910 30255 29344 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_32910 31204 30260 gene locus_tag LOCUS_32920 gene mch 31204 30260 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145084390.1 protein_id gnl|my_center|LOCUS_32920 31457 32128 gene locus_tag LOCUS_32930 31457 32128 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_32930 33771 32161 gene locus_tag LOCUS_32940 33771 32161 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_32940 34340 33813 gene locus_tag LOCUS_32950 34340 33813 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545603.1 protein_id gnl|my_center|LOCUS_32950 34759 35190 gene locus_tag LOCUS_32960 34759 35190 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence093 1541 849 gene locus_tag LOCUS_32970 1541 849 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145098967.1 protein_id gnl|my_center|LOCUS_32970 1707 3275 gene locus_tag LOCUS_32980 1707 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 3578 4705 gene locus_tag LOCUS_32990 3578 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 6484 4733 gene locus_tag LOCUS_33000 6484 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 7388 6540 gene locus_tag LOCUS_33010 7388 6540 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_33010 7735 7385 gene locus_tag LOCUS_33020 7735 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 8813 7674 gene locus_tag LOCUS_33030 8813 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 10554 9160 gene locus_tag LOCUS_33040 10554 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173391559.1 protein_id gnl|my_center|LOCUS_33040 11491 12429 gene locus_tag LOCUS_33050 11491 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 12663 13586 gene locus_tag LOCUS_33060 12663 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 14098 14373 gene locus_tag LOCUS_33070 14098 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 14327 14746 gene locus_tag LOCUS_33080 14327 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 14765 15367 gene locus_tag LOCUS_33090 14765 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 19663 15473 gene locus_tag LOCUS_33100 19663 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 20079 21407 gene locus_tag LOCUS_33110 20079 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 22732 21875 gene locus_tag LOCUS_33120 22732 21875 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767448.1 protein_id gnl|my_center|LOCUS_33120 23029 24486 gene locus_tag LOCUS_33130 23029 24486 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_33130 25475 24525 gene locus_tag LOCUS_33140 25475 24525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 27508 25646 gene locus_tag LOCUS_33150 27508 25646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 27665 29164 gene locus_tag LOCUS_33160 27665 29164 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_33160 30882 29209 gene locus_tag LOCUS_33170 30882 29209 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990061.1 protein_id gnl|my_center|LOCUS_33170 32009 30879 gene locus_tag LOCUS_33180 32009 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 33419 32172 gene locus_tag LOCUS_33190 33419 32172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 33840 34703 gene locus_tag LOCUS_33200 33840 34703 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_33200 34696 35076 gene locus_tag LOCUS_33210 34696 35076 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_33210 35063 35467 gene locus_tag LOCUS_33220 35063 35467 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392983.1 protein_id gnl|my_center|LOCUS_33220 35807 36868 gene locus_tag LOCUS_33230 35807 36868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036371.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence094 <1 1979 gene locus_tag LOCUS_33240 <1 1979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein 2124 2657 gene locus_tag LOCUS_33250 2124 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 4454 2916 gene locus_tag LOCUS_33260 4454 2916 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_33260 6600 4681 gene locus_tag LOCUS_33270 6600 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 10155 6796 gene locus_tag LOCUS_33280 10155 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 10604 10870 gene locus_tag LOCUS_33290 10604 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 11107 13044 gene locus_tag LOCUS_33300 11107 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 14367 13135 gene locus_tag LOCUS_33310 14367 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 16403 14505 gene locus_tag LOCUS_33320 16403 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 17940 16453 gene locus_tag LOCUS_33330 17940 16453 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_33330 18173 17937 gene locus_tag LOCUS_33340 18173 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 19964 18309 gene locus_tag LOCUS_33350 19964 18309 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_33350 22213 20042 gene locus_tag LOCUS_33360 22213 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 23760 22303 gene locus_tag LOCUS_33370 23760 22303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 24282 25592 gene locus_tag LOCUS_33380 gene mexV 24282 25592 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 protein_id gnl|my_center|LOCUS_33380 25595 28906 gene locus_tag LOCUS_33390 25595 28906 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_33390 28919 29812 gene locus_tag LOCUS_33400 28919 29812 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672775.1 protein_id gnl|my_center|LOCUS_33400 29947 32574 gene locus_tag LOCUS_33410 29947 32574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 32626 34158 gene locus_tag LOCUS_33420 32626 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 34280 35554 gene locus_tag LOCUS_33430 34280 35554 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_33430 36477 36893 gene locus_tag LOCUS_33440 36477 36893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 >Feature sequence095 1313 4537 gene locus_tag LOCUS_33450 1313 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 4593 5090 gene locus_tag LOCUS_33460 4593 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 5142 5492 gene locus_tag LOCUS_33470 5142 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 6918 5683 gene locus_tag LOCUS_33480 6918 5683 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804458.1 protein_id gnl|my_center|LOCUS_33480 9801 7129 gene locus_tag LOCUS_33490 9801 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 10260 11681 gene locus_tag LOCUS_33500 10260 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 11689 12570 gene locus_tag LOCUS_33510 11689 12570 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922316.1 protein_id gnl|my_center|LOCUS_33510 12636 13520 gene locus_tag LOCUS_33520 12636 13520 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_33520 13787 14311 gene locus_tag LOCUS_33530 13787 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 14501 17623 gene locus_tag LOCUS_33540 14501 17623 CDS product [glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008674544.1 protein_id gnl|my_center|LOCUS_33540 18414 17674 gene locus_tag LOCUS_33550 18414 17674 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121331.1 protein_id gnl|my_center|LOCUS_33550 19374 18421 gene locus_tag LOCUS_33560 19374 18421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 19826 20830 gene locus_tag LOCUS_33570 19826 20830 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_33570 21154 22566 gene locus_tag LOCUS_33580 21154 22566 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_33580 23601 22573 gene locus_tag LOCUS_33590 23601 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 23855 24658 gene locus_tag LOCUS_33600 23855 24658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 25848 24784 gene locus_tag LOCUS_33610 25848 24784 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_33610 26068 26565 gene locus_tag LOCUS_33620 gene fae 26068 26565 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_33620 26650 27525 gene locus_tag LOCUS_33630 26650 27525 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_33630 27767 28384 gene locus_tag LOCUS_33640 gene msrA 27767 28384 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_33640 28686 29963 gene locus_tag LOCUS_33650 28686 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 29066 29158 gene locus_tag LOCUS_t00180 29066 29158 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 29969 30553 gene locus_tag LOCUS_33660 29969 30553 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_33660 30571 30906 gene locus_tag LOCUS_33670 gene nuoK 30571 30906 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_33670 30906 33440 gene locus_tag LOCUS_33680 30906 33440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 33466 35448 gene locus_tag LOCUS_33690 33466 35448 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence096 853 632 gene locus_tag LOCUS_33700 853 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1936 968 gene locus_tag LOCUS_33710 1936 968 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_33710 2335 3843 gene locus_tag LOCUS_33720 2335 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 5307 3955 gene locus_tag LOCUS_33730 5307 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 6171 8945 gene locus_tag LOCUS_33740 6171 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 8964 10328 gene locus_tag LOCUS_33750 8964 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 13421 10338 gene locus_tag LOCUS_33760 13421 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 13790 17161 gene locus_tag LOCUS_33770 13790 17161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 17255 21637 gene locus_tag LOCUS_33780 17255 21637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 25455 21763 gene locus_tag LOCUS_33790 25455 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 26486 25512 gene locus_tag LOCUS_33800 26486 25512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_33800 26997 29435 gene locus_tag LOCUS_33810 26997 29435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 29624 32668 gene locus_tag LOCUS_33820 29624 32668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 32846 34246 gene locus_tag LOCUS_33830 32846 34246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 34351 35607 gene locus_tag LOCUS_33840 34351 35607 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence097 199 486 gene locus_tag LOCUS_33850 199 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 590 742 gene locus_tag LOCUS_33860 590 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 905 1189 gene locus_tag LOCUS_33870 905 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 2364 1165 gene locus_tag LOCUS_33880 2364 1165 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922363.1 protein_id gnl|my_center|LOCUS_33880 2551 3342 gene locus_tag LOCUS_33890 2551 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 3647 3883 gene locus_tag LOCUS_33900 3647 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 3979 4860 gene locus_tag LOCUS_33910 3979 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 5241 6719 gene locus_tag LOCUS_33920 5241 6719 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_33920 6740 7384 gene locus_tag LOCUS_33930 6740 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 7536 8786 gene locus_tag LOCUS_33940 7536 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 8788 9426 gene locus_tag LOCUS_33950 8788 9426 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_33950 9428 10495 gene locus_tag LOCUS_33960 9428 10495 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_33960 10492 12990 gene locus_tag LOCUS_33970 10492 12990 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_33970 13179 13439 gene locus_tag LOCUS_33980 13179 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 13549 13782 gene locus_tag LOCUS_33990 13549 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 13779 14090 gene locus_tag LOCUS_34000 13779 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 14634 14257 gene locus_tag LOCUS_34010 14634 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 16547 14631 gene locus_tag LOCUS_34020 16547 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 17654 16638 gene locus_tag LOCUS_34030 17654 16638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 17820 20309 gene locus_tag LOCUS_34040 17820 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 21090 20560 gene locus_tag LOCUS_34050 21090 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 21372 21545 gene locus_tag LOCUS_34060 21372 21545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 21475 21642 gene locus_tag LOCUS_34070 21475 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 21642 24644 gene locus_tag LOCUS_34080 21642 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 24674 25084 gene locus_tag LOCUS_34090 24674 25084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 25090 25383 gene locus_tag LOCUS_34100 25090 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 28473 25489 gene locus_tag LOCUS_34110 28473 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 28810 29106 gene locus_tag LOCUS_34120 28810 29106 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 protein_id gnl|my_center|LOCUS_34120 30081 31361 gene locus_tag LOCUS_34130 30081 31361 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_34130 31826 31362 gene locus_tag LOCUS_34140 31826 31362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 32200 32973 gene locus_tag LOCUS_34150 32200 32973 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120692.1 protein_id gnl|my_center|LOCUS_34150 33141 33653 gene locus_tag LOCUS_34160 33141 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 33666 35087 gene locus_tag LOCUS_34170 33666 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence098 222 1829 gene locus_tag LOCUS_34180 222 1829 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878050.1 protein_id gnl|my_center|LOCUS_34180 2495 1830 gene locus_tag LOCUS_34190 2495 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3303 2530 gene locus_tag LOCUS_34200 3303 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 5090 3300 gene locus_tag LOCUS_34210 5090 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34210 6073 5087 gene locus_tag LOCUS_34220 6073 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 6337 6969 gene locus_tag LOCUS_34230 6337 6969 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582936.1 protein_id gnl|my_center|LOCUS_34230 7263 7730 gene locus_tag LOCUS_34240 gene aprB 7263 7730 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_34240 7794 9686 gene locus_tag LOCUS_34250 gene aprA 7794 9686 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_34250 9922 10206 gene locus_tag LOCUS_34260 9922 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_34260 10203 11093 gene locus_tag LOCUS_34270 10203 11093 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_34270 11097 12380 gene locus_tag LOCUS_34280 11097 12380 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_34280 12373 14628 gene locus_tag LOCUS_34290 12373 14628 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_34290 14790 16022 gene locus_tag LOCUS_34300 gene qmoC 14790 16022 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932549.1 protein_id gnl|my_center|LOCUS_34300 16148 17344 gene locus_tag LOCUS_34310 gene sat 16148 17344 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_34310 17365 17757 gene locus_tag LOCUS_34320 17365 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 17832 18149 gene locus_tag LOCUS_34330 17832 18149 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_34330 18337 18915 gene locus_tag LOCUS_34340 18337 18915 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_34340 18912 19910 gene locus_tag LOCUS_34350 gene dsrM 18912 19910 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_34350 19913 21565 gene locus_tag LOCUS_34360 19913 21565 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_34360 21558 21926 gene locus_tag LOCUS_34370 gene dsrJ 21558 21926 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_34370 21930 22790 gene locus_tag LOCUS_34380 21930 22790 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933894.1 protein_id gnl|my_center|LOCUS_34380 22825 23982 gene locus_tag LOCUS_34390 gene nrfD 22825 23982 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_34390 24043 25248 gene locus_tag LOCUS_34400 gene dsrA 24043 25248 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545539.1 protein_id gnl|my_center|LOCUS_34400 25313 26392 gene locus_tag LOCUS_34410 gene dsrB 25313 26392 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546493.1 protein_id gnl|my_center|LOCUS_34410 26407 26652 gene locus_tag LOCUS_34420 26407 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545371.1 protein_id gnl|my_center|LOCUS_34420 26841 28523 gene locus_tag LOCUS_34430 26841 28523 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933900.1 protein_id gnl|my_center|LOCUS_34430 28611 30017 gene locus_tag LOCUS_34440 gene cobB 28611 30017 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_34440 30234 29998 gene locus_tag LOCUS_34450 30234 29998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 31219 30575 gene locus_tag LOCUS_34460 31219 30575 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_34460 33647 31452 gene locus_tag LOCUS_34470 33647 31452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 34382 33789 gene locus_tag LOCUS_34480 34382 33789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence099 5574 1570 gene locus_tag LOCUS_34490 5574 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 6111 5740 gene locus_tag LOCUS_34500 6111 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 6383 6108 gene locus_tag LOCUS_34510 6383 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 9093 6541 gene locus_tag LOCUS_34520 9093 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 12392 9078 gene locus_tag LOCUS_34530 12392 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 12540 12875 gene locus_tag LOCUS_34540 12540 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 12877 13230 gene locus_tag LOCUS_34550 12877 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 16700 13272 gene locus_tag LOCUS_34560 16700 13272 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_34560 17005 19584 gene locus_tag LOCUS_34570 17005 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 21770 19668 gene locus_tag LOCUS_34580 21770 19668 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_34580 22052 22948 gene locus_tag LOCUS_34590 22052 22948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 22997 24685 gene locus_tag LOCUS_34600 22997 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 24864 26450 gene locus_tag LOCUS_34610 24864 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 26499 28631 gene locus_tag LOCUS_34620 26499 28631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 29626 28817 gene locus_tag LOCUS_34630 29626 28817 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 protein_id gnl|my_center|LOCUS_34630 29968 29630 gene locus_tag LOCUS_34640 29968 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 30825 30073 gene locus_tag LOCUS_34650 30825 30073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 32760 30937 gene locus_tag LOCUS_34660 32760 30937 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_34660 33363 33022 gene locus_tag LOCUS_34670 33363 33022 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_34670 33747 33367 gene locus_tag LOCUS_34680 33747 33367 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142158.1 protein_id gnl|my_center|LOCUS_34680 34273 33884 gene locus_tag LOCUS_34690 gene acpS 34273 33884 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324752.1 protein_id gnl|my_center|LOCUS_34690 35241 34270 gene locus_tag LOCUS_34700 gene trpS 35241 34270 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence100 271 1536 gene locus_tag LOCUS_34710 271 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 1806 3017 gene locus_tag LOCUS_34720 1806 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 3151 3651 gene locus_tag LOCUS_34730 3151 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 4053 5864 gene locus_tag LOCUS_34740 4053 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 5914 8004 gene locus_tag LOCUS_34750 5914 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 8016 8318 gene locus_tag LOCUS_34760 8016 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 8343 9326 gene locus_tag LOCUS_34770 8343 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 9535 9293 gene locus_tag LOCUS_34780 9535 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 10088 11182 gene locus_tag LOCUS_34790 10088 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 11199 11426 gene locus_tag LOCUS_34800 11199 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 12141 11875 gene locus_tag LOCUS_34810 12141 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 12614 12246 gene locus_tag LOCUS_34820 12614 12246 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_34820 13070 12996 gene locus_tag LOCUS_t00190 13070 12996 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13277 14098 gene locus_tag LOCUS_34830 13277 14098 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_34830 14113 15699 gene locus_tag LOCUS_34840 14113 15699 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922192.1 protein_id gnl|my_center|LOCUS_34840 16392 15769 gene locus_tag LOCUS_34850 16392 15769 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140313.1 protein_id gnl|my_center|LOCUS_34850 16646 18286 gene locus_tag LOCUS_34860 16646 18286 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327691.1 protein_id gnl|my_center|LOCUS_34860 18300 18875 gene locus_tag LOCUS_34870 18300 18875 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_34870 19618 18965 gene locus_tag LOCUS_34880 gene pncA 19618 18965 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_34880 22040 19641 gene locus_tag LOCUS_34890 22040 19641 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 protein_id gnl|my_center|LOCUS_34890 22006 22191 gene locus_tag LOCUS_34900 22006 22191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 22340 23401 gene locus_tag LOCUS_34910 22340 23401 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_34910 23416 24309 gene locus_tag LOCUS_34920 23416 24309 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_34920 24444 24896 gene locus_tag LOCUS_34930 gene tnpA 24444 24896 CDS product IS200/IS605-like element ISEc46 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 protein_id gnl|my_center|LOCUS_34930 25070 27424 gene locus_tag LOCUS_34940 25070 27424 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122940.1 protein_id gnl|my_center|LOCUS_34940 27518 28075 gene locus_tag LOCUS_34950 27518 28075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 28095 31295 gene locus_tag LOCUS_34960 28095 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 31653 32267 gene locus_tag LOCUS_34970 31653 32267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 33433 32273 gene locus_tag LOCUS_34980 33433 32273 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence101 789 2390 gene locus_tag LOCUS_34990 789 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3732 2455 gene locus_tag LOCUS_35000 3732 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 4733 3762 gene locus_tag LOCUS_35010 4733 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 5653 4916 gene locus_tag LOCUS_35020 5653 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 5996 6391 gene locus_tag LOCUS_35030 5996 6391 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327289.1 protein_id gnl|my_center|LOCUS_35030 7921 6545 gene locus_tag LOCUS_35040 7921 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 10051 8039 gene locus_tag LOCUS_35050 10051 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 10284 11654 gene locus_tag LOCUS_35060 10284 11654 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_35060 12499 11900 gene locus_tag LOCUS_35070 12499 11900 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921949.1 protein_id gnl|my_center|LOCUS_35070 13506 12496 gene locus_tag LOCUS_35080 13506 12496 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261424.1 protein_id gnl|my_center|LOCUS_35080 15580 13544 gene locus_tag LOCUS_35090 15580 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 16222 18363 gene locus_tag LOCUS_35100 16222 18363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 18351 20072 gene locus_tag LOCUS_35110 18351 20072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 21382 20189 gene locus_tag LOCUS_35120 21382 20189 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_35120 21574 22455 gene locus_tag LOCUS_35130 21574 22455 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921623.1 protein_id gnl|my_center|LOCUS_35130 22469 23437 gene locus_tag LOCUS_35140 22469 23437 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_35140 23572 25278 gene locus_tag LOCUS_35150 23572 25278 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258088.1 protein_id gnl|my_center|LOCUS_35150 25338 25424 gene locus_tag LOCUS_t00200 25338 25424 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25532 25834 gene locus_tag LOCUS_35160 25532 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 25866 27155 gene locus_tag LOCUS_35170 25866 27155 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_35170 27169 27330 gene locus_tag LOCUS_35180 27169 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 29167 27374 gene locus_tag LOCUS_35190 29167 27374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 29796 29164 gene locus_tag LOCUS_35200 29796 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 30990 29851 gene locus_tag LOCUS_35210 30990 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 31163 30987 gene locus_tag LOCUS_35220 31163 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 33051 31129 gene locus_tag LOCUS_35230 33051 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence102 170 9 gene locus_tag LOCUS_35240 170 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 546 196 gene locus_tag LOCUS_35250 546 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 6233 546 gene locus_tag LOCUS_35260 6233 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 6921 6367 gene locus_tag LOCUS_35270 6921 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 7338 7958 gene locus_tag LOCUS_35280 7338 7958 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325064.1 protein_id gnl|my_center|LOCUS_35280 8182 8346 gene locus_tag LOCUS_35290 8182 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 13873 8354 gene locus_tag LOCUS_35300 13873 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 14442 13870 gene locus_tag LOCUS_35310 14442 13870 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_35310 14441 14770 gene locus_tag LOCUS_35320 14441 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 15959 14697 gene locus_tag LOCUS_35330 gene xseA 15959 14697 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_35330 17593 16214 gene locus_tag LOCUS_35340 17593 16214 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_35340 18063 17608 gene locus_tag LOCUS_35350 18063 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 19303 18098 gene locus_tag LOCUS_35360 19303 18098 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_35360 19561 20415 gene locus_tag LOCUS_35370 19561 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 22381 20591 gene locus_tag LOCUS_35380 22381 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 25086 22507 gene locus_tag LOCUS_35390 25086 22507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146579418.1 protein_id gnl|my_center|LOCUS_35390 25276 27894 gene locus_tag LOCUS_35400 gene topA 25276 27894 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812879.1 protein_id gnl|my_center|LOCUS_35400 28106 30064 gene locus_tag LOCUS_35410 28106 30064 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_35410 30319 31569 gene locus_tag LOCUS_35420 30319 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 33061 31730 gene locus_tag LOCUS_35430 33061 31730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 >Feature sequence103 2957 1293 gene locus_tag LOCUS_35440 2957 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 3192 4097 gene locus_tag LOCUS_35450 3192 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 4101 4886 gene locus_tag LOCUS_35460 4101 4886 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_35460 4931 6442 gene locus_tag LOCUS_35470 4931 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_35470 6625 8613 gene locus_tag LOCUS_35480 6625 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_35480 9178 8651 gene locus_tag LOCUS_35490 9178 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 9491 9706 gene locus_tag LOCUS_35500 9491 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 11681 10044 gene locus_tag LOCUS_35510 11681 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 14660 11760 gene locus_tag LOCUS_35520 14660 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 14791 16485 gene locus_tag LOCUS_35530 14791 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 16797 17411 gene locus_tag LOCUS_35540 16797 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965182.1 protein_id gnl|my_center|LOCUS_35540 17398 17811 gene locus_tag LOCUS_35550 17398 17811 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965183.1 protein_id gnl|my_center|LOCUS_35550 17840 19504 gene locus_tag LOCUS_35560 17840 19504 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921447.1 protein_id gnl|my_center|LOCUS_35560 19992 19627 gene locus_tag LOCUS_35570 19992 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 20244 19996 gene locus_tag LOCUS_35580 20244 19996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 20554 20396 gene locus_tag LOCUS_35590 20554 20396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 21797 20823 gene locus_tag LOCUS_35600 21797 20823 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_35600 22859 21936 gene locus_tag LOCUS_35610 22859 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 23827 22874 gene locus_tag LOCUS_35620 23827 22874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 24051 26879 gene locus_tag LOCUS_35630 24051 26879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 26898 27611 gene locus_tag LOCUS_35640 26898 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 29409 27769 gene locus_tag LOCUS_35650 29409 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 >Feature sequence104 4254 3037 gene locus_tag LOCUS_35660 4254 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 6837 4765 gene locus_tag LOCUS_35670 6837 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 7101 7559 gene locus_tag LOCUS_35680 7101 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 7615 8181 gene locus_tag LOCUS_35690 7615 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 9361 8273 gene locus_tag LOCUS_35700 9361 8273 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919207.1 protein_id gnl|my_center|LOCUS_35700 9462 10022 gene locus_tag LOCUS_35710 9462 10022 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654974.1 protein_id gnl|my_center|LOCUS_35710 10191 11435 gene locus_tag LOCUS_35720 10191 11435 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_35720 11422 12657 gene locus_tag LOCUS_35730 11422 12657 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_35730 12881 12693 gene locus_tag LOCUS_35740 12881 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 13684 12824 gene locus_tag LOCUS_35750 13684 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 13844 13918 gene locus_tag LOCUS_t00210 13844 13918 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14747 14145 gene locus_tag LOCUS_35760 14747 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 14881 15171 gene locus_tag LOCUS_35770 14881 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 15311 15721 gene locus_tag LOCUS_35780 15311 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 18112 16106 gene locus_tag LOCUS_35790 18112 16106 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_35790 19815 18142 gene locus_tag LOCUS_35800 19815 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 19905 22889 gene locus_tag LOCUS_35810 19905 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 22907 24985 gene locus_tag LOCUS_35820 22907 24985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 25479 25736 gene locus_tag LOCUS_35830 25479 25736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 25816 26163 gene locus_tag LOCUS_35840 25816 26163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 26436 27485 gene locus_tag LOCUS_35850 26436 27485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 27523 28947 gene locus_tag LOCUS_35860 27523 28947 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_35860 28977 29606 gene locus_tag LOCUS_35870 28977 29606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 29821 33015 gene locus_tag LOCUS_35880 29821 33015 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189169828.1 protein_id gnl|my_center|LOCUS_35880 33271 33080 gene locus_tag LOCUS_35890 33271 33080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence105 11322 1066 gene locus_tag LOCUS_35900 11322 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 12566 11958 gene locus_tag LOCUS_35910 12566 11958 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325155.1 protein_id gnl|my_center|LOCUS_35910 12804 12592 gene locus_tag LOCUS_35920 12804 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 13052 13411 gene locus_tag LOCUS_35930 13052 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 13462 14070 gene locus_tag LOCUS_35940 13462 14070 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103068.1 protein_id gnl|my_center|LOCUS_35940 15375 14305 gene locus_tag LOCUS_35950 gene rhaT 15375 14305 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_35950 16336 15365 gene locus_tag LOCUS_35960 16336 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 18726 16384 gene locus_tag LOCUS_35970 18726 16384 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_35970 18941 21325 gene locus_tag LOCUS_35980 18941 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 21333 22979 gene locus_tag LOCUS_35990 21333 22979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 24033 23083 gene locus_tag LOCUS_36000 24033 23083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 27609 24256 gene locus_tag LOCUS_36010 27609 24256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 29017 27779 gene locus_tag LOCUS_36020 29017 27779 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 protein_id gnl|my_center|LOCUS_36020 31417 29216 gene locus_tag LOCUS_36030 31417 29216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 31620 33026 gene locus_tag LOCUS_36040 31620 33026 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157579517.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence106 4043 5053 gene locus_tag LOCUS_36050 4043 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 9480 5074 gene locus_tag LOCUS_36060 9480 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 9887 10783 gene locus_tag LOCUS_36070 9887 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 10890 11060 gene locus_tag LOCUS_36080 10890 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 11149 12429 gene locus_tag LOCUS_36090 11149 12429 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684174.1 protein_id gnl|my_center|LOCUS_36090 12422 13249 gene locus_tag LOCUS_36100 12422 13249 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_36100 13280 14626 gene locus_tag LOCUS_36110 13280 14626 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_36110 14674 15468 gene locus_tag LOCUS_36120 14674 15468 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_36120 15465 15872 gene locus_tag LOCUS_36130 15465 15872 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_36130 16024 16533 gene locus_tag LOCUS_36140 16024 16533 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_36140 16597 17172 gene locus_tag LOCUS_36150 16597 17172 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_36150 17291 18373 gene locus_tag LOCUS_36160 17291 18373 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_36160 19785 18565 gene locus_tag LOCUS_36170 19785 18565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36170 21540 19804 gene locus_tag LOCUS_36180 21540 19804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_36180 23220 22021 gene locus_tag LOCUS_36190 23220 22021 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_36190 25847 23415 gene locus_tag LOCUS_36200 25847 23415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 27635 26079 gene locus_tag LOCUS_36210 27635 26079 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166740.1 protein_id gnl|my_center|LOCUS_36210 28608 27676 gene locus_tag LOCUS_36220 28608 27676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 29444 28602 gene locus_tag LOCUS_36230 29444 28602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 31959 29449 gene locus_tag LOCUS_36240 31959 29449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence107 144 389 gene locus_tag LOCUS_36250 144 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 906 688 gene locus_tag LOCUS_36260 906 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 1521 2063 gene locus_tag LOCUS_36270 1521 2063 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_36270 2067 4769 gene locus_tag LOCUS_36280 2067 4769 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_36280 4816 8049 gene locus_tag LOCUS_36290 4816 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 9678 8254 gene locus_tag LOCUS_36300 9678 8254 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921976.1 protein_id gnl|my_center|LOCUS_36300 10472 9750 gene locus_tag LOCUS_36310 10472 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 13065 11158 gene locus_tag LOCUS_36320 13065 11158 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174683.1 protein_id gnl|my_center|LOCUS_36320 14440 13088 gene locus_tag LOCUS_36330 14440 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 15638 14646 gene locus_tag LOCUS_36340 15638 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 15968 15663 gene locus_tag LOCUS_36350 15968 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 16229 16969 gene locus_tag LOCUS_36360 16229 16969 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_36360 18446 17073 gene locus_tag LOCUS_36370 18446 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_36370 20155 18530 gene locus_tag LOCUS_36380 20155 18530 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_36380 22105 20201 gene locus_tag LOCUS_36390 22105 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 22150 22443 gene locus_tag LOCUS_36400 22150 22443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 22594 24636 gene locus_tag LOCUS_36410 22594 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 24823 26091 gene locus_tag LOCUS_36420 24823 26091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 26124 27542 gene locus_tag LOCUS_36430 26124 27542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 27617 28303 gene locus_tag LOCUS_36440 27617 28303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 29402 28515 gene locus_tag LOCUS_36450 29402 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 29710 32019 gene locus_tag LOCUS_36460 29710 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence108 426 106 gene locus_tag LOCUS_36470 426 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 458 1714 gene locus_tag LOCUS_36480 458 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 2257 3972 gene locus_tag LOCUS_36490 2257 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 9906 4564 gene locus_tag LOCUS_36500 9906 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 10310 11548 gene locus_tag LOCUS_36510 10310 11548 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_36510 11732 14509 gene locus_tag LOCUS_36520 11732 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 14548 16371 gene locus_tag LOCUS_36530 14548 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 16414 20067 gene locus_tag LOCUS_36540 16414 20067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 20244 21251 gene locus_tag LOCUS_36550 20244 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 21473 24502 gene locus_tag LOCUS_36560 21473 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 24553 26079 gene locus_tag LOCUS_36570 24553 26079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 27202 26240 gene locus_tag LOCUS_36580 27202 26240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 27468 28961 gene locus_tag LOCUS_36590 27468 28961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 29074 30678 gene locus_tag LOCUS_36600 29074 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 30835 32208 gene locus_tag LOCUS_36610 30835 32208 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922615.1 protein_id gnl|my_center|LOCUS_36610 >Feature sequence109 1250 156 gene locus_tag LOCUS_36620 1250 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 2304 3437 gene locus_tag LOCUS_36630 2304 3437 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_36630 4879 3434 gene locus_tag LOCUS_36640 4879 3434 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_36640 5550 4873 gene locus_tag LOCUS_36650 5550 4873 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_36650 5813 7147 gene locus_tag LOCUS_36660 5813 7147 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939710.1 protein_id gnl|my_center|LOCUS_36660 7140 8360 gene locus_tag LOCUS_36670 7140 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 8371 9114 gene locus_tag LOCUS_36680 8371 9114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_36680 9122 10339 gene locus_tag LOCUS_36690 9122 10339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_36690 11641 10928 gene locus_tag LOCUS_36700 11641 10928 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_36700 12546 11662 gene locus_tag LOCUS_36710 gene pstB 12546 11662 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663066.1 protein_id gnl|my_center|LOCUS_36710 13715 12582 gene locus_tag LOCUS_36720 13715 12582 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121293.1 protein_id gnl|my_center|LOCUS_36720 14737 13784 gene locus_tag LOCUS_36730 gene pstC 14737 13784 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332191.1 protein_id gnl|my_center|LOCUS_36730 15839 14739 gene locus_tag LOCUS_36740 15839 14739 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922046.1 protein_id gnl|my_center|LOCUS_36740 17884 16574 gene locus_tag LOCUS_36750 17884 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 19639 18065 gene locus_tag LOCUS_36760 19639 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 20121 21560 gene locus_tag LOCUS_36770 20121 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 21688 22338 gene locus_tag LOCUS_36780 21688 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 22534 23871 gene locus_tag LOCUS_36790 22534 23871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 24990 25586 gene locus_tag LOCUS_36800 24990 25586 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021127.1 protein_id gnl|my_center|LOCUS_36800 26117 25677 gene locus_tag LOCUS_36810 26117 25677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 26997 28631 gene locus_tag LOCUS_36820 26997 28631 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_36820 28795 31686 gene locus_tag LOCUS_36830 28795 31686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence110 1408 155 gene locus_tag LOCUS_36840 1408 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 1712 1443 gene locus_tag LOCUS_36850 1712 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 2079 3077 gene locus_tag LOCUS_36860 2079 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_36860 3474 3157 gene locus_tag LOCUS_36870 3474 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3592 5151 gene locus_tag LOCUS_36880 3592 5151 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963747.1 protein_id gnl|my_center|LOCUS_36880 5443 5237 gene locus_tag LOCUS_36890 5443 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 5524 5844 gene locus_tag LOCUS_36900 5524 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 9473 6006 gene locus_tag LOCUS_36910 9473 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 12875 9690 gene locus_tag LOCUS_36920 12875 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 13209 12886 gene locus_tag LOCUS_36930 13209 12886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 13459 13226 gene locus_tag LOCUS_36940 13459 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 13762 13520 gene locus_tag LOCUS_36950 13762 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 13655 13882 gene locus_tag LOCUS_36960 13655 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 14150 13935 gene locus_tag LOCUS_36970 14150 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 17536 14255 gene locus_tag LOCUS_36980 17536 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 18771 17551 gene locus_tag LOCUS_36990 18771 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 20032 18785 gene locus_tag LOCUS_37000 20032 18785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 20252 22627 gene locus_tag LOCUS_37010 20252 22627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 22810 26838 gene locus_tag LOCUS_37020 22810 26838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 29223 26932 gene locus_tag LOCUS_37030 29223 26932 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206292570.1 protein_id gnl|my_center|LOCUS_37030 31807 29357 gene locus_tag LOCUS_37040 31807 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 >Feature sequence111 82 1953 gene locus_tag LOCUS_37050 82 1953 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_37050 5004 1954 gene locus_tag LOCUS_37060 5004 1954 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672241.1 protein_id gnl|my_center|LOCUS_37060 5274 8936 gene locus_tag LOCUS_37070 5274 8936 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_37070 9196 10590 gene locus_tag LOCUS_37080 9196 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 10961 12244 gene locus_tag LOCUS_37090 10961 12244 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 protein_id gnl|my_center|LOCUS_37090 12279 13196 gene locus_tag LOCUS_37100 gene thiL 12279 13196 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_37100 13756 13193 gene locus_tag LOCUS_37110 13756 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 13893 15536 gene locus_tag LOCUS_37120 13893 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615709.1 protein_id gnl|my_center|LOCUS_37120 15548 16201 gene locus_tag LOCUS_37130 15548 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 16718 16356 gene locus_tag LOCUS_37140 16718 16356 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171268.1 protein_id gnl|my_center|LOCUS_37140 17816 16881 gene locus_tag LOCUS_37150 17816 16881 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_37150 18828 17818 gene locus_tag LOCUS_37160 18828 17818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 20212 18941 gene locus_tag LOCUS_37170 20212 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 20509 20808 gene locus_tag LOCUS_37180 20509 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 22119 20953 gene locus_tag LOCUS_37190 22119 20953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 24201 22171 gene locus_tag LOCUS_37200 24201 22171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 26216 24264 gene locus_tag LOCUS_37210 26216 24264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 27163 26498 gene locus_tag LOCUS_37220 27163 26498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 28037 27267 gene locus_tag LOCUS_37230 28037 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 28570 28034 gene locus_tag LOCUS_37240 28570 28034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 28853 31696 gene locus_tag LOCUS_37250 28853 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence112 343 621 gene locus_tag LOCUS_37260 343 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 823 1047 gene locus_tag LOCUS_37270 823 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4104 1231 gene locus_tag LOCUS_37280 4104 1231 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 protein_id gnl|my_center|LOCUS_37280 4348 4662 gene locus_tag LOCUS_37290 4348 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 5062 4706 gene locus_tag LOCUS_37300 5062 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 5939 5301 gene locus_tag LOCUS_37310 gene fixJ 5939 5301 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_37310 6397 5969 gene locus_tag LOCUS_37320 6397 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 8026 6836 gene locus_tag LOCUS_37330 8026 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 10807 8195 gene locus_tag LOCUS_37340 10807 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 13451 11097 gene locus_tag LOCUS_37350 13451 11097 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122749.1 protein_id gnl|my_center|LOCUS_37350 14501 13476 gene locus_tag LOCUS_37360 14501 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 16485 14716 gene locus_tag LOCUS_37370 16485 14716 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_37370 17399 16596 gene locus_tag LOCUS_37380 17399 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 18679 17807 gene locus_tag LOCUS_37390 18679 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 18788 19036 gene locus_tag LOCUS_37400 18788 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 20634 19030 gene locus_tag LOCUS_37410 20634 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 20552 20824 gene locus_tag LOCUS_37420 20552 20824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 21173 21355 gene locus_tag LOCUS_37430 21173 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 22633 21731 gene locus_tag LOCUS_37440 22633 21731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 23185 22652 gene locus_tag LOCUS_37450 23185 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 25196 23910 gene locus_tag LOCUS_37460 25196 23910 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_37460 25723 25193 gene locus_tag LOCUS_37470 25723 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 26715 26969 gene locus_tag LOCUS_37480 26715 26969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 27460 26957 gene locus_tag LOCUS_37490 27460 26957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 27728 27961 gene locus_tag LOCUS_37500 27728 27961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 28804 28181 gene locus_tag LOCUS_37510 28804 28181 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088253.1 protein_id gnl|my_center|LOCUS_37510 30022 28889 gene locus_tag LOCUS_37520 30022 28889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 30960 30037 gene locus_tag LOCUS_37530 30960 30037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 31441 31064 gene locus_tag LOCUS_37540 31441 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 >Feature sequence113 1509 850 gene locus_tag LOCUS_37550 1509 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 1756 2310 gene locus_tag LOCUS_37560 1756 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 2714 2502 gene locus_tag LOCUS_37570 2714 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 3012 2782 gene locus_tag LOCUS_37580 3012 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 3071 4459 gene locus_tag LOCUS_37590 3071 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_37590 4452 5867 gene locus_tag LOCUS_37600 gene xylB 4452 5867 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_37600 5872 7272 gene locus_tag LOCUS_37610 gene xylE 5872 7272 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 protein_id gnl|my_center|LOCUS_37610 7540 7403 gene locus_tag LOCUS_37620 7540 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 7929 7747 gene locus_tag LOCUS_37630 7929 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 7912 10860 gene locus_tag LOCUS_37640 7912 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 10928 11131 gene locus_tag LOCUS_37650 10928 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 11356 11763 gene locus_tag LOCUS_37660 11356 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 11886 13181 gene locus_tag LOCUS_37670 11886 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 13543 13178 gene locus_tag LOCUS_37680 13543 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 13771 14319 gene locus_tag LOCUS_37690 13771 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 15947 14508 gene locus_tag LOCUS_37700 15947 14508 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_37700 17725 16121 gene locus_tag LOCUS_37710 17725 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 18423 18250 gene locus_tag LOCUS_37720 18423 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 20225 18531 gene locus_tag LOCUS_37730 20225 18531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 20685 20308 gene locus_tag LOCUS_37740 20685 20308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 20982 20833 gene locus_tag LOCUS_37750 20982 20833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 21180 21016 gene locus_tag LOCUS_37760 21180 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 22581 21316 gene locus_tag LOCUS_37770 22581 21316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730930.1 protein_id gnl|my_center|LOCUS_37770 22788 23363 gene locus_tag LOCUS_37780 22788 23363 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_37780 24030 24383 gene locus_tag LOCUS_37790 24030 24383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 25093 24482 gene locus_tag LOCUS_37800 25093 24482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 27215 25161 gene locus_tag LOCUS_37810 27215 25161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921796.1 protein_id gnl|my_center|LOCUS_37810 27907 30838 gene locus_tag LOCUS_r00020 27907 30838 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 31010 31096 gene locus_tag LOCUS_r00030 31010 31096 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 73 percent of the 5S ribosomal RNA 31298 31212 gene locus_tag LOCUS_t00220 31298 31212 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31581 31306 gene locus_tag LOCUS_37820 31581 31306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 >Feature sequence114 2006 246 gene locus_tag LOCUS_37830 2006 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3104 2187 gene locus_tag LOCUS_37840 3104 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4053 3034 gene locus_tag LOCUS_37850 4053 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4583 5038 gene locus_tag LOCUS_37860 4583 5038 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707273.1 protein_id gnl|my_center|LOCUS_37860 5238 5432 gene locus_tag LOCUS_37870 5238 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 5429 6241 gene locus_tag LOCUS_37880 5429 6241 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_37880 8318 6258 gene locus_tag LOCUS_37890 8318 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 8620 9876 gene locus_tag LOCUS_37900 8620 9876 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_37900 9873 11570 gene locus_tag LOCUS_37910 9873 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 11693 11851 gene locus_tag LOCUS_37920 11693 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 11875 12969 gene locus_tag LOCUS_37930 11875 12969 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533145.1 protein_id gnl|my_center|LOCUS_37930 13087 13968 gene locus_tag LOCUS_37940 13087 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 15038 14022 gene locus_tag LOCUS_37950 15038 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 16087 15035 gene locus_tag LOCUS_37960 16087 15035 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529509.1 protein_id gnl|my_center|LOCUS_37960 17221 16289 gene locus_tag LOCUS_37970 17221 16289 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_37970 18473 17295 gene locus_tag LOCUS_37980 18473 17295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 18777 20072 gene locus_tag LOCUS_37990 18777 20072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_37990 20243 20620 gene locus_tag LOCUS_38000 20243 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 20673 21575 gene locus_tag LOCUS_38010 20673 21575 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_38010 24085 21686 gene locus_tag LOCUS_38020 24085 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_38020 24394 25401 gene locus_tag LOCUS_38030 24394 25401 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119033.1 protein_id gnl|my_center|LOCUS_38030 25526 26371 gene locus_tag LOCUS_38040 25526 26371 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_38040 26506 27666 gene locus_tag LOCUS_38050 26506 27666 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582756.1 protein_id gnl|my_center|LOCUS_38050 28568 27834 gene locus_tag LOCUS_38060 28568 27834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 29900 28701 gene locus_tag LOCUS_38070 29900 28701 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_38070 30292 31203 gene locus_tag LOCUS_38080 30292 31203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 >Feature sequence115 456 1157 gene locus_tag LOCUS_38090 456 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 1291 2016 gene locus_tag LOCUS_38100 1291 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 2038 3069 gene locus_tag LOCUS_38110 2038 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 3249 4349 gene locus_tag LOCUS_38120 3249 4349 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_38120 4488 5636 gene locus_tag LOCUS_38130 gene hgcA 4488 5636 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_38130 5671 5982 gene locus_tag LOCUS_38140 gene hgcB 5671 5982 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_38140 6124 7119 gene locus_tag LOCUS_38150 6124 7119 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_38150 7480 7974 gene locus_tag LOCUS_38160 7480 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 7971 9269 gene locus_tag LOCUS_38170 7971 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 11297 9243 gene locus_tag LOCUS_38180 11297 9243 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_38180 12917 11556 gene locus_tag LOCUS_38190 12917 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 13054 14202 gene locus_tag LOCUS_38200 13054 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 14320 14931 gene locus_tag LOCUS_38210 14320 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 15076 15591 gene locus_tag LOCUS_38220 15076 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 15759 16643 gene locus_tag LOCUS_38230 15759 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 16654 18768 gene locus_tag LOCUS_38240 16654 18768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 18845 19645 gene locus_tag LOCUS_38250 18845 19645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 21022 19652 gene locus_tag LOCUS_38260 21022 19652 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_38260 22502 21192 gene locus_tag LOCUS_38270 22502 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 23287 22703 gene locus_tag LOCUS_38280 23287 22703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 23816 24025 gene locus_tag LOCUS_38290 23816 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 25786 24056 gene locus_tag LOCUS_38300 25786 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 26068 29343 gene locus_tag LOCUS_38310 26068 29343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 29532 31058 gene locus_tag LOCUS_38320 29532 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence116 4899 3895 gene locus_tag LOCUS_38330 4899 3895 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_38330 5241 5735 gene locus_tag LOCUS_38340 5241 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 5728 5919 gene locus_tag LOCUS_38350 5728 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 7515 6037 gene locus_tag LOCUS_38360 7515 6037 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926026.1 protein_id gnl|my_center|LOCUS_38360 9339 7825 gene locus_tag LOCUS_38370 9339 7825 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_38370 11275 9539 gene locus_tag LOCUS_38380 11275 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 13737 11275 gene locus_tag LOCUS_38390 13737 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 14970 13897 gene locus_tag LOCUS_38400 14970 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 15216 16163 gene locus_tag LOCUS_38410 15216 16163 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_38410 16410 17477 gene locus_tag LOCUS_38420 16410 17477 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_38420 17431 18210 gene locus_tag LOCUS_38430 17431 18210 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_38430 18255 19457 gene locus_tag LOCUS_38440 18255 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 19697 20752 gene locus_tag LOCUS_38450 19697 20752 CDS product tRNA adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262485.1 protein_id gnl|my_center|LOCUS_38450 20928 20716 gene locus_tag LOCUS_38460 20928 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 21367 20888 gene locus_tag LOCUS_38470 21367 20888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 21745 22560 gene locus_tag LOCUS_38480 gene nagB 21745 22560 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_38480 22588 23592 gene locus_tag LOCUS_38490 22588 23592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 24702 23620 gene locus_tag LOCUS_38500 24702 23620 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_38500 25104 25268 gene locus_tag LOCUS_38510 25104 25268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 26841 25327 gene locus_tag LOCUS_38520 gene xylB 26841 25327 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_38520 27904 26864 gene locus_tag LOCUS_38530 gene gutB 27904 26864 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_38530 29136 27901 gene locus_tag LOCUS_38540 29136 27901 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905040.1 protein_id gnl|my_center|LOCUS_38540 30783 29137 gene locus_tag LOCUS_38550 30783 29137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 >Feature sequence117 134 1393 gene locus_tag LOCUS_38560 134 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 1740 3797 gene locus_tag LOCUS_38570 1740 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 3962 4783 gene locus_tag LOCUS_38580 gene lptB 3962 4783 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120303.1 protein_id gnl|my_center|LOCUS_38580 7050 4798 gene locus_tag LOCUS_38590 7050 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 7187 9010 gene locus_tag LOCUS_38600 7187 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 9034 12315 gene locus_tag LOCUS_38610 9034 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 13280 12594 gene locus_tag LOCUS_38620 13280 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 13611 14978 gene locus_tag LOCUS_38630 13611 14978 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_38630 15062 16579 gene locus_tag LOCUS_38640 15062 16579 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_38640 16764 17174 gene locus_tag LOCUS_38650 16764 17174 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_38650 18793 17243 gene locus_tag LOCUS_38660 18793 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 19085 18891 gene locus_tag LOCUS_38670 gene csrA 19085 18891 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_38670 19433 21745 gene locus_tag LOCUS_38680 19433 21745 CDS product ethanolamine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513617.1 protein_id gnl|my_center|LOCUS_38680 21981 22736 gene locus_tag LOCUS_38690 21981 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 22764 23387 gene locus_tag LOCUS_38700 22764 23387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 24374 23646 gene locus_tag LOCUS_38710 24374 23646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 24781 26016 gene locus_tag LOCUS_38720 24781 26016 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_38720 27739 26183 gene locus_tag LOCUS_38730 27739 26183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 28359 27736 gene locus_tag LOCUS_38740 28359 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 28574 30586 gene locus_tag LOCUS_38750 28574 30586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence118 1906 134 gene locus_tag LOCUS_38760 1906 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 3036 2005 gene locus_tag LOCUS_38770 3036 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 3517 3245 gene locus_tag LOCUS_38780 3517 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 4447 3551 gene locus_tag LOCUS_38790 4447 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 5142 4534 gene locus_tag LOCUS_38800 5142 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 6645 5467 gene locus_tag LOCUS_38810 6645 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 7228 6626 gene locus_tag LOCUS_38820 7228 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 8911 7613 gene locus_tag LOCUS_38830 8911 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 9375 9962 gene locus_tag LOCUS_38840 9375 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 10310 11233 gene locus_tag LOCUS_38850 10310 11233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 11466 12635 gene locus_tag LOCUS_38860 11466 12635 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830450.1 protein_id gnl|my_center|LOCUS_38860 12890 13318 gene locus_tag LOCUS_38870 12890 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38870 13352 13990 gene locus_tag LOCUS_38880 13352 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38880 14950 14018 gene locus_tag LOCUS_38890 14950 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_38890 16091 14985 gene locus_tag LOCUS_38900 16091 14985 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 protein_id gnl|my_center|LOCUS_38900 17595 16153 gene locus_tag LOCUS_38910 17595 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 17971 20319 gene locus_tag LOCUS_38920 17971 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 20383 21786 gene locus_tag LOCUS_38930 20383 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 21840 23246 gene locus_tag LOCUS_38940 21840 23246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 23306 24769 gene locus_tag LOCUS_38950 23306 24769 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_38950 25018 25983 gene locus_tag LOCUS_38960 25018 25983 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_38960 25980 28295 gene locus_tag LOCUS_38970 25980 28295 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_38970 28422 28961 gene locus_tag LOCUS_38980 28422 28961 CDS product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121594.1 protein_id gnl|my_center|LOCUS_38980 29005 30792 gene locus_tag LOCUS_38990 29005 30792 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921899.1 protein_id gnl|my_center|LOCUS_38990 >Feature sequence119 920 4396 gene locus_tag LOCUS_39000 920 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 4556 5731 gene locus_tag LOCUS_39010 gene nagA 4556 5731 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_39010 5835 7163 gene locus_tag LOCUS_39020 5835 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 7223 7591 gene locus_tag LOCUS_39030 7223 7591 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_39030 7698 8735 gene locus_tag LOCUS_39040 gene lgoD 7698 8735 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106030.1 protein_id gnl|my_center|LOCUS_39040 8860 10959 gene locus_tag LOCUS_39050 8860 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 12190 10994 gene locus_tag LOCUS_39060 12190 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 14095 12221 gene locus_tag LOCUS_39070 14095 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 15315 14290 gene locus_tag LOCUS_39080 gene pyrB 15315 14290 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434504.1 protein_id gnl|my_center|LOCUS_39080 15589 16683 gene locus_tag LOCUS_39090 15589 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 19000 16826 gene locus_tag LOCUS_39100 19000 16826 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_39100 19266 21554 gene locus_tag LOCUS_39110 19266 21554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 23713 21569 gene locus_tag LOCUS_39120 23713 21569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 24899 23679 gene locus_tag LOCUS_39130 24899 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120328.1 protein_id gnl|my_center|LOCUS_39130 27020 24939 gene locus_tag LOCUS_39140 27020 24939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 27891 27199 gene locus_tag LOCUS_39150 27891 27199 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223927.1 protein_id gnl|my_center|LOCUS_39150 28648 27929 gene locus_tag LOCUS_39160 28648 27929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 29855 28755 gene locus_tag LOCUS_39170 29855 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence120 2431 5652 gene locus_tag LOCUS_39180 2431 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 5796 6494 gene locus_tag LOCUS_39190 5796 6494 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_39190 6487 6906 gene locus_tag LOCUS_39200 6487 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39200 6960 7142 gene locus_tag LOCUS_39210 6960 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 8955 7243 gene locus_tag LOCUS_39220 8955 7243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_39220 10292 9318 gene locus_tag LOCUS_39230 10292 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 10422 11981 gene locus_tag LOCUS_39240 10422 11981 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121439.1 protein_id gnl|my_center|LOCUS_39240 12000 13445 gene locus_tag LOCUS_39250 12000 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 16503 13471 gene locus_tag LOCUS_39260 16503 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 19747 16532 gene locus_tag LOCUS_39270 19747 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 20930 19779 gene locus_tag LOCUS_39280 20930 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 21193 23604 gene locus_tag LOCUS_39290 21193 23604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 23950 23753 gene locus_tag LOCUS_39300 23950 23753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 24117 24683 gene locus_tag LOCUS_39310 24117 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 24691 26214 gene locus_tag LOCUS_39320 24691 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 26266 29961 gene locus_tag LOCUS_39330 26266 29961 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_39330 >Feature sequence121 565 1308 gene locus_tag LOCUS_39340 565 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 3560 1332 gene locus_tag LOCUS_39350 3560 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 4685 3645 gene locus_tag LOCUS_39360 4685 3645 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_39360 4906 6084 gene locus_tag LOCUS_39370 4906 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 6081 6419 gene locus_tag LOCUS_39380 6081 6419 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_39380 6477 6890 gene locus_tag LOCUS_39390 6477 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 8455 6887 gene locus_tag LOCUS_39400 8455 6887 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328293.1 protein_id gnl|my_center|LOCUS_39400 9463 9089 gene locus_tag LOCUS_39410 9463 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39410 9774 9445 gene locus_tag LOCUS_39420 9774 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39420 10300 9758 gene locus_tag LOCUS_39430 10300 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 10428 10595 gene locus_tag LOCUS_39440 10428 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 10622 11014 gene locus_tag LOCUS_39450 10622 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 11715 11320 gene locus_tag LOCUS_39460 11715 11320 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919719.1 protein_id gnl|my_center|LOCUS_39460 13948 11756 gene locus_tag LOCUS_39470 13948 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 15288 14062 gene locus_tag LOCUS_39480 15288 14062 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121827.1 protein_id gnl|my_center|LOCUS_39480 15558 15998 gene locus_tag LOCUS_39490 15558 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 15995 17026 gene locus_tag LOCUS_39500 gene rlmN 15995 17026 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_39500 17669 17187 gene locus_tag LOCUS_39510 gene queD 17669 17187 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_39510 18007 17666 gene locus_tag LOCUS_39520 18007 17666 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_39520 19014 18028 gene locus_tag LOCUS_39530 gene folE2 19014 18028 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 protein_id gnl|my_center|LOCUS_39530 19375 19088 gene locus_tag LOCUS_39540 19375 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 19498 20367 gene locus_tag LOCUS_39550 19498 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 20367 21107 gene locus_tag LOCUS_39560 20367 21107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 21351 22460 gene locus_tag LOCUS_39570 21351 22460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 22839 22450 gene locus_tag LOCUS_39580 22839 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 24105 22939 gene locus_tag LOCUS_39590 24105 22939 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921425.1 protein_id gnl|my_center|LOCUS_39590 24708 24217 gene locus_tag LOCUS_39600 24708 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 26651 24720 gene locus_tag LOCUS_39610 gene hemE 26651 24720 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121588.1 protein_id gnl|my_center|LOCUS_39610 26688 27989 gene locus_tag LOCUS_39620 26688 27989 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122798.1 protein_id gnl|my_center|LOCUS_39620 28000 30519 gene locus_tag LOCUS_39630 28000 30519 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922339.1 protein_id gnl|my_center|LOCUS_39630 30494 30808 gene locus_tag LOCUS_39640 30494 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 >Feature sequence122 620 126 gene locus_tag LOCUS_39650 620 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 1402 617 gene locus_tag LOCUS_39660 1402 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 1542 3302 gene locus_tag LOCUS_39670 1542 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 3709 3443 gene locus_tag LOCUS_39680 3709 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 3862 4506 gene locus_tag LOCUS_39690 gene rpe 3862 4506 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118429.1 protein_id gnl|my_center|LOCUS_39690 4522 5100 gene locus_tag LOCUS_39700 4522 5100 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332332.1 protein_id gnl|my_center|LOCUS_39700 5156 5992 gene locus_tag LOCUS_39710 gene accD 5156 5992 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_39710 5994 6869 gene locus_tag LOCUS_39720 5994 6869 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_39720 6873 8273 gene locus_tag LOCUS_39730 gene thrC 6873 8273 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_39730 8276 9073 gene locus_tag LOCUS_39740 gene dapB 8276 9073 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_39740 9291 10610 gene locus_tag LOCUS_39750 9291 10610 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 protein_id gnl|my_center|LOCUS_39750 10882 13152 gene locus_tag LOCUS_39760 10882 13152 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922898.1 protein_id gnl|my_center|LOCUS_39760 13405 13788 gene locus_tag LOCUS_39770 13405 13788 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_39770 13850 14731 gene locus_tag LOCUS_39780 13850 14731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_39780 14747 16351 gene locus_tag LOCUS_39790 14747 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 16496 17365 gene locus_tag LOCUS_39800 16496 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 20325 17362 gene locus_tag LOCUS_39810 20325 17362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 20459 21535 gene locus_tag LOCUS_39820 20459 21535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 21729 23483 gene locus_tag LOCUS_39830 21729 23483 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_39830 24918 23584 gene locus_tag LOCUS_39840 24918 23584 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_39840 25795 24956 gene locus_tag LOCUS_39850 25795 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 26548 26874 gene locus_tag LOCUS_39860 26548 26874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 26871 27869 gene locus_tag LOCUS_39870 26871 27869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 27998 28156 gene locus_tag LOCUS_39880 27998 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 28410 29582 gene locus_tag LOCUS_39890 28410 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 >Feature sequence123 924 469 gene locus_tag LOCUS_39900 924 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 2771 957 gene locus_tag LOCUS_39910 2771 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 4649 2814 gene locus_tag LOCUS_39920 4649 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 5498 4791 gene locus_tag LOCUS_39930 5498 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 5921 9121 gene locus_tag LOCUS_39940 5921 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 9887 9156 gene locus_tag LOCUS_39950 9887 9156 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326130.1 protein_id gnl|my_center|LOCUS_39950 10756 9890 gene locus_tag LOCUS_39960 10756 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 11028 11333 gene locus_tag LOCUS_39970 11028 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 11487 11684 gene locus_tag LOCUS_39980 11487 11684 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_39980 11953 12294 gene locus_tag LOCUS_39990 11953 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 12458 12613 gene locus_tag LOCUS_40000 12458 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 12675 12890 gene locus_tag LOCUS_40010 12675 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 13107 13385 gene locus_tag LOCUS_40020 13107 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 13511 13861 gene locus_tag LOCUS_40030 13511 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 14133 16175 gene locus_tag LOCUS_40040 14133 16175 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_40040 17807 16215 gene locus_tag LOCUS_40050 17807 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_40050 17953 20022 gene locus_tag LOCUS_40060 17953 20022 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_40060 20157 21308 gene locus_tag LOCUS_40070 gene rhaT 20157 21308 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 protein_id gnl|my_center|LOCUS_40070 21331 22344 gene locus_tag LOCUS_40080 21331 22344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 22886 22401 gene locus_tag LOCUS_40090 22886 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 23070 24416 gene locus_tag LOCUS_40100 23070 24416 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_40100 24439 27501 gene locus_tag LOCUS_40110 24439 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 27620 27426 gene locus_tag LOCUS_40120 27620 27426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 30368 27648 gene locus_tag LOCUS_40130 30368 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence124 200 655 gene locus_tag LOCUS_40140 gene tnpA 200 655 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_40140 808 1620 gene locus_tag LOCUS_40150 808 1620 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_40150 5965 1736 gene locus_tag LOCUS_40160 5965 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 7206 5962 gene locus_tag LOCUS_40170 7206 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 11348 7398 gene locus_tag LOCUS_40180 11348 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 12308 11523 gene locus_tag LOCUS_40190 12308 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 14901 12439 gene locus_tag LOCUS_40200 14901 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 18271 15176 gene locus_tag LOCUS_40210 18271 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 18491 22576 gene locus_tag LOCUS_40220 18491 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 23031 26003 gene locus_tag LOCUS_40230 23031 26003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 27013 26150 gene locus_tag LOCUS_40240 27013 26150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 28297 27260 gene locus_tag LOCUS_40250 28297 27260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 30150 28744 gene locus_tag LOCUS_40260 30150 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence125 1388 762 gene locus_tag LOCUS_40270 1388 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 2104 1385 gene locus_tag LOCUS_40280 2104 1385 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814769.1 protein_id gnl|my_center|LOCUS_40280 4245 2152 gene locus_tag LOCUS_40290 4245 2152 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_40290 4421 5383 gene locus_tag LOCUS_40300 4421 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 5499 6794 gene locus_tag LOCUS_40310 5499 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 6861 9074 gene locus_tag LOCUS_40320 6861 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 9892 9245 gene locus_tag LOCUS_40330 9892 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 12907 9917 gene locus_tag LOCUS_40340 12907 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 13124 14605 gene locus_tag LOCUS_40350 13124 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 14669 17509 gene locus_tag LOCUS_40360 14669 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 18045 21446 gene locus_tag LOCUS_40370 18045 21446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 21631 22818 gene locus_tag LOCUS_40380 21631 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 22932 23402 gene locus_tag LOCUS_40390 22932 23402 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_40390 23505 25574 gene locus_tag LOCUS_40400 23505 25574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 26007 25618 gene locus_tag LOCUS_40410 26007 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 27120 26284 gene locus_tag LOCUS_40420 27120 26284 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_40420 27369 27596 gene locus_tag LOCUS_40430 27369 27596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 29170 27779 gene locus_tag LOCUS_40440 29170 27779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 >Feature sequence126 1151 717 gene locus_tag LOCUS_40450 1151 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 3085 1187 gene locus_tag LOCUS_40460 3085 1187 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_40460 6345 3223 gene locus_tag LOCUS_40470 6345 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 6734 6342 gene locus_tag LOCUS_40480 6734 6342 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_40480 7266 7772 gene locus_tag LOCUS_40490 gene sigL 7266 7772 CDS product sigma-70 family RNA polymerase sigma factor SigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403731.1 protein_id gnl|my_center|LOCUS_40490 7782 8330 gene locus_tag LOCUS_40500 7782 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 8360 9592 gene locus_tag LOCUS_40510 8360 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 9864 10976 gene locus_tag LOCUS_40520 9864 10976 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121993.1 protein_id gnl|my_center|LOCUS_40520 11272 11066 gene locus_tag LOCUS_40530 11272 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 11460 11768 gene locus_tag LOCUS_40540 11460 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 12030 14636 gene locus_tag LOCUS_40550 12030 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 14683 17484 gene locus_tag LOCUS_40560 14683 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 19109 17451 gene locus_tag LOCUS_40570 19109 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 19263 20303 gene locus_tag LOCUS_40580 19263 20303 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_40580 20383 21789 gene locus_tag LOCUS_40590 20383 21789 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_40590 21949 24234 gene locus_tag LOCUS_40600 21949 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 25552 24254 gene locus_tag LOCUS_40610 25552 24254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 25806 25603 gene locus_tag LOCUS_40620 25806 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 25892 27157 gene locus_tag LOCUS_40630 25892 27157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 27504 27683 gene locus_tag LOCUS_40640 27504 27683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 27673 28146 gene locus_tag LOCUS_40650 27673 28146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 28276 29565 gene locus_tag LOCUS_40660 28276 29565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 29631 29945 gene locus_tag LOCUS_40670 29631 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 >Feature sequence127 556 1668 gene locus_tag LOCUS_40680 556 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 7457 1731 gene locus_tag LOCUS_40690 7457 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 8993 8070 gene locus_tag LOCUS_40700 8993 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 10011 9025 gene locus_tag LOCUS_40710 10011 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 10829 10488 gene locus_tag LOCUS_40720 10829 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 10922 12760 gene locus_tag LOCUS_40730 10922 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 12812 16591 gene locus_tag LOCUS_40740 12812 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 16640 17695 gene locus_tag LOCUS_40750 16640 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 20165 17889 gene locus_tag LOCUS_40760 20165 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 23786 20178 gene locus_tag LOCUS_40770 23786 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 24195 23950 gene locus_tag LOCUS_40780 24195 23950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 25498 24455 gene locus_tag LOCUS_40790 25498 24455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 28039 25538 gene locus_tag LOCUS_40800 28039 25538 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_40800 30020 28119 gene locus_tag LOCUS_40810 30020 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence128 3030 2761 gene locus_tag LOCUS_40820 3030 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 3065 4990 gene locus_tag LOCUS_40830 3065 4990 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_40830 6658 5117 gene locus_tag LOCUS_40840 6658 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 9882 6655 gene locus_tag LOCUS_40850 9882 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 10053 11009 gene locus_tag LOCUS_40860 10053 11009 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_40860 12725 11103 gene locus_tag LOCUS_40870 12725 11103 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_40870 12699 13169 gene locus_tag LOCUS_40880 12699 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 13386 16280 gene locus_tag LOCUS_40890 13386 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 16253 16504 gene locus_tag LOCUS_40900 16253 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 16581 17621 gene locus_tag LOCUS_40910 16581 17621 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057409.1 protein_id gnl|my_center|LOCUS_40910 17893 18996 gene locus_tag LOCUS_40920 17893 18996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 19154 19801 gene locus_tag LOCUS_40930 19154 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 21194 19848 gene locus_tag LOCUS_40940 21194 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 21409 23199 gene locus_tag LOCUS_40950 21409 23199 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260568.1 protein_id gnl|my_center|LOCUS_40950 23563 24522 gene locus_tag LOCUS_40960 23563 24522 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210024.1 protein_id gnl|my_center|LOCUS_40960 26004 24883 gene locus_tag LOCUS_40970 26004 24883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 26033 26401 gene locus_tag LOCUS_40980 26033 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 26651 29323 gene locus_tag LOCUS_40990 26651 29323 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041976239.1 protein_id gnl|my_center|LOCUS_40990 >Feature sequence129 1156 83 gene locus_tag LOCUS_41000 1156 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 2165 1299 gene locus_tag LOCUS_41010 2165 1299 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_41010 2893 2438 gene locus_tag LOCUS_41020 2893 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 3666 3040 gene locus_tag LOCUS_41030 3666 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4347 3871 gene locus_tag LOCUS_41040 4347 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 5214 6206 gene locus_tag LOCUS_41050 5214 6206 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_41050 13254 6436 gene locus_tag LOCUS_41060 13254 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 13685 13266 gene locus_tag LOCUS_41070 13685 13266 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_41070 14791 13829 gene locus_tag LOCUS_41080 14791 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 18329 15105 gene locus_tag LOCUS_41090 18329 15105 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123552.1 protein_id gnl|my_center|LOCUS_41090 18535 19590 gene locus_tag LOCUS_41100 18535 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 19849 21417 gene locus_tag LOCUS_41110 19849 21417 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338343.1 protein_id gnl|my_center|LOCUS_41110 22496 21414 gene locus_tag LOCUS_41120 22496 21414 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_41120 23660 22677 gene locus_tag LOCUS_41130 23660 22677 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_41130 24934 23690 gene locus_tag LOCUS_41140 24934 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 25565 24972 gene locus_tag LOCUS_41150 gene leuD 25565 24972 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_41150 27112 25694 gene locus_tag LOCUS_41160 gene leuC 27112 25694 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_41160 27401 28699 gene locus_tag LOCUS_41170 27401 28699 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence130 <1 1167 gene locus_tag LOCUS_41180 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121664.1:sulfatase-like hydrolase/transferase 1242 2258 gene locus_tag LOCUS_41190 1242 2258 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 protein_id gnl|my_center|LOCUS_41190 5741 2259 gene locus_tag LOCUS_41200 5741 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 6110 6496 gene locus_tag LOCUS_41210 6110 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 6547 9540 gene locus_tag LOCUS_41220 6547 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 9644 11023 gene locus_tag LOCUS_41230 9644 11023 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_41230 13306 10979 gene locus_tag LOCUS_41240 13306 10979 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_41240 13534 14541 gene locus_tag LOCUS_41250 13534 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 14874 14548 gene locus_tag LOCUS_41260 14874 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 15187 14855 gene locus_tag LOCUS_41270 15187 14855 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_41270 17656 15266 gene locus_tag LOCUS_41280 17656 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 17970 19676 gene locus_tag LOCUS_41290 17970 19676 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922030.1 protein_id gnl|my_center|LOCUS_41290 19673 20362 gene locus_tag LOCUS_41300 19673 20362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_41300 20377 20541 gene locus_tag LOCUS_41310 20377 20541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 21494 20646 gene locus_tag LOCUS_41320 21494 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 22163 21495 gene locus_tag LOCUS_41330 22163 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 23666 22203 gene locus_tag LOCUS_41340 23666 22203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 24837 23659 gene locus_tag LOCUS_41350 24837 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 25387 24869 gene locus_tag LOCUS_41360 25387 24869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 26503 25778 gene locus_tag LOCUS_41370 26503 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 26875 26579 gene locus_tag LOCUS_41380 26875 26579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 28103 27066 gene locus_tag LOCUS_41390 28103 27066 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_41390 <29406 28281 gene locus_tag LOCUS_41400 <29406 28281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788846.1:uroporphyrinogen decarboxylase family protein >Feature sequence131 67 825 gene locus_tag LOCUS_41410 67 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 822 1256 gene locus_tag LOCUS_41420 822 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 4405 1307 gene locus_tag LOCUS_41430 4405 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 5780 4848 gene locus_tag LOCUS_41440 5780 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 11050 5840 gene locus_tag LOCUS_41450 11050 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 13187 11268 gene locus_tag LOCUS_41460 13187 11268 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122938.1 protein_id gnl|my_center|LOCUS_41460 13417 14262 gene locus_tag LOCUS_41470 13417 14262 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327143.1 protein_id gnl|my_center|LOCUS_41470 14364 15008 gene locus_tag LOCUS_41480 gene rsmG 14364 15008 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334161.1 protein_id gnl|my_center|LOCUS_41480 15152 16303 gene locus_tag LOCUS_41490 15152 16303 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_41490 16451 17368 gene locus_tag LOCUS_41500 16451 17368 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_41500 17393 18370 gene locus_tag LOCUS_41510 17393 18370 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_41510 18401 19084 gene locus_tag LOCUS_41520 gene deoC 18401 19084 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_41520 19508 20806 gene locus_tag LOCUS_41530 19508 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 21060 21941 gene locus_tag LOCUS_41540 21060 21941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120295.1 protein_id gnl|my_center|LOCUS_41540 21941 23806 gene locus_tag LOCUS_41550 21941 23806 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_41550 24453 26105 gene locus_tag LOCUS_41560 gene rny 24453 26105 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 protein_id gnl|my_center|LOCUS_41560 26109 26921 gene locus_tag LOCUS_41570 26109 26921 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118627.1 protein_id gnl|my_center|LOCUS_41570 27470 28132 gene locus_tag LOCUS_41580 27470 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 >Feature sequence132 2061 1438 gene locus_tag LOCUS_41590 2061 1438 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_41590 3332 2274 gene locus_tag LOCUS_41600 3332 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769801.1 protein_id gnl|my_center|LOCUS_41600 4820 3381 gene locus_tag LOCUS_41610 4820 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 6112 4817 gene locus_tag LOCUS_41620 6112 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 6301 8475 gene locus_tag LOCUS_41630 6301 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 8542 9615 gene locus_tag LOCUS_41640 8542 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 10038 9661 gene locus_tag LOCUS_41650 10038 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 10395 12707 gene locus_tag LOCUS_41660 10395 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_41660 12827 13813 gene locus_tag LOCUS_41670 12827 13813 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_41670 17185 13832 gene locus_tag LOCUS_41680 17185 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 19539 17221 gene locus_tag LOCUS_41690 19539 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 20721 19810 gene locus_tag LOCUS_41700 20721 19810 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_41700 22192 20768 gene locus_tag LOCUS_41710 22192 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 23356 23072 gene locus_tag LOCUS_41720 23356 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 23816 23950 gene locus_tag LOCUS_41730 23816 23950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 24235 24011 gene locus_tag LOCUS_41740 24235 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 24299 25183 gene locus_tag LOCUS_41750 24299 25183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 25375 26691 gene locus_tag LOCUS_41760 25375 26691 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_41760 27775 26714 gene locus_tag LOCUS_41770 27775 26714 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_41770 28457 27762 gene locus_tag LOCUS_41780 28457 27762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_41780 >Feature sequence133 1570 1746 gene locus_tag LOCUS_41790 1570 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 1795 2298 gene locus_tag LOCUS_41800 1795 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 2660 3106 gene locus_tag LOCUS_41810 2660 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 3241 3744 gene locus_tag LOCUS_41820 3241 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 4921 5274 gene locus_tag LOCUS_41830 4921 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 5378 6388 gene locus_tag LOCUS_41840 5378 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 6513 6875 gene locus_tag LOCUS_41850 6513 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 6883 7308 gene locus_tag LOCUS_41860 6883 7308 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_41860 7404 9101 gene locus_tag LOCUS_41870 7404 9101 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_41870 9107 9814 gene locus_tag LOCUS_41880 9107 9814 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704178.1 protein_id gnl|my_center|LOCUS_41880 9811 11268 gene locus_tag LOCUS_41890 9811 11268 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_41890 11460 13205 gene locus_tag LOCUS_41900 11460 13205 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_41900 16704 13405 gene locus_tag LOCUS_41910 16704 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 17024 18475 gene locus_tag LOCUS_41920 17024 18475 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_41920 18505 20091 gene locus_tag LOCUS_41930 18505 20091 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261373.1 protein_id gnl|my_center|LOCUS_41930 20302 23655 gene locus_tag LOCUS_41940 20302 23655 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_41940 24296 23856 gene locus_tag LOCUS_41950 gene rpiB 24296 23856 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_41950 25407 24301 gene locus_tag LOCUS_41960 25407 24301 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_41960 26438 25728 gene locus_tag LOCUS_41970 26438 25728 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 protein_id gnl|my_center|LOCUS_41970 28150 26453 gene locus_tag LOCUS_41980 28150 26453 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_41980 28538 28167 gene locus_tag LOCUS_41990 28538 28167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 29016 28654 gene locus_tag LOCUS_42000 29016 28654 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324404.1 protein_id gnl|my_center|LOCUS_42000 >Feature sequence134 1889 2173 gene locus_tag LOCUS_42010 1889 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 2189 3364 gene locus_tag LOCUS_42020 2189 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616078.1 protein_id gnl|my_center|LOCUS_42020 3361 6525 gene locus_tag LOCUS_42030 3361 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 9934 6590 gene locus_tag LOCUS_42040 9934 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 10048 10350 gene locus_tag LOCUS_42050 10048 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 10490 10708 gene locus_tag LOCUS_42060 10490 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 11362 11784 gene locus_tag LOCUS_42070 11362 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 11919 12239 gene locus_tag LOCUS_42080 11919 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 12544 12762 gene locus_tag LOCUS_42090 12544 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 12987 12820 gene locus_tag LOCUS_42100 12987 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 16047 13636 gene locus_tag LOCUS_42110 16047 13636 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_42110 19425 16138 gene locus_tag LOCUS_42120 19425 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 19837 19520 gene locus_tag LOCUS_42130 19837 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 20124 21194 gene locus_tag LOCUS_42140 20124 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 21207 22232 gene locus_tag LOCUS_42150 21207 22232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 23717 22239 gene locus_tag LOCUS_42160 23717 22239 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_42160 23943 25991 gene locus_tag LOCUS_42170 23943 25991 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_42170 27734 26127 gene locus_tag LOCUS_42180 27734 26127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 <28798 27768 gene locus_tag LOCUS_42190 <28798 27768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123802.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence135 2022 628 gene locus_tag LOCUS_42200 2022 628 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_42200 4030 2210 gene locus_tag LOCUS_42210 4030 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 5334 4315 gene locus_tag LOCUS_42220 5334 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 6230 5433 gene locus_tag LOCUS_42230 6230 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 7937 6654 gene locus_tag LOCUS_42240 7937 6654 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263340.1 protein_id gnl|my_center|LOCUS_42240 8000 8200 gene locus_tag LOCUS_42250 8000 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 9979 8213 gene locus_tag LOCUS_42260 9979 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 11129 9876 gene locus_tag LOCUS_42270 11129 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 12015 14315 gene locus_tag LOCUS_42280 12015 14315 CDS product N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086331.1 protein_id gnl|my_center|LOCUS_42280 14587 14823 gene locus_tag LOCUS_42290 14587 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 14820 15269 gene locus_tag LOCUS_42300 14820 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 15273 16592 gene locus_tag LOCUS_42310 15273 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 16653 16955 gene locus_tag LOCUS_42320 16653 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 16998 17729 gene locus_tag LOCUS_42330 16998 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 17747 18370 gene locus_tag LOCUS_42340 gene atpH 17747 18370 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816489.1 protein_id gnl|my_center|LOCUS_42340 18383 19918 gene locus_tag LOCUS_42350 gene atpA 18383 19918 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_42350 20039 20938 gene locus_tag LOCUS_42360 gene atpG 20039 20938 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_42360 21002 22453 gene locus_tag LOCUS_42370 gene atpD 21002 22453 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_42370 22460 22861 gene locus_tag LOCUS_42380 22460 22861 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 protein_id gnl|my_center|LOCUS_42380 23160 23543 gene locus_tag LOCUS_42390 gene hisI 23160 23543 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_42390 23550 24428 gene locus_tag LOCUS_42400 gene hisG 23550 24428 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_42400 24699 25415 gene locus_tag LOCUS_42410 24699 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 27466 25748 gene locus_tag LOCUS_42420 gene putP 27466 25748 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776955.1 protein_id gnl|my_center|LOCUS_42420 <28635 27632 gene locus_tag LOCUS_42430 <28635 27632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119313.1:sialidase family protein >Feature sequence136 182 643 gene locus_tag LOCUS_42440 gene ruvX 182 643 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_42440 1213 650 gene locus_tag LOCUS_42450 1213 650 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_42450 1611 2810 gene locus_tag LOCUS_42460 gene larC 1611 2810 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122655.1 protein_id gnl|my_center|LOCUS_42460 2785 3666 gene locus_tag LOCUS_42470 2785 3666 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_42470 3647 6628 gene locus_tag LOCUS_42480 gene purL 3647 6628 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_42480 6664 7440 gene locus_tag LOCUS_42490 6664 7440 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_42490 9537 7513 gene locus_tag LOCUS_42500 9537 7513 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_42500 9761 12190 gene locus_tag LOCUS_42510 9761 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 12310 14337 gene locus_tag LOCUS_42520 12310 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 15125 14334 gene locus_tag LOCUS_42530 15125 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 18361 15320 gene locus_tag LOCUS_42540 18361 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 26094 18487 gene locus_tag LOCUS_42550 26094 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 26480 26091 gene locus_tag LOCUS_42560 26480 26091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 26834 27982 gene locus_tag LOCUS_42570 26834 27982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 >Feature sequence137 982 3009 gene locus_tag LOCUS_42580 982 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 4138 3086 gene locus_tag LOCUS_42590 4138 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 5183 4131 gene locus_tag LOCUS_42600 5183 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 6550 5183 gene locus_tag LOCUS_42610 6550 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 13542 6784 gene locus_tag LOCUS_42620 13542 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 14219 13809 gene locus_tag LOCUS_42630 14219 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 15824 14814 gene locus_tag LOCUS_42640 15824 14814 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_42640 19739 15870 gene locus_tag LOCUS_42650 19739 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 20489 19827 gene locus_tag LOCUS_42660 20489 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 21104 20553 gene locus_tag LOCUS_42670 21104 20553 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_42670 22194 21385 gene locus_tag LOCUS_42680 22194 21385 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211232185.1 protein_id gnl|my_center|LOCUS_42680 23198 22191 gene locus_tag LOCUS_42690 23198 22191 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089653.1 protein_id gnl|my_center|LOCUS_42690 24106 23303 gene locus_tag LOCUS_42700 24106 23303 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339509.1 protein_id gnl|my_center|LOCUS_42700 25158 24151 gene locus_tag LOCUS_42710 25158 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 25383 25171 gene locus_tag LOCUS_42720 25383 25171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 27069 25540 gene locus_tag LOCUS_42730 27069 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 27773 27066 gene locus_tag LOCUS_42740 27773 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 <28515 28005 gene locus_tag LOCUS_42750 <28515 28005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435072.1:DUF1559 domain-containing protein note possible pseudo, internal stop codon >Feature sequence138 1171 2214 gene locus_tag LOCUS_42760 1171 2214 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_42760 3518 2361 gene locus_tag LOCUS_42770 3518 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 4305 3835 gene locus_tag LOCUS_42780 4305 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 5618 4509 gene locus_tag LOCUS_42790 5618 4509 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122217.1 protein_id gnl|my_center|LOCUS_42790 7378 5615 gene locus_tag LOCUS_42800 gene recJ 7378 5615 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_42800 7584 7405 gene locus_tag LOCUS_42810 gene rpmG 7584 7405 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324504.1 protein_id gnl|my_center|LOCUS_42810 7996 9555 gene locus_tag LOCUS_42820 7996 9555 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_42820 9939 10502 gene locus_tag LOCUS_42830 gene cyaB 9939 10502 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120856.1 protein_id gnl|my_center|LOCUS_42830 10678 11271 gene locus_tag LOCUS_42840 10678 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 11498 11295 gene locus_tag LOCUS_42850 11498 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 12577 11495 gene locus_tag LOCUS_42860 12577 11495 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_42860 13901 12753 gene locus_tag LOCUS_42870 13901 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_42870 14252 15343 gene locus_tag LOCUS_42880 14252 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 15431 15640 gene locus_tag LOCUS_42890 15431 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 15732 17102 gene locus_tag LOCUS_42900 15732 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 17139 18551 gene locus_tag LOCUS_42910 gene gabT 17139 18551 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 protein_id gnl|my_center|LOCUS_42910 19950 18604 gene locus_tag LOCUS_42920 19950 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 20616 20230 gene locus_tag LOCUS_42930 20616 20230 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056975.1 protein_id gnl|my_center|LOCUS_42930 20901 21506 gene locus_tag LOCUS_42940 gene dcd 20901 21506 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_42940 23221 21806 gene locus_tag LOCUS_42950 23221 21806 CDS product ATPase with chaperone activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615735.1 protein_id gnl|my_center|LOCUS_42950 23950 23477 gene locus_tag LOCUS_42960 23950 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328560.1 protein_id gnl|my_center|LOCUS_42960 24309 24896 gene locus_tag LOCUS_42970 24309 24896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 25534 25199 gene locus_tag LOCUS_42980 25534 25199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 25476 26981 gene locus_tag LOCUS_42990 25476 26981 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_42990 28384 27059 gene locus_tag LOCUS_43000 28384 27059 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_43000 >Feature sequence139 307 1995 gene locus_tag LOCUS_43010 307 1995 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922182.1 protein_id gnl|my_center|LOCUS_43010 3872 1998 gene locus_tag LOCUS_43020 gene glmS 3872 1998 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_43020 4448 4239 gene locus_tag LOCUS_43030 4448 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 5041 4547 gene locus_tag LOCUS_43040 5041 4547 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_43040 6092 5163 gene locus_tag LOCUS_43050 6092 5163 CDS product DUF6263 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121717.1 protein_id gnl|my_center|LOCUS_43050 7079 6183 gene locus_tag LOCUS_43060 7079 6183 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_43060 8980 7076 gene locus_tag LOCUS_43070 gene dxs 8980 7076 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 protein_id gnl|my_center|LOCUS_43070 9883 8987 gene locus_tag LOCUS_43080 9883 8987 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125281.1 protein_id gnl|my_center|LOCUS_43080 10304 9936 gene locus_tag LOCUS_43090 10304 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 11221 10328 gene locus_tag LOCUS_43100 11221 10328 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_43100 13405 11405 gene locus_tag LOCUS_43110 13405 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 13827 13402 gene locus_tag LOCUS_43120 13827 13402 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_43120 14697 13837 gene locus_tag LOCUS_43130 14697 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 17731 14744 gene locus_tag LOCUS_43140 17731 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 18194 17934 gene locus_tag LOCUS_43150 18194 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 18327 18512 gene locus_tag LOCUS_43160 18327 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 18926 18666 gene locus_tag LOCUS_43170 18926 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 19179 20009 gene locus_tag LOCUS_43180 19179 20009 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336481.1 protein_id gnl|my_center|LOCUS_43180 20548 20024 gene locus_tag LOCUS_43190 20548 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 20541 20867 gene locus_tag LOCUS_43200 20541 20867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 21223 20969 gene locus_tag LOCUS_43210 21223 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 21470 21285 gene locus_tag LOCUS_43220 21470 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 23606 21672 gene locus_tag LOCUS_43230 23606 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 27218 23784 gene locus_tag LOCUS_43240 27218 23784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 <28452 27430 gene locus_tag LOCUS_43250 <28452 27430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119294.1:TonB-dependent copper receptor >Feature sequence140 2811 79 gene locus_tag LOCUS_43260 2811 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 3117 5075 gene locus_tag LOCUS_43270 3117 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 5401 7827 gene locus_tag LOCUS_43280 5401 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 7843 9489 gene locus_tag LOCUS_43290 7843 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 9651 11216 gene locus_tag LOCUS_43300 9651 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730930.1 protein_id gnl|my_center|LOCUS_43300 11355 11675 gene locus_tag LOCUS_43310 11355 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 11749 12783 gene locus_tag LOCUS_43320 11749 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 12888 14276 gene locus_tag LOCUS_43330 12888 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 15313 14939 gene locus_tag LOCUS_43340 15313 14939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 15348 18737 gene locus_tag LOCUS_43350 15348 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 19363 20244 gene locus_tag LOCUS_43360 19363 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 20426 22051 gene locus_tag LOCUS_43370 20426 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 23721 25244 gene locus_tag LOCUS_43380 23721 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 >Feature sequence141 521 1825 gene locus_tag LOCUS_43390 521 1825 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_43390 2114 3304 gene locus_tag LOCUS_43400 2114 3304 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_43400 3740 5257 gene locus_tag LOCUS_43410 3740 5257 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_43410 5433 6692 gene locus_tag LOCUS_43420 5433 6692 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_43420 6977 7231 gene locus_tag LOCUS_43430 6977 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 7869 9665 gene locus_tag LOCUS_43440 gene lepA 7869 9665 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334775.1 protein_id gnl|my_center|LOCUS_43440 9867 10706 gene locus_tag LOCUS_43450 9867 10706 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_43450 10753 12153 gene locus_tag LOCUS_43460 10753 12153 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_43460 12313 14181 gene locus_tag LOCUS_43470 gene mutL 12313 14181 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121618.1 protein_id gnl|my_center|LOCUS_43470 14313 15761 gene locus_tag LOCUS_43480 gene aroE 14313 15761 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_43480 15807 17042 gene locus_tag LOCUS_43490 15807 17042 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616111.1 protein_id gnl|my_center|LOCUS_43490 18184 17156 gene locus_tag LOCUS_43500 18184 17156 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_43500 19299 18346 gene locus_tag LOCUS_43510 19299 18346 CDS product TIGR03009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922291.1 protein_id gnl|my_center|LOCUS_43510 20530 19607 gene locus_tag LOCUS_43520 20530 19607 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817229.1 protein_id gnl|my_center|LOCUS_43520 21705 20746 gene locus_tag LOCUS_43530 21705 20746 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817229.1 protein_id gnl|my_center|LOCUS_43530 22101 21847 gene locus_tag LOCUS_43540 22101 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 22337 23314 gene locus_tag LOCUS_43550 22337 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 23583 23257 gene locus_tag LOCUS_43560 23583 23257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 23479 24342 gene locus_tag LOCUS_43570 23479 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 25366 24389 gene locus_tag LOCUS_43580 25366 24389 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401898.1 protein_id gnl|my_center|LOCUS_43580 25724 25437 gene locus_tag LOCUS_43590 25724 25437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 25659 26126 gene locus_tag LOCUS_43600 25659 26126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 26133 26822 gene locus_tag LOCUS_43610 26133 26822 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_43610 >Feature sequence142 3134 1695 gene locus_tag LOCUS_43620 3134 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 3494 6082 gene locus_tag LOCUS_43630 3494 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 6168 7481 gene locus_tag LOCUS_43640 6168 7481 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_43640 8525 7758 gene locus_tag LOCUS_43650 8525 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 11331 8995 gene locus_tag LOCUS_43660 11331 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 12622 11468 gene locus_tag LOCUS_43670 12622 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 12927 13826 gene locus_tag LOCUS_43680 12927 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 14000 14632 gene locus_tag LOCUS_43690 14000 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 14931 15194 gene locus_tag LOCUS_43700 14931 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 15334 15849 gene locus_tag LOCUS_43710 15334 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 15849 17030 gene locus_tag LOCUS_43720 15849 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 17345 17109 gene locus_tag LOCUS_43730 17345 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 17571 20306 gene locus_tag LOCUS_43740 17571 20306 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922343.1 protein_id gnl|my_center|LOCUS_43740 20328 22142 gene locus_tag LOCUS_43750 20328 22142 CDS product proprotein convertase P-domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261738.1 protein_id gnl|my_center|LOCUS_43750 23809 22565 gene locus_tag LOCUS_43760 23809 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 24274 26676 gene locus_tag LOCUS_43770 24274 26676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 26856 27881 gene locus_tag LOCUS_43780 26856 27881 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_43780 >Feature sequence143 3907 3521 gene locus_tag LOCUS_43790 3907 3521 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336246.1 protein_id gnl|my_center|LOCUS_43790 4193 4591 gene locus_tag LOCUS_43800 4193 4591 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895085.1 protein_id gnl|my_center|LOCUS_43800 4572 8444 gene locus_tag LOCUS_43810 4572 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 9556 8645 gene locus_tag LOCUS_43820 9556 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 11054 9582 gene locus_tag LOCUS_43830 11054 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 12424 11126 gene locus_tag LOCUS_43840 12424 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 12695 13957 gene locus_tag LOCUS_43850 12695 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 14051 14755 gene locus_tag LOCUS_43860 14051 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 14767 17007 gene locus_tag LOCUS_43870 14767 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 17152 17400 gene locus_tag LOCUS_43880 17152 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 17562 20168 gene locus_tag LOCUS_43890 17562 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 20510 21319 gene locus_tag LOCUS_43900 20510 21319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 21387 21746 gene locus_tag LOCUS_43910 21387 21746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 21823 23385 gene locus_tag LOCUS_43920 gene putP 21823 23385 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891939.1 protein_id gnl|my_center|LOCUS_43920 23476 24993 gene locus_tag LOCUS_43930 23476 24993 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_43930 25505 25098 gene locus_tag LOCUS_43940 25505 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 25827 25486 gene locus_tag LOCUS_43950 25827 25486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 27392 26112 gene locus_tag LOCUS_43960 27392 26112 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123548.1 protein_id gnl|my_center|LOCUS_43960 >Feature sequence144 <1 2111 gene locus_tag LOCUS_43970 <1 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243532.1:beta-galactosidase GanA 2212 3714 gene locus_tag LOCUS_43980 2212 3714 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_43980 4670 3750 gene locus_tag LOCUS_43990 4670 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 7822 4766 gene locus_tag LOCUS_44000 7822 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 8752 7913 gene locus_tag LOCUS_44010 8752 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 8985 9758 gene locus_tag LOCUS_44020 8985 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 9787 11424 gene locus_tag LOCUS_44030 9787 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 11555 13102 gene locus_tag LOCUS_44040 11555 13102 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_44040 14934 13324 gene locus_tag LOCUS_44050 14934 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 17226 14992 gene locus_tag LOCUS_44060 17226 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 18922 17255 gene locus_tag LOCUS_44070 18922 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 19612 19055 gene locus_tag LOCUS_44080 19612 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 20787 19915 gene locus_tag LOCUS_44090 20787 19915 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_44090 21023 22048 gene locus_tag LOCUS_44100 21023 22048 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_44100 22193 23002 gene locus_tag LOCUS_44110 22193 23002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 23004 23825 gene locus_tag LOCUS_44120 23004 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 23892 24986 gene locus_tag LOCUS_44130 23892 24986 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_44130 25468 25280 gene locus_tag LOCUS_44140 25468 25280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 >Feature sequence145 <1 1835 gene locus_tag LOCUS_44150 <1 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119184.1:pre-peptidase C-terminal domain-containing protein 2003 5962 gene locus_tag LOCUS_44160 2003 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 7313 6081 gene locus_tag LOCUS_44170 7313 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 8123 7455 gene locus_tag LOCUS_44180 8123 7455 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 protein_id gnl|my_center|LOCUS_44180 8163 9680 gene locus_tag LOCUS_44190 8163 9680 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_44190 9951 13190 gene locus_tag LOCUS_44200 9951 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 13388 15109 gene locus_tag LOCUS_44210 13388 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 15139 16023 gene locus_tag LOCUS_44220 15139 16023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 16026 17522 gene locus_tag LOCUS_44230 16026 17522 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_44230 17519 18703 gene locus_tag LOCUS_44240 17519 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 19553 18897 gene locus_tag LOCUS_44250 19553 18897 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_44250 19831 22044 gene locus_tag LOCUS_44260 19831 22044 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404984.1 protein_id gnl|my_center|LOCUS_44260 22390 22602 gene locus_tag LOCUS_44270 22390 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 22674 22943 gene locus_tag LOCUS_44280 22674 22943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 23182 24222 gene locus_tag LOCUS_44290 23182 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 24344 24496 gene locus_tag LOCUS_44300 24344 24496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 25798 24614 gene locus_tag LOCUS_44310 25798 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 >Feature sequence146 5375 2382 gene locus_tag LOCUS_44320 5375 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 5943 8426 gene locus_tag LOCUS_44330 5943 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 8531 9331 gene locus_tag LOCUS_44340 8531 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 9647 10123 gene locus_tag LOCUS_44350 9647 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 10609 10199 gene locus_tag LOCUS_44360 10609 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 11045 11455 gene locus_tag LOCUS_44370 11045 11455 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_44370 11483 12946 gene locus_tag LOCUS_44380 11483 12946 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 protein_id gnl|my_center|LOCUS_44380 13143 13490 gene locus_tag LOCUS_44390 13143 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 13574 13972 gene locus_tag LOCUS_44400 13574 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 14302 16992 gene locus_tag LOCUS_44410 14302 16992 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_44410 17106 17252 gene locus_tag LOCUS_44420 17106 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 17765 20026 gene locus_tag LOCUS_44430 17765 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 20010 20408 gene locus_tag LOCUS_44440 20010 20408 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_44440 20454 20627 gene locus_tag LOCUS_44450 20454 20627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 20775 21179 gene locus_tag LOCUS_44460 20775 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 22031 21408 gene locus_tag LOCUS_44470 22031 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 22389 22063 gene locus_tag LOCUS_44480 22389 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44480 24621 22525 gene locus_tag LOCUS_44490 24621 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 25053 25712 gene locus_tag LOCUS_44500 25053 25712 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_44500 25789 26841 gene locus_tag LOCUS_44510 25789 26841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 26834 27424 gene locus_tag LOCUS_44520 26834 27424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 >Feature sequence147 877 1620 gene locus_tag LOCUS_44530 877 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 2503 2877 gene locus_tag LOCUS_44540 2503 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 3107 2838 gene locus_tag LOCUS_44550 3107 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 3393 4061 gene locus_tag LOCUS_44560 3393 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 4217 5752 gene locus_tag LOCUS_44570 4217 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 5858 6235 gene locus_tag LOCUS_44580 5858 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 6610 7341 gene locus_tag LOCUS_44590 6610 7341 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 protein_id gnl|my_center|LOCUS_44590 8892 7378 gene locus_tag LOCUS_44600 8892 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 9221 8889 gene locus_tag LOCUS_44610 9221 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 9108 9488 gene locus_tag LOCUS_44620 9108 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 9691 10305 gene locus_tag LOCUS_44630 9691 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 11669 10452 gene locus_tag LOCUS_44640 11669 10452 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921859.1 protein_id gnl|my_center|LOCUS_44640 13072 11951 gene locus_tag LOCUS_44650 13072 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921966.1 protein_id gnl|my_center|LOCUS_44650 13872 13069 gene locus_tag LOCUS_44660 13872 13069 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_44660 14817 13876 gene locus_tag LOCUS_44670 14817 13876 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_44670 15195 14950 gene locus_tag LOCUS_44680 15195 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 15237 17324 gene locus_tag LOCUS_44690 15237 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 17573 17364 gene locus_tag LOCUS_44700 17573 17364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 17490 18764 gene locus_tag LOCUS_44710 17490 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_44710 19119 19253 gene locus_tag LOCUS_44720 19119 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 19534 20199 gene locus_tag LOCUS_44730 19534 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44730 20203 20841 gene locus_tag LOCUS_44740 20203 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44740 20892 21092 gene locus_tag LOCUS_44750 20892 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 21472 21957 gene locus_tag LOCUS_44760 21472 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 22158 22619 gene locus_tag LOCUS_44770 22158 22619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 22964 22830 gene locus_tag LOCUS_44780 22964 22830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 23021 23629 gene locus_tag LOCUS_44790 23021 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 24113 23880 gene locus_tag LOCUS_44800 24113 23880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 24771 24301 gene locus_tag LOCUS_44810 gene rpiB 24771 24301 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_44810 25186 24920 gene locus_tag LOCUS_44820 25186 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 26102 25371 gene locus_tag LOCUS_44830 26102 25371 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582813.1 protein_id gnl|my_center|LOCUS_44830 26956 26759 gene locus_tag LOCUS_44840 26956 26759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 26992 27189 gene locus_tag LOCUS_44850 26992 27189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 >Feature sequence148 371 601 gene locus_tag LOCUS_44860 371 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 598 1020 gene locus_tag LOCUS_44870 598 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 1182 1991 gene locus_tag LOCUS_44880 1182 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 2782 2411 gene locus_tag LOCUS_44890 2782 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 3348 5564 gene locus_tag LOCUS_44900 3348 5564 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_44900 5833 6921 gene locus_tag LOCUS_44910 5833 6921 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_44910 7030 7533 gene locus_tag LOCUS_44920 gene accB 7030 7533 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_44920 7552 8895 gene locus_tag LOCUS_44930 gene accC 7552 8895 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_44930 8938 10455 gene locus_tag LOCUS_44940 gene murJ 8938 10455 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 protein_id gnl|my_center|LOCUS_44940 10467 11264 gene locus_tag LOCUS_44950 10467 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 12401 11370 gene locus_tag LOCUS_44960 12401 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 13338 12406 gene locus_tag LOCUS_44970 gene rfbD 13338 12406 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_44970 14239 13328 gene locus_tag LOCUS_44980 14239 13328 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_44980 15014 14349 gene locus_tag LOCUS_44990 15014 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 15691 15011 gene locus_tag LOCUS_45000 gene gmhB 15691 15011 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_45000 16664 15657 gene locus_tag LOCUS_45010 16664 15657 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_45010 17664 16720 gene locus_tag LOCUS_45020 17664 16720 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_45020 18347 17751 gene locus_tag LOCUS_45030 gene rfbC 18347 17751 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_45030 18472 20115 gene locus_tag LOCUS_45040 18472 20115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122878.1 protein_id gnl|my_center|LOCUS_45040 20135 21394 gene locus_tag LOCUS_45050 20135 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 23264 21357 gene locus_tag LOCUS_45060 gene asnB 23264 21357 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_45060 23438 24565 gene locus_tag LOCUS_45070 23438 24565 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921480.1 protein_id gnl|my_center|LOCUS_45070 24818 25102 gene locus_tag LOCUS_45080 24818 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 25157 25342 gene locus_tag LOCUS_45090 25157 25342 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122692.1 protein_id gnl|my_center|LOCUS_45090 25663 25588 gene locus_tag LOCUS_t00230 25663 25588 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26764 25763 gene locus_tag LOCUS_45100 26764 25763 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118761.1 protein_id gnl|my_center|LOCUS_45100 27443 26757 gene locus_tag LOCUS_45110 27443 26757 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118760.1 protein_id gnl|my_center|LOCUS_45110 >Feature sequence149 3825 3154 gene locus_tag LOCUS_45120 3825 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 4236 4445 gene locus_tag LOCUS_45130 4236 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 4381 5697 gene locus_tag LOCUS_45140 4381 5697 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_45140 5866 8130 gene locus_tag LOCUS_45150 5866 8130 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_45150 8443 10089 gene locus_tag LOCUS_45160 8443 10089 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_45160 10114 10902 gene locus_tag LOCUS_45170 10114 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 11086 12159 gene locus_tag LOCUS_45180 11086 12159 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_45180 12330 14243 gene locus_tag LOCUS_45190 12330 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 14646 15929 gene locus_tag LOCUS_45200 14646 15929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_45200 16008 17840 gene locus_tag LOCUS_45210 16008 17840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 18058 20529 gene locus_tag LOCUS_45220 18058 20529 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202078.1 protein_id gnl|my_center|LOCUS_45220 21370 20564 gene locus_tag LOCUS_45230 21370 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 22161 21367 gene locus_tag LOCUS_45240 22161 21367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 24056 22224 gene locus_tag LOCUS_45250 24056 22224 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_45250 24807 24109 gene locus_tag LOCUS_45260 24807 24109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 26074 24842 gene locus_tag LOCUS_45270 26074 24842 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_45270 <27290 26353 gene locus_tag LOCUS_45280 <27290 26353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_195899535.1:arylsulfatase >Feature sequence150 739 143 gene locus_tag LOCUS_45290 739 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 1524 4235 gene locus_tag LOCUS_45300 1524 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 4381 5772 gene locus_tag LOCUS_45310 4381 5772 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_45310 5769 6464 gene locus_tag LOCUS_45320 5769 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 6585 9299 gene locus_tag LOCUS_45330 6585 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 9393 12119 gene locus_tag LOCUS_45340 9393 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 13643 12513 gene locus_tag LOCUS_45350 13643 12513 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_45350 13959 16358 gene locus_tag LOCUS_45360 13959 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 20521 16292 gene locus_tag LOCUS_45370 20521 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 22086 20725 gene locus_tag LOCUS_45380 22086 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 22957 22196 gene locus_tag LOCUS_45390 22957 22196 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_45390 23347 24345 gene locus_tag LOCUS_45400 23347 24345 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970571.1 protein_id gnl|my_center|LOCUS_45400 24504 25718 gene locus_tag LOCUS_45410 24504 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 26263 25913 gene locus_tag LOCUS_45420 26263 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 26441 26226 gene locus_tag LOCUS_45430 26441 26226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 >Feature sequence151 323 643 gene locus_tag LOCUS_45440 323 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392788.1 protein_id gnl|my_center|LOCUS_45440 1957 647 gene locus_tag LOCUS_45450 1957 647 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_45450 2408 2770 gene locus_tag LOCUS_45460 2408 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 2841 5093 gene locus_tag LOCUS_45470 2841 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 5489 5208 gene locus_tag LOCUS_45480 5489 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 5812 6144 gene locus_tag LOCUS_45490 5812 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 6433 7515 gene locus_tag LOCUS_45500 6433 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 7560 8729 gene locus_tag LOCUS_45510 7560 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 8908 9051 gene locus_tag LOCUS_45520 8908 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 9267 9040 gene locus_tag LOCUS_45530 9267 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 10960 9323 gene locus_tag LOCUS_45540 10960 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 12638 11025 gene locus_tag LOCUS_45550 12638 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 13026 12793 gene locus_tag LOCUS_45560 13026 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 12980 17344 gene locus_tag LOCUS_45570 12980 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 17357 18166 gene locus_tag LOCUS_45580 17357 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 20563 18254 gene locus_tag LOCUS_45590 20563 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 20964 22496 gene locus_tag LOCUS_45600 20964 22496 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_45600 24956 22482 gene locus_tag LOCUS_45610 24956 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 26705 25221 gene locus_tag LOCUS_45620 26705 25221 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_45620 >Feature sequence152 <1 11293 gene locus_tag LOCUS_45630 <1 11293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein 11596 13059 gene locus_tag LOCUS_45640 11596 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 13367 16399 gene locus_tag LOCUS_45650 13367 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 16494 16673 gene locus_tag LOCUS_45660 16494 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 17992 16652 gene locus_tag LOCUS_45670 17992 16652 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_45670 18236 18054 gene locus_tag LOCUS_45680 18236 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 18907 18332 gene locus_tag LOCUS_45690 18907 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 18986 19477 gene locus_tag LOCUS_45700 18986 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 19522 19869 gene locus_tag LOCUS_45710 19522 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 22328 20043 gene locus_tag LOCUS_45720 22328 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 23553 22585 gene locus_tag LOCUS_45730 gene radC 23553 22585 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922268.1 protein_id gnl|my_center|LOCUS_45730 24244 25965 gene locus_tag LOCUS_45740 24244 25965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 >Feature sequence153 305 1261 gene locus_tag LOCUS_45750 305 1261 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928612.1 protein_id gnl|my_center|LOCUS_45750 1507 3030 gene locus_tag LOCUS_45760 1507 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 3109 3894 gene locus_tag LOCUS_45770 3109 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 4045 4635 gene locus_tag LOCUS_45780 4045 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 5010 6731 gene locus_tag LOCUS_45790 5010 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 6754 9090 gene locus_tag LOCUS_45800 6754 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 11207 9135 gene locus_tag LOCUS_45810 11207 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 11757 11560 gene locus_tag LOCUS_45820 11757 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 13022 11676 gene locus_tag LOCUS_45830 13022 11676 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_45830 13477 15042 gene locus_tag LOCUS_45840 13477 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 15189 17372 gene locus_tag LOCUS_45850 15189 17372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 17395 18717 gene locus_tag LOCUS_45860 17395 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 20513 18828 gene locus_tag LOCUS_45870 20513 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 23810 20529 gene locus_tag LOCUS_45880 23810 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 23970 25667 gene locus_tag LOCUS_45890 23970 25667 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_45890 25904 26815 gene locus_tag LOCUS_45900 gene selD 25904 26815 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_45900 >Feature sequence154 1233 1006 gene locus_tag LOCUS_45910 1233 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 1696 1226 gene locus_tag LOCUS_45920 1696 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 2549 1857 gene locus_tag LOCUS_45930 2549 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 3415 3588 gene locus_tag LOCUS_45940 3415 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 5124 3775 gene locus_tag LOCUS_45950 5124 3775 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_45950 5347 5772 gene locus_tag LOCUS_45960 5347 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 7377 5887 gene locus_tag LOCUS_45970 7377 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 8087 13108 gene locus_tag LOCUS_45980 8087 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 13756 13337 gene locus_tag LOCUS_45990 13756 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 13879 15057 gene locus_tag LOCUS_46000 13879 15057 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_46000 15077 16414 gene locus_tag LOCUS_46010 15077 16414 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_46010 16416 16979 gene locus_tag LOCUS_46020 16416 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 17146 18402 gene locus_tag LOCUS_46030 17146 18402 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_46030 18854 21046 gene locus_tag LOCUS_46040 18854 21046 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_46040 21092 22561 gene locus_tag LOCUS_46050 21092 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 22561 23661 gene locus_tag LOCUS_46060 22561 23661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_46060 23661 25094 gene locus_tag LOCUS_46070 23661 25094 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_46070 25256 25477 gene locus_tag LOCUS_46080 25256 25477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 >Feature sequence155 2591 693 gene locus_tag LOCUS_46090 2591 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 3005 2802 gene locus_tag LOCUS_46100 3005 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 3057 3515 gene locus_tag LOCUS_46110 3057 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 3578 3907 gene locus_tag LOCUS_46120 3578 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 3962 4393 gene locus_tag LOCUS_46130 3962 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 4420 4785 gene locus_tag LOCUS_46140 4420 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211291926.1 protein_id gnl|my_center|LOCUS_46140 4792 5670 gene locus_tag LOCUS_46150 4792 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 6082 6483 gene locus_tag LOCUS_46160 6082 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 6684 6508 gene locus_tag LOCUS_46170 6684 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 6917 7270 gene locus_tag LOCUS_46180 6917 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 7317 8096 gene locus_tag LOCUS_46190 7317 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 8990 8130 gene locus_tag LOCUS_46200 8990 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 9123 9377 gene locus_tag LOCUS_46210 9123 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 9995 10204 gene locus_tag LOCUS_46220 gene csrA 9995 10204 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_46220 10397 10230 gene locus_tag LOCUS_46230 10397 10230 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013190.1 protein_id gnl|my_center|LOCUS_46230 10777 10538 gene locus_tag LOCUS_46240 10777 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 10908 11093 gene locus_tag LOCUS_46250 10908 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 11419 11090 gene locus_tag LOCUS_46260 11419 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 11449 11568 gene locus_tag LOCUS_46270 11449 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 11805 11996 gene locus_tag LOCUS_46280 gene csrA 11805 11996 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632782.1 protein_id gnl|my_center|LOCUS_46280 12201 12608 gene locus_tag LOCUS_46290 12201 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 13163 12627 gene locus_tag LOCUS_46300 13163 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 13400 14329 gene locus_tag LOCUS_46310 13400 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 14338 15348 gene locus_tag LOCUS_46320 14338 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 15403 17253 gene locus_tag LOCUS_46330 15403 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 17345 17875 gene locus_tag LOCUS_46340 17345 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 18086 17931 gene locus_tag LOCUS_46350 18086 17931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46350 18382 18188 gene locus_tag LOCUS_46360 18382 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 18616 19134 gene locus_tag LOCUS_46370 18616 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 19291 19725 gene locus_tag LOCUS_46380 19291 19725 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258015.1 protein_id gnl|my_center|LOCUS_46380 19833 20528 gene locus_tag LOCUS_46390 19833 20528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 20507 20851 gene locus_tag LOCUS_46400 20507 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 21181 20948 gene locus_tag LOCUS_46410 21181 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 21078 21614 gene locus_tag LOCUS_46420 21078 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 21611 21856 gene locus_tag LOCUS_46430 21611 21856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 22174 22089 gene locus_tag LOCUS_t00240 22174 22089 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22603 22259 gene locus_tag LOCUS_46440 22603 22259 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552785.1 protein_id gnl|my_center|LOCUS_46440 23859 22615 gene locus_tag LOCUS_46450 23859 22615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46450 24721 25305 gene locus_tag LOCUS_46460 24721 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 26434 25319 gene locus_tag LOCUS_46470 26434 25319 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_46470 >Feature sequence156 416 4492 gene locus_tag LOCUS_46480 416 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 4565 5968 gene locus_tag LOCUS_46490 4565 5968 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_46490 6059 5850 gene locus_tag LOCUS_46500 6059 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 7106 6180 gene locus_tag LOCUS_46510 7106 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 7370 10282 gene locus_tag LOCUS_46520 7370 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 13214 10470 gene locus_tag LOCUS_46530 13214 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 13704 13931 gene locus_tag LOCUS_46540 13704 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 14137 14526 gene locus_tag LOCUS_46550 14137 14526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 14712 16295 gene locus_tag LOCUS_46560 14712 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 16728 16420 gene locus_tag LOCUS_46570 16728 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 17287 19500 gene locus_tag LOCUS_46580 17287 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 20377 21663 gene locus_tag LOCUS_46590 20377 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 21653 21817 gene locus_tag LOCUS_46600 21653 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 22428 22213 gene locus_tag LOCUS_46610 22428 22213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 23913 22447 gene locus_tag LOCUS_46620 23913 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 24798 24316 gene locus_tag LOCUS_46630 gene sixA 24798 24316 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_46630 25233 25886 gene locus_tag LOCUS_46640 25233 25886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 25976 26299 gene locus_tag LOCUS_46650 25976 26299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 >Feature sequence157 <1 684 gene locus_tag LOCUS_46660 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727105.1:ABC transporter ATP-binding protein 858 1754 gene locus_tag LOCUS_46670 858 1754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 protein_id gnl|my_center|LOCUS_46670 1751 2566 gene locus_tag LOCUS_46680 1751 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 2606 2767 gene locus_tag LOCUS_46690 2606 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 3070 4104 gene locus_tag LOCUS_46700 3070 4104 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_46700 5349 4285 gene locus_tag LOCUS_46710 5349 4285 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_46710 5666 5346 gene locus_tag LOCUS_46720 5666 5346 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_46720 5876 6880 gene locus_tag LOCUS_46730 5876 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 8560 6899 gene locus_tag LOCUS_46740 8560 6899 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921424.1 protein_id gnl|my_center|LOCUS_46740 8695 9666 gene locus_tag LOCUS_46750 8695 9666 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_46750 9707 11002 gene locus_tag LOCUS_46760 9707 11002 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_46760 11143 11997 gene locus_tag LOCUS_46770 11143 11997 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_46770 13525 12182 gene locus_tag LOCUS_46780 13525 12182 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_46780 13851 13973 gene locus_tag LOCUS_46790 13851 13973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 14223 14441 gene locus_tag LOCUS_46800 14223 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 14639 15217 gene locus_tag LOCUS_46810 14639 15217 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120574.1 protein_id gnl|my_center|LOCUS_46810 15385 16602 gene locus_tag LOCUS_46820 15385 16602 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_46820 16656 17465 gene locus_tag LOCUS_46830 16656 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 17652 18251 gene locus_tag LOCUS_46840 17652 18251 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 protein_id gnl|my_center|LOCUS_46840 18262 19389 gene locus_tag LOCUS_46850 18262 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 19558 20352 gene locus_tag LOCUS_46860 19558 20352 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_46860 20571 23486 gene locus_tag LOCUS_46870 20571 23486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 24425 23538 gene locus_tag LOCUS_46880 24425 23538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 24649 25527 gene locus_tag LOCUS_46890 gene truB 24649 25527 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_46890 25871 25524 gene locus_tag LOCUS_46900 25871 25524 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_46900 <26467 25965 gene locus_tag LOCUS_46910 <26467 25965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327631.1:ABC transporter permease >Feature sequence158 3248 531 gene locus_tag LOCUS_46920 gene acnA 3248 531 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_46920 5226 3448 gene locus_tag LOCUS_46930 5226 3448 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118564.1 protein_id gnl|my_center|LOCUS_46930 5515 6543 gene locus_tag LOCUS_46940 5515 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 7359 6667 gene locus_tag LOCUS_46950 7359 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 7435 8100 gene locus_tag LOCUS_46960 7435 8100 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331723.1 protein_id gnl|my_center|LOCUS_46960 8158 11448 gene locus_tag LOCUS_46970 gene mfd 8158 11448 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_46970 11740 12894 gene locus_tag LOCUS_46980 11740 12894 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615848.1 protein_id gnl|my_center|LOCUS_46980 13106 13690 gene locus_tag LOCUS_46990 13106 13690 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_46990 13757 14632 gene locus_tag LOCUS_47000 13757 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 15711 14644 gene locus_tag LOCUS_47010 15711 14644 CDS product DUF6268 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122532.1 protein_id gnl|my_center|LOCUS_47010 16839 15781 gene locus_tag LOCUS_47020 16839 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 18339 17344 gene locus_tag LOCUS_47030 18339 17344 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615603.1 protein_id gnl|my_center|LOCUS_47030 18753 20858 gene locus_tag LOCUS_47040 18753 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 21023 22498 gene locus_tag LOCUS_47050 gene ffh 21023 22498 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_47050 22580 23041 gene locus_tag LOCUS_47060 22580 23041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 23045 23800 gene locus_tag LOCUS_47070 gene trmD 23045 23800 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123923.1 protein_id gnl|my_center|LOCUS_47070 23772 24146 gene locus_tag LOCUS_47080 gene rplS 23772 24146 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_47080 24163 24591 gene locus_tag LOCUS_47090 24163 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 25624 24629 gene locus_tag LOCUS_47100 25624 24629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 >Feature sequence159 3237 1621 gene locus_tag LOCUS_47110 3237 1621 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878256.1 protein_id gnl|my_center|LOCUS_47110 3587 4258 gene locus_tag LOCUS_47120 3587 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 4310 7321 gene locus_tag LOCUS_47130 4310 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 8271 7345 gene locus_tag LOCUS_47140 8271 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 8623 9168 gene locus_tag LOCUS_47150 8623 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 9253 10194 gene locus_tag LOCUS_47160 9253 10194 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 protein_id gnl|my_center|LOCUS_47160 10309 11748 gene locus_tag LOCUS_47170 10309 11748 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_47170 12180 11764 gene locus_tag LOCUS_47180 12180 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 12767 12381 gene locus_tag LOCUS_47190 12767 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 13227 12769 gene locus_tag LOCUS_47200 13227 12769 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_47200 14365 13400 gene locus_tag LOCUS_47210 14365 13400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 14562 15671 gene locus_tag LOCUS_47220 14562 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 16782 15826 gene locus_tag LOCUS_47230 16782 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 17457 18755 gene locus_tag LOCUS_47240 17457 18755 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_47240 20300 18834 gene locus_tag LOCUS_47250 20300 18834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 21576 20410 gene locus_tag LOCUS_47260 21576 20410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 22928 21648 gene locus_tag LOCUS_47270 22928 21648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 23257 24627 gene locus_tag LOCUS_47280 23257 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 >Feature sequence160 19 552 gene locus_tag LOCUS_47290 19 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 1736 555 gene locus_tag LOCUS_47300 gene bioF 1736 555 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_47300 2035 1736 gene locus_tag LOCUS_47310 2035 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 2126 3169 gene locus_tag LOCUS_47320 2126 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 3465 4979 gene locus_tag LOCUS_47330 3465 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 5063 5599 gene locus_tag LOCUS_47340 5063 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 5835 5608 gene locus_tag LOCUS_47350 5835 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 5997 5836 gene locus_tag LOCUS_47360 5997 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 6101 7666 gene locus_tag LOCUS_47370 6101 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 7992 7717 gene locus_tag LOCUS_47380 7992 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 7979 9226 gene locus_tag LOCUS_47390 7979 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 9239 10123 gene locus_tag LOCUS_47400 9239 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 10611 16133 gene locus_tag LOCUS_47410 10611 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 16405 16737 gene locus_tag LOCUS_47420 16405 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 18331 17003 gene locus_tag LOCUS_47430 18331 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 19438 18461 gene locus_tag LOCUS_47440 19438 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 21639 19435 gene locus_tag LOCUS_47450 gene thrS 21639 19435 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_47450 21991 22356 gene locus_tag LOCUS_47460 21991 22356 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_47460 22385 24265 gene locus_tag LOCUS_47470 22385 24265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 24327 25418 gene locus_tag LOCUS_47480 24327 25418 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_47480 >Feature sequence161 2514 1261 gene locus_tag LOCUS_47490 2514 1261 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_47490 2750 3775 gene locus_tag LOCUS_47500 2750 3775 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_47500 3953 5104 gene locus_tag LOCUS_47510 3953 5104 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121993.1 protein_id gnl|my_center|LOCUS_47510 6692 5232 gene locus_tag LOCUS_47520 6692 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_47520 6949 7470 gene locus_tag LOCUS_47530 6949 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 7482 7958 gene locus_tag LOCUS_47540 7482 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 8056 8322 gene locus_tag LOCUS_47550 8056 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 8312 8902 gene locus_tag LOCUS_47560 8312 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 8993 9883 gene locus_tag LOCUS_47570 8993 9883 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967714.1 protein_id gnl|my_center|LOCUS_47570 12764 9915 gene locus_tag LOCUS_47580 12764 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 13681 12761 gene locus_tag LOCUS_47590 13681 12761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_47590 14073 13684 gene locus_tag LOCUS_47600 14073 13684 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_47600 15182 14523 gene locus_tag LOCUS_47610 15182 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 15318 15521 gene locus_tag LOCUS_47620 15318 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 17961 16207 gene locus_tag LOCUS_47630 17961 16207 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_47630 19648 18209 gene locus_tag LOCUS_47640 19648 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 19885 20958 gene locus_tag LOCUS_47650 19885 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 21264 21938 gene locus_tag LOCUS_47660 21264 21938 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 protein_id gnl|my_center|LOCUS_47660 23218 22118 gene locus_tag LOCUS_47670 gene msrB 23218 22118 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_47670 23365 23550 gene locus_tag LOCUS_47680 23365 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 23661 25325 gene locus_tag LOCUS_47690 23661 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 >Feature sequence162 456 641 gene locus_tag LOCUS_47700 456 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 724 2349 gene locus_tag LOCUS_47710 724 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 2388 5879 gene locus_tag LOCUS_47720 2388 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 6955 5900 gene locus_tag LOCUS_47730 6955 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 7423 7707 gene locus_tag LOCUS_47740 7423 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 8120 11038 gene locus_tag LOCUS_47750 8120 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 14968 11126 gene locus_tag LOCUS_47760 14968 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 18036 15013 gene locus_tag LOCUS_47770 18036 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 19161 18199 gene locus_tag LOCUS_47780 19161 18199 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_47780 20741 19173 gene locus_tag LOCUS_47790 20741 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 21035 24409 gene locus_tag LOCUS_47800 21035 24409 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_47800 24488 25924 gene locus_tag LOCUS_47810 24488 25924 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_47810 >Feature sequence163 378 1502 gene locus_tag LOCUS_47820 378 1502 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_47820 1661 2998 gene locus_tag LOCUS_47830 1661 2998 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_47830 3037 3807 gene locus_tag LOCUS_47840 3037 3807 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_47840 3914 4804 gene locus_tag LOCUS_47850 3914 4804 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_47850 4886 5194 gene locus_tag LOCUS_47860 4886 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 5309 7855 gene locus_tag LOCUS_47870 5309 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 7821 8078 gene locus_tag LOCUS_47880 7821 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 8593 8234 gene locus_tag LOCUS_47890 8593 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 9151 16131 gene locus_tag LOCUS_47900 9151 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 16762 16148 gene locus_tag LOCUS_47910 16762 16148 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_47910 18682 16775 gene locus_tag LOCUS_47920 18682 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 20521 18761 gene locus_tag LOCUS_47930 20521 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 21820 20831 gene locus_tag LOCUS_47940 21820 20831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 22137 23432 gene locus_tag LOCUS_47950 22137 23432 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_47950 23459 24205 gene locus_tag LOCUS_47960 23459 24205 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_47960 24586 24431 gene locus_tag LOCUS_47970 24586 24431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 25082 25252 gene locus_tag LOCUS_47980 25082 25252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 >Feature sequence164 <1 1335 gene locus_tag LOCUS_47990 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870682.1:formylmethanofuran dehydrogenase subunit A 1737 2642 gene locus_tag LOCUS_48000 1737 2642 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_48000 3435 2644 gene locus_tag LOCUS_48010 3435 2644 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_48010 3537 4319 gene locus_tag LOCUS_48020 3537 4319 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119693.1 protein_id gnl|my_center|LOCUS_48020 4372 4896 gene locus_tag LOCUS_48030 4372 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 5759 4893 gene locus_tag LOCUS_48040 5759 4893 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_48040 6091 6747 gene locus_tag LOCUS_48050 6091 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 6832 9264 gene locus_tag LOCUS_48060 6832 9264 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_48060 9639 10223 gene locus_tag LOCUS_48070 9639 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 10385 10134 gene locus_tag LOCUS_48080 10385 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 12685 10598 gene locus_tag LOCUS_48090 12685 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 15424 12884 gene locus_tag LOCUS_48100 15424 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 16041 15559 gene locus_tag LOCUS_48110 16041 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 17863 16268 gene locus_tag LOCUS_48120 17863 16268 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937938.1 protein_id gnl|my_center|LOCUS_48120 19139 17979 gene locus_tag LOCUS_48130 19139 17979 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_48130 20279 19317 gene locus_tag LOCUS_48140 20279 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 20665 21720 gene locus_tag LOCUS_48150 gene lpxD 20665 21720 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 protein_id gnl|my_center|LOCUS_48150 21717 22601 gene locus_tag LOCUS_48160 gene lpxI 21717 22601 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_48160 23761 22706 gene locus_tag LOCUS_48170 23761 22706 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_48170 23999 24736 gene locus_tag LOCUS_48180 23999 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 >Feature sequence165 <1 895 gene locus_tag LOCUS_48190 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145098967.1:leucine-rich repeat domain-containing protein 892 2328 gene locus_tag LOCUS_48200 892 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 2602 4911 gene locus_tag LOCUS_48210 2602 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 6206 4953 gene locus_tag LOCUS_48220 6206 4953 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_48220 6504 7922 gene locus_tag LOCUS_48230 6504 7922 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015136.1 protein_id gnl|my_center|LOCUS_48230 9257 8013 gene locus_tag LOCUS_48240 gene fabF 9257 8013 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_48240 9486 12650 gene locus_tag LOCUS_48250 9486 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 12819 13067 gene locus_tag LOCUS_48260 12819 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 13064 13471 gene locus_tag LOCUS_48270 13064 13471 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_48270 13575 14516 gene locus_tag LOCUS_48280 13575 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 14673 17711 gene locus_tag LOCUS_48290 14673 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 21533 17856 gene locus_tag LOCUS_48300 21533 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 21739 21933 gene locus_tag LOCUS_48310 21739 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 22845 22030 gene locus_tag LOCUS_48320 22845 22030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 23060 23506 gene locus_tag LOCUS_48330 23060 23506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 23866 25155 gene locus_tag LOCUS_48340 23866 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 >Feature sequence166 316 116 gene locus_tag LOCUS_48350 316 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 518 2710 gene locus_tag LOCUS_48360 518 2710 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_48360 3063 2737 gene locus_tag LOCUS_48370 3063 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 3026 3565 gene locus_tag LOCUS_48380 3026 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 5851 3767 gene locus_tag LOCUS_48390 5851 3767 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_48390 6020 6178 gene locus_tag LOCUS_48400 6020 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 6175 7200 gene locus_tag LOCUS_48410 6175 7200 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_48410 7197 8090 gene locus_tag LOCUS_48420 7197 8090 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_48420 8294 8205 gene locus_tag LOCUS_t00250 8294 8205 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8461 9987 gene locus_tag LOCUS_48430 8461 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 10166 11119 gene locus_tag LOCUS_48440 gene dusB 10166 11119 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334998.1 protein_id gnl|my_center|LOCUS_48440 11920 11168 gene locus_tag LOCUS_48450 11920 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118171.1 protein_id gnl|my_center|LOCUS_48450 12290 12994 gene locus_tag LOCUS_48460 12290 12994 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_48460 13727 13014 gene locus_tag LOCUS_48470 13727 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 14401 13763 gene locus_tag LOCUS_48480 14401 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 15339 15112 gene locus_tag LOCUS_48490 15339 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 15416 16879 gene locus_tag LOCUS_48500 15416 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 17078 18268 gene locus_tag LOCUS_48510 17078 18268 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335565.1 protein_id gnl|my_center|LOCUS_48510 18715 18569 gene locus_tag LOCUS_48520 18715 18569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 19689 18871 gene locus_tag LOCUS_48530 19689 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 19976 21607 gene locus_tag LOCUS_48540 19976 21607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 21667 22005 gene locus_tag LOCUS_48550 21667 22005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 22007 22780 gene locus_tag LOCUS_48560 22007 22780 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 protein_id gnl|my_center|LOCUS_48560 22806 23954 gene locus_tag LOCUS_48570 gene mqnE 22806 23954 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_48570 25316 24381 gene locus_tag LOCUS_48580 25316 24381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 >Feature sequence167 174 464 gene locus_tag LOCUS_48590 174 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 454 1593 gene locus_tag LOCUS_48600 454 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 1828 2904 gene locus_tag LOCUS_48610 1828 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 3190 4350 gene locus_tag LOCUS_48620 3190 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 4561 4884 gene locus_tag LOCUS_48630 4561 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 4951 6465 gene locus_tag LOCUS_48640 4951 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 6479 7600 gene locus_tag LOCUS_48650 6479 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 7601 9181 gene locus_tag LOCUS_48660 7601 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 9342 10895 gene locus_tag LOCUS_48670 9342 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 11157 11804 gene locus_tag LOCUS_48680 11157 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 13464 11824 gene locus_tag LOCUS_48690 13464 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 13641 14888 gene locus_tag LOCUS_48700 gene dgoD 13641 14888 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036920.1 protein_id gnl|my_center|LOCUS_48700 14869 15888 gene locus_tag LOCUS_48710 14869 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 15885 16391 gene locus_tag LOCUS_48720 15885 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 16985 16563 gene locus_tag LOCUS_48730 16985 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 17195 16992 gene locus_tag LOCUS_48740 17195 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 19705 17363 gene locus_tag LOCUS_48750 19705 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 21756 19903 gene locus_tag LOCUS_48760 21756 19903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 23542 21881 gene locus_tag LOCUS_48770 23542 21881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 25598 24114 gene locus_tag LOCUS_48780 25598 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 >Feature sequence168 5725 1580 gene locus_tag LOCUS_48790 5725 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 7259 6045 gene locus_tag LOCUS_48800 7259 6045 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_48800 8874 7828 gene locus_tag LOCUS_48810 8874 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 10420 8885 gene locus_tag LOCUS_48820 10420 8885 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_48820 10773 11555 gene locus_tag LOCUS_48830 gene kdsB 10773 11555 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 protein_id gnl|my_center|LOCUS_48830 11726 13360 gene locus_tag LOCUS_48840 11726 13360 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_48840 13357 13788 gene locus_tag LOCUS_48850 13357 13788 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_48850 14402 13923 gene locus_tag LOCUS_48860 14402 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 14963 16192 gene locus_tag LOCUS_48870 14963 16192 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442683.1 protein_id gnl|my_center|LOCUS_48870 16410 19865 gene locus_tag LOCUS_48880 16410 19865 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921373.1 protein_id gnl|my_center|LOCUS_48880 20166 21827 gene locus_tag LOCUS_48890 20166 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122727.1 protein_id gnl|my_center|LOCUS_48890 23454 22057 gene locus_tag LOCUS_48900 23454 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 <25744 23666 gene locus_tag LOCUS_48910 <25744 23666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120731.1:serine/threonine-protein kinase >Feature sequence169 494 1894 gene locus_tag LOCUS_48920 494 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 2149 2826 gene locus_tag LOCUS_48930 gene folE 2149 2826 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_48930 2846 3334 gene locus_tag LOCUS_48940 gene queD 2846 3334 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966887.1 protein_id gnl|my_center|LOCUS_48940 3518 4273 gene locus_tag LOCUS_48950 3518 4273 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_48950 4796 4407 gene locus_tag LOCUS_48960 4796 4407 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_48960 5283 5762 gene locus_tag LOCUS_48970 gene msrB 5283 5762 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_48970 6183 5968 gene locus_tag LOCUS_48980 6183 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 6472 6813 gene locus_tag LOCUS_48990 6472 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 6920 7246 gene locus_tag LOCUS_49000 6920 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 7277 8743 gene locus_tag LOCUS_49010 7277 8743 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_49010 8984 14665 gene locus_tag LOCUS_49020 8984 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 14670 15266 gene locus_tag LOCUS_49030 14670 15266 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140719.1 protein_id gnl|my_center|LOCUS_49030 16399 15362 gene locus_tag LOCUS_49040 16399 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 16931 17269 gene locus_tag LOCUS_49050 16931 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485429.1 protein_id gnl|my_center|LOCUS_49050 17391 17720 gene locus_tag LOCUS_49060 17391 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 17692 18042 gene locus_tag LOCUS_49070 17692 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 20252 18069 gene locus_tag LOCUS_49080 20252 18069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 21896 20319 gene locus_tag LOCUS_49090 21896 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 22178 22579 gene locus_tag LOCUS_49100 22178 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_49100 22576 22785 gene locus_tag LOCUS_49110 22576 22785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 22843 23328 gene locus_tag LOCUS_49120 22843 23328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 23564 24244 gene locus_tag LOCUS_49130 23564 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328057.1 protein_id gnl|my_center|LOCUS_49130 24241 25086 gene locus_tag LOCUS_49140 24241 25086 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_49140 >Feature sequence170 1153 56 gene locus_tag LOCUS_49150 1153 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 1318 2673 gene locus_tag LOCUS_49160 1318 2673 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932994.1 protein_id gnl|my_center|LOCUS_49160 3147 2815 gene locus_tag LOCUS_49170 3147 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 3386 3135 gene locus_tag LOCUS_49180 3386 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 3904 5718 gene locus_tag LOCUS_49190 3904 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 6126 5908 gene locus_tag LOCUS_49200 gene csrA 6126 5908 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_49200 6737 6297 gene locus_tag LOCUS_49210 6737 6297 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198267.1 protein_id gnl|my_center|LOCUS_49210 8091 7111 gene locus_tag LOCUS_49220 8091 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 8736 8227 gene locus_tag LOCUS_49230 8736 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 10374 9091 gene locus_tag LOCUS_49240 10374 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 10575 10964 gene locus_tag LOCUS_49250 10575 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 11139 11975 gene locus_tag LOCUS_49260 11139 11975 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434699.1 protein_id gnl|my_center|LOCUS_49260 14989 12323 gene locus_tag LOCUS_49270 gene clpB 14989 12323 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922205.1 protein_id gnl|my_center|LOCUS_49270 17136 15196 gene locus_tag LOCUS_49280 gene dnaK 17136 15196 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_49280 17556 18665 gene locus_tag LOCUS_49290 gene pheA 17556 18665 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122147.1 protein_id gnl|my_center|LOCUS_49290 18677 19723 gene locus_tag LOCUS_49300 18677 19723 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230899.1 protein_id gnl|my_center|LOCUS_49300 20910 19825 gene locus_tag LOCUS_49310 20910 19825 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_49310 21901 21077 gene locus_tag LOCUS_49320 gene lpxA 21901 21077 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328498.1 protein_id gnl|my_center|LOCUS_49320 22717 21923 gene locus_tag LOCUS_49330 gene lpxC 22717 21923 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_49330 23484 22843 gene locus_tag LOCUS_49340 23484 22843 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335125.1 protein_id gnl|my_center|LOCUS_49340 24679 23681 gene locus_tag LOCUS_49350 24679 23681 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_49350 24754 25368 gene locus_tag LOCUS_49360 24754 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 >Feature sequence171 1671 2828 gene locus_tag LOCUS_49370 1671 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 4780 2876 gene locus_tag LOCUS_49380 4780 2876 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_49380 5540 4791 gene locus_tag LOCUS_49390 5540 4791 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_49390 5678 6313 gene locus_tag LOCUS_49400 5678 6313 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462097.1 protein_id gnl|my_center|LOCUS_49400 7519 6497 gene locus_tag LOCUS_49410 7519 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 7788 9113 gene locus_tag LOCUS_49420 7788 9113 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_49420 9225 10097 gene locus_tag LOCUS_49430 9225 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 10094 11290 gene locus_tag LOCUS_49440 10094 11290 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_49440 11490 12479 gene locus_tag LOCUS_49450 11490 12479 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_49450 14026 12551 gene locus_tag LOCUS_49460 14026 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 14798 14109 gene locus_tag LOCUS_49470 14798 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 15924 14905 gene locus_tag LOCUS_49480 15924 14905 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_49480 16343 18196 gene locus_tag LOCUS_49490 16343 18196 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325003.1 protein_id gnl|my_center|LOCUS_49490 19694 18213 gene locus_tag LOCUS_49500 19694 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 22106 19698 gene locus_tag LOCUS_49510 22106 19698 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122892.1 protein_id gnl|my_center|LOCUS_49510 >Feature sequence172 766 2259 gene locus_tag LOCUS_49520 766 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 2402 3190 gene locus_tag LOCUS_49530 2402 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 3403 3579 gene locus_tag LOCUS_49540 3403 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 3741 4757 gene locus_tag LOCUS_49550 3741 4757 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_49550 8001 4837 gene locus_tag LOCUS_49560 8001 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 8820 8218 gene locus_tag LOCUS_49570 8820 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 9933 9340 gene locus_tag LOCUS_49580 9933 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 10812 9940 gene locus_tag LOCUS_49590 10812 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 11066 11584 gene locus_tag LOCUS_49600 11066 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 11822 11601 gene locus_tag LOCUS_49610 11822 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 13119 12085 gene locus_tag LOCUS_49620 13119 12085 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707000.1 protein_id gnl|my_center|LOCUS_49620 15364 13412 gene locus_tag LOCUS_49630 15364 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 15861 16463 gene locus_tag LOCUS_49640 15861 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 16492 17247 gene locus_tag LOCUS_49650 16492 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 17244 18761 gene locus_tag LOCUS_49660 17244 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 18790 19029 gene locus_tag LOCUS_49670 18790 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 19022 19696 gene locus_tag LOCUS_49680 19022 19696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 19888 20958 gene locus_tag LOCUS_49690 gene pilM 19888 20958 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_49690 20951 21676 gene locus_tag LOCUS_49700 20951 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 21681 22229 gene locus_tag LOCUS_49710 21681 22229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 22311 23051 gene locus_tag LOCUS_49720 22311 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 >Feature sequence173 127 1332 gene locus_tag LOCUS_49730 127 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 1576 4338 gene locus_tag LOCUS_49740 1576 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 4391 6235 gene locus_tag LOCUS_49750 4391 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 8612 6291 gene locus_tag LOCUS_49760 8612 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 10976 8715 gene locus_tag LOCUS_49770 10976 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 14259 11146 gene locus_tag LOCUS_49780 14259 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 14426 14256 gene locus_tag LOCUS_49790 14426 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 14458 16248 gene locus_tag LOCUS_49800 14458 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 16304 17065 gene locus_tag LOCUS_49810 16304 17065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 17181 16948 gene locus_tag LOCUS_49820 17181 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 17612 17944 gene locus_tag LOCUS_49830 17612 17944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 17958 19040 gene locus_tag LOCUS_49840 17958 19040 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_49840 19422 20594 gene locus_tag LOCUS_49850 19422 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 20989 21858 gene locus_tag LOCUS_49860 20989 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 24224 21870 gene locus_tag LOCUS_49870 24224 21870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 25067 24294 gene locus_tag LOCUS_49880 25067 24294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 >Feature sequence174 371 18 gene locus_tag LOCUS_49890 371 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 990 1313 gene locus_tag LOCUS_49900 990 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 2241 1687 gene locus_tag LOCUS_49910 2241 1687 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119124.1 protein_id gnl|my_center|LOCUS_49910 3701 2238 gene locus_tag LOCUS_49920 gene miaB 3701 2238 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_49920 6457 3965 gene locus_tag LOCUS_49930 6457 3965 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922337.1 protein_id gnl|my_center|LOCUS_49930 7461 6574 gene locus_tag LOCUS_49940 7461 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 8536 7934 gene locus_tag LOCUS_49950 8536 7934 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327091.1 protein_id gnl|my_center|LOCUS_49950 10175 8760 gene locus_tag LOCUS_49960 gene selA 10175 8760 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_49960 10188 11339 gene locus_tag LOCUS_49970 gene trpD 10188 11339 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117897.1 protein_id gnl|my_center|LOCUS_49970 11426 12256 gene locus_tag LOCUS_49980 11426 12256 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_49980 12279 13139 gene locus_tag LOCUS_49990 12279 13139 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_49990 15607 13148 gene locus_tag LOCUS_50000 15607 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 16813 16052 gene locus_tag LOCUS_50010 16813 16052 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_50010 17783 17118 gene locus_tag LOCUS_50020 17783 17118 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_50020 18851 17880 gene locus_tag LOCUS_50030 gene glpG 18851 17880 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_50030 19673 18861 gene locus_tag LOCUS_50040 gene nagB 19673 18861 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461409.1 protein_id gnl|my_center|LOCUS_50040 20127 20975 gene locus_tag LOCUS_50050 20127 20975 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_50050 22240 20993 gene locus_tag LOCUS_50060 22240 20993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 23224 22562 gene locus_tag LOCUS_50070 23224 22562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_50070 24760 23330 gene locus_tag LOCUS_50080 24760 23330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 >Feature sequence175 506 198 gene locus_tag LOCUS_50090 506 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 496 693 gene locus_tag LOCUS_50100 496 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 835 683 gene locus_tag LOCUS_50110 835 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 977 904 gene locus_tag LOCUS_t00260 977 904 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1167 1093 gene locus_tag LOCUS_t00270 1167 1093 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1365 3278 gene locus_tag LOCUS_50120 1365 3278 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325434.1 protein_id gnl|my_center|LOCUS_50120 3557 3165 gene locus_tag LOCUS_50130 3557 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 3936 3658 gene locus_tag LOCUS_50140 3936 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 4368 6755 gene locus_tag LOCUS_50150 4368 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 6995 7570 gene locus_tag LOCUS_50160 6995 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_50160 7909 9921 gene locus_tag LOCUS_50170 7909 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 9953 11614 gene locus_tag LOCUS_50180 9953 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 12160 11693 gene locus_tag LOCUS_50190 12160 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 12717 12544 gene locus_tag LOCUS_50200 12717 12544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 12650 13282 gene locus_tag LOCUS_50210 gene sigE 12650 13282 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_50210 13293 14123 gene locus_tag LOCUS_50220 13293 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 14498 14298 gene locus_tag LOCUS_50230 14498 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 14391 15221 gene locus_tag LOCUS_50240 14391 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 15345 16523 gene locus_tag LOCUS_50250 gene nagA 15345 16523 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289803.1 protein_id gnl|my_center|LOCUS_50250 16719 17996 gene locus_tag LOCUS_50260 gene eno 16719 17996 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123706.1 protein_id gnl|my_center|LOCUS_50260 18353 19180 gene locus_tag LOCUS_50270 18353 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 21432 19348 gene locus_tag LOCUS_50280 gene fusA 21432 19348 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120445.1 protein_id gnl|my_center|LOCUS_50280 22759 21908 gene locus_tag LOCUS_50290 22759 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 23784 22780 gene locus_tag LOCUS_50300 gene ilvC 23784 22780 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339869.1 protein_id gnl|my_center|LOCUS_50300 24345 23788 gene locus_tag LOCUS_50310 gene ilvN 24345 23788 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_50310 25066 24425 gene locus_tag LOCUS_50320 25066 24425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 >Feature sequence176 1439 1645 gene locus_tag LOCUS_50330 1439 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 2040 3860 gene locus_tag LOCUS_50340 2040 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 3904 5724 gene locus_tag LOCUS_50350 3904 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 5727 6149 gene locus_tag LOCUS_50360 5727 6149 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_50360 6808 6359 gene locus_tag LOCUS_50370 6808 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 8717 6783 gene locus_tag LOCUS_50380 8717 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 9145 10917 gene locus_tag LOCUS_50390 9145 10917 CDS product DUF3352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922585.1 protein_id gnl|my_center|LOCUS_50390 14792 11058 gene locus_tag LOCUS_50400 gene ccsA 14792 11058 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922162.1 protein_id gnl|my_center|LOCUS_50400 16200 14782 gene locus_tag LOCUS_50410 16200 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 17981 16581 gene locus_tag LOCUS_50420 17981 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 20280 18526 gene locus_tag LOCUS_50430 20280 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 20803 22551 gene locus_tag LOCUS_50440 20803 22551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 22541 23185 gene locus_tag LOCUS_50450 22541 23185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_50450 24257 23577 gene locus_tag LOCUS_50460 24257 23577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 >Feature sequence177 330 2798 gene locus_tag LOCUS_50470 330 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 2909 3295 gene locus_tag LOCUS_50480 2909 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 4097 3588 gene locus_tag LOCUS_50490 4097 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 4264 5430 gene locus_tag LOCUS_50500 4264 5430 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_50500 5482 8904 gene locus_tag LOCUS_50510 5482 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 8901 10583 gene locus_tag LOCUS_50520 8901 10583 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975360.1 protein_id gnl|my_center|LOCUS_50520 10707 12032 gene locus_tag LOCUS_50530 10707 12032 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_50530 12093 12773 gene locus_tag LOCUS_50540 12093 12773 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_50540 13260 14903 gene locus_tag LOCUS_50550 13260 14903 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921563.1 protein_id gnl|my_center|LOCUS_50550 14863 16254 gene locus_tag LOCUS_50560 14863 16254 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_50560 17104 16280 gene locus_tag LOCUS_50570 17104 16280 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_50570 17466 18824 gene locus_tag LOCUS_50580 17466 18824 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 protein_id gnl|my_center|LOCUS_50580 20521 18848 gene locus_tag LOCUS_50590 20521 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 20830 20567 gene locus_tag LOCUS_50600 20830 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 >Feature sequence178 1530 85 gene locus_tag LOCUS_50610 1530 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 1816 4533 gene locus_tag LOCUS_50620 1816 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 10832 4656 gene locus_tag LOCUS_50630 10832 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 12561 11056 gene locus_tag LOCUS_50640 12561 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 14309 12873 gene locus_tag LOCUS_50650 14309 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 15168 14299 gene locus_tag LOCUS_50660 15168 14299 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_50660 15616 15353 gene locus_tag LOCUS_50670 15616 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 16158 15619 gene locus_tag LOCUS_50680 16158 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 16454 19012 gene locus_tag LOCUS_50690 16454 19012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 22742 19026 gene locus_tag LOCUS_50700 22742 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 23071 24498 gene locus_tag LOCUS_50710 23071 24498 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_50710 >Feature sequence179 296 595 gene locus_tag LOCUS_50720 296 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 592 1179 gene locus_tag LOCUS_50730 592 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50730 2897 1326 gene locus_tag LOCUS_50740 2897 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 4817 3087 gene locus_tag LOCUS_50750 4817 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 8117 5004 gene locus_tag LOCUS_50760 8117 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 9458 8508 gene locus_tag LOCUS_50770 9458 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 10138 9725 gene locus_tag LOCUS_50780 10138 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 11637 10408 gene locus_tag LOCUS_50790 gene ackA 11637 10408 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_50790 12661 11585 gene locus_tag LOCUS_50800 gene pta 12661 11585 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_50800 12926 13534 gene locus_tag LOCUS_50810 12926 13534 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_50810 16056 13528 gene locus_tag LOCUS_50820 16056 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 16213 18594 gene locus_tag LOCUS_50830 16213 18594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_50830 18654 18884 gene locus_tag LOCUS_50840 18654 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 19017 20495 gene locus_tag LOCUS_50850 19017 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331359.1 protein_id gnl|my_center|LOCUS_50850 20635 21501 gene locus_tag LOCUS_50860 20635 21501 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921963.1 protein_id gnl|my_center|LOCUS_50860 21666 24254 gene locus_tag LOCUS_50870 21666 24254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 >Feature sequence180 127 2109 gene locus_tag LOCUS_50880 127 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 2290 5049 gene locus_tag LOCUS_50890 2290 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 8656 5450 gene locus_tag LOCUS_50900 8656 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 10284 8782 gene locus_tag LOCUS_50910 10284 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 12577 10484 gene locus_tag LOCUS_50920 12577 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 12784 15999 gene locus_tag LOCUS_50930 12784 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 16325 16011 gene locus_tag LOCUS_50940 16325 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 19633 16484 gene locus_tag LOCUS_50950 19633 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 22616 19953 gene locus_tag LOCUS_50960 22616 19953 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_50960 23385 22699 gene locus_tag LOCUS_50970 23385 22699 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_50970 24042 23470 gene locus_tag LOCUS_50980 24042 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 >Feature sequence181 281 664 gene locus_tag LOCUS_50990 281 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 793 1203 gene locus_tag LOCUS_51000 793 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 1222 1725 gene locus_tag LOCUS_51010 1222 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 1774 2361 gene locus_tag LOCUS_51020 1774 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 2334 2570 gene locus_tag LOCUS_51030 2334 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 2551 3039 gene locus_tag LOCUS_51040 2551 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 3152 5560 gene locus_tag LOCUS_51050 3152 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 5608 6462 gene locus_tag LOCUS_51060 5608 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 6989 7183 gene locus_tag LOCUS_51070 6989 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 7302 8264 gene locus_tag LOCUS_51080 7302 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 8332 9582 gene locus_tag LOCUS_51090 8332 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 9626 10327 gene locus_tag LOCUS_51100 9626 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 10393 12132 gene locus_tag LOCUS_51110 10393 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 12167 12346 gene locus_tag LOCUS_51120 12167 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 12506 13042 gene locus_tag LOCUS_51130 12506 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 13049 14176 gene locus_tag LOCUS_51140 13049 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 14403 17972 gene locus_tag LOCUS_51150 14403 17972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 18344 23722 gene locus_tag LOCUS_51160 18344 23722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 >Feature sequence182 2176 425 gene locus_tag LOCUS_51170 2176 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 2265 3458 gene locus_tag LOCUS_51180 2265 3458 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123093.1 protein_id gnl|my_center|LOCUS_51180 4007 3489 gene locus_tag LOCUS_51190 4007 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 4384 9489 gene locus_tag LOCUS_51200 4384 9489 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442596.1 protein_id gnl|my_center|LOCUS_51200 9640 10122 gene locus_tag LOCUS_51210 9640 10122 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064513.1 protein_id gnl|my_center|LOCUS_51210 10490 12739 gene locus_tag LOCUS_51220 gene vgrG1b 10490 12739 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_51220 12763 13119 gene locus_tag LOCUS_51230 12763 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 13079 13345 gene locus_tag LOCUS_51240 13079 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 13338 13715 gene locus_tag LOCUS_51250 13338 13715 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941651.1 protein_id gnl|my_center|LOCUS_51250 13806 17279 gene locus_tag LOCUS_51260 13806 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 17338 17991 gene locus_tag LOCUS_51270 17338 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 17984 18943 gene locus_tag LOCUS_51280 17984 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 18959 21031 gene locus_tag LOCUS_51290 18959 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 21323 22087 gene locus_tag LOCUS_51300 gene modA 21323 22087 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932353.1 protein_id gnl|my_center|LOCUS_51300 22077 22877 gene locus_tag LOCUS_51310 gene modA 22077 22877 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 protein_id gnl|my_center|LOCUS_51310 23048 23800 gene locus_tag LOCUS_51320 gene cysT 23048 23800 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724659.1 protein_id gnl|my_center|LOCUS_51320 >Feature sequence183 <1 591 gene locus_tag LOCUS_51330 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615720.1:right-handed parallel beta-helix repeat-containing protein 2146 698 gene locus_tag LOCUS_51340 2146 698 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_51340 2432 3283 gene locus_tag LOCUS_51350 2432 3283 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921514.1 protein_id gnl|my_center|LOCUS_51350 3423 4301 gene locus_tag LOCUS_51360 3423 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 6933 4849 gene locus_tag LOCUS_51370 6933 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 8168 6930 gene locus_tag LOCUS_51380 8168 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 9100 8165 gene locus_tag LOCUS_51390 9100 8165 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335663.1 protein_id gnl|my_center|LOCUS_51390 9553 11004 gene locus_tag LOCUS_51400 9553 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 11001 11780 gene locus_tag LOCUS_51410 11001 11780 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_51410 13503 12247 gene locus_tag LOCUS_51420 13503 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 14994 13609 gene locus_tag LOCUS_51430 14994 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 18379 15077 gene locus_tag LOCUS_51440 18379 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 22120 18731 gene locus_tag LOCUS_51450 22120 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 23849 22146 gene locus_tag LOCUS_51460 23849 22146 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_51460 >Feature sequence184 3108 259 gene locus_tag LOCUS_51470 3108 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 3475 3693 gene locus_tag LOCUS_51480 3475 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 5069 3699 gene locus_tag LOCUS_51490 5069 3699 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_51490 5906 5493 gene locus_tag LOCUS_51500 5906 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 6441 6019 gene locus_tag LOCUS_51510 6441 6019 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_51510 7513 6431 gene locus_tag LOCUS_51520 7513 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 8379 7549 gene locus_tag LOCUS_51530 8379 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 8932 8381 gene locus_tag LOCUS_51540 8932 8381 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_51540 9820 9155 gene locus_tag LOCUS_51550 9820 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 11857 10514 gene locus_tag LOCUS_51560 11857 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 13904 11892 gene locus_tag LOCUS_51570 13904 11892 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118388.1 protein_id gnl|my_center|LOCUS_51570 14242 15078 gene locus_tag LOCUS_51580 14242 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427774.1 protein_id gnl|my_center|LOCUS_51580 15952 15095 gene locus_tag LOCUS_51590 15952 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 16264 15989 gene locus_tag LOCUS_51600 16264 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 16348 16527 gene locus_tag LOCUS_51610 16348 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 16976 16521 gene locus_tag LOCUS_51620 16976 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 20758 17234 gene locus_tag LOCUS_51630 20758 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 22869 20755 gene locus_tag LOCUS_51640 22869 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 >Feature sequence185 1 1677 gene locus_tag LOCUS_51650 1 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 1699 2169 gene locus_tag LOCUS_51660 1699 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 2698 4263 gene locus_tag LOCUS_51670 2698 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 4414 4602 gene locus_tag LOCUS_51680 4414 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 6090 4723 gene locus_tag LOCUS_51690 6090 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 7018 6668 gene locus_tag LOCUS_51700 7018 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 7932 7030 gene locus_tag LOCUS_51710 7932 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 8289 8975 gene locus_tag LOCUS_51720 8289 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 9588 10490 gene locus_tag LOCUS_51730 9588 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 11911 10583 gene locus_tag LOCUS_51740 11911 10583 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_51740 12038 12532 gene locus_tag LOCUS_51750 12038 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 13027 12554 gene locus_tag LOCUS_51760 13027 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 13406 13101 gene locus_tag LOCUS_51770 13406 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 14112 13423 gene locus_tag LOCUS_51780 14112 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 15363 14158 gene locus_tag LOCUS_51790 15363 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 16822 15419 gene locus_tag LOCUS_51800 16822 15419 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295834.1 protein_id gnl|my_center|LOCUS_51800 18668 16851 gene locus_tag LOCUS_51810 18668 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 19995 18676 gene locus_tag LOCUS_51820 19995 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 20118 21446 gene locus_tag LOCUS_51830 20118 21446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 21454 22617 gene locus_tag LOCUS_51840 21454 22617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 22748 23332 gene locus_tag LOCUS_51850 22748 23332 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_51850 23373 23555 gene locus_tag LOCUS_51860 23373 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 >Feature sequence186 1577 1753 gene locus_tag LOCUS_51870 1577 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 1753 3690 gene locus_tag LOCUS_51880 1753 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 3743 7072 gene locus_tag LOCUS_51890 3743 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 9095 7209 gene locus_tag LOCUS_51900 9095 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 10612 9239 gene locus_tag LOCUS_51910 10612 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 10945 12627 gene locus_tag LOCUS_51920 10945 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 12784 14181 gene locus_tag LOCUS_51930 12784 14181 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_51930 14994 14587 gene locus_tag LOCUS_51940 14994 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 15815 15057 gene locus_tag LOCUS_51950 15815 15057 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_51950 18091 15947 gene locus_tag LOCUS_51960 18091 15947 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202488.1 protein_id gnl|my_center|LOCUS_51960 19592 18207 gene locus_tag LOCUS_51970 19592 18207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_51970 21445 19832 gene locus_tag LOCUS_51980 21445 19832 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146502713.1 protein_id gnl|my_center|LOCUS_51980 >Feature sequence187 174 2261 gene locus_tag LOCUS_51990 174 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 2304 2546 gene locus_tag LOCUS_52000 2304 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 2800 4317 gene locus_tag LOCUS_52010 2800 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 4500 8519 gene locus_tag LOCUS_52020 4500 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 8562 10055 gene locus_tag LOCUS_52030 gene betC 8562 10055 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241097.1 protein_id gnl|my_center|LOCUS_52030 10301 11050 gene locus_tag LOCUS_52040 10301 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 10942 12627 gene locus_tag LOCUS_52050 10942 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 12661 12831 gene locus_tag LOCUS_52060 12661 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 12978 14516 gene locus_tag LOCUS_52070 12978 14516 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_52070 14699 15979 gene locus_tag LOCUS_52080 14699 15979 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_52080 16149 18020 gene locus_tag LOCUS_52090 16149 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 18553 19485 gene locus_tag LOCUS_52100 18553 19485 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146535726.1 protein_id gnl|my_center|LOCUS_52100 19686 22163 gene locus_tag LOCUS_52110 19686 22163 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146536093.1 protein_id gnl|my_center|LOCUS_52110 22480 22358 gene locus_tag LOCUS_52120 22480 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 23221 22589 gene locus_tag LOCUS_52130 23221 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 >Feature sequence188 53 337 gene locus_tag LOCUS_52140 53 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 560 318 gene locus_tag LOCUS_52150 560 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 983 2320 gene locus_tag LOCUS_52160 983 2320 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119216.1 protein_id gnl|my_center|LOCUS_52160 4119 2488 gene locus_tag LOCUS_52170 4119 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 4259 5812 gene locus_tag LOCUS_52180 4259 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 7339 5990 gene locus_tag LOCUS_52190 7339 5990 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_52190 8981 7671 gene locus_tag LOCUS_52200 8981 7671 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123471.1 protein_id gnl|my_center|LOCUS_52200 8980 9144 gene locus_tag LOCUS_52210 8980 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 10330 9185 gene locus_tag LOCUS_52220 10330 9185 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324953.1 protein_id gnl|my_center|LOCUS_52220 10428 10604 gene locus_tag LOCUS_52230 10428 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 10727 11800 gene locus_tag LOCUS_52240 10727 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 11942 12177 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acacccgacacccgacacc 12180 13439 gene locus_tag LOCUS_52250 12180 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 13439 16726 gene locus_tag LOCUS_52260 13439 16726 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120847.1 protein_id gnl|my_center|LOCUS_52260 16867 17715 gene locus_tag LOCUS_52270 gene dapF 16867 17715 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_52270 17754 18548 gene locus_tag LOCUS_52280 17754 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 18569 19072 gene locus_tag LOCUS_52290 18569 19072 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_52290 19190 21133 gene locus_tag LOCUS_52300 19190 21133 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921839.1 protein_id gnl|my_center|LOCUS_52300 21408 22394 gene locus_tag LOCUS_52310 21408 22394 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921965.1 protein_id gnl|my_center|LOCUS_52310 >Feature sequence189 2099 276 gene locus_tag LOCUS_52320 2099 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 4954 2363 gene locus_tag LOCUS_52330 4954 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 5651 5953 gene locus_tag LOCUS_52340 5651 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 9342 5980 gene locus_tag LOCUS_52350 9342 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 10345 9353 gene locus_tag LOCUS_52360 10345 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 13788 10534 gene locus_tag LOCUS_52370 13788 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 14216 17641 gene locus_tag LOCUS_52380 14216 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 17861 18601 gene locus_tag LOCUS_52390 17861 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 21926 18699 gene locus_tag LOCUS_52400 21926 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 >Feature sequence190 30 452 gene locus_tag LOCUS_52410 30 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 1618 608 gene locus_tag LOCUS_52420 1618 608 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_52420 3201 1780 gene locus_tag LOCUS_52430 3201 1780 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_52430 3559 4422 gene locus_tag LOCUS_52440 3559 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 6191 4578 gene locus_tag LOCUS_52450 6191 4578 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122094.1 protein_id gnl|my_center|LOCUS_52450 6446 7360 gene locus_tag LOCUS_52460 6446 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 7484 9859 gene locus_tag LOCUS_52470 7484 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 11205 9904 gene locus_tag LOCUS_52480 11205 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 11814 12269 gene locus_tag LOCUS_52490 11814 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 13496 12354 gene locus_tag LOCUS_52500 13496 12354 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120921.1 protein_id gnl|my_center|LOCUS_52500 13816 13496 gene locus_tag LOCUS_52510 13816 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 14976 13813 gene locus_tag LOCUS_52520 14976 13813 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922668.1 protein_id gnl|my_center|LOCUS_52520 15289 16428 gene locus_tag LOCUS_52530 gene aroC 15289 16428 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_52530 16550 17764 gene locus_tag LOCUS_52540 16550 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 17875 19458 gene locus_tag LOCUS_52550 17875 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117961.1 protein_id gnl|my_center|LOCUS_52550 19518 19685 gene locus_tag LOCUS_52560 19518 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 <23236 19648 gene locus_tag LOCUS_52570 <23236 19648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000498844.1:type II secretion system secretin GspD >Feature sequence191 1716 469 gene locus_tag LOCUS_52580 1716 469 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_52580 2102 3952 gene locus_tag LOCUS_52590 2102 3952 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_52590 4057 5823 gene locus_tag LOCUS_52600 4057 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 5799 6977 gene locus_tag LOCUS_52610 5799 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 8402 7059 gene locus_tag LOCUS_52620 8402 7059 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_52620 10850 8442 gene locus_tag LOCUS_52630 10850 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 11098 11925 gene locus_tag LOCUS_52640 11098 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 12014 13537 gene locus_tag LOCUS_52650 12014 13537 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_52650 13571 13897 gene locus_tag LOCUS_52660 13571 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 13970 14962 gene locus_tag LOCUS_52670 13970 14962 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_52670 15118 16224 gene locus_tag LOCUS_52680 15118 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 16224 19316 gene locus_tag LOCUS_52690 16224 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 19349 20986 gene locus_tag LOCUS_52700 19349 20986 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_52700 21150 22226 gene locus_tag LOCUS_52710 21150 22226 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_52710 >Feature sequence192 <1 740 gene locus_tag LOCUS_52720 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728823.1:FGGY family carbohydrate kinase 756 1742 gene locus_tag LOCUS_52730 756 1742 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_52730 2003 2827 gene locus_tag LOCUS_52740 2003 2827 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970028.1 protein_id gnl|my_center|LOCUS_52740 2834 3472 gene locus_tag LOCUS_52750 2834 3472 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970026.1 protein_id gnl|my_center|LOCUS_52750 3622 4941 gene locus_tag LOCUS_52760 3622 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 4944 5801 gene locus_tag LOCUS_52770 4944 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 5947 10479 gene locus_tag LOCUS_52780 5947 10479 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_52780 10750 11931 gene locus_tag LOCUS_52790 10750 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 13086 11947 gene locus_tag LOCUS_52800 13086 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 14693 13197 gene locus_tag LOCUS_52810 gene glpK 14693 13197 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_52810 17223 14722 gene locus_tag LOCUS_52820 17223 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 18528 17611 gene locus_tag LOCUS_52830 18528 17611 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_52830 19537 18470 gene locus_tag LOCUS_52840 19537 18470 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_52840 21923 19551 gene locus_tag LOCUS_52850 21923 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 <23181 22077 gene locus_tag LOCUS_52860 <23181 22077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005094688.1:sulfotransferase >Feature sequence193 1149 40 gene locus_tag LOCUS_52870 1149 40 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_52870 3206 1164 gene locus_tag LOCUS_52880 3206 1164 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_52880 3205 3471 gene locus_tag LOCUS_52890 3205 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 3998 5254 gene locus_tag LOCUS_52900 3998 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 6286 5414 gene locus_tag LOCUS_52910 6286 5414 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_52910 6524 6742 gene locus_tag LOCUS_52920 6524 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 7707 6754 gene locus_tag LOCUS_52930 7707 6754 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_52930 8071 9216 gene locus_tag LOCUS_52940 8071 9216 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120130.1 protein_id gnl|my_center|LOCUS_52940 9366 10013 gene locus_tag LOCUS_52950 9366 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 10212 11207 gene locus_tag LOCUS_52960 10212 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 11483 12643 gene locus_tag LOCUS_52970 11483 12643 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_52970 13211 16852 gene locus_tag LOCUS_52980 13211 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 17616 18005 gene locus_tag LOCUS_52990 17616 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 18066 18419 gene locus_tag LOCUS_53000 18066 18419 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964018.1 protein_id gnl|my_center|LOCUS_53000 18656 18874 gene locus_tag LOCUS_53010 18656 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 18871 19302 gene locus_tag LOCUS_53020 18871 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 19484 19299 gene locus_tag LOCUS_53030 19484 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 19822 20304 gene locus_tag LOCUS_53040 19822 20304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 20688 20506 gene locus_tag LOCUS_53050 20688 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 20951 21370 gene locus_tag LOCUS_53060 20951 21370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 22514 21870 gene locus_tag LOCUS_53070 22514 21870 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_53070 >Feature sequence194 1080 1871 gene locus_tag LOCUS_53080 1080 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 2025 1864 gene locus_tag LOCUS_53090 2025 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 3651 2041 gene locus_tag LOCUS_53100 3651 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 3914 3693 gene locus_tag LOCUS_53110 3914 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 5624 4104 gene locus_tag LOCUS_53120 5624 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 7516 6359 gene locus_tag LOCUS_53130 7516 6359 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120614.1 protein_id gnl|my_center|LOCUS_53130 7732 8838 gene locus_tag LOCUS_53140 7732 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 9300 9070 gene locus_tag LOCUS_53150 9300 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 9446 10462 gene locus_tag LOCUS_53160 9446 10462 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332028.1 protein_id gnl|my_center|LOCUS_53160 10462 11379 gene locus_tag LOCUS_53170 10462 11379 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326720.1 protein_id gnl|my_center|LOCUS_53170 11889 12107 gene locus_tag LOCUS_53180 11889 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 12141 14945 gene locus_tag LOCUS_53190 12141 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 15538 16734 gene locus_tag LOCUS_53200 15538 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 16777 17664 gene locus_tag LOCUS_53210 16777 17664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 17952 17734 gene locus_tag LOCUS_53220 17952 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 18236 18910 gene locus_tag LOCUS_53230 18236 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 18991 19890 gene locus_tag LOCUS_53240 18991 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 20296 21144 gene locus_tag LOCUS_53250 20296 21144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 >Feature sequence195 1988 1398 gene locus_tag LOCUS_53260 1988 1398 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921328.1 protein_id gnl|my_center|LOCUS_53260 2357 2590 gene locus_tag LOCUS_53270 2357 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 3265 2759 gene locus_tag LOCUS_53280 3265 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53280 3701 3330 gene locus_tag LOCUS_53290 3701 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53290 3936 5501 gene locus_tag LOCUS_53300 3936 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 5757 5524 gene locus_tag LOCUS_53310 5757 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 6824 5886 gene locus_tag LOCUS_53320 gene prmC 6824 5886 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_53320 7978 6905 gene locus_tag LOCUS_53330 gene prfA 7978 6905 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_53330 8377 8120 gene locus_tag LOCUS_53340 gene rpmE 8377 8120 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_53340 8658 10145 gene locus_tag LOCUS_53350 8658 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 10362 10532 gene locus_tag LOCUS_53360 10362 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 11439 10567 gene locus_tag LOCUS_53370 11439 10567 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_53370 12242 11439 gene locus_tag LOCUS_53380 12242 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 12745 12494 gene locus_tag LOCUS_53390 12745 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817272.1 protein_id gnl|my_center|LOCUS_53390 13306 14367 gene locus_tag LOCUS_53400 gene tatC 13306 14367 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_53400 14824 14477 gene locus_tag LOCUS_53410 14824 14477 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_53410 16884 15322 gene locus_tag LOCUS_53420 gene amt 16884 15322 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922808.1 protein_id gnl|my_center|LOCUS_53420 18403 17210 gene locus_tag LOCUS_53430 18403 17210 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_53430 20099 18849 gene locus_tag LOCUS_53440 20099 18849 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_53440 21507 20491 gene locus_tag LOCUS_53450 gene ftsY 21507 20491 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331084.1 protein_id gnl|my_center|LOCUS_53450 22150 21746 gene locus_tag LOCUS_53460 gene nusB 22150 21746 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_53460 22765 22289 gene locus_tag LOCUS_53470 gene ribH 22765 22289 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403828.1 protein_id gnl|my_center|LOCUS_53470 >Feature sequence196 64 10794 gene locus_tag LOCUS_53480 64 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 12095 11109 gene locus_tag LOCUS_53490 12095 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 12398 12234 gene locus_tag LOCUS_53500 12398 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 12925 12428 gene locus_tag LOCUS_53510 12925 12428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 14309 13110 gene locus_tag LOCUS_53520 14309 13110 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921287.1 protein_id gnl|my_center|LOCUS_53520 14553 15278 gene locus_tag LOCUS_53530 14553 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 17041 15497 gene locus_tag LOCUS_53540 17041 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 18866 17499 gene locus_tag LOCUS_53550 18866 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 20241 18949 gene locus_tag LOCUS_53560 20241 18949 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_53560 >Feature sequence197 71 655 gene locus_tag LOCUS_53570 71 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 2423 1533 gene locus_tag LOCUS_53580 2423 1533 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328910.1 protein_id gnl|my_center|LOCUS_53580 2536 3351 gene locus_tag LOCUS_53590 2536 3351 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_53590 4819 3488 gene locus_tag LOCUS_53600 4819 3488 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_53600 5143 5754 gene locus_tag LOCUS_53610 5143 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 7623 5773 gene locus_tag LOCUS_53620 7623 5773 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_53620 9352 8087 gene locus_tag LOCUS_53630 9352 8087 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_53630 10577 9450 gene locus_tag LOCUS_53640 10577 9450 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_53640 11326 10712 gene locus_tag LOCUS_53650 11326 10712 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_53650 12877 11357 gene locus_tag LOCUS_53660 gene proS 12877 11357 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_53660 12899 13153 gene locus_tag LOCUS_53670 12899 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 13588 13848 gene locus_tag LOCUS_53680 13588 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 15022 13913 gene locus_tag LOCUS_53690 15022 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 16100 15027 gene locus_tag LOCUS_53700 16100 15027 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762093.1 protein_id gnl|my_center|LOCUS_53700 17836 16277 gene locus_tag LOCUS_53710 17836 16277 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_53710 18603 18385 gene locus_tag LOCUS_53720 18603 18385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 18517 20958 gene locus_tag LOCUS_53730 18517 20958 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_53730 20968 21618 gene locus_tag LOCUS_53740 20968 21618 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879872.1 protein_id gnl|my_center|LOCUS_53740 21625 22530 gene locus_tag LOCUS_53750 gene nrfD 21625 22530 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943565.1 protein_id gnl|my_center|LOCUS_53750 >Feature sequence198 48 1061 gene locus_tag LOCUS_53760 48 1061 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_53760 6104 1152 gene locus_tag LOCUS_53770 6104 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 7566 6373 gene locus_tag LOCUS_53780 7566 6373 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_53780 8328 7669 gene locus_tag LOCUS_53790 8328 7669 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141382.1 protein_id gnl|my_center|LOCUS_53790 8568 10055 gene locus_tag LOCUS_53800 8568 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 10193 10501 gene locus_tag LOCUS_53810 10193 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 10570 11112 gene locus_tag LOCUS_53820 10570 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 11567 12451 gene locus_tag LOCUS_53830 11567 12451 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615713.1 protein_id gnl|my_center|LOCUS_53830 12759 13481 gene locus_tag LOCUS_53840 12759 13481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_53840 13553 16666 gene locus_tag LOCUS_53850 13553 16666 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921396.1 protein_id gnl|my_center|LOCUS_53850 16775 18466 gene locus_tag LOCUS_53860 16775 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 19274 18525 gene locus_tag LOCUS_53870 19274 18525 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615889.1 protein_id gnl|my_center|LOCUS_53870 19540 20445 gene locus_tag LOCUS_53880 gene folP 19540 20445 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120943.1 protein_id gnl|my_center|LOCUS_53880 20464 21066 gene locus_tag LOCUS_53890 20464 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 >Feature sequence199 229 1095 gene locus_tag LOCUS_53900 229 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53900 1290 2708 gene locus_tag LOCUS_53910 1290 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 5177 2760 gene locus_tag LOCUS_53920 5177 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_53920 5910 5296 gene locus_tag LOCUS_53930 5910 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 7025 5997 gene locus_tag LOCUS_53940 7025 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 10550 7122 gene locus_tag LOCUS_53950 10550 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 10904 11641 gene locus_tag LOCUS_53960 10904 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 11638 14991 gene locus_tag LOCUS_53970 11638 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 16062 15124 gene locus_tag LOCUS_53980 16062 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 16242 18035 gene locus_tag LOCUS_53990 16242 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 18234 20633 gene locus_tag LOCUS_54000 18234 20633 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_54000 21073 22332 gene locus_tag LOCUS_54010 21073 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 >Feature sequence200 549 166 gene locus_tag LOCUS_54020 549 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 2216 873 gene locus_tag LOCUS_54030 2216 873 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920949.1 protein_id gnl|my_center|LOCUS_54030 2370 4424 gene locus_tag LOCUS_54040 2370 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 5087 4593 gene locus_tag LOCUS_54050 5087 4593 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_54050 6404 5130 gene locus_tag LOCUS_54060 6404 5130 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_54060 7223 6465 gene locus_tag LOCUS_54070 7223 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 7356 7114 gene locus_tag LOCUS_54080 7356 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 8220 7468 gene locus_tag LOCUS_54090 8220 7468 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122318.1 protein_id gnl|my_center|LOCUS_54090 9632 8250 gene locus_tag LOCUS_54100 9632 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 9802 12183 gene locus_tag LOCUS_54110 9802 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 12722 12225 gene locus_tag LOCUS_54120 12722 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 13474 12719 gene locus_tag LOCUS_54130 13474 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 16962 13561 gene locus_tag LOCUS_54140 16962 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 17504 16962 gene locus_tag LOCUS_54150 17504 16962 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_54150 18055 17696 gene locus_tag LOCUS_54160 18055 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 18198 18410 gene locus_tag LOCUS_54170 18198 18410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 21871 18488 gene locus_tag LOCUS_54180 21871 18488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 >Feature sequence201 188 865 gene locus_tag LOCUS_54190 188 865 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_54190 2270 1113 gene locus_tag LOCUS_54200 2270 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 3326 2283 gene locus_tag LOCUS_54210 3326 2283 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329841.1 protein_id gnl|my_center|LOCUS_54210 3730 5757 gene locus_tag LOCUS_54220 3730 5757 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_54220 7241 5778 gene locus_tag LOCUS_54230 7241 5778 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_54230 7964 7392 gene locus_tag LOCUS_54240 gene thpR 7964 7392 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332599.1 protein_id gnl|my_center|LOCUS_54240 8763 8131 gene locus_tag LOCUS_54250 8763 8131 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_54250 9928 8828 gene locus_tag LOCUS_54260 9928 8828 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922011.1 protein_id gnl|my_center|LOCUS_54260 10148 11170 gene locus_tag LOCUS_54270 10148 11170 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_54270 11226 15836 gene locus_tag LOCUS_54280 gene gltB 11226 15836 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_54280 15845 17413 gene locus_tag LOCUS_54290 15845 17413 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_54290 17782 18747 gene locus_tag LOCUS_54300 17782 18747 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_54300 18747 19205 gene locus_tag LOCUS_54310 18747 19205 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_54310 19208 20629 gene locus_tag LOCUS_54320 19208 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 20674 22287 gene locus_tag LOCUS_54330 20674 22287 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083229.1 protein_id gnl|my_center|LOCUS_54330 >Feature sequence202 173 2113 gene locus_tag LOCUS_54340 173 2113 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427755.1 protein_id gnl|my_center|LOCUS_54340 2125 3630 gene locus_tag LOCUS_54350 2125 3630 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_54350 3915 5198 gene locus_tag LOCUS_54360 3915 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 5236 6816 gene locus_tag LOCUS_54370 5236 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 6886 7884 gene locus_tag LOCUS_54380 6886 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 8091 9014 gene locus_tag LOCUS_54390 8091 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 9305 9649 gene locus_tag LOCUS_54400 9305 9649 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329795.1 protein_id gnl|my_center|LOCUS_54400 9655 10764 gene locus_tag LOCUS_54410 9655 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 10960 13521 gene locus_tag LOCUS_54420 10960 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 13518 15029 gene locus_tag LOCUS_54430 13518 15029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 15069 17795 gene locus_tag LOCUS_54440 15069 17795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 17929 18897 gene locus_tag LOCUS_54450 17929 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 18962 19867 gene locus_tag LOCUS_54460 18962 19867 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_54460 21987 20083 gene locus_tag LOCUS_54470 21987 20083 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615540.1 protein_id gnl|my_center|LOCUS_54470 >Feature sequence203 366 1406 gene locus_tag LOCUS_54480 366 1406 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_54480 1819 1565 gene locus_tag LOCUS_54490 1819 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903162.1 protein_id gnl|my_center|LOCUS_54490 2695 1847 gene locus_tag LOCUS_54500 2695 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 4899 2692 gene locus_tag LOCUS_54510 4899 2692 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016976.1 protein_id gnl|my_center|LOCUS_54510 5471 4911 gene locus_tag LOCUS_54520 5471 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016974.1 protein_id gnl|my_center|LOCUS_54520 6925 5702 gene locus_tag LOCUS_54530 6925 5702 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_54530 7486 6980 gene locus_tag LOCUS_54540 7486 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 10059 7744 gene locus_tag LOCUS_54550 10059 7744 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922084.1 protein_id gnl|my_center|LOCUS_54550 10804 10328 gene locus_tag LOCUS_54560 10804 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326944.1 protein_id gnl|my_center|LOCUS_54560 11208 11017 gene locus_tag LOCUS_54570 11208 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 11413 11225 gene locus_tag LOCUS_54580 11413 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 12083 13771 gene locus_tag LOCUS_54590 12083 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 14623 13775 gene locus_tag LOCUS_54600 14623 13775 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_54600 15113 14613 gene locus_tag LOCUS_54610 15113 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 15201 16370 gene locus_tag LOCUS_54620 gene eboE 15201 16370 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328980.1 protein_id gnl|my_center|LOCUS_54620 16904 16512 gene locus_tag LOCUS_54630 16904 16512 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_54630 17202 20540 gene locus_tag LOCUS_54640 17202 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 >Feature sequence204 1247 132 gene locus_tag LOCUS_54650 1247 132 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_54650 5410 1556 gene locus_tag LOCUS_54660 5410 1556 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899883.1 protein_id gnl|my_center|LOCUS_54660 6067 5414 gene locus_tag LOCUS_54670 6067 5414 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131748.1 protein_id gnl|my_center|LOCUS_54670 6411 7307 gene locus_tag LOCUS_54680 6411 7307 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_54680 9023 7404 gene locus_tag LOCUS_54690 9023 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 9553 9017 gene locus_tag LOCUS_54700 gene lptE 9553 9017 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119987.1 protein_id gnl|my_center|LOCUS_54700 10876 9680 gene locus_tag LOCUS_54710 10876 9680 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615906.1 protein_id gnl|my_center|LOCUS_54710 11657 10905 gene locus_tag LOCUS_54720 gene recO 11657 10905 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119985.1 protein_id gnl|my_center|LOCUS_54720 12964 11660 gene locus_tag LOCUS_54730 12964 11660 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_54730 13455 12961 gene locus_tag LOCUS_54740 13455 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 15194 13533 gene locus_tag LOCUS_54750 15194 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 16359 15367 gene locus_tag LOCUS_54760 16359 15367 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_54760 17438 16503 gene locus_tag LOCUS_54770 17438 16503 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_54770 18805 17543 gene locus_tag LOCUS_54780 18805 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 19737 19042 gene locus_tag LOCUS_54790 19737 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 >Feature sequence205 920 759 gene locus_tag LOCUS_54800 920 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 1155 1376 gene locus_tag LOCUS_54810 1155 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 3334 1979 gene locus_tag LOCUS_54820 3334 1979 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_54820 3501 3899 gene locus_tag LOCUS_54830 3501 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 4363 4515 gene locus_tag LOCUS_54840 4363 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 4554 4967 gene locus_tag LOCUS_54850 4554 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 5221 6519 gene locus_tag LOCUS_54860 5221 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 6740 6495 gene locus_tag LOCUS_54870 6740 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 6751 7038 gene locus_tag LOCUS_54880 6751 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 8775 6955 gene locus_tag LOCUS_54890 8775 6955 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120263.1 protein_id gnl|my_center|LOCUS_54890 9539 8778 gene locus_tag LOCUS_54900 9539 8778 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_54900 11036 9561 gene locus_tag LOCUS_54910 11036 9561 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_54910 11413 11240 gene locus_tag LOCUS_54920 11413 11240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 12181 11534 gene locus_tag LOCUS_54930 12181 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 13868 12210 gene locus_tag LOCUS_54940 13868 12210 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764376.1 protein_id gnl|my_center|LOCUS_54940 14146 17262 gene locus_tag LOCUS_54950 14146 17262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 18068 17385 gene locus_tag LOCUS_54960 18068 17385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_54960 20127 18073 gene locus_tag LOCUS_54970 20127 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 >Feature sequence206 <1 1445 gene locus_tag LOCUS_54980 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037246149.1:polyribonucleotide nucleotidyltransferase 1952 1623 gene locus_tag LOCUS_54990 1952 1623 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_54990 2045 3025 gene locus_tag LOCUS_55000 2045 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 3133 4437 gene locus_tag LOCUS_55010 3133 4437 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_55010 6246 4570 gene locus_tag LOCUS_55020 6246 4570 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_55020 6527 7672 gene locus_tag LOCUS_55030 6527 7672 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922057.1 protein_id gnl|my_center|LOCUS_55030 8939 7740 gene locus_tag LOCUS_55040 8939 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 9304 9822 gene locus_tag LOCUS_55050 9304 9822 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_55050 9875 10294 gene locus_tag LOCUS_55060 9875 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 10323 10874 gene locus_tag LOCUS_55070 10323 10874 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122795.1 protein_id gnl|my_center|LOCUS_55070 10885 11487 gene locus_tag LOCUS_55080 10885 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258774.1 protein_id gnl|my_center|LOCUS_55080 12410 11601 gene locus_tag LOCUS_55090 12410 11601 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122962.1 protein_id gnl|my_center|LOCUS_55090 14488 12416 gene locus_tag LOCUS_55100 gene metG 14488 12416 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 protein_id gnl|my_center|LOCUS_55100 15075 14698 gene locus_tag LOCUS_55110 15075 14698 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_55110 15190 15483 gene locus_tag LOCUS_55120 15190 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 15905 16993 gene locus_tag LOCUS_55130 15905 16993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 18198 17212 gene locus_tag LOCUS_55140 18198 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 18737 20938 gene locus_tag LOCUS_55150 18737 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 >Feature sequence207 1266 205 gene locus_tag LOCUS_55160 1266 205 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_55160 3121 1415 gene locus_tag LOCUS_55170 gene dnaK 3121 1415 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228715.1 protein_id gnl|my_center|LOCUS_55170 3657 3166 gene locus_tag LOCUS_55180 3657 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 4133 3660 gene locus_tag LOCUS_55190 4133 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 5318 4470 gene locus_tag LOCUS_55200 gene aroE 5318 4470 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_55200 6585 5548 gene locus_tag LOCUS_55210 6585 5548 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_55210 6925 6680 gene locus_tag LOCUS_55220 6925 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 8773 7217 gene locus_tag LOCUS_55230 8773 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814558.1 protein_id gnl|my_center|LOCUS_55230 9795 8770 gene locus_tag LOCUS_55240 gene tdh 9795 8770 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_55240 11116 9890 gene locus_tag LOCUS_55250 11116 9890 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_55250 12551 11121 gene locus_tag LOCUS_55260 12551 11121 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763623.1 protein_id gnl|my_center|LOCUS_55260 13130 14338 gene locus_tag LOCUS_55270 13130 14338 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_55270 15300 14821 gene locus_tag LOCUS_55280 gene greA 15300 14821 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_55280 16140 15403 gene locus_tag LOCUS_55290 16140 15403 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326094.1 protein_id gnl|my_center|LOCUS_55290 17901 16240 gene locus_tag LOCUS_55300 17901 16240 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_55300 19838 17952 gene locus_tag LOCUS_55310 19838 17952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 20999 19998 gene locus_tag LOCUS_55320 20999 19998 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_55320 21215 21412 gene locus_tag LOCUS_55330 21215 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 >Feature sequence208 1667 387 gene locus_tag LOCUS_55340 1667 387 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_55340 5885 1968 gene locus_tag LOCUS_55350 5885 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 6098 7183 gene locus_tag LOCUS_55360 6098 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 7320 8279 gene locus_tag LOCUS_55370 7320 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 10576 8399 gene locus_tag LOCUS_55380 10576 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 10824 12365 gene locus_tag LOCUS_55390 10824 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 12366 12572 gene locus_tag LOCUS_55400 12366 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 12569 13696 gene locus_tag LOCUS_55410 12569 13696 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 protein_id gnl|my_center|LOCUS_55410 15693 13714 gene locus_tag LOCUS_55420 15693 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 16991 15699 gene locus_tag LOCUS_55430 16991 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 18404 17139 gene locus_tag LOCUS_55440 gene rifK 18404 17139 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_55440 19829 18429 gene locus_tag LOCUS_55450 19829 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_55450 <21938 19853 gene locus_tag LOCUS_55460 <21938 19853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040044.1:DUF3604 domain-containing protein >Feature sequence209 2563 668 gene locus_tag LOCUS_55470 2563 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 4097 2580 gene locus_tag LOCUS_55480 4097 2580 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119147.1 protein_id gnl|my_center|LOCUS_55480 4307 5929 gene locus_tag LOCUS_55490 4307 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 5841 6674 gene locus_tag LOCUS_55500 5841 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 7018 6707 gene locus_tag LOCUS_55510 7018 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 9152 7176 gene locus_tag LOCUS_55520 9152 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 10446 9298 gene locus_tag LOCUS_55530 10446 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 10446 10727 gene locus_tag LOCUS_55540 10446 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 12261 10807 gene locus_tag LOCUS_55550 12261 10807 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_55550 13713 12301 gene locus_tag LOCUS_55560 13713 12301 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_55560 15588 13762 gene locus_tag LOCUS_55570 15588 13762 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_55570 16143 15601 gene locus_tag LOCUS_55580 16143 15601 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_55580 16535 16771 gene locus_tag LOCUS_55590 16535 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 16737 16907 gene locus_tag LOCUS_55600 16737 16907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 17091 17627 gene locus_tag LOCUS_55610 17091 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 17798 18430 gene locus_tag LOCUS_55620 17798 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 21592 19949 gene locus_tag LOCUS_55630 21592 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 >Feature sequence210 1372 917 gene locus_tag LOCUS_55640 1372 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 3147 1369 gene locus_tag LOCUS_55650 3147 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 3927 3352 gene locus_tag LOCUS_55660 3927 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 4721 4272 gene locus_tag LOCUS_55670 4721 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 5376 4714 gene locus_tag LOCUS_55680 5376 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 6171 5671 gene locus_tag LOCUS_55690 6171 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 6441 6755 gene locus_tag LOCUS_55700 6441 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 7036 6746 gene locus_tag LOCUS_55710 7036 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 8457 7234 gene locus_tag LOCUS_55720 8457 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 10435 8492 gene locus_tag LOCUS_55730 10435 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 12739 10574 gene locus_tag LOCUS_55740 12739 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 13897 12845 gene locus_tag LOCUS_55750 13897 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 13972 14226 gene locus_tag LOCUS_55760 13972 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 15977 14682 gene locus_tag LOCUS_55770 15977 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 17386 16007 gene locus_tag LOCUS_55780 17386 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 17835 17503 gene locus_tag LOCUS_55790 17835 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 18640 17936 gene locus_tag LOCUS_55800 18640 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 19481 18672 gene locus_tag LOCUS_55810 19481 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 >Feature sequence211 846 169 gene locus_tag LOCUS_55820 gene ccsA 846 169 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_55820 1519 851 gene locus_tag LOCUS_55830 1519 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 2239 1535 gene locus_tag LOCUS_55840 2239 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 4377 2260 gene locus_tag LOCUS_55850 4377 2260 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_55850 4814 4374 gene locus_tag LOCUS_55860 4814 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 5338 5892 gene locus_tag LOCUS_55870 5338 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 7317 5899 gene locus_tag LOCUS_55880 7317 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 8612 7323 gene locus_tag LOCUS_55890 8612 7323 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931995.1 protein_id gnl|my_center|LOCUS_55890 9024 8593 gene locus_tag LOCUS_55900 9024 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 9398 9949 gene locus_tag LOCUS_55910 9398 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 10319 12622 gene locus_tag LOCUS_55920 10319 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 12627 14270 gene locus_tag LOCUS_55930 12627 14270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 14347 16803 gene locus_tag LOCUS_55940 14347 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 19278 16960 gene locus_tag LOCUS_55950 19278 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 20834 19341 gene locus_tag LOCUS_55960 20834 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 >Feature sequence212 2405 66 gene locus_tag LOCUS_55970 2405 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 3770 3129 gene locus_tag LOCUS_55980 3770 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 4353 4550 gene locus_tag LOCUS_55990 4353 4550 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_55990 5235 8261 gene locus_tag LOCUS_56000 5235 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 8784 8524 gene locus_tag LOCUS_56010 8784 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 9014 8850 gene locus_tag LOCUS_56020 9014 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 9810 9616 gene locus_tag LOCUS_56030 9810 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 10958 9813 gene locus_tag LOCUS_56040 10958 9813 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_56040 12029 10989 gene locus_tag LOCUS_56050 12029 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 12427 12026 gene locus_tag LOCUS_56060 12427 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 13984 15666 gene locus_tag LOCUS_56070 13984 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 16761 15862 gene locus_tag LOCUS_56080 16761 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 18007 16919 gene locus_tag LOCUS_56090 18007 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 >Feature sequence213 382 1041 gene locus_tag LOCUS_56100 382 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 1022 2023 gene locus_tag LOCUS_56110 1022 2023 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921674.1 protein_id gnl|my_center|LOCUS_56110 2115 2921 gene locus_tag LOCUS_56120 gene pssA 2115 2921 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616286.1 protein_id gnl|my_center|LOCUS_56120 3113 3562 gene locus_tag LOCUS_56130 3113 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 4723 3569 gene locus_tag LOCUS_56140 4723 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 6178 4919 gene locus_tag LOCUS_56150 6178 4919 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_56150 6571 7476 gene locus_tag LOCUS_56160 6571 7476 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_56160 7481 9841 gene locus_tag LOCUS_56170 7481 9841 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942746.1 protein_id gnl|my_center|LOCUS_56170 10354 9899 gene locus_tag LOCUS_56180 10354 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 10502 11911 gene locus_tag LOCUS_56190 10502 11911 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_56190 11945 13387 gene locus_tag LOCUS_56200 11945 13387 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_56200 14247 13579 gene locus_tag LOCUS_56210 14247 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 15834 14347 gene locus_tag LOCUS_56220 15834 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 18357 15961 gene locus_tag LOCUS_56230 18357 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 19656 18739 gene locus_tag LOCUS_56240 19656 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 20580 19819 gene locus_tag LOCUS_56250 20580 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 20804 21148 gene locus_tag LOCUS_56260 20804 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 >Feature sequence214 815 201 gene locus_tag LOCUS_56270 815 201 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325155.1 protein_id gnl|my_center|LOCUS_56270 1664 981 gene locus_tag LOCUS_56280 1664 981 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_56280 3198 1993 gene locus_tag LOCUS_56290 3198 1993 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_56290 3304 3729 gene locus_tag LOCUS_56300 3304 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 3743 6631 gene locus_tag LOCUS_56310 3743 6631 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615777.1 protein_id gnl|my_center|LOCUS_56310 8799 6679 gene locus_tag LOCUS_56320 gene glgX 8799 6679 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_56320 9155 9454 gene locus_tag LOCUS_56330 9155 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328915.1 protein_id gnl|my_center|LOCUS_56330 9479 10240 gene locus_tag LOCUS_56340 9479 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 10790 10419 gene locus_tag LOCUS_56350 10790 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 10946 14932 gene locus_tag LOCUS_56360 10946 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334944.1 protein_id gnl|my_center|LOCUS_56360 15839 15000 gene locus_tag LOCUS_56370 15839 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_56370 16757 16044 gene locus_tag LOCUS_56380 16757 16044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 17302 17928 gene locus_tag LOCUS_56390 17302 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 18272 20269 gene locus_tag LOCUS_56400 gene glgB 18272 20269 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324338.1 protein_id gnl|my_center|LOCUS_56400 20779 20354 gene locus_tag LOCUS_56410 20779 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 >Feature sequence215 277 204 gene locus_tag LOCUS_t00280 277 204 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1196 414 gene locus_tag LOCUS_56420 1196 414 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121590.1 protein_id gnl|my_center|LOCUS_56420 2194 1661 gene locus_tag LOCUS_56430 2194 1661 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530095.1 protein_id gnl|my_center|LOCUS_56430 2394 3137 gene locus_tag LOCUS_56440 2394 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_56440 4779 3463 gene locus_tag LOCUS_56450 4779 3463 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_56450 5525 5007 gene locus_tag LOCUS_56460 5525 5007 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_56460 6211 6537 gene locus_tag LOCUS_56470 gene rpsJ 6211 6537 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_56470 6714 7475 gene locus_tag LOCUS_56480 gene rplC 6714 7475 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_56480 7483 8127 gene locus_tag LOCUS_56490 gene rplD 7483 8127 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_56490 8223 8549 gene locus_tag LOCUS_56500 gene rplW 8223 8549 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_56500 8593 9453 gene locus_tag LOCUS_56510 gene rplB 8593 9453 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_56510 9472 9741 gene locus_tag LOCUS_56520 gene rpsS 9472 9741 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_56520 9757 10113 gene locus_tag LOCUS_56530 gene rplV 9757 10113 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121604.1 protein_id gnl|my_center|LOCUS_56530 10116 10829 gene locus_tag LOCUS_56540 gene rpsC 10116 10829 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_56540 10768 11184 gene locus_tag LOCUS_56550 gene rplP 10768 11184 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_56550 11200 11418 gene locus_tag LOCUS_56560 11200 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 11424 11732 gene locus_tag LOCUS_56570 gene rpsQ 11424 11732 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812390.1 protein_id gnl|my_center|LOCUS_56570 11729 12097 gene locus_tag LOCUS_56580 gene rplN 11729 12097 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_56580 12097 12453 gene locus_tag LOCUS_56590 gene rplX 12097 12453 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326807.1 protein_id gnl|my_center|LOCUS_56590 12577 13140 gene locus_tag LOCUS_56600 gene rplE 12577 13140 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173391575.1 protein_id gnl|my_center|LOCUS_56600 13450 13845 gene locus_tag LOCUS_56610 gene rpsH 13450 13845 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_56610 13832 14410 gene locus_tag LOCUS_56620 gene rplF 13832 14410 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_56620 14489 14857 gene locus_tag LOCUS_56630 gene rplR 14489 14857 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326812.1 protein_id gnl|my_center|LOCUS_56630 14934 15419 gene locus_tag LOCUS_56640 gene rpsE 14934 15419 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_56640 15416 15901 gene locus_tag LOCUS_56650 gene rplO 15416 15901 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 protein_id gnl|my_center|LOCUS_56650 16006 17370 gene locus_tag LOCUS_56660 gene secY 16006 17370 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_56660 17751 18134 gene locus_tag LOCUS_56670 gene rpsM 17751 18134 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_56670 18208 18588 gene locus_tag LOCUS_56680 gene rpsK 18208 18588 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_56680 18665 19663 gene locus_tag LOCUS_56690 18665 19663 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_56690 19740 20420 gene locus_tag LOCUS_56700 19740 20420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 >Feature sequence216 2048 966 gene locus_tag LOCUS_56710 2048 966 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_56710 3426 2056 gene locus_tag LOCUS_56720 3426 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 4760 3423 gene locus_tag LOCUS_56730 4760 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 5719 4760 gene locus_tag LOCUS_56740 5719 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 6812 5730 gene locus_tag LOCUS_56750 6812 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 7620 6844 gene locus_tag LOCUS_56760 7620 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 9163 7625 gene locus_tag LOCUS_56770 9163 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 10328 12319 gene locus_tag LOCUS_56780 10328 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 13791 12445 gene locus_tag LOCUS_56790 13791 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 16558 14327 gene locus_tag LOCUS_56800 16558 14327 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664668.1 protein_id gnl|my_center|LOCUS_56800 16844 18838 gene locus_tag LOCUS_56810 16844 18838 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_56810 18964 19827 gene locus_tag LOCUS_56820 18964 19827 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117849.1 protein_id gnl|my_center|LOCUS_56820 >Feature sequence217 196 981 gene locus_tag LOCUS_56830 196 981 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_56830 1135 1686 gene locus_tag LOCUS_56840 1135 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 1858 5142 gene locus_tag LOCUS_56850 1858 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 5329 7182 gene locus_tag LOCUS_56860 5329 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 7338 9734 gene locus_tag LOCUS_56870 7338 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 9915 17261 gene locus_tag LOCUS_56880 9915 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 17441 18418 gene locus_tag LOCUS_56890 17441 18418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 18533 18958 gene locus_tag LOCUS_56900 18533 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 18961 19365 gene locus_tag LOCUS_56910 18961 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 19368 19886 gene locus_tag LOCUS_56920 19368 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 >Feature sequence218 403 843 gene locus_tag LOCUS_56930 403 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 2402 990 gene locus_tag LOCUS_56940 2402 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 4064 2688 gene locus_tag LOCUS_56950 4064 2688 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_56950 6006 4489 gene locus_tag LOCUS_56960 6006 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 7313 6069 gene locus_tag LOCUS_56970 7313 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 10422 7936 gene locus_tag LOCUS_56980 10422 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 12451 10571 gene locus_tag LOCUS_56990 12451 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 13086 12718 gene locus_tag LOCUS_57000 13086 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 13272 13105 gene locus_tag LOCUS_57010 13272 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 13472 14659 gene locus_tag LOCUS_57020 13472 14659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 14783 15007 gene locus_tag LOCUS_57030 14783 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 14994 15413 gene locus_tag LOCUS_57040 14994 15413 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_57040 15460 16461 gene locus_tag LOCUS_57050 15460 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 16918 18264 gene locus_tag LOCUS_57060 16918 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 >Feature sequence219 523 2421 gene locus_tag LOCUS_57070 523 2421 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_57070 2650 3570 gene locus_tag LOCUS_57080 2650 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120449.1 protein_id gnl|my_center|LOCUS_57080 3765 4745 gene locus_tag LOCUS_57090 3765 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 4808 5626 gene locus_tag LOCUS_57100 4808 5626 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_57100 5626 6054 gene locus_tag LOCUS_57110 5626 6054 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119077.1 protein_id gnl|my_center|LOCUS_57110 6054 6509 gene locus_tag LOCUS_57120 6054 6509 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119076.1 protein_id gnl|my_center|LOCUS_57120 6549 7673 gene locus_tag LOCUS_57130 6549 7673 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_57130 7898 7972 gene locus_tag LOCUS_t00290 7898 7972 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8289 9374 gene locus_tag LOCUS_57140 8289 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 10258 9479 gene locus_tag LOCUS_57150 10258 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 11512 10481 gene locus_tag LOCUS_57160 11512 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 13584 11596 gene locus_tag LOCUS_57170 gene nadE 13584 11596 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_57170 13864 14478 gene locus_tag LOCUS_57180 13864 14478 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_57180 14951 14619 gene locus_tag LOCUS_57190 gene rplU 14951 14619 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325148.1 protein_id gnl|my_center|LOCUS_57190 15177 16361 gene locus_tag LOCUS_57200 15177 16361 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_57200 16363 17190 gene locus_tag LOCUS_57210 16363 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 17220 17633 gene locus_tag LOCUS_57220 17220 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 18254 17685 gene locus_tag LOCUS_57230 18254 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 19250 18258 gene locus_tag LOCUS_57240 gene prfB 19250 18258 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146392543.1 protein_id gnl|my_center|LOCUS_57240 19625 20728 gene locus_tag LOCUS_57250 gene mnmA 19625 20728 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_57250 20782 20864 gene locus_tag LOCUS_t00300 20782 20864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence220 <1 947 gene locus_tag LOCUS_57260 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922846.1:IRE (iron responsive element) 1416 2054 gene locus_tag LOCUS_57270 1416 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 2199 2474 gene locus_tag LOCUS_57280 2199 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 4005 2512 gene locus_tag LOCUS_57290 4005 2512 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_57290 5928 4828 gene locus_tag LOCUS_57300 5928 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 6936 6004 gene locus_tag LOCUS_57310 6936 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 7319 8791 gene locus_tag LOCUS_57320 7319 8791 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_57320 9366 9914 gene locus_tag LOCUS_57330 9366 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 10967 9921 gene locus_tag LOCUS_57340 gene queA 10967 9921 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_57340 11078 11890 gene locus_tag LOCUS_57350 11078 11890 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_57350 12491 11985 gene locus_tag LOCUS_57360 12491 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 13581 12583 gene locus_tag LOCUS_57370 13581 12583 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615590.1 protein_id gnl|my_center|LOCUS_57370 14771 13578 gene locus_tag LOCUS_57380 gene argJ 14771 13578 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119260.1 protein_id gnl|my_center|LOCUS_57380 15256 14774 gene locus_tag LOCUS_57390 15256 14774 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_57390 15642 15292 gene locus_tag LOCUS_57400 15642 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 16669 15788 gene locus_tag LOCUS_57410 gene rsmH 16669 15788 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121784.1 protein_id gnl|my_center|LOCUS_57410 16822 17040 gene locus_tag LOCUS_57420 16822 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 17461 17066 gene locus_tag LOCUS_57430 17461 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 18963 17839 gene locus_tag LOCUS_57440 18963 17839 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122846.1 protein_id gnl|my_center|LOCUS_57440 19189 18980 gene locus_tag LOCUS_57450 19189 18980 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_57450 19382 19194 gene locus_tag LOCUS_57460 19382 19194 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_57460 <20684 19410 gene locus_tag LOCUS_57470 <20684 19410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227631.1:pyruvate kinase >Feature sequence221 567 2609 gene locus_tag LOCUS_57480 567 2609 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109364.1 protein_id gnl|my_center|LOCUS_57480 3595 3131 gene locus_tag LOCUS_57490 3595 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 4054 3731 gene locus_tag LOCUS_57500 4054 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 4441 5844 gene locus_tag LOCUS_57510 4441 5844 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_57510 6275 5994 gene locus_tag LOCUS_57520 6275 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 6394 6714 gene locus_tag LOCUS_57530 6394 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 6875 8881 gene locus_tag LOCUS_57540 6875 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 10056 8920 gene locus_tag LOCUS_57550 10056 8920 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_57550 10196 11188 gene locus_tag LOCUS_57560 10196 11188 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_57560 12373 11273 gene locus_tag LOCUS_57570 12373 11273 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_57570 15430 12392 gene locus_tag LOCUS_57580 15430 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 16386 15580 gene locus_tag LOCUS_57590 16386 15580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 16545 16763 gene locus_tag LOCUS_57600 16545 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 17000 18031 gene locus_tag LOCUS_57610 17000 18031 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_57610 18889 18125 gene locus_tag LOCUS_57620 18889 18125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 19484 19005 gene locus_tag LOCUS_57630 19484 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 20275 19565 gene locus_tag LOCUS_57640 20275 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 >Feature sequence222 1461 82 gene locus_tag LOCUS_57650 1461 82 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_57650 1706 2110 gene locus_tag LOCUS_57660 1706 2110 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_57660 2549 2157 gene locus_tag LOCUS_57670 2549 2157 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_57670 2824 4542 gene locus_tag LOCUS_57680 2824 4542 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_57680 4584 4901 gene locus_tag LOCUS_57690 4584 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 7380 4972 gene locus_tag LOCUS_57700 7380 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 8985 7582 gene locus_tag LOCUS_57710 8985 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 12252 9103 gene locus_tag LOCUS_57720 12252 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 12814 12299 gene locus_tag LOCUS_57730 gene mobB 12814 12299 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969528.1 protein_id gnl|my_center|LOCUS_57730 12881 16066 gene locus_tag LOCUS_57740 12881 16066 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_57740 16354 16106 gene locus_tag LOCUS_57750 16354 16106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 17658 16384 gene locus_tag LOCUS_57760 17658 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 18283 17906 gene locus_tag LOCUS_57770 18283 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 19308 18409 gene locus_tag LOCUS_57780 19308 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 20480 19308 gene locus_tag LOCUS_57790 gene hflC 20480 19308 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_57790 >Feature sequence223 1610 825 gene locus_tag LOCUS_57800 1610 825 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_57800 2953 1685 gene locus_tag LOCUS_57810 2953 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_57810 3520 6063 gene locus_tag LOCUS_57820 3520 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 6079 7047 gene locus_tag LOCUS_57830 6079 7047 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_57830 7286 8077 gene locus_tag LOCUS_57840 7286 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 8221 9579 gene locus_tag LOCUS_57850 8221 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 12846 9583 gene locus_tag LOCUS_57860 12846 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 13142 12978 gene locus_tag LOCUS_57870 13142 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 14498 13260 gene locus_tag LOCUS_57880 14498 13260 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_57880 15802 14573 gene locus_tag LOCUS_57890 15802 14573 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_57890 17163 15892 gene locus_tag LOCUS_57900 17163 15892 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_57900 >Feature sequence224 2075 108 gene locus_tag LOCUS_57910 2075 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121814.1 protein_id gnl|my_center|LOCUS_57910 2383 3771 gene locus_tag LOCUS_57920 gene argH 2383 3771 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_57920 3862 6204 gene locus_tag LOCUS_57930 3862 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 6313 7383 gene locus_tag LOCUS_57940 6313 7383 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434800.1 protein_id gnl|my_center|LOCUS_57940 7845 11900 gene locus_tag LOCUS_57950 7845 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 12387 12776 gene locus_tag LOCUS_57960 12387 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 12912 13532 gene locus_tag LOCUS_57970 12912 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 13718 16450 gene locus_tag LOCUS_57980 13718 16450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 17099 16587 gene locus_tag LOCUS_57990 17099 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_57990 17350 17096 gene locus_tag LOCUS_58000 17350 17096 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_58000 17567 17328 gene locus_tag LOCUS_58010 17567 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 20367 17557 gene locus_tag LOCUS_58020 20367 17557 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_58020 >Feature sequence225 717 1742 gene locus_tag LOCUS_58030 717 1742 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722159.1 protein_id gnl|my_center|LOCUS_58030 1818 4241 gene locus_tag LOCUS_58040 1818 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 4275 5114 gene locus_tag LOCUS_58050 4275 5114 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086979.1 protein_id gnl|my_center|LOCUS_58050 5388 6419 gene locus_tag LOCUS_58060 5388 6419 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_58060 6412 7092 gene locus_tag LOCUS_58070 6412 7092 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535853.1 protein_id gnl|my_center|LOCUS_58070 7240 8043 gene locus_tag LOCUS_58080 gene fetB 7240 8043 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538235.1 protein_id gnl|my_center|LOCUS_58080 9731 8094 gene locus_tag LOCUS_58090 9731 8094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328354.1 protein_id gnl|my_center|LOCUS_58090 10370 9750 gene locus_tag LOCUS_58100 10370 9750 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_58100 10538 11188 gene locus_tag LOCUS_58110 10538 11188 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 protein_id gnl|my_center|LOCUS_58110 11889 11185 gene locus_tag LOCUS_58120 gene queC 11889 11185 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_58120 12285 13589 gene locus_tag LOCUS_58130 12285 13589 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_58130 13765 16209 gene locus_tag LOCUS_58140 13765 16209 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_58140 16311 18728 gene locus_tag LOCUS_58150 16311 18728 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_58150 18740 20242 gene locus_tag LOCUS_58160 18740 20242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 >Feature sequence226 796 1008 gene locus_tag LOCUS_58170 796 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 2220 1324 gene locus_tag LOCUS_58180 2220 1324 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_58180 2954 2430 gene locus_tag LOCUS_58190 2954 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 3135 3965 gene locus_tag LOCUS_58200 3135 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 3941 4210 gene locus_tag LOCUS_58210 3941 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 5470 4631 gene locus_tag LOCUS_58220 5470 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 7791 5545 gene locus_tag LOCUS_58230 7791 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 8249 7872 gene locus_tag LOCUS_58240 8249 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 8397 8218 gene locus_tag LOCUS_58250 8397 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 9070 8564 gene locus_tag LOCUS_58260 9070 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 10035 9064 gene locus_tag LOCUS_58270 10035 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 11666 11046 gene locus_tag LOCUS_58280 11666 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 12051 12380 gene locus_tag LOCUS_58290 12051 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 13075 12449 gene locus_tag LOCUS_58300 13075 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 13452 13637 gene locus_tag LOCUS_58310 13452 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 14346 14017 gene locus_tag LOCUS_58320 14346 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 15376 15053 gene locus_tag LOCUS_58330 15376 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 15689 15459 gene locus_tag LOCUS_58340 15689 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 16075 16842 gene locus_tag LOCUS_58350 16075 16842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 17003 18478 gene locus_tag LOCUS_58360 17003 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 19613 19921 gene locus_tag LOCUS_58370 19613 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 >Feature sequence227 <1 732 gene locus_tag LOCUS_58380 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794868.1:creatininase family protein 935 1666 gene locus_tag LOCUS_58390 935 1666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 protein_id gnl|my_center|LOCUS_58390 1689 3095 gene locus_tag LOCUS_58400 1689 3095 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_58400 3114 4532 gene locus_tag LOCUS_58410 3114 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 4529 5461 gene locus_tag LOCUS_58420 4529 5461 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_58420 7928 5631 gene locus_tag LOCUS_58430 7928 5631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921672.1 protein_id gnl|my_center|LOCUS_58430 8890 7925 gene locus_tag LOCUS_58440 8890 7925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119554.1 protein_id gnl|my_center|LOCUS_58440 11725 9155 gene locus_tag LOCUS_58450 11725 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 12016 14388 gene locus_tag LOCUS_58460 12016 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 14388 14963 gene locus_tag LOCUS_58470 14388 14963 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_58470 16459 14975 gene locus_tag LOCUS_58480 gene aroE 16459 14975 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_58480 17904 16582 gene locus_tag LOCUS_58490 gene aroC 17904 16582 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_58490 19187 17898 gene locus_tag LOCUS_58500 gene aroA 19187 17898 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_58500 >Feature sequence228 1147 482 gene locus_tag LOCUS_58510 1147 482 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_58510 1859 1374 gene locus_tag LOCUS_58520 1859 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 2550 2107 gene locus_tag LOCUS_58530 2550 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 3332 2631 gene locus_tag LOCUS_58540 3332 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 3992 4954 gene locus_tag LOCUS_58550 3992 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 5038 5406 gene locus_tag LOCUS_58560 5038 5406 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324404.1 protein_id gnl|my_center|LOCUS_58560 8444 5673 gene locus_tag LOCUS_58570 8444 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 10169 9618 gene locus_tag LOCUS_58580 10169 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 10444 10632 gene locus_tag LOCUS_58590 10444 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 11257 10640 gene locus_tag LOCUS_58600 11257 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 11981 12187 gene locus_tag LOCUS_58610 11981 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 12367 12564 gene locus_tag LOCUS_58620 12367 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 12754 14100 gene locus_tag LOCUS_58630 12754 14100 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_58630 15648 15001 gene locus_tag LOCUS_58640 15648 15001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_58640 18971 15816 gene locus_tag LOCUS_58650 18971 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 19579 18977 gene locus_tag LOCUS_58660 19579 18977 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 protein_id gnl|my_center|LOCUS_58660 >Feature sequence229 1143 5717 gene locus_tag LOCUS_58670 1143 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 6828 5767 gene locus_tag LOCUS_58680 6828 5767 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_58680 8341 6839 gene locus_tag LOCUS_58690 8341 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 8553 9857 gene locus_tag LOCUS_58700 gene gdhA 8553 9857 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_58700 10232 15223 gene locus_tag LOCUS_58710 10232 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 16492 15290 gene locus_tag LOCUS_58720 16492 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 17782 16532 gene locus_tag LOCUS_58730 17782 16532 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_58730 17999 18910 gene locus_tag LOCUS_58740 17999 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 <20300 18931 gene locus_tag LOCUS_58750 <20300 18931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein >Feature sequence230 220 1305 gene locus_tag LOCUS_58760 220 1305 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965351.1 protein_id gnl|my_center|LOCUS_58760 1631 1323 gene locus_tag LOCUS_58770 1631 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 4126 1859 gene locus_tag LOCUS_58780 4126 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 5965 4241 gene locus_tag LOCUS_58790 5965 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 7017 6607 gene locus_tag LOCUS_58800 7017 6607 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384603.1 protein_id gnl|my_center|LOCUS_58800 7784 7029 gene locus_tag LOCUS_58810 gene gmk 7784 7029 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_58810 10228 7802 gene locus_tag LOCUS_58820 10228 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 11938 10595 gene locus_tag LOCUS_58830 11938 10595 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_58830 12114 12599 gene locus_tag LOCUS_58840 12114 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 12767 14068 gene locus_tag LOCUS_58850 12767 14068 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_58850 14236 16053 gene locus_tag LOCUS_58860 14236 16053 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_58860 16331 16107 gene locus_tag LOCUS_58870 16331 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 16567 16926 gene locus_tag LOCUS_58880 16567 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 17244 19337 gene locus_tag LOCUS_58890 17244 19337 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_58890 >Feature sequence231 2677 77 gene locus_tag LOCUS_58900 2677 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 4476 2776 gene locus_tag LOCUS_58910 4476 2776 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262483.1 protein_id gnl|my_center|LOCUS_58910 4790 6223 gene locus_tag LOCUS_58920 4790 6223 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_58920 6307 8478 gene locus_tag LOCUS_58930 6307 8478 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922751.1 protein_id gnl|my_center|LOCUS_58930 8683 9420 gene locus_tag LOCUS_58940 8683 9420 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_58940 9448 10884 gene locus_tag LOCUS_58950 9448 10884 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261293.1 protein_id gnl|my_center|LOCUS_58950 11260 11006 gene locus_tag LOCUS_58960 11260 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 11628 11419 gene locus_tag LOCUS_58970 11628 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 12587 12030 gene locus_tag LOCUS_58980 12587 12030 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_58980 13510 12713 gene locus_tag LOCUS_58990 13510 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 14463 13678 gene locus_tag LOCUS_59000 gene fliR 14463 13678 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420038.1 protein_id gnl|my_center|LOCUS_59000 14740 14465 gene locus_tag LOCUS_59010 gene fliQ 14740 14465 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329633.1 protein_id gnl|my_center|LOCUS_59010 15486 14869 gene locus_tag LOCUS_59020 15486 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 15485 15748 gene locus_tag LOCUS_59030 15485 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 16388 15783 gene locus_tag LOCUS_59040 16388 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 16855 16478 gene locus_tag LOCUS_59050 gene fliN 16855 16478 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918792.1 protein_id gnl|my_center|LOCUS_59050 17140 16895 gene locus_tag LOCUS_59060 17140 16895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 17213 17353 gene locus_tag LOCUS_59070 17213 17353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 18835 17525 gene locus_tag LOCUS_59080 gene fliI 18835 17525 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_59080 19510 18848 gene locus_tag LOCUS_59090 19510 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 20125 19541 gene locus_tag LOCUS_59100 20125 19541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 >Feature sequence232 <1 2676 gene locus_tag LOCUS_59110 <1 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158208138.1:DNRLRE domain-containing protein 3092 3457 gene locus_tag LOCUS_59120 3092 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 4325 4777 gene locus_tag LOCUS_59130 4325 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 4796 4945 gene locus_tag LOCUS_59140 4796 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 5174 11521 gene locus_tag LOCUS_59150 5174 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 11644 12273 gene locus_tag LOCUS_59160 11644 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 12650 12874 gene locus_tag LOCUS_59170 12650 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59170 13861 13139 gene locus_tag LOCUS_59180 13861 13139 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404487.1 protein_id gnl|my_center|LOCUS_59180 13979 16273 gene locus_tag LOCUS_59190 13979 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123883.1 protein_id gnl|my_center|LOCUS_59190 16592 16942 gene locus_tag LOCUS_59200 gene raiA 16592 16942 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328917.1 protein_id gnl|my_center|LOCUS_59200 16972 17493 gene locus_tag LOCUS_59210 16972 17493 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_59210 17554 17841 gene locus_tag LOCUS_59220 17554 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 17944 19680 gene locus_tag LOCUS_59230 gene ptsP 17944 19680 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_59230 >Feature sequence233 290 637 gene locus_tag LOCUS_59240 290 637 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_59240 659 2881 gene locus_tag LOCUS_59250 659 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 2885 3817 gene locus_tag LOCUS_59260 2885 3817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_59260 4338 6668 gene locus_tag LOCUS_59270 4338 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 6658 7275 gene locus_tag LOCUS_59280 gene fixJ 6658 7275 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_59280 7803 9917 gene locus_tag LOCUS_59290 7803 9917 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141452.1 protein_id gnl|my_center|LOCUS_59290 9929 10501 gene locus_tag LOCUS_59300 9929 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 10739 12799 gene locus_tag LOCUS_59310 10739 12799 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_59310 13981 12887 gene locus_tag LOCUS_59320 13981 12887 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_59320 14699 14007 gene locus_tag LOCUS_59330 14699 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 15379 17679 gene locus_tag LOCUS_59340 15379 17679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59340 17710 17988 gene locus_tag LOCUS_59350 17710 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 19104 18067 gene locus_tag LOCUS_59360 gene purM 19104 18067 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_59360 19864 19196 gene locus_tag LOCUS_59370 19864 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 >Feature sequence234 957 1373 gene locus_tag LOCUS_59380 957 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 1973 1605 gene locus_tag LOCUS_59390 1973 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 3090 2023 gene locus_tag LOCUS_59400 3090 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 4448 3252 gene locus_tag LOCUS_59410 4448 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 6166 4829 gene locus_tag LOCUS_59420 6166 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 7073 7519 gene locus_tag LOCUS_59430 7073 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 7603 8556 gene locus_tag LOCUS_59440 7603 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 8553 9869 gene locus_tag LOCUS_59450 8553 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 9889 10713 gene locus_tag LOCUS_59460 9889 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 10720 11334 gene locus_tag LOCUS_59470 10720 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 11678 15961 gene locus_tag LOCUS_59480 11678 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 16194 16577 gene locus_tag LOCUS_59490 16194 16577 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_59490 16574 19327 gene locus_tag LOCUS_59500 16574 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 19446 19255 gene locus_tag LOCUS_59510 19446 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 19498 19806 gene locus_tag LOCUS_59520 19498 19806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 >Feature sequence235 402 232 gene locus_tag LOCUS_59530 402 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 2196 430 gene locus_tag LOCUS_59540 2196 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 3423 2407 gene locus_tag LOCUS_59550 3423 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 5396 3507 gene locus_tag LOCUS_59560 5396 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 6651 5530 gene locus_tag LOCUS_59570 6651 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 6919 8265 gene locus_tag LOCUS_59580 6919 8265 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119708.1 protein_id gnl|my_center|LOCUS_59580 8267 9691 gene locus_tag LOCUS_59590 8267 9691 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_59590 10981 9740 gene locus_tag LOCUS_59600 10981 9740 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_59600 11376 12653 gene locus_tag LOCUS_59610 11376 12653 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_59610 12631 13887 gene locus_tag LOCUS_59620 12631 13887 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_59620 14570 13953 gene locus_tag LOCUS_59630 gene fixJ 14570 13953 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_59630 16485 14560 gene locus_tag LOCUS_59640 16485 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 17289 16516 gene locus_tag LOCUS_59650 17289 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 19563 17419 gene locus_tag LOCUS_59660 19563 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 >Feature sequence236 348 199 gene locus_tag LOCUS_59670 348 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 702 1610 gene locus_tag LOCUS_59680 702 1610 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_59680 1846 2079 gene locus_tag LOCUS_59690 1846 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 2051 2446 gene locus_tag LOCUS_59700 2051 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 2515 4131 gene locus_tag LOCUS_59710 2515 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 4284 5708 gene locus_tag LOCUS_59720 4284 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 5850 7835 gene locus_tag LOCUS_59730 5850 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 8963 8019 gene locus_tag LOCUS_59740 8963 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 10302 9199 gene locus_tag LOCUS_59750 10302 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 10492 11145 gene locus_tag LOCUS_59760 10492 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325368.1 protein_id gnl|my_center|LOCUS_59760 14208 11167 gene locus_tag LOCUS_59770 14208 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 14466 15350 gene locus_tag LOCUS_59780 14466 15350 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_59780 16905 15643 gene locus_tag LOCUS_59790 16905 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_59790 18383 16968 gene locus_tag LOCUS_59800 18383 16968 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_59800 18903 18364 gene locus_tag LOCUS_59810 18903 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 19811 18903 gene locus_tag LOCUS_59820 19811 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 >Feature sequence237 2223 7 gene locus_tag LOCUS_59830 2223 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 2380 4128 gene locus_tag LOCUS_59840 gene lnt 2380 4128 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921835.1 protein_id gnl|my_center|LOCUS_59840 4384 5262 gene locus_tag LOCUS_59850 4384 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336109.1 protein_id gnl|my_center|LOCUS_59850 5225 5488 gene locus_tag LOCUS_59860 5225 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 5576 7114 gene locus_tag LOCUS_59870 5576 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 7024 7302 gene locus_tag LOCUS_59880 7024 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 7374 8429 gene locus_tag LOCUS_59890 7374 8429 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615784.1 protein_id gnl|my_center|LOCUS_59890 8463 9491 gene locus_tag LOCUS_59900 8463 9491 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017578.1 protein_id gnl|my_center|LOCUS_59900 11154 9637 gene locus_tag LOCUS_59910 11154 9637 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250650.1 protein_id gnl|my_center|LOCUS_59910 11385 12077 gene locus_tag LOCUS_59920 gene bshB1 11385 12077 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_59920 12711 12085 gene locus_tag LOCUS_59930 12711 12085 CDS product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615783.1 protein_id gnl|my_center|LOCUS_59930 13195 14607 gene locus_tag LOCUS_59940 gene glnA 13195 14607 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_59940 14987 15739 gene locus_tag LOCUS_59950 14987 15739 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922086.1 protein_id gnl|my_center|LOCUS_59950 15842 17227 gene locus_tag LOCUS_59960 15842 17227 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_59960 17211 17810 gene locus_tag LOCUS_59970 17211 17810 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922085.1 protein_id gnl|my_center|LOCUS_59970 17952 18413 gene locus_tag LOCUS_59980 17952 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327803.1 protein_id gnl|my_center|LOCUS_59980 18857 19759 gene locus_tag LOCUS_59990 18857 19759 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816586.1 protein_id gnl|my_center|LOCUS_59990 >Feature sequence238 525 2570 gene locus_tag LOCUS_60000 525 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 2679 4145 gene locus_tag LOCUS_60010 2679 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 4197 7361 gene locus_tag LOCUS_60020 4197 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 7665 8864 gene locus_tag LOCUS_60030 7665 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 11788 8909 gene locus_tag LOCUS_60040 11788 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 11912 12085 gene locus_tag LOCUS_60050 11912 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 12600 15299 gene locus_tag LOCUS_60060 12600 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 16154 15417 gene locus_tag LOCUS_60070 16154 15417 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_60070 16529 17497 gene locus_tag LOCUS_60080 16529 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 >Feature sequence239 955 53 gene locus_tag LOCUS_60090 955 53 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_60090 2006 1017 gene locus_tag LOCUS_60100 2006 1017 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_60100 2165 3007 gene locus_tag LOCUS_60110 2165 3007 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775659.1 protein_id gnl|my_center|LOCUS_60110 3354 3043 gene locus_tag LOCUS_60120 3354 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 3886 4968 gene locus_tag LOCUS_60130 3886 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 5515 5006 gene locus_tag LOCUS_60140 5515 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 6958 5927 gene locus_tag LOCUS_60150 gene ruvB 6958 5927 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331968.1 protein_id gnl|my_center|LOCUS_60150 8046 6841 gene locus_tag LOCUS_60160 8046 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123815508.1 protein_id gnl|my_center|LOCUS_60160 9170 8046 gene locus_tag LOCUS_60170 9170 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122051.1 protein_id gnl|my_center|LOCUS_60170 9462 9241 gene locus_tag LOCUS_60180 9462 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 9485 10117 gene locus_tag LOCUS_60190 9485 10117 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_60190 10123 11484 gene locus_tag LOCUS_60200 10123 11484 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_60200 12162 11749 gene locus_tag LOCUS_60210 gene rpsI 12162 11749 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122781.1 protein_id gnl|my_center|LOCUS_60210 12613 12170 gene locus_tag LOCUS_60220 gene rplM 12613 12170 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328021.1 protein_id gnl|my_center|LOCUS_60220 12866 13849 gene locus_tag LOCUS_60230 12866 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 14797 13967 gene locus_tag LOCUS_60240 14797 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 15069 15668 gene locus_tag LOCUS_60250 15069 15668 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606634.1 protein_id gnl|my_center|LOCUS_60250 15810 17546 gene locus_tag LOCUS_60260 15810 17546 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_60260 17555 17788 gene locus_tag LOCUS_60270 17555 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 17805 18719 gene locus_tag LOCUS_60280 17805 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 19303 19073 gene locus_tag LOCUS_60290 19303 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 >Feature sequence240 207 1745 gene locus_tag LOCUS_60300 207 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 2725 1793 gene locus_tag LOCUS_60310 2725 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 7066 2801 gene locus_tag LOCUS_60320 7066 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 8231 7083 gene locus_tag LOCUS_60330 8231 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 11041 8276 gene locus_tag LOCUS_60340 11041 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 11349 14534 gene locus_tag LOCUS_60350 11349 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 14657 16114 gene locus_tag LOCUS_60360 14657 16114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146502312.1 protein_id gnl|my_center|LOCUS_60360 16709 16284 gene locus_tag LOCUS_60370 16709 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 17137 16706 gene locus_tag LOCUS_60380 17137 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 <19531 17298 gene locus_tag LOCUS_60390 <19531 17298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121949.1:PQQ-like beta-propeller repeat protein >Feature sequence241 1150 479 gene locus_tag LOCUS_60400 1150 479 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122890.1 protein_id gnl|my_center|LOCUS_60400 1643 1155 gene locus_tag LOCUS_60410 1643 1155 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324222.1 protein_id gnl|my_center|LOCUS_60410 2445 1792 gene locus_tag LOCUS_60420 2445 1792 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324221.1 protein_id gnl|my_center|LOCUS_60420 3651 2722 gene locus_tag LOCUS_60430 3651 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122886.1 protein_id gnl|my_center|LOCUS_60430 3887 3960 gene locus_tag LOCUS_t00310 3887 3960 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4648 4451 gene locus_tag LOCUS_60440 4648 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 4995 4645 gene locus_tag LOCUS_60450 4995 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 5378 4995 gene locus_tag LOCUS_60460 5378 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 5657 5502 gene locus_tag LOCUS_60470 5657 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 5756 7825 gene locus_tag LOCUS_60480 5756 7825 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974016.1 protein_id gnl|my_center|LOCUS_60480 7836 8483 gene locus_tag LOCUS_60490 7836 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 8780 8938 gene locus_tag LOCUS_60500 8780 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 8997 9365 gene locus_tag LOCUS_60510 8997 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 9552 10388 gene locus_tag LOCUS_60520 9552 10388 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_60520 10446 12398 gene locus_tag LOCUS_60530 10446 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 12441 14135 gene locus_tag LOCUS_60540 12441 14135 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198673836.1 protein_id gnl|my_center|LOCUS_60540 14179 15552 gene locus_tag LOCUS_60550 14179 15552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 16328 15597 gene locus_tag LOCUS_60560 16328 15597 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_60560 16875 16946 gene locus_tag LOCUS_t00320 16875 16946 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17086 17159 gene locus_tag LOCUS_t00330 17086 17159 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17414 17485 gene locus_tag LOCUS_t00340 17414 17485 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17591 17677 gene locus_tag LOCUS_t00350 17591 17677 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17770 18066 gene locus_tag LOCUS_60570 17770 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 18054 18126 gene locus_tag LOCUS_t00360 18054 18126 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18238 19041 gene locus_tag LOCUS_60580 18238 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 19125 19200 gene locus_tag LOCUS_t00370 19125 19200 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence242 90 1022 gene locus_tag LOCUS_60590 90 1022 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_60590 1205 2368 gene locus_tag LOCUS_60600 1205 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 4643 3021 gene locus_tag LOCUS_60610 4643 3021 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923057.1 protein_id gnl|my_center|LOCUS_60610 4866 5519 gene locus_tag LOCUS_60620 4866 5519 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_60620 5528 6568 gene locus_tag LOCUS_60630 5528 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666288.1 protein_id gnl|my_center|LOCUS_60630 6619 6894 gene locus_tag LOCUS_60640 6619 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 7263 8468 gene locus_tag LOCUS_60650 7263 8468 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_60650 8473 12054 gene locus_tag LOCUS_60660 8473 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 12102 13055 gene locus_tag LOCUS_60670 12102 13055 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_60670 13317 13898 gene locus_tag LOCUS_60680 13317 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 13905 14252 gene locus_tag LOCUS_60690 13905 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 16380 14344 gene locus_tag LOCUS_60700 16380 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 16433 16807 gene locus_tag LOCUS_60710 16433 16807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 16807 17067 gene locus_tag LOCUS_60720 16807 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 17129 18565 gene locus_tag LOCUS_60730 17129 18565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 >Feature sequence243 2 529 gene locus_tag LOCUS_60740 2 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 533 1816 gene locus_tag LOCUS_60750 533 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 1813 2325 gene locus_tag LOCUS_60760 1813 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 2322 2843 gene locus_tag LOCUS_60770 2322 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 2854 3276 gene locus_tag LOCUS_60780 2854 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 3273 4250 gene locus_tag LOCUS_60790 3273 4250 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_60790 4261 4752 gene locus_tag LOCUS_60800 4261 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 5288 4896 gene locus_tag LOCUS_60810 5288 4896 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813571.1 protein_id gnl|my_center|LOCUS_60810 5488 5676 gene locus_tag LOCUS_60820 5488 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 5678 7522 gene locus_tag LOCUS_60830 5678 7522 CDS product polymorphic toxin-type HINT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921936.1 protein_id gnl|my_center|LOCUS_60830 7546 8319 gene locus_tag LOCUS_60840 7546 8319 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_60840 8499 9038 gene locus_tag LOCUS_60850 8499 9038 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169876.1 protein_id gnl|my_center|LOCUS_60850 9226 11151 gene locus_tag LOCUS_60860 9226 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 11444 11283 gene locus_tag LOCUS_60870 11444 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 11404 12840 gene locus_tag LOCUS_60880 11404 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 13763 12846 gene locus_tag LOCUS_60890 13763 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 15070 13871 gene locus_tag LOCUS_60900 15070 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 15592 16962 gene locus_tag LOCUS_60910 15592 16962 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_60910 17591 17004 gene locus_tag LOCUS_60920 17591 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 17671 17826 gene locus_tag LOCUS_60930 17671 17826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 <19208 17787 gene locus_tag LOCUS_60940 <19208 17787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122749.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence244 <1 2859 gene locus_tag LOCUS_60950 <1 2859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921642.1:secretin N-terminal domain-containing protein 3040 2774 gene locus_tag LOCUS_60960 3040 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 3031 3885 gene locus_tag LOCUS_60970 3031 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 4107 5594 gene locus_tag LOCUS_60980 4107 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 5914 6654 gene locus_tag LOCUS_60990 5914 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 7019 8731 gene locus_tag LOCUS_61000 7019 8731 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_61000 8860 10065 gene locus_tag LOCUS_61010 8860 10065 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_61010 10153 10593 gene locus_tag LOCUS_61020 10153 10593 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325029.1 protein_id gnl|my_center|LOCUS_61020 10694 11200 gene locus_tag LOCUS_61030 10694 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 11197 11670 gene locus_tag LOCUS_61040 11197 11670 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434904.1 protein_id gnl|my_center|LOCUS_61040 11660 12820 gene locus_tag LOCUS_61050 11660 12820 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921875.1 protein_id gnl|my_center|LOCUS_61050 12817 14376 gene locus_tag LOCUS_61060 12817 14376 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_61060 14489 15934 gene locus_tag LOCUS_61070 14489 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120490.1 protein_id gnl|my_center|LOCUS_61070 15927 17126 gene locus_tag LOCUS_61080 15927 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120489.1 protein_id gnl|my_center|LOCUS_61080 <19143 17257 gene locus_tag LOCUS_61090 <19143 17257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615720.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence245 645 340 gene locus_tag LOCUS_61100 645 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 726 1493 gene locus_tag LOCUS_61110 726 1493 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_61110 2036 1743 gene locus_tag LOCUS_61120 2036 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 2350 5241 gene locus_tag LOCUS_61130 2350 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 5301 5813 gene locus_tag LOCUS_61140 5301 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 9294 6640 gene locus_tag LOCUS_61150 9294 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 9567 10505 gene locus_tag LOCUS_61160 9567 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 10507 11187 gene locus_tag LOCUS_61170 10507 11187 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 protein_id gnl|my_center|LOCUS_61170 11235 12521 gene locus_tag LOCUS_61180 11235 12521 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_61180 12629 14785 gene locus_tag LOCUS_61190 12629 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 16437 14968 gene locus_tag LOCUS_61200 16437 14968 CDS product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203748.1 protein_id gnl|my_center|LOCUS_61200 16604 17122 gene locus_tag LOCUS_61210 16604 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 17288 17130 gene locus_tag LOCUS_61220 17288 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 17610 17915 gene locus_tag LOCUS_61230 17610 17915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 19074 17920 gene locus_tag LOCUS_61240 19074 17920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 >Feature sequence246 383 2755 gene locus_tag LOCUS_61250 383 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61250 3346 3642 gene locus_tag LOCUS_61260 3346 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 3639 4073 gene locus_tag LOCUS_61270 3639 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 5552 4137 gene locus_tag LOCUS_61280 5552 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 7000 5549 gene locus_tag LOCUS_61290 7000 5549 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 protein_id gnl|my_center|LOCUS_61290 7133 8701 gene locus_tag LOCUS_61300 7133 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427771.1 protein_id gnl|my_center|LOCUS_61300 8698 9606 gene locus_tag LOCUS_61310 8698 9606 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_61310 9638 10903 gene locus_tag LOCUS_61320 9638 10903 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_61320 10916 12646 gene locus_tag LOCUS_61330 10916 12646 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_61330 14536 12878 gene locus_tag LOCUS_61340 14536 12878 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_61340 15331 14573 gene locus_tag LOCUS_61350 15331 14573 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918371.1 protein_id gnl|my_center|LOCUS_61350 15729 17558 gene locus_tag LOCUS_61360 15729 17558 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_61360 18432 17578 gene locus_tag LOCUS_61370 18432 17578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 >Feature sequence247 4262 3012 gene locus_tag LOCUS_61380 4262 3012 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_61380 4562 5953 gene locus_tag LOCUS_61390 4562 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 5993 6145 gene locus_tag LOCUS_61400 5993 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 7056 6307 gene locus_tag LOCUS_61410 7056 6307 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_61410 8024 7080 gene locus_tag LOCUS_61420 8024 7080 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_61420 8202 9212 gene locus_tag LOCUS_61430 8202 9212 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_61430 10324 9314 gene locus_tag LOCUS_61440 10324 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 12137 10518 gene locus_tag LOCUS_61450 12137 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 12515 13870 gene locus_tag LOCUS_61460 12515 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 14210 14740 gene locus_tag LOCUS_61470 14210 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 14755 15630 gene locus_tag LOCUS_61480 14755 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 16180 15674 gene locus_tag LOCUS_61490 16180 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 16538 16173 gene locus_tag LOCUS_61500 16538 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 <18990 16696 gene locus_tag LOCUS_61510 <18990 16696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113034874.1:DUF4838 domain-containing protein >Feature sequence248 3679 785 gene locus_tag LOCUS_61520 3679 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 8733 4138 gene locus_tag LOCUS_61530 8733 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 9145 8753 gene locus_tag LOCUS_61540 9145 8753 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_61540 11710 9356 gene locus_tag LOCUS_61550 11710 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 12789 11806 gene locus_tag LOCUS_61560 12789 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 14515 12980 gene locus_tag LOCUS_61570 14515 12980 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272619.1 protein_id gnl|my_center|LOCUS_61570 15344 14526 gene locus_tag LOCUS_61580 15344 14526 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272620.1 protein_id gnl|my_center|LOCUS_61580 16030 15848 gene locus_tag LOCUS_61590 16030 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 16117 16947 gene locus_tag LOCUS_61600 16117 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 16947 17252 gene locus_tag LOCUS_61610 16947 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 17565 17254 gene locus_tag LOCUS_61620 17565 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 >Feature sequence249 5789 3030 gene locus_tag LOCUS_61630 5789 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 6168 6491 gene locus_tag LOCUS_61640 6168 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 6415 6690 gene locus_tag LOCUS_61650 6415 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 10915 6746 gene locus_tag LOCUS_61660 10915 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 12224 11625 gene locus_tag LOCUS_61670 12224 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 14862 12217 gene locus_tag LOCUS_61680 14862 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 16582 15146 gene locus_tag LOCUS_61690 16582 15146 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_61690 >Feature sequence250 839 321 gene locus_tag LOCUS_61700 839 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 4282 1166 gene locus_tag LOCUS_61710 4282 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 4737 4267 gene locus_tag LOCUS_61720 4737 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 5339 4782 gene locus_tag LOCUS_61730 5339 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 5681 5442 gene locus_tag LOCUS_61740 5681 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 6436 5783 gene locus_tag LOCUS_61750 6436 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 11606 7032 gene locus_tag LOCUS_61760 11606 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 12202 11606 gene locus_tag LOCUS_61770 12202 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 12405 12199 gene locus_tag LOCUS_61780 12405 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 15502 12563 gene locus_tag LOCUS_61790 15502 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 17747 15681 gene locus_tag LOCUS_61800 17747 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 18361 17762 gene locus_tag LOCUS_61810 18361 17762 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_61810 >Feature sequence251 371 138 gene locus_tag LOCUS_61820 371 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 816 364 gene locus_tag LOCUS_61830 816 364 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_61830 1160 2791 gene locus_tag LOCUS_61840 1160 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 7299 2842 gene locus_tag LOCUS_61850 7299 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 7602 10010 gene locus_tag LOCUS_61860 7602 10010 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_61860 10108 11544 gene locus_tag LOCUS_61870 10108 11544 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123584.1 protein_id gnl|my_center|LOCUS_61870 14981 11592 gene locus_tag LOCUS_61880 14981 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61880 15418 16596 gene locus_tag LOCUS_61890 15418 16596 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_61890 17124 18578 gene locus_tag LOCUS_61900 17124 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 >Feature sequence252 <1 1682 gene locus_tag LOCUS_61910 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393063.1:GspE/PulE family protein 1704 2927 gene locus_tag LOCUS_61920 1704 2927 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_61920 2953 4077 gene locus_tag LOCUS_61930 2953 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 4074 4700 gene locus_tag LOCUS_61940 4074 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 4697 5287 gene locus_tag LOCUS_61950 4697 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 5423 6001 gene locus_tag LOCUS_61960 5423 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 6223 8109 gene locus_tag LOCUS_61970 6223 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 8113 8364 gene locus_tag LOCUS_61980 8113 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 8448 8615 gene locus_tag LOCUS_61990 8448 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 8637 9551 gene locus_tag LOCUS_62000 8637 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 9564 10904 gene locus_tag LOCUS_62010 9564 10904 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_62010 11174 11782 gene locus_tag LOCUS_62020 11174 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 11859 12854 gene locus_tag LOCUS_62030 11859 12854 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_62030 13029 13691 gene locus_tag LOCUS_62040 13029 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 15275 13878 gene locus_tag LOCUS_62050 15275 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 15737 16060 gene locus_tag LOCUS_62060 15737 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_62060 16083 16973 gene locus_tag LOCUS_62070 gene fhcD 16083 16973 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_62070 16970 18442 gene locus_tag LOCUS_62080 16970 18442 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006102898.1 protein_id gnl|my_center|LOCUS_62080 >Feature sequence253 2460 355 gene locus_tag LOCUS_62090 2460 355 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_62090 2706 5174 gene locus_tag LOCUS_62100 2706 5174 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_62100 6252 5230 gene locus_tag LOCUS_62110 6252 5230 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_62110 6776 6351 gene locus_tag LOCUS_62120 6776 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 7103 7480 gene locus_tag LOCUS_62130 7103 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 8532 7477 gene locus_tag LOCUS_62140 8532 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 8776 9960 gene locus_tag LOCUS_62150 8776 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 10178 10360 gene locus_tag LOCUS_62160 10178 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 15551 10524 gene locus_tag LOCUS_62170 15551 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 15664 15867 gene locus_tag LOCUS_62180 15664 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 15864 17807 gene locus_tag LOCUS_62190 15864 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 >Feature sequence254 528 88 gene locus_tag LOCUS_62200 528 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 988 2766 gene locus_tag LOCUS_62210 gene rhgW 988 2766 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_62210 3254 2880 gene locus_tag LOCUS_62220 3254 2880 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_62220 6130 3386 gene locus_tag LOCUS_62230 6130 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 7258 6131 gene locus_tag LOCUS_62240 7258 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 8568 7291 gene locus_tag LOCUS_62250 8568 7291 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_62250 9636 8713 gene locus_tag LOCUS_62260 9636 8713 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_62260 10339 9653 gene locus_tag LOCUS_62270 10339 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 10555 12456 gene locus_tag LOCUS_62280 10555 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 12812 14494 gene locus_tag LOCUS_62290 12812 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 14512 15141 gene locus_tag LOCUS_62300 14512 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942932.1 protein_id gnl|my_center|LOCUS_62300 16612 15425 gene locus_tag LOCUS_62310 16612 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 18202 16832 gene locus_tag LOCUS_62320 18202 16832 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_62320 >Feature sequence255 313 747 gene locus_tag LOCUS_62330 313 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 2372 777 gene locus_tag LOCUS_62340 2372 777 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118144.1 protein_id gnl|my_center|LOCUS_62340 5194 2402 gene locus_tag LOCUS_62350 5194 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 5603 5202 gene locus_tag LOCUS_62360 5603 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 8863 5606 gene locus_tag LOCUS_62370 8863 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 9578 9072 gene locus_tag LOCUS_62380 9578 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 12229 9905 gene locus_tag LOCUS_62390 12229 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 12860 16381 gene locus_tag LOCUS_62400 12860 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 >Feature sequence256 154 1575 gene locus_tag LOCUS_62410 154 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 1568 2032 gene locus_tag LOCUS_62420 1568 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 2270 5173 gene locus_tag LOCUS_62430 2270 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 6087 7130 gene locus_tag LOCUS_62440 6087 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 7342 7554 gene locus_tag LOCUS_62450 7342 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 7973 7464 gene locus_tag LOCUS_62460 7973 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 8034 8306 gene locus_tag LOCUS_62470 8034 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 8502 9722 gene locus_tag LOCUS_62480 8502 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 11640 10129 gene locus_tag LOCUS_62490 11640 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 12127 13773 gene locus_tag LOCUS_62500 12127 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 14020 13745 gene locus_tag LOCUS_62510 14020 13745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 14251 14057 gene locus_tag LOCUS_62520 14251 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 14420 14746 gene locus_tag LOCUS_62530 14420 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 14815 18315 gene locus_tag LOCUS_62540 14815 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 >Feature sequence257 3939 271 gene locus_tag LOCUS_62550 gene smc 3939 271 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921931.1 protein_id gnl|my_center|LOCUS_62550 6012 4168 gene locus_tag LOCUS_62560 6012 4168 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_62560 9235 6284 gene locus_tag LOCUS_62570 9235 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670336.1 protein_id gnl|my_center|LOCUS_62570 9452 9691 gene locus_tag LOCUS_62580 9452 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812685.1 protein_id gnl|my_center|LOCUS_62580 9873 10136 gene locus_tag LOCUS_62590 gene rpmB 9873 10136 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193812.1 protein_id gnl|my_center|LOCUS_62590 10160 10450 gene locus_tag LOCUS_62600 gene gatC 10160 10450 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_62600 10779 12326 gene locus_tag LOCUS_62610 gene gatA 10779 12326 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119740.1 protein_id gnl|my_center|LOCUS_62610 12323 13801 gene locus_tag LOCUS_62620 gene gatB 12323 13801 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122965.1 protein_id gnl|my_center|LOCUS_62620 13928 14671 gene locus_tag LOCUS_62630 13928 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 >Feature sequence258 677 351 gene locus_tag LOCUS_62640 677 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 1023 1943 gene locus_tag LOCUS_62650 1023 1943 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_62650 2010 2471 gene locus_tag LOCUS_62660 2010 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 3686 2472 gene locus_tag LOCUS_62670 3686 2472 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_62670 4756 3875 gene locus_tag LOCUS_62680 4756 3875 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_62680 5021 6028 gene locus_tag LOCUS_62690 5021 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 6231 6971 gene locus_tag LOCUS_62700 6231 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 7477 7650 gene locus_tag LOCUS_62710 7477 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 7985 9076 gene locus_tag LOCUS_62720 7985 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 9097 10083 gene locus_tag LOCUS_62730 9097 10083 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397776.1 protein_id gnl|my_center|LOCUS_62730 10094 10870 gene locus_tag LOCUS_62740 10094 10870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223729.1 protein_id gnl|my_center|LOCUS_62740 11026 11622 gene locus_tag LOCUS_62750 11026 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 11749 12663 gene locus_tag LOCUS_62760 11749 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 12660 12827 gene locus_tag LOCUS_62770 12660 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 12800 14533 gene locus_tag LOCUS_62780 12800 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 14549 16297 gene locus_tag LOCUS_62790 14549 16297 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_62790 >Feature sequence259 <1 1768 gene locus_tag LOCUS_62800 <1 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921531.1:exosortase U 2071 3576 gene locus_tag LOCUS_62810 2071 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 4916 7330 gene locus_tag LOCUS_62820 4916 7330 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253001.1 protein_id gnl|my_center|LOCUS_62820 7513 8286 gene locus_tag LOCUS_62830 7513 8286 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_62830 8327 9868 gene locus_tag LOCUS_62840 8327 9868 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921975.1 protein_id gnl|my_center|LOCUS_62840 9974 10594 gene locus_tag LOCUS_62850 9974 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 10705 12426 gene locus_tag LOCUS_62860 gene xrtU 10705 12426 CDS product exosortase U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921531.1 protein_id gnl|my_center|LOCUS_62860 12423 13955 gene locus_tag LOCUS_62870 12423 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118854.1 protein_id gnl|my_center|LOCUS_62870 15259 14201 gene locus_tag LOCUS_62880 15259 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 15987 15427 gene locus_tag LOCUS_62890 15987 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 17119 17304 gene locus_tag LOCUS_62900 17119 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 >Feature sequence260 1494 136 gene locus_tag LOCUS_62910 1494 136 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_62910 1766 1587 gene locus_tag LOCUS_62920 1766 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 2692 1796 gene locus_tag LOCUS_62930 2692 1796 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_62930 3146 3556 gene locus_tag LOCUS_62940 3146 3556 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_62940 3933 4892 gene locus_tag LOCUS_62950 3933 4892 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_62950 5705 4893 gene locus_tag LOCUS_62960 5705 4893 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826360.1 protein_id gnl|my_center|LOCUS_62960 6139 9186 gene locus_tag LOCUS_62970 6139 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 10224 9202 gene locus_tag LOCUS_62980 10224 9202 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_62980 11490 10369 gene locus_tag LOCUS_62990 11490 10369 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_62990 11782 12558 gene locus_tag LOCUS_63000 11782 12558 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_63000 12737 14563 gene locus_tag LOCUS_63010 gene mnmG 12737 14563 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_63010 15566 14769 gene locus_tag LOCUS_63020 15566 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 17179 16442 gene locus_tag LOCUS_63030 17179 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 17284 17472 gene locus_tag LOCUS_63040 17284 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 17662 18087 gene locus_tag LOCUS_63050 17662 18087 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986893.1 protein_id gnl|my_center|LOCUS_63050 >Feature sequence261 535 4236 gene locus_tag LOCUS_63060 535 4236 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260976.1 protein_id gnl|my_center|LOCUS_63060 4247 5524 gene locus_tag LOCUS_63070 4247 5524 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_63070 6682 5537 gene locus_tag LOCUS_63080 6682 5537 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_63080 7145 6765 gene locus_tag LOCUS_63090 7145 6765 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_63090 8238 7183 gene locus_tag LOCUS_63100 8238 7183 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_63100 9524 8286 gene locus_tag LOCUS_63110 9524 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_63110 10974 9964 gene locus_tag LOCUS_63120 10974 9964 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922309.1 protein_id gnl|my_center|LOCUS_63120 13694 11322 gene locus_tag LOCUS_63130 13694 11322 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120826.1 protein_id gnl|my_center|LOCUS_63130 13911 14174 gene locus_tag LOCUS_63140 13911 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 14351 14668 gene locus_tag LOCUS_63150 14351 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 15104 14700 gene locus_tag LOCUS_63160 15104 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 15414 15175 gene locus_tag LOCUS_63170 15414 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 15928 15641 gene locus_tag LOCUS_63180 15928 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 16709 16071 gene locus_tag LOCUS_63190 16709 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 17895 16843 gene locus_tag LOCUS_63200 17895 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 >Feature sequence262 5646 2698 gene locus_tag LOCUS_63210 5646 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 7519 5753 gene locus_tag LOCUS_63220 7519 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 9118 7703 gene locus_tag LOCUS_63230 9118 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 9532 9795 gene locus_tag LOCUS_63240 9532 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 9792 9929 gene locus_tag LOCUS_63250 9792 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 >Feature sequence263 <1 902 gene locus_tag LOCUS_63260 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232035.1:3-oxoacyl-[acyl-carrier-protein] reductase 1097 2251 gene locus_tag LOCUS_63270 1097 2251 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877945.1 protein_id gnl|my_center|LOCUS_63270 2255 2713 gene locus_tag LOCUS_63280 2255 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 3646 2873 gene locus_tag LOCUS_63290 3646 2873 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_63290 4397 3753 gene locus_tag LOCUS_63300 4397 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 4793 7624 gene locus_tag LOCUS_63310 4793 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 7634 9544 gene locus_tag LOCUS_63320 7634 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 9732 12482 gene locus_tag LOCUS_63330 9732 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 12461 15250 gene locus_tag LOCUS_63340 12461 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 15255 16088 gene locus_tag LOCUS_63350 15255 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 >Feature sequence264 100 249 gene locus_tag LOCUS_63360 100 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 274 2358 gene locus_tag LOCUS_63370 274 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 2561 3898 gene locus_tag LOCUS_63380 2561 3898 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_63380 3829 4407 gene locus_tag LOCUS_63390 3829 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 6503 4452 gene locus_tag LOCUS_63400 6503 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 6522 6695 gene locus_tag LOCUS_63410 6522 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 7065 7976 gene locus_tag LOCUS_63420 7065 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 8425 9426 gene locus_tag LOCUS_63430 8425 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 10521 9730 gene locus_tag LOCUS_63440 10521 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 10690 10884 gene locus_tag LOCUS_63450 10690 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 11230 10877 gene locus_tag LOCUS_63460 11230 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 11756 11403 gene locus_tag LOCUS_63470 11756 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 12461 12799 gene locus_tag LOCUS_63480 12461 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 13013 13309 gene locus_tag LOCUS_63490 13013 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 13339 14073 gene locus_tag LOCUS_63500 13339 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 14196 13969 gene locus_tag LOCUS_63510 14196 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 14650 14369 gene locus_tag LOCUS_63520 14650 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 15085 15342 gene locus_tag LOCUS_63530 15085 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 15428 15670 gene locus_tag LOCUS_63540 15428 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 15693 15887 gene locus_tag LOCUS_63550 15693 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63550 16091 17074 gene locus_tag LOCUS_63560 16091 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 17138 17470 gene locus_tag LOCUS_63570 17138 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 >Feature sequence265 799 359 gene locus_tag LOCUS_63580 799 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 1222 956 gene locus_tag LOCUS_63590 1222 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 1987 1292 gene locus_tag LOCUS_63600 1987 1292 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188844.1 protein_id gnl|my_center|LOCUS_63600 3600 1984 gene locus_tag LOCUS_63610 3600 1984 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090948.1 protein_id gnl|my_center|LOCUS_63610 3810 4616 gene locus_tag LOCUS_63620 3810 4616 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329162.1 protein_id gnl|my_center|LOCUS_63620 5765 4722 gene locus_tag LOCUS_63630 5765 4722 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_63630 6101 6367 gene locus_tag LOCUS_63640 6101 6367 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_63640 7831 6788 gene locus_tag LOCUS_63650 7831 6788 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_63650 8698 7898 gene locus_tag LOCUS_63660 8698 7898 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209695.1 protein_id gnl|my_center|LOCUS_63660 11238 8923 gene locus_tag LOCUS_63670 11238 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 12778 11399 gene locus_tag LOCUS_63680 12778 11399 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_63680 14565 12922 gene locus_tag LOCUS_63690 14565 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 15355 14858 gene locus_tag LOCUS_63700 15355 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 16113 15481 gene locus_tag LOCUS_63710 16113 15481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 16662 16114 gene locus_tag LOCUS_63720 16662 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 17180 16659 gene locus_tag LOCUS_63730 17180 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 17692 17321 gene locus_tag LOCUS_63740 17692 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 >Feature sequence266 501 1424 gene locus_tag LOCUS_63750 501 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 1505 2575 gene locus_tag LOCUS_63760 gene ribD 1505 2575 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_63760 2808 3467 gene locus_tag LOCUS_63770 2808 3467 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_63770 3564 8642 gene locus_tag LOCUS_63780 3564 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 8721 8951 gene locus_tag LOCUS_63790 8721 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 9222 12350 gene locus_tag LOCUS_63800 9222 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 12588 13013 gene locus_tag LOCUS_63810 12588 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 13435 13746 gene locus_tag LOCUS_63820 13435 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 13786 14139 gene locus_tag LOCUS_63830 13786 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 <17673 14503 gene locus_tag LOCUS_63840 <17673 14503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122155.1:HEAT repeat domain-containing protein >Feature sequence267 1278 478 gene locus_tag LOCUS_63850 1278 478 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 protein_id gnl|my_center|LOCUS_63850 1810 1418 gene locus_tag LOCUS_63860 1810 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 1953 5216 gene locus_tag LOCUS_63870 1953 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 7262 5220 gene locus_tag LOCUS_63880 7262 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 7502 8842 gene locus_tag LOCUS_63890 7502 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63890 8952 9848 gene locus_tag LOCUS_63900 8952 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 10728 10015 gene locus_tag LOCUS_63910 10728 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 11828 10752 gene locus_tag LOCUS_63920 11828 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 12250 16551 gene locus_tag LOCUS_63930 12250 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 >Feature sequence268 724 873 gene locus_tag LOCUS_63940 724 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 4073 906 gene locus_tag LOCUS_63950 4073 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 4336 4953 gene locus_tag LOCUS_63960 4336 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 5045 6334 gene locus_tag LOCUS_63970 5045 6334 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_63970 7042 6497 gene locus_tag LOCUS_63980 7042 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63980 8278 7058 gene locus_tag LOCUS_63990 8278 7058 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 protein_id gnl|my_center|LOCUS_63990 8744 10066 gene locus_tag LOCUS_64000 8744 10066 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_64000 10461 10297 gene locus_tag LOCUS_64010 10461 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 10873 10454 gene locus_tag LOCUS_64020 10873 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64020 14074 10973 gene locus_tag LOCUS_64030 14074 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 16190 15267 gene locus_tag LOCUS_64040 16190 15267 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_64040 16616 17515 gene locus_tag LOCUS_64050 16616 17515 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_64050 >Feature sequence269 247 804 gene locus_tag LOCUS_64060 247 804 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_64060 1536 961 gene locus_tag LOCUS_64070 1536 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 3098 1692 gene locus_tag LOCUS_64080 3098 1692 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_64080 5570 3198 gene locus_tag LOCUS_64090 5570 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 7532 5712 gene locus_tag LOCUS_64100 7532 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 8096 8755 gene locus_tag LOCUS_64110 gene rpoE 8096 8755 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_64110 8745 10988 gene locus_tag LOCUS_64120 8745 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 11259 11957 gene locus_tag LOCUS_64130 11259 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 13008 12025 gene locus_tag LOCUS_64140 13008 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 13285 13061 gene locus_tag LOCUS_64150 13285 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64150 13750 13932 gene locus_tag LOCUS_64160 13750 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 14534 14229 gene locus_tag LOCUS_64170 14534 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 14917 14606 gene locus_tag LOCUS_64180 14917 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 <17452 15364 gene locus_tag LOCUS_64190 <17452 15364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767027.1:glycoside hydrolase family 127 protein >Feature sequence270 23 394 gene locus_tag LOCUS_64200 23 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 611 1759 gene locus_tag LOCUS_64210 611 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 3777 2050 gene locus_tag LOCUS_64220 3777 2050 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927003.1 protein_id gnl|my_center|LOCUS_64220 4315 3848 gene locus_tag LOCUS_64230 4315 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 4543 4340 gene locus_tag LOCUS_64240 4543 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 7230 4810 gene locus_tag LOCUS_64250 7230 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 8454 7684 gene locus_tag LOCUS_64260 8454 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 9365 8451 gene locus_tag LOCUS_64270 9365 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 10459 9467 gene locus_tag LOCUS_64280 10459 9467 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_64280 11953 10640 gene locus_tag LOCUS_64290 11953 10640 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_64290 13580 12270 gene locus_tag LOCUS_64300 13580 12270 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_64300 13742 14587 gene locus_tag LOCUS_64310 13742 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 14649 16010 gene locus_tag LOCUS_64320 14649 16010 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_64320 >Feature sequence271 925 32 gene locus_tag LOCUS_64330 925 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 1917 922 gene locus_tag LOCUS_64340 1917 922 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922072.1 protein_id gnl|my_center|LOCUS_64340 3337 1973 gene locus_tag LOCUS_64350 3337 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 5242 3515 gene locus_tag LOCUS_64360 5242 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 5814 5365 gene locus_tag LOCUS_64370 5814 5365 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329282.1 protein_id gnl|my_center|LOCUS_64370 8100 5902 gene locus_tag LOCUS_64380 8100 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 9250 8102 gene locus_tag LOCUS_64390 9250 8102 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118978.1 protein_id gnl|my_center|LOCUS_64390 9509 9883 gene locus_tag LOCUS_64400 9509 9883 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330460.1 protein_id gnl|my_center|LOCUS_64400 11755 10031 gene locus_tag LOCUS_64410 11755 10031 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_64410 12213 12518 gene locus_tag LOCUS_64420 12213 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 12582 13892 gene locus_tag LOCUS_64430 12582 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 14878 13889 gene locus_tag LOCUS_64440 14878 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 16410 14875 gene locus_tag LOCUS_64450 16410 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120490.1 protein_id gnl|my_center|LOCUS_64450 <17245 16611 gene locus_tag LOCUS_64460 <17245 16611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921874.1:type II secretion system protein GspK >Feature sequence272 6788 6069 gene locus_tag LOCUS_64470 6788 6069 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_64470 7108 8211 gene locus_tag LOCUS_64480 gene mgrA 7108 8211 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_64480 8420 9385 gene locus_tag LOCUS_64490 8420 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 9700 10863 gene locus_tag LOCUS_64500 9700 10863 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121715.1 protein_id gnl|my_center|LOCUS_64500 10968 12272 gene locus_tag LOCUS_64510 10968 12272 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615817.1 protein_id gnl|my_center|LOCUS_64510 12462 13613 gene locus_tag LOCUS_64520 12462 13613 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922121.1 protein_id gnl|my_center|LOCUS_64520 13709 15922 gene locus_tag LOCUS_64530 13709 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 >Feature sequence273 939 463 gene locus_tag LOCUS_64540 939 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 4045 941 gene locus_tag LOCUS_64550 4045 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 4551 6977 gene locus_tag LOCUS_64560 4551 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922069.1 protein_id gnl|my_center|LOCUS_64560 7280 8869 gene locus_tag LOCUS_64570 7280 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 8898 10973 gene locus_tag LOCUS_64580 8898 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 11307 12626 gene locus_tag LOCUS_64590 11307 12626 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_64590 12929 14410 gene locus_tag LOCUS_64600 12929 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 14552 15817 gene locus_tag LOCUS_64610 14552 15817 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445149.1 protein_id gnl|my_center|LOCUS_64610 15882 17024 gene locus_tag LOCUS_64620 15882 17024 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_64620 >Feature sequence274 1915 2307 gene locus_tag LOCUS_64630 1915 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 2870 3868 gene locus_tag LOCUS_64640 2870 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 4700 4497 gene locus_tag LOCUS_64650 4700 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 5755 4658 gene locus_tag LOCUS_64660 5755 4658 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64660 8480 6051 gene locus_tag LOCUS_64670 8480 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 9010 10350 gene locus_tag LOCUS_64680 9010 10350 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_64680 13610 10464 gene locus_tag LOCUS_64690 13610 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64690 14932 13655 gene locus_tag LOCUS_64700 14932 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 15557 17032 gene locus_tag LOCUS_64710 15557 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 >Feature sequence275 <1 1061 gene locus_tag LOCUS_64720 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765775.1:glycosyl hydrolase 1511 3331 gene locus_tag LOCUS_64730 1511 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 3535 5502 gene locus_tag LOCUS_64740 3535 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 5545 7932 gene locus_tag LOCUS_64750 5545 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 9514 8009 gene locus_tag LOCUS_64760 9514 8009 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_64760 12163 9542 gene locus_tag LOCUS_64770 12163 9542 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_64770 12424 12230 gene locus_tag LOCUS_64780 12424 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64780 12674 12946 gene locus_tag LOCUS_64790 12674 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 13495 13770 gene locus_tag LOCUS_64800 13495 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64800 14511 14173 gene locus_tag LOCUS_64810 14511 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 15781 14621 gene locus_tag LOCUS_64820 15781 14621 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017613.1 protein_id gnl|my_center|LOCUS_64820 >Feature sequence276 <1 2568 gene locus_tag LOCUS_64830 <1 2568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001031126.1:glycosyl hydrolase family 98 C-terminal domain-containing protein 2724 2569 gene locus_tag LOCUS_64840 2724 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 4441 2960 gene locus_tag LOCUS_64850 gene xylB 4441 2960 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_64850 5456 4584 gene locus_tag LOCUS_64860 5456 4584 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_64860 5809 7701 gene locus_tag LOCUS_64870 5809 7701 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_64870 7698 10895 gene locus_tag LOCUS_64880 7698 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 10940 12700 gene locus_tag LOCUS_64890 10940 12700 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813188.1 protein_id gnl|my_center|LOCUS_64890 13835 12723 gene locus_tag LOCUS_64900 13835 12723 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 protein_id gnl|my_center|LOCUS_64900 14901 13855 gene locus_tag LOCUS_64910 14901 13855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 15889 15026 gene locus_tag LOCUS_64920 15889 15026 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_64920 16691 15909 gene locus_tag LOCUS_64930 gene fabG 16691 15909 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_64930 >Feature sequence277 36 578 gene locus_tag LOCUS_64940 36 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 952 755 gene locus_tag LOCUS_64950 952 755 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_64950 2103 6641 gene locus_tag LOCUS_64960 2103 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64960 6733 6987 gene locus_tag LOCUS_64970 6733 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 7117 7044 gene locus_tag LOCUS_t00380 7117 7044 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8650 7280 gene locus_tag LOCUS_64980 8650 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64980 8950 9318 gene locus_tag LOCUS_64990 8950 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 9571 11961 gene locus_tag LOCUS_65000 9571 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 12131 12373 gene locus_tag LOCUS_65010 12131 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 12507 15224 gene locus_tag LOCUS_65020 12507 15224 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840071.1 protein_id gnl|my_center|LOCUS_65020 15336 16562 gene locus_tag LOCUS_65030 15336 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 >Feature sequence278 <1 1350 gene locus_tag LOCUS_65040 <1 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764577.1:YncE family protein 2491 1436 gene locus_tag LOCUS_65050 2491 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 2661 5072 gene locus_tag LOCUS_65060 2661 5072 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_65060 8842 5147 gene locus_tag LOCUS_65070 gene metH 8842 5147 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922281.1 protein_id gnl|my_center|LOCUS_65070 9244 10362 gene locus_tag LOCUS_65080 9244 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 10434 11585 gene locus_tag LOCUS_65090 10434 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65090 11593 12417 gene locus_tag LOCUS_65100 11593 12417 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_65100 14290 12716 gene locus_tag LOCUS_65110 14290 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65110 14606 14998 gene locus_tag LOCUS_65120 14606 14998 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_65120 14995 16476 gene locus_tag LOCUS_65130 14995 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 >Feature sequence279 846 421 gene locus_tag LOCUS_65140 846 421 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_65140 1265 1489 gene locus_tag LOCUS_65150 1265 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 5484 1567 gene locus_tag LOCUS_65160 5484 1567 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119558.1 protein_id gnl|my_center|LOCUS_65160 5723 5487 gene locus_tag LOCUS_65170 5723 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 6274 5720 gene locus_tag LOCUS_65180 6274 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 6545 6276 gene locus_tag LOCUS_65190 6545 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 7364 6588 gene locus_tag LOCUS_65200 7364 6588 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_65200 8716 7592 gene locus_tag LOCUS_65210 gene murG 8716 7592 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_65210 8715 8918 gene locus_tag LOCUS_65220 8715 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 9200 9514 gene locus_tag LOCUS_65230 9200 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 9628 9966 gene locus_tag LOCUS_65240 9628 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 10446 11939 gene locus_tag LOCUS_65250 10446 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 12778 12029 gene locus_tag LOCUS_65260 12778 12029 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_65260 12893 13636 gene locus_tag LOCUS_65270 12893 13636 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_65270 13920 14951 gene locus_tag LOCUS_65280 13920 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 >Feature sequence280 110 1747 gene locus_tag LOCUS_65290 110 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 2126 2761 gene locus_tag LOCUS_65300 2126 2761 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328180.1 protein_id gnl|my_center|LOCUS_65300 2876 3835 gene locus_tag LOCUS_65310 2876 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 5228 3900 gene locus_tag LOCUS_65320 5228 3900 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_65320 8146 5240 gene locus_tag LOCUS_65330 8146 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 8619 9545 gene locus_tag LOCUS_65340 8619 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 12656 9657 gene locus_tag LOCUS_65350 12656 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 12993 14336 gene locus_tag LOCUS_65360 12993 14336 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_65360 14351 15133 gene locus_tag LOCUS_65370 14351 15133 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880335.1 protein_id gnl|my_center|LOCUS_65370 15396 15650 gene locus_tag LOCUS_65380 15396 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 15625 16371 gene locus_tag LOCUS_65390 15625 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 16368 16586 gene locus_tag LOCUS_65400 16368 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 >Feature sequence281 127 1002 gene locus_tag LOCUS_65410 127 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 1274 1417 gene locus_tag LOCUS_65420 1274 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 1786 3195 gene locus_tag LOCUS_65430 1786 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 3612 5495 gene locus_tag LOCUS_65440 3612 5495 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_65440 5695 7494 gene locus_tag LOCUS_65450 5695 7494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_65450 7951 7505 gene locus_tag LOCUS_65460 7951 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 8814 9083 gene locus_tag LOCUS_65470 8814 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 9089 10972 gene locus_tag LOCUS_65480 9089 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 10953 11441 gene locus_tag LOCUS_65490 10953 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 11450 14053 gene locus_tag LOCUS_65500 11450 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 15112 14909 gene locus_tag LOCUS_65510 15112 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 15175 16407 gene locus_tag LOCUS_65520 15175 16407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 >Feature sequence282 <1 843 gene locus_tag LOCUS_65530 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921837.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit 1502 996 gene locus_tag LOCUS_65540 1502 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 3230 1809 gene locus_tag LOCUS_65550 3230 1809 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_65550 3822 6218 gene locus_tag LOCUS_65560 3822 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443220.1 protein_id gnl|my_center|LOCUS_65560 6507 7292 gene locus_tag LOCUS_65570 6507 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 7408 9474 gene locus_tag LOCUS_65580 7408 9474 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_65580 9733 10959 gene locus_tag LOCUS_65590 9733 10959 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_65590 12166 11003 gene locus_tag LOCUS_65600 12166 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 12331 13446 gene locus_tag LOCUS_65610 12331 13446 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391454.1 protein_id gnl|my_center|LOCUS_65610 13642 13427 gene locus_tag LOCUS_65620 13642 13427 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327487.1 protein_id gnl|my_center|LOCUS_65620 14065 13649 gene locus_tag LOCUS_65630 14065 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 14499 14071 gene locus_tag LOCUS_65640 14499 14071 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_65640 16008 14596 gene locus_tag LOCUS_65650 16008 14596 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_65650 >Feature sequence283 1282 11 gene locus_tag LOCUS_65660 1282 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 4549 1400 gene locus_tag LOCUS_65670 4549 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65670 5799 6746 gene locus_tag LOCUS_65680 5799 6746 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_65680 8330 6786 gene locus_tag LOCUS_65690 8330 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 9466 8363 gene locus_tag LOCUS_65700 9466 8363 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_65700 10914 9529 gene locus_tag LOCUS_65710 10914 9529 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_65710 13152 10945 gene locus_tag LOCUS_65720 13152 10945 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_65720 14326 13157 gene locus_tag LOCUS_65730 14326 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 14932 14360 gene locus_tag LOCUS_65740 14932 14360 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_65740 15958 15344 gene locus_tag LOCUS_65750 gene modA 15958 15344 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249668.1 protein_id gnl|my_center|LOCUS_65750 >Feature sequence284 1338 253 gene locus_tag LOCUS_65760 1338 253 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_65760 2156 1338 gene locus_tag LOCUS_65770 2156 1338 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_65770 4826 2724 gene locus_tag LOCUS_65780 4826 2724 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_65780 6830 5313 gene locus_tag LOCUS_65790 6830 5313 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615865.1 protein_id gnl|my_center|LOCUS_65790 10672 7109 gene locus_tag LOCUS_65800 10672 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 10831 11037 gene locus_tag LOCUS_65810 10831 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65810 11056 12603 gene locus_tag LOCUS_65820 11056 12603 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967728.1 protein_id gnl|my_center|LOCUS_65820 12849 13550 gene locus_tag LOCUS_65830 12849 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 15051 13648 gene locus_tag LOCUS_65840 15051 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 15385 15194 gene locus_tag LOCUS_65850 15385 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 15813 16241 gene locus_tag LOCUS_65860 gene aroH 15813 16241 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_65860 >Feature sequence285 1669 134 gene locus_tag LOCUS_65870 1669 134 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_65870 1992 1765 gene locus_tag LOCUS_65880 1992 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 5552 2622 gene locus_tag LOCUS_65890 5552 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 6404 6186 gene locus_tag LOCUS_65900 6404 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65900 7901 6462 gene locus_tag LOCUS_65910 7901 6462 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921752.1 protein_id gnl|my_center|LOCUS_65910 8371 8550 gene locus_tag LOCUS_65920 8371 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 8840 9847 gene locus_tag LOCUS_65930 gene corA 8840 9847 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_65930 9880 10749 gene locus_tag LOCUS_65940 9880 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 11452 11003 gene locus_tag LOCUS_65950 11452 11003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_65950 11958 11467 gene locus_tag LOCUS_65960 11958 11467 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_65960 14225 12159 gene locus_tag LOCUS_65970 14225 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 15966 14212 gene locus_tag LOCUS_65980 15966 14212 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_65980 >Feature sequence286 <1 3107 gene locus_tag LOCUS_65990 <1 3107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:c-type cytochrome 3272 3625 gene locus_tag LOCUS_66000 3272 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 6491 3762 gene locus_tag LOCUS_66010 6491 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 7040 6690 gene locus_tag LOCUS_66020 7040 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 7534 7094 gene locus_tag LOCUS_66030 7534 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 8010 7531 gene locus_tag LOCUS_66040 8010 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 8261 7983 gene locus_tag LOCUS_66050 8261 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 8583 9713 gene locus_tag LOCUS_66060 8583 9713 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941150.1 protein_id gnl|my_center|LOCUS_66060 9785 12838 gene locus_tag LOCUS_66070 9785 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 13781 13068 gene locus_tag LOCUS_66080 13781 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 13979 14323 gene locus_tag LOCUS_66090 13979 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 14401 14637 gene locus_tag LOCUS_66100 14401 14637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 14784 14590 gene locus_tag LOCUS_66110 14784 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 15908 14937 gene locus_tag LOCUS_66120 15908 14937 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_66120 >Feature sequence287 405 1541 gene locus_tag LOCUS_66130 gene recA 405 1541 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_66130 1538 3070 gene locus_tag LOCUS_66140 1538 3070 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_66140 3240 6047 gene locus_tag LOCUS_66150 gene alaS 3240 6047 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121911.1 protein_id gnl|my_center|LOCUS_66150 6710 6204 gene locus_tag LOCUS_66160 6710 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 7756 8811 gene locus_tag LOCUS_66170 7756 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 11402 8904 gene locus_tag LOCUS_66180 11402 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 11569 15852 gene locus_tag LOCUS_66190 11569 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 >Feature sequence288 689 1915 gene locus_tag LOCUS_66200 689 1915 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921312.1 protein_id gnl|my_center|LOCUS_66200 3542 2079 gene locus_tag LOCUS_66210 3542 2079 CDS product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339102.1 protein_id gnl|my_center|LOCUS_66210 5118 3898 gene locus_tag LOCUS_66220 5118 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 6372 5125 gene locus_tag LOCUS_66230 6372 5125 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119436.1 protein_id gnl|my_center|LOCUS_66230 6618 7601 gene locus_tag LOCUS_66240 6618 7601 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_66240 7643 8158 gene locus_tag LOCUS_66250 7643 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 8155 9720 gene locus_tag LOCUS_66260 8155 9720 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_66260 10990 10103 gene locus_tag LOCUS_66270 gene dapA 10990 10103 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_66270 11803 11090 gene locus_tag LOCUS_66280 11803 11090 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922652.1 protein_id gnl|my_center|LOCUS_66280 13609 12194 gene locus_tag LOCUS_66290 13609 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 15170 13689 gene locus_tag LOCUS_66300 gene guaB 15170 13689 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_66300 >Feature sequence289 1417 317 gene locus_tag LOCUS_66310 1417 317 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_66310 1713 3797 gene locus_tag LOCUS_66320 gene ftsH 1713 3797 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120515.1 protein_id gnl|my_center|LOCUS_66320 5911 3938 gene locus_tag LOCUS_66330 5911 3938 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_66330 10132 6116 gene locus_tag LOCUS_66340 10132 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 11675 10461 gene locus_tag LOCUS_66350 11675 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 13121 11811 gene locus_tag LOCUS_66360 13121 11811 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_66360 13753 13118 gene locus_tag LOCUS_66370 13753 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66370 14052 14255 gene locus_tag LOCUS_66380 gene rpmI 14052 14255 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332031.1 protein_id gnl|my_center|LOCUS_66380 14372 14728 gene locus_tag LOCUS_66390 gene rplT 14372 14728 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_66390 14910 15935 gene locus_tag LOCUS_66400 gene pheS 14910 15935 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_66400 >Feature sequence290 <1 885 gene locus_tag LOCUS_66410 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764318.1:sialate O-acetylesterase 1109 4075 gene locus_tag LOCUS_66420 1109 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 5183 4104 gene locus_tag LOCUS_66430 5183 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 7298 5271 gene locus_tag LOCUS_66440 7298 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 8689 7307 gene locus_tag LOCUS_66450 8689 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 8830 11595 gene locus_tag LOCUS_66460 8830 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66460 11658 13250 gene locus_tag LOCUS_66470 11658 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66470 13414 15039 gene locus_tag LOCUS_66480 13414 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 15217 15480 gene locus_tag LOCUS_66490 15217 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 >Feature sequence291 379 1806 gene locus_tag LOCUS_66500 379 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 3868 1823 gene locus_tag LOCUS_66510 3868 1823 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_66510 5181 3937 gene locus_tag LOCUS_66520 5181 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 6230 5178 gene locus_tag LOCUS_66530 6230 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66530 7323 6214 gene locus_tag LOCUS_66540 7323 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 10278 7867 gene locus_tag LOCUS_66550 10278 7867 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_66550 13904 10620 gene locus_tag LOCUS_66560 13904 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 14340 15818 gene locus_tag LOCUS_66570 14340 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 >Feature sequence292 261 524 gene locus_tag LOCUS_66580 261 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 1356 613 gene locus_tag LOCUS_66590 1356 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 7945 1505 gene locus_tag LOCUS_66600 7945 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 9917 8382 gene locus_tag LOCUS_66610 gene rfaE1 9917 8382 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_66610 13150 9944 gene locus_tag LOCUS_66620 13150 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66620 13772 13110 gene locus_tag LOCUS_66630 13772 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 >Feature sequence293 609 343 gene locus_tag LOCUS_66640 609 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66640 2479 824 gene locus_tag LOCUS_66650 2479 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 2759 5563 gene locus_tag LOCUS_66660 2759 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 5673 6608 gene locus_tag LOCUS_66670 5673 6608 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_66670 8278 6614 gene locus_tag LOCUS_66680 8278 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 9508 8327 gene locus_tag LOCUS_66690 9508 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66690 11797 9578 gene locus_tag LOCUS_66700 11797 9578 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121148.1 protein_id gnl|my_center|LOCUS_66700 12970 11930 gene locus_tag LOCUS_66710 gene aroF 12970 11930 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_66710 13634 13296 gene locus_tag LOCUS_66720 13634 13296 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258045.1 protein_id gnl|my_center|LOCUS_66720 13895 13969 gene locus_tag LOCUS_t00390 13895 13969 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14182 13997 gene locus_tag LOCUS_66730 14182 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 14292 15101 gene locus_tag LOCUS_66740 14292 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 15210 15425 gene locus_tag LOCUS_66750 15210 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 >Feature sequence294 <1 2451 gene locus_tag LOCUS_66760 <1 2451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922826.1:Hsp70 family protein 3502 2555 gene locus_tag LOCUS_66770 3502 2555 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_66770 4205 3738 gene locus_tag LOCUS_66780 4205 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 4390 5703 gene locus_tag LOCUS_66790 4390 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 5727 6953 gene locus_tag LOCUS_66800 5727 6953 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923038.1 protein_id gnl|my_center|LOCUS_66800 7022 7207 gene locus_tag LOCUS_66810 7022 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 7360 8367 gene locus_tag LOCUS_66820 7360 8367 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_66820 8604 9362 gene locus_tag LOCUS_66830 gene truA 8604 9362 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_66830 9411 10565 gene locus_tag LOCUS_66840 9411 10565 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_66840 10632 11579 gene locus_tag LOCUS_66850 10632 11579 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338658.1 protein_id gnl|my_center|LOCUS_66850 11710 12705 gene locus_tag LOCUS_66860 11710 12705 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_66860 12751 13068 gene locus_tag LOCUS_66870 12751 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 14110 13403 gene locus_tag LOCUS_66880 14110 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 14398 15279 gene locus_tag LOCUS_66890 14398 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 15679 15230 gene locus_tag LOCUS_66900 gene dtd 15679 15230 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_66900 >Feature sequence295 1820 3340 gene locus_tag LOCUS_66910 1820 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 3412 4719 gene locus_tag LOCUS_66920 3412 4719 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_66920 7297 4814 gene locus_tag LOCUS_66930 7297 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 8791 7388 gene locus_tag LOCUS_66940 8791 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 9097 10446 gene locus_tag LOCUS_66950 9097 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 10472 13018 gene locus_tag LOCUS_66960 10472 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 13830 15245 gene locus_tag LOCUS_66970 13830 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 15203 15538 gene locus_tag LOCUS_66980 15203 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 >Feature sequence296 1503 2066 gene locus_tag LOCUS_66990 1503 2066 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 protein_id gnl|my_center|LOCUS_66990 2332 3591 gene locus_tag LOCUS_67000 2332 3591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203404.1 protein_id gnl|my_center|LOCUS_67000 4971 3682 gene locus_tag LOCUS_67010 4971 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 6437 4968 gene locus_tag LOCUS_67020 gene mttB 6437 4968 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_67020 8210 6504 gene locus_tag LOCUS_67030 8210 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 9795 8278 gene locus_tag LOCUS_67040 gene asnB 9795 8278 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_67040 10700 10200 gene locus_tag LOCUS_67050 10700 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 11486 10707 gene locus_tag LOCUS_67060 11486 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67060 12483 11539 gene locus_tag LOCUS_67070 12483 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67070 13999 12674 gene locus_tag LOCUS_67080 13999 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67080 14904 13927 gene locus_tag LOCUS_67090 14904 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 >Feature sequence297 360 518 gene locus_tag LOCUS_67100 360 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 1006 1263 gene locus_tag LOCUS_67110 1006 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 5175 1276 gene locus_tag LOCUS_67120 5175 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 5362 7383 gene locus_tag LOCUS_67130 5362 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 8800 7709 gene locus_tag LOCUS_67140 8800 7709 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_67140 9238 10563 gene locus_tag LOCUS_67150 9238 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 11352 11882 gene locus_tag LOCUS_67160 11352 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 13598 12177 gene locus_tag LOCUS_67170 13598 12177 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_67170 14141 15487 gene locus_tag LOCUS_67180 14141 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 >Feature sequence298 3524 1749 gene locus_tag LOCUS_67190 3524 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 3787 5496 gene locus_tag LOCUS_67200 3787 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 5496 6875 gene locus_tag LOCUS_67210 5496 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 7183 7258 gene locus_tag LOCUS_t00400 7183 7258 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7747 7493 gene locus_tag LOCUS_67220 7747 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67220 7776 8330 gene locus_tag LOCUS_67230 7776 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 8535 9176 gene locus_tag LOCUS_67240 8535 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 12172 9365 gene locus_tag LOCUS_67250 12172 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 12354 12666 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgcaacgacccgaggaaaacgatgttgcctgaaac 13620 13138 gene locus_tag LOCUS_67260 13620 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 15167 13617 gene locus_tag LOCUS_67270 15167 13617 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_67270 >Feature sequence299 2173 1778 gene locus_tag LOCUS_67280 2173 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 3558 2455 gene locus_tag LOCUS_67290 3558 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 4761 3754 gene locus_tag LOCUS_67300 4761 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 4917 5912 gene locus_tag LOCUS_67310 4917 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 6417 5974 gene locus_tag LOCUS_67320 6417 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 7213 6467 gene locus_tag LOCUS_67330 7213 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67330 9055 7559 gene locus_tag LOCUS_67340 9055 7559 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_67340 10721 9183 gene locus_tag LOCUS_67350 10721 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 11170 10952 gene locus_tag LOCUS_67360 11170 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 11571 11167 gene locus_tag LOCUS_67370 11571 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 12008 13363 gene locus_tag LOCUS_67380 12008 13363 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_67380 15205 13622 gene locus_tag LOCUS_67390 15205 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67390 >Feature sequence300 802 134 gene locus_tag LOCUS_67400 802 134 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_67400 1014 1250 gene locus_tag LOCUS_67410 1014 1250 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_67410 1222 1533 gene locus_tag LOCUS_67420 1222 1533 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_67420 1811 2563 gene locus_tag LOCUS_67430 1811 2563 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_67430 2604 3893 gene locus_tag LOCUS_67440 2604 3893 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_67440 4589 4410 gene locus_tag LOCUS_67450 4589 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 4569 5630 gene locus_tag LOCUS_67460 4569 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 5684 6670 gene locus_tag LOCUS_67470 5684 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 8169 6838 gene locus_tag LOCUS_67480 8169 6838 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_67480 9740 8358 gene locus_tag LOCUS_67490 9740 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615918.1 protein_id gnl|my_center|LOCUS_67490 10745 9759 gene locus_tag LOCUS_67500 10745 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 10629 10856 gene locus_tag LOCUS_67510 10629 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 10980 11987 gene locus_tag LOCUS_67520 10980 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 11984 12856 gene locus_tag LOCUS_67530 11984 12856 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_67530 14450 12933 gene locus_tag LOCUS_67540 14450 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 >Feature sequence301 291 2906 gene locus_tag LOCUS_67550 291 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 3058 5391 gene locus_tag LOCUS_67560 3058 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 5449 7629 gene locus_tag LOCUS_67570 5449 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 9381 7756 gene locus_tag LOCUS_67580 9381 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 9859 11082 gene locus_tag LOCUS_67590 9859 11082 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_67590 11258 13771 gene locus_tag LOCUS_67600 11258 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 14133 15050 gene locus_tag LOCUS_67610 14133 15050 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_67610 >Feature sequence302 2413 1037 gene locus_tag LOCUS_67620 2413 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67620 3192 2416 gene locus_tag LOCUS_67630 3192 2416 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_67630 3767 3195 gene locus_tag LOCUS_67640 3767 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 4305 4099 gene locus_tag LOCUS_67650 4305 4099 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969698.1 protein_id gnl|my_center|LOCUS_67650 6785 4518 gene locus_tag LOCUS_67660 6785 4518 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_67660 7937 6798 gene locus_tag LOCUS_67670 7937 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_67670 8551 7949 gene locus_tag LOCUS_67680 8551 7949 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261619.1 protein_id gnl|my_center|LOCUS_67680 9264 8608 gene locus_tag LOCUS_67690 9264 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67690 10463 9537 gene locus_tag LOCUS_67700 10463 9537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_67700 13124 10476 gene locus_tag LOCUS_67710 13124 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 13453 14268 gene locus_tag LOCUS_67720 13453 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 14271 15236 gene locus_tag LOCUS_67730 14271 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_67730 >Feature sequence303 471 1223 gene locus_tag LOCUS_67740 471 1223 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031514.1 protein_id gnl|my_center|LOCUS_67740 1376 1618 gene locus_tag LOCUS_67750 1376 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67750 1932 1717 gene locus_tag LOCUS_67760 1932 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 2091 2774 gene locus_tag LOCUS_67770 2091 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 4591 3350 gene locus_tag LOCUS_67780 4591 3350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_67780 5943 4675 gene locus_tag LOCUS_67790 5943 4675 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_67790 9819 6064 gene locus_tag LOCUS_67800 9819 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 10405 9812 gene locus_tag LOCUS_67810 10405 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 10632 11504 gene locus_tag LOCUS_67820 10632 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 13272 11488 gene locus_tag LOCUS_67830 13272 11488 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_67830 15260 13344 gene locus_tag LOCUS_67840 15260 13344 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921646.1 protein_id gnl|my_center|LOCUS_67840 >Feature sequence304 665 2563 gene locus_tag LOCUS_67850 665 2563 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_67850 2682 4145 gene locus_tag LOCUS_67860 2682 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 6479 4173 gene locus_tag LOCUS_67870 6479 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 6655 8085 gene locus_tag LOCUS_67880 6655 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 8197 9003 gene locus_tag LOCUS_67890 8197 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 9045 11111 gene locus_tag LOCUS_67900 9045 11111 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_67900 11287 11709 gene locus_tag LOCUS_67910 11287 11709 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200957.1 protein_id gnl|my_center|LOCUS_67910 12017 13060 gene locus_tag LOCUS_67920 12017 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67920 14416 13310 gene locus_tag LOCUS_67930 gene mutY 14416 13310 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117840.1 protein_id gnl|my_center|LOCUS_67930 15320 14418 gene locus_tag LOCUS_67940 15320 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 >Feature sequence305 108 872 gene locus_tag LOCUS_67950 108 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950 4167 1375 gene locus_tag LOCUS_67960 4167 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 7115 4374 gene locus_tag LOCUS_67970 7115 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67970 7216 7599 gene locus_tag LOCUS_67980 7216 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 7792 8172 gene locus_tag LOCUS_67990 7792 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67990 8184 8744 gene locus_tag LOCUS_68000 8184 8744 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_68000 9308 8901 gene locus_tag LOCUS_68010 9308 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 12924 9820 gene locus_tag LOCUS_68020 12924 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68020 14165 13074 gene locus_tag LOCUS_68030 14165 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 <15299 14262 gene locus_tag LOCUS_68040 <15299 14262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803818.1:endo-1,4-beta-xylanase >Feature sequence306 3506 2052 gene locus_tag LOCUS_68050 3506 2052 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117762.1 protein_id gnl|my_center|LOCUS_68050 4495 3497 gene locus_tag LOCUS_68060 4495 3497 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117763.1 protein_id gnl|my_center|LOCUS_68060 4723 12933 gene locus_tag LOCUS_68070 4723 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 13042 14373 gene locus_tag LOCUS_68080 13042 14373 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_68080 14504 15145 gene locus_tag LOCUS_68090 14504 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 >Feature sequence307 857 1987 gene locus_tag LOCUS_68100 857 1987 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_68100 2277 2107 gene locus_tag LOCUS_68110 2277 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68110 2791 2438 gene locus_tag LOCUS_68120 2791 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68120 3005 2931 gene locus_tag LOCUS_t00410 3005 2931 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3596 4318 gene locus_tag LOCUS_68130 3596 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68130 4572 5384 gene locus_tag LOCUS_68140 4572 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334335.1 protein_id gnl|my_center|LOCUS_68140 5456 6871 gene locus_tag LOCUS_68150 5456 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 6847 8868 gene locus_tag LOCUS_68160 6847 8868 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667550.1 protein_id gnl|my_center|LOCUS_68160 8885 9784 gene locus_tag LOCUS_68170 8885 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 9824 10468 gene locus_tag LOCUS_68180 9824 10468 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921755.1 protein_id gnl|my_center|LOCUS_68180 10498 11193 gene locus_tag LOCUS_68190 10498 11193 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_68190 11582 11235 gene locus_tag LOCUS_68200 11582 11235 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_68200 11858 11589 gene locus_tag LOCUS_68210 11858 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68210 15186 12022 gene locus_tag LOCUS_68220 15186 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68220 >Feature sequence308 1235 330 gene locus_tag LOCUS_68230 1235 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68230 1575 2342 gene locus_tag LOCUS_68240 1575 2342 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_68240 2336 2875 gene locus_tag LOCUS_68250 2336 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68250 2868 5135 gene locus_tag LOCUS_68260 2868 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 5268 6041 gene locus_tag LOCUS_68270 5268 6041 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_68270 8210 6117 gene locus_tag LOCUS_68280 8210 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 8562 10430 gene locus_tag LOCUS_68290 8562 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 10591 12147 gene locus_tag LOCUS_68300 10591 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 12825 12271 gene locus_tag LOCUS_68310 12825 12271 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476513.1 protein_id gnl|my_center|LOCUS_68310 13068 13727 gene locus_tag LOCUS_68320 13068 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 >Feature sequence309 8301 13841 gene locus_tag LOCUS_68330 8301 13841 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442596.1 protein_id gnl|my_center|LOCUS_68330 14000 14269 gene locus_tag LOCUS_68340 14000 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 14793 14200 gene locus_tag LOCUS_68350 14793 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 >Feature sequence310 1084 2553 gene locus_tag LOCUS_68360 1084 2553 CDS product polysaccharide lyase 6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029032.1 protein_id gnl|my_center|LOCUS_68360 2550 3512 gene locus_tag LOCUS_68370 2550 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68370 6667 3620 gene locus_tag LOCUS_68380 6667 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 6582 6884 gene locus_tag LOCUS_68390 6582 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68390 9781 7262 gene locus_tag LOCUS_68400 9781 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 9910 11679 gene locus_tag LOCUS_68410 9910 11679 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_68410 11682 12647 gene locus_tag LOCUS_68420 11682 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 12672 13661 gene locus_tag LOCUS_68430 12672 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 14769 13978 gene locus_tag LOCUS_68440 14769 13978 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_68440 >Feature sequence311 1439 1233 gene locus_tag LOCUS_68450 1439 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 2886 1450 gene locus_tag LOCUS_68460 2886 1450 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_68460 2939 3172 gene locus_tag LOCUS_68470 2939 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 3489 3169 gene locus_tag LOCUS_68480 3489 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68480 7392 4216 gene locus_tag LOCUS_68490 7392 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 7789 7538 gene locus_tag LOCUS_68500 7789 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 8026 7805 gene locus_tag LOCUS_68510 8026 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706168.1 protein_id gnl|my_center|LOCUS_68510 8284 9858 gene locus_tag LOCUS_68520 8284 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68520 11364 9874 gene locus_tag LOCUS_68530 11364 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 11677 12384 gene locus_tag LOCUS_68540 11677 12384 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_68540 12423 14891 gene locus_tag LOCUS_68550 12423 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68550 >Feature sequence312 1262 813 gene locus_tag LOCUS_68560 1262 813 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_68560 1538 1996 gene locus_tag LOCUS_68570 1538 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68570 2506 2273 gene locus_tag LOCUS_68580 2506 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 3356 2577 gene locus_tag LOCUS_68590 3356 2577 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018237596.1 protein_id gnl|my_center|LOCUS_68590 3696 4667 gene locus_tag LOCUS_68600 3696 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 5852 5166 gene locus_tag LOCUS_68610 5852 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 8136 6301 gene locus_tag LOCUS_68620 gene for 8136 6301 CDS product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 protein_id gnl|my_center|LOCUS_68620 8732 8199 gene locus_tag LOCUS_68630 8732 8199 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_68630 9112 11055 gene locus_tag LOCUS_68640 9112 11055 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_68640 12136 11132 gene locus_tag LOCUS_68650 12136 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68650 12450 13802 gene locus_tag LOCUS_68660 12450 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 >Feature sequence313 <1 587 gene locus_tag LOCUS_68670 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529478.1:FGGY-family carbohydrate kinase 612 1487 gene locus_tag LOCUS_68680 612 1487 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_68680 1764 3161 gene locus_tag LOCUS_68690 1764 3161 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_68690 3511 3158 gene locus_tag LOCUS_68700 3511 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 3836 6223 gene locus_tag LOCUS_68710 3836 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68710 6411 7688 gene locus_tag LOCUS_68720 6411 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 11063 7722 gene locus_tag LOCUS_68730 11063 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68730 11146 11400 gene locus_tag LOCUS_68740 11146 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 11457 13013 gene locus_tag LOCUS_68750 11457 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68750 13041 14069 gene locus_tag LOCUS_68760 13041 14069 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 protein_id gnl|my_center|LOCUS_68760 >Feature sequence314 1647 706 gene locus_tag LOCUS_68770 1647 706 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_68770 2703 5123 gene locus_tag LOCUS_68780 2703 5123 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922246.1 protein_id gnl|my_center|LOCUS_68780 5123 6028 gene locus_tag LOCUS_68790 5123 6028 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_68790 8412 5992 gene locus_tag LOCUS_68800 8412 5992 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_68800 9789 8641 gene locus_tag LOCUS_68810 9789 8641 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_68810 10541 9819 gene locus_tag LOCUS_68820 10541 9819 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_68820 >Feature sequence315 9 3986 gene locus_tag LOCUS_68830 9 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 4186 5760 gene locus_tag LOCUS_68840 4186 5760 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_68840 5893 9144 gene locus_tag LOCUS_68850 5893 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 11280 9190 gene locus_tag LOCUS_68860 11280 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68860 11545 12429 gene locus_tag LOCUS_68870 11545 12429 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329345.1 protein_id gnl|my_center|LOCUS_68870 13533 12436 gene locus_tag LOCUS_68880 13533 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68880 >Feature sequence316 439 1368 gene locus_tag LOCUS_68890 439 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 1621 2118 gene locus_tag LOCUS_68900 1621 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 3294 2563 gene locus_tag LOCUS_68910 3294 2563 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_68910 3520 4455 gene locus_tag LOCUS_68920 3520 4455 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264628.1 protein_id gnl|my_center|LOCUS_68920 4462 5508 gene locus_tag LOCUS_68930 4462 5508 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 protein_id gnl|my_center|LOCUS_68930 5520 6428 gene locus_tag LOCUS_68940 5520 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68940 6455 7270 gene locus_tag LOCUS_68950 6455 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68950 7357 8526 gene locus_tag LOCUS_68960 7357 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 10244 8505 gene locus_tag LOCUS_68970 10244 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 10693 11139 gene locus_tag LOCUS_68980 10693 11139 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_68980 11237 12391 gene locus_tag LOCUS_68990 11237 12391 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615740.1 protein_id gnl|my_center|LOCUS_68990 12973 12776 gene locus_tag LOCUS_69000 12973 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 13133 13870 gene locus_tag LOCUS_69010 13133 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 >Feature sequence317 1621 110 gene locus_tag LOCUS_69020 1621 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 1872 2867 gene locus_tag LOCUS_69030 1872 2867 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_69030 3466 3191 gene locus_tag LOCUS_69040 3466 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 3383 4408 gene locus_tag LOCUS_69050 3383 4408 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_69050 4440 5615 gene locus_tag LOCUS_69060 4440 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 5612 6865 gene locus_tag LOCUS_69070 5612 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 6904 7503 gene locus_tag LOCUS_69080 6904 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69080 7776 9110 gene locus_tag LOCUS_69090 7776 9110 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_69090 9341 10705 gene locus_tag LOCUS_69100 9341 10705 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_69100 10981 12243 gene locus_tag LOCUS_69110 10981 12243 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_69110 12417 13676 gene locus_tag LOCUS_69120 12417 13676 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_69120 13793 14584 gene locus_tag LOCUS_69130 13793 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 >Feature sequence318 3026 159 gene locus_tag LOCUS_69140 3026 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69140 3356 4906 gene locus_tag LOCUS_69150 3356 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 7342 5282 gene locus_tag LOCUS_69160 7342 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 7672 10704 gene locus_tag LOCUS_69170 7672 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 10707 10916 gene locus_tag LOCUS_69180 10707 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 12468 10951 gene locus_tag LOCUS_69190 12468 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69190 12815 13750 gene locus_tag LOCUS_69200 12815 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69200 <14660 13992 gene locus_tag LOCUS_69210 <14660 13992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921397.1:exo-alpha-sialidase >Feature sequence319 283 852 gene locus_tag LOCUS_69220 283 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 2930 1122 gene locus_tag LOCUS_69230 2930 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 4602 2941 gene locus_tag LOCUS_69240 4602 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 5558 4596 gene locus_tag LOCUS_69250 5558 4596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_69250 8050 5582 gene locus_tag LOCUS_69260 8050 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69260 8259 10484 gene locus_tag LOCUS_69270 8259 10484 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_69270 10524 12053 gene locus_tag LOCUS_69280 10524 12053 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_69280 12182 12979 gene locus_tag LOCUS_69290 12182 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69290 >Feature sequence320 3087 388 gene locus_tag LOCUS_69300 3087 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 3751 3194 gene locus_tag LOCUS_69310 3751 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 3989 5791 gene locus_tag LOCUS_69320 3989 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 6569 6267 gene locus_tag LOCUS_69330 6569 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 6999 7325 gene locus_tag LOCUS_69340 6999 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 7210 7473 gene locus_tag LOCUS_69350 7210 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 9936 7579 gene locus_tag LOCUS_69360 9936 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 12428 9990 gene locus_tag LOCUS_69370 12428 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 13229 12843 gene locus_tag LOCUS_69380 13229 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 14002 14571 gene locus_tag LOCUS_69390 14002 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 >Feature sequence321 <1 1824 gene locus_tag LOCUS_69400 <1 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922671.1:error-prone DNA polymerase 2235 1927 gene locus_tag LOCUS_69410 2235 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 3700 2516 gene locus_tag LOCUS_69420 3700 2516 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121665.1 protein_id gnl|my_center|LOCUS_69420 4239 4051 gene locus_tag LOCUS_69430 4239 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69430 4933 6135 gene locus_tag LOCUS_69440 4933 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 8118 6154 gene locus_tag LOCUS_69450 8118 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 8484 10151 gene locus_tag LOCUS_69460 8484 10151 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_69460 10555 12729 gene locus_tag LOCUS_69470 10555 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 13045 13674 gene locus_tag LOCUS_69480 gene rrtA 13045 13674 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122419.1 protein_id gnl|my_center|LOCUS_69480 >Feature sequence322 241 1623 gene locus_tag LOCUS_69490 241 1623 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817128.1 protein_id gnl|my_center|LOCUS_69490 1636 2919 gene locus_tag LOCUS_69500 1636 2919 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393790.1 protein_id gnl|my_center|LOCUS_69500 2945 5632 gene locus_tag LOCUS_69510 2945 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69510 5686 6597 gene locus_tag LOCUS_69520 5686 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 7735 6671 gene locus_tag LOCUS_69530 7735 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 9201 7741 gene locus_tag LOCUS_69540 9201 7741 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537771.1 protein_id gnl|my_center|LOCUS_69540 10605 9202 gene locus_tag LOCUS_69550 gene araA 10605 9202 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727846.1 protein_id gnl|my_center|LOCUS_69550 11539 10724 gene locus_tag LOCUS_69560 11539 10724 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_69560 11780 13633 gene locus_tag LOCUS_69570 11780 13633 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_69570 >Feature sequence323 783 565 gene locus_tag LOCUS_69580 783 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 1387 4359 gene locus_tag LOCUS_69590 1387 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 4900 4412 gene locus_tag LOCUS_69600 4900 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69600 7031 5358 gene locus_tag LOCUS_69610 7031 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69610 8292 7279 gene locus_tag LOCUS_69620 8292 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 10432 8387 gene locus_tag LOCUS_69630 10432 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 10638 11780 gene locus_tag LOCUS_69640 10638 11780 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_69640 11974 12297 gene locus_tag LOCUS_69650 11974 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69650 12507 13481 gene locus_tag LOCUS_69660 12507 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 13665 13910 gene locus_tag LOCUS_69670 13665 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 13904 14065 gene locus_tag LOCUS_69680 13904 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 14505 14433 gene locus_tag LOCUS_t00420 14505 14433 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence324 1198 2589 gene locus_tag LOCUS_69690 1198 2589 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616161.1 protein_id gnl|my_center|LOCUS_69690 2666 2983 gene locus_tag LOCUS_69700 2666 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 2967 3404 gene locus_tag LOCUS_69710 2967 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69710 3428 4843 gene locus_tag LOCUS_69720 3428 4843 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_69720 5032 5901 gene locus_tag LOCUS_69730 5032 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69730 5960 6244 gene locus_tag LOCUS_69740 5960 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 6498 6142 gene locus_tag LOCUS_69750 6498 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69750 6546 7553 gene locus_tag LOCUS_69760 6546 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 8290 7625 gene locus_tag LOCUS_69770 8290 7625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_69770 9440 8295 gene locus_tag LOCUS_69780 9440 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 9766 9446 gene locus_tag LOCUS_69790 9766 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 10905 9952 gene locus_tag LOCUS_69800 10905 9952 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_69800 12102 11101 gene locus_tag LOCUS_69810 12102 11101 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_69810 12567 14099 gene locus_tag LOCUS_69820 12567 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 14123 14335 gene locus_tag LOCUS_69830 14123 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 >Feature sequence325 1441 641 gene locus_tag LOCUS_69840 1441 641 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839199.1 protein_id gnl|my_center|LOCUS_69840 1606 3087 gene locus_tag LOCUS_69850 1606 3087 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_69850 3697 3098 gene locus_tag LOCUS_69860 3697 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 4111 3881 gene locus_tag LOCUS_69870 4111 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 6840 4780 gene locus_tag LOCUS_69880 6840 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 9136 6980 gene locus_tag LOCUS_69890 9136 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 9567 10583 gene locus_tag LOCUS_69900 9567 10583 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_69900 10682 11035 gene locus_tag LOCUS_69910 10682 11035 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_69910 11089 11859 gene locus_tag LOCUS_69920 gene kduD 11089 11859 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_69920 >Feature sequence326 466 257 gene locus_tag LOCUS_69930 466 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 720 529 gene locus_tag LOCUS_69940 720 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69940 1227 1027 gene locus_tag LOCUS_69950 1227 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69950 1395 1718 gene locus_tag LOCUS_69960 1395 1718 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145175446.1 protein_id gnl|my_center|LOCUS_69960 1715 1933 gene locus_tag LOCUS_69970 1715 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69970 2168 2095 gene locus_tag LOCUS_t00430 2168 2095 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3158 2367 gene locus_tag LOCUS_69980 3158 2367 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530305.1 protein_id gnl|my_center|LOCUS_69980 4861 3272 gene locus_tag LOCUS_69990 4861 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 6204 4891 gene locus_tag LOCUS_70000 gene hemL 6204 4891 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_70000 6590 7591 gene locus_tag LOCUS_70010 6590 7591 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_70010 8390 7953 gene locus_tag LOCUS_70020 8390 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70020 9104 8457 gene locus_tag LOCUS_70030 9104 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70030 9847 9116 gene locus_tag LOCUS_70040 9847 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70040 10225 9860 gene locus_tag LOCUS_70050 10225 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70050 10486 10229 gene locus_tag LOCUS_70060 10486 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70060 11247 10951 gene locus_tag LOCUS_70070 11247 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70070 12911 11838 gene locus_tag LOCUS_70080 12911 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70080 13232 14305 gene locus_tag LOCUS_70090 13232 14305 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_70090 >Feature sequence327 386 628 gene locus_tag LOCUS_70100 386 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 857 783 gene locus_tag LOCUS_t00440 857 783 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2782 1001 gene locus_tag LOCUS_70110 2782 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664385.1 protein_id gnl|my_center|LOCUS_70110 3658 2825 gene locus_tag LOCUS_70120 gene kdsA 3658 2825 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_70120 4708 3773 gene locus_tag LOCUS_70130 4708 3773 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324520.1 protein_id gnl|my_center|LOCUS_70130 6753 5191 gene locus_tag LOCUS_70140 6753 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70140 7049 7906 gene locus_tag LOCUS_70150 7049 7906 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_70150 8020 8646 gene locus_tag LOCUS_70160 gene rdgB 8020 8646 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_70160 8685 8760 gene locus_tag LOCUS_t00450 8685 8760 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11971 8936 gene locus_tag LOCUS_70170 11971 8936 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_70170 13628 12150 gene locus_tag LOCUS_70180 13628 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 <14380 13628 gene locus_tag LOCUS_70190 <14380 13628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103419.1:restriction endonuclease subunit S >Feature sequence328 <1 972 gene locus_tag LOCUS_70200 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225414074.1:aldo/keto reductase 972 1475 gene locus_tag LOCUS_70210 972 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 3004 1514 gene locus_tag LOCUS_70220 3004 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 4848 3223 gene locus_tag LOCUS_70230 4848 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 6003 4909 gene locus_tag LOCUS_70240 6003 4909 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_70240 6598 8160 gene locus_tag LOCUS_70250 6598 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 8253 8750 gene locus_tag LOCUS_70260 8253 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70260 8827 9789 gene locus_tag LOCUS_70270 gene pqqB 8827 9789 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038060.1 protein_id gnl|my_center|LOCUS_70270 9806 11509 gene locus_tag LOCUS_70280 9806 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70280 12158 12976 gene locus_tag LOCUS_70290 12158 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494134.1 protein_id gnl|my_center|LOCUS_70290 12987 13301 gene locus_tag LOCUS_70300 12987 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 >Feature sequence329 255 1340 gene locus_tag LOCUS_70310 gene rfbB 255 1340 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 protein_id gnl|my_center|LOCUS_70310 1414 2364 gene locus_tag LOCUS_70320 gene rfbA 1414 2364 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 protein_id gnl|my_center|LOCUS_70320 2361 2537 gene locus_tag LOCUS_70330 2361 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70330 2586 4661 gene locus_tag LOCUS_70340 2586 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 4702 5580 gene locus_tag LOCUS_70350 gene rfbF 4702 5580 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_70350 5631 6782 gene locus_tag LOCUS_70360 gene rfbG 5631 6782 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_70360 6883 8220 gene locus_tag LOCUS_70370 gene rfbH 6883 8220 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_70370 8198 10003 gene locus_tag LOCUS_70380 8198 10003 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551340.1 protein_id gnl|my_center|LOCUS_70380 10000 10950 gene locus_tag LOCUS_70390 10000 10950 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_70390 11092 12945 gene locus_tag LOCUS_70400 11092 12945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 protein_id gnl|my_center|LOCUS_70400 12996 13841 gene locus_tag LOCUS_70410 12996 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 >Feature sequence330 2324 1893 gene locus_tag LOCUS_70420 2324 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 2703 2326 gene locus_tag LOCUS_70430 2703 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 5947 2828 gene locus_tag LOCUS_70440 5947 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 6617 5958 gene locus_tag LOCUS_70450 6617 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70450 9637 6815 gene locus_tag LOCUS_70460 9637 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70460 9880 11532 gene locus_tag LOCUS_70470 9880 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 13524 11587 gene locus_tag LOCUS_70480 13524 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70480 >Feature sequence331 3937 653 gene locus_tag LOCUS_70490 3937 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 4178 5503 gene locus_tag LOCUS_70500 4178 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 5504 7732 gene locus_tag LOCUS_70510 5504 7732 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_70510 7813 8193 gene locus_tag LOCUS_70520 7813 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70520 9418 11226 gene locus_tag LOCUS_70530 9418 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 11656 11366 gene locus_tag LOCUS_70540 11656 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 11953 13395 gene locus_tag LOCUS_70550 11953 13395 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_70550 >Feature sequence332 1374 3161 gene locus_tag LOCUS_70560 1374 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 4935 3259 gene locus_tag LOCUS_70570 4935 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70570 5191 6978 gene locus_tag LOCUS_70580 5191 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 8335 7034 gene locus_tag LOCUS_70590 8335 7034 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_70590 9361 8558 gene locus_tag LOCUS_70600 9361 8558 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_70600 10496 9510 gene locus_tag LOCUS_70610 10496 9510 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392313.1 protein_id gnl|my_center|LOCUS_70610 11706 10507 gene locus_tag LOCUS_70620 gene flhF 11706 10507 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_70620 13847 11742 gene locus_tag LOCUS_70630 gene flhA 13847 11742 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_70630 >Feature sequence333 171 1628 gene locus_tag LOCUS_70640 171 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70640 1819 3024 gene locus_tag LOCUS_70650 1819 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70650 7080 3184 gene locus_tag LOCUS_70660 7080 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70660 8942 7458 gene locus_tag LOCUS_70670 8942 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 9316 10875 gene locus_tag LOCUS_70680 9316 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 11608 10973 gene locus_tag LOCUS_70690 11608 10973 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_70690 12696 11731 gene locus_tag LOCUS_70700 12696 11731 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_70700 13926 12766 gene locus_tag LOCUS_70710 13926 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70710 >Feature sequence334 528 91 gene locus_tag LOCUS_70720 528 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 7199 1140 gene locus_tag LOCUS_70730 7199 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 7953 7321 gene locus_tag LOCUS_70740 7953 7321 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_70740 9585 8353 gene locus_tag LOCUS_70750 9585 8353 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_70750 9584 10720 gene locus_tag LOCUS_70760 gene xerD 9584 10720 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_70760 11421 10942 gene locus_tag LOCUS_70770 11421 10942 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 protein_id gnl|my_center|LOCUS_70770 11884 12138 gene locus_tag LOCUS_70780 11884 12138 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719616.1 protein_id gnl|my_center|LOCUS_70780 12328 13728 gene locus_tag LOCUS_70790 12328 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70790 >Feature sequence335 667 1446 gene locus_tag LOCUS_70800 667 1446 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_70800 1596 4052 gene locus_tag LOCUS_70810 1596 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 4062 4343 gene locus_tag LOCUS_70820 4062 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 4457 6586 gene locus_tag LOCUS_70830 4457 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 6599 7339 gene locus_tag LOCUS_70840 6599 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 7738 8733 gene locus_tag LOCUS_70850 7738 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70850 8824 10263 gene locus_tag LOCUS_70860 8824 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 10267 12621 gene locus_tag LOCUS_70870 10267 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70870 12654 12839 gene locus_tag LOCUS_70880 12654 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 >Feature sequence336 2595 70 gene locus_tag LOCUS_70890 2595 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 4875 2749 gene locus_tag LOCUS_70900 4875 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70900 5267 4875 gene locus_tag LOCUS_70910 5267 4875 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_70910 7744 5924 gene locus_tag LOCUS_70920 7744 5924 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 protein_id gnl|my_center|LOCUS_70920 11636 7854 gene locus_tag LOCUS_70930 11636 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 13175 11877 gene locus_tag LOCUS_70940 13175 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70940 <14045 13257 gene locus_tag LOCUS_70950 <14045 13257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123039.1:exo-alpha-sialidase >Feature sequence337 1782 328 gene locus_tag LOCUS_70960 gene gcvPB 1782 328 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 protein_id gnl|my_center|LOCUS_70960 3172 1784 gene locus_tag LOCUS_70970 gene gcvPA 3172 1784 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331407.1 protein_id gnl|my_center|LOCUS_70970 3629 3183 gene locus_tag LOCUS_70980 gene gcvH 3629 3183 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121467.1 protein_id gnl|my_center|LOCUS_70980 4494 3814 gene locus_tag LOCUS_70990 4494 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 6549 4690 gene locus_tag LOCUS_71000 6549 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 6943 6731 gene locus_tag LOCUS_71010 6943 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71010 7977 6940 gene locus_tag LOCUS_71020 gene rtcA 7977 6940 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922229.1 protein_id gnl|my_center|LOCUS_71020 8216 8650 gene locus_tag LOCUS_71030 8216 8650 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_71030 8663 10009 gene locus_tag LOCUS_71040 gene hisS 8663 10009 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_71040 11044 10118 gene locus_tag LOCUS_71050 11044 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71050 12415 11105 gene locus_tag LOCUS_71060 12415 11105 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_71060 13929 12508 gene locus_tag LOCUS_71070 13929 12508 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_71070 >Feature sequence338 2 547 gene locus_tag LOCUS_71080 2 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 673 1761 gene locus_tag LOCUS_71090 673 1761 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_71090 1801 2604 gene locus_tag LOCUS_71100 1801 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71100 2613 3890 gene locus_tag LOCUS_71110 2613 3890 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_71110 3973 5253 gene locus_tag LOCUS_71120 3973 5253 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_71120 5323 5733 gene locus_tag LOCUS_71130 gene rsfS 5323 5733 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615413.1 protein_id gnl|my_center|LOCUS_71130 5946 5767 gene locus_tag LOCUS_71140 5946 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 6049 7971 gene locus_tag LOCUS_71150 gene argS 6049 7971 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120594.1 protein_id gnl|my_center|LOCUS_71150 8091 8741 gene locus_tag LOCUS_71160 8091 8741 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615786.1 protein_id gnl|my_center|LOCUS_71160 8876 12088 gene locus_tag LOCUS_71170 8876 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71170 12125 12400 gene locus_tag LOCUS_71180 12125 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 13662 12619 gene locus_tag LOCUS_71190 13662 12619 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_71190 >Feature sequence339 1695 355 gene locus_tag LOCUS_71200 1695 355 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_71200 3962 1692 gene locus_tag LOCUS_71210 3962 1692 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_71210 4499 5251 gene locus_tag LOCUS_71220 4499 5251 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_71220 5268 6086 gene locus_tag LOCUS_71230 5268 6086 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333052.1 protein_id gnl|my_center|LOCUS_71230 7569 6229 gene locus_tag LOCUS_71240 7569 6229 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_71240 7656 7835 gene locus_tag LOCUS_71250 7656 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 8203 8000 gene locus_tag LOCUS_71260 8203 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 9599 8196 gene locus_tag LOCUS_71270 9599 8196 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_71270 9825 10829 gene locus_tag LOCUS_71280 9825 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71280 11012 13150 gene locus_tag LOCUS_71290 11012 13150 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_71290 >Feature sequence340 319 2253 gene locus_tag LOCUS_71300 gene dnaK 319 2253 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_71300 2290 3105 gene locus_tag LOCUS_71310 2290 3105 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_71310 6934 3767 gene locus_tag LOCUS_71320 6934 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71320 7351 10866 gene locus_tag LOCUS_71330 7351 10866 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 protein_id gnl|my_center|LOCUS_71330 11042 11338 gene locus_tag LOCUS_71340 11042 11338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 11402 12739 gene locus_tag LOCUS_71350 11402 12739 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 protein_id gnl|my_center|LOCUS_71350 12743 13132 gene locus_tag LOCUS_71360 12743 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 >Feature sequence341 <1 4161 gene locus_tag LOCUS_71370 <1 4161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014640143.1:autotransporter outer membrane protein 5656 4280 gene locus_tag LOCUS_71380 5656 4280 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_71380 5898 6131 gene locus_tag LOCUS_71390 5898 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71390 7552 6344 gene locus_tag LOCUS_71400 7552 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 8016 7603 gene locus_tag LOCUS_71410 8016 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 8128 9039 gene locus_tag LOCUS_71420 gene nadC 8128 9039 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921990.1 protein_id gnl|my_center|LOCUS_71420 9043 10311 gene locus_tag LOCUS_71430 9043 10311 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_71430 10316 11047 gene locus_tag LOCUS_71440 10316 11047 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_71440 11314 11649 gene locus_tag LOCUS_71450 11314 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813830.1 protein_id gnl|my_center|LOCUS_71450 11659 12360 gene locus_tag LOCUS_71460 gene bioD 11659 12360 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921893.1 protein_id gnl|my_center|LOCUS_71460 >Feature sequence342 40 636 gene locus_tag LOCUS_71470 40 636 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_71470 645 5294 gene locus_tag LOCUS_71480 645 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 5307 5510 gene locus_tag LOCUS_71490 5307 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71490 5707 7956 gene locus_tag LOCUS_71500 5707 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 7953 8450 gene locus_tag LOCUS_71510 7953 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71510 9170 8502 gene locus_tag LOCUS_71520 9170 8502 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_71520 9497 11164 gene locus_tag LOCUS_71530 9497 11164 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_71530 11335 12963 gene locus_tag LOCUS_71540 11335 12963 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729326.1 protein_id gnl|my_center|LOCUS_71540 12986 13321 gene locus_tag LOCUS_71550 12986 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71550 >Feature sequence343 83 3004 gene locus_tag LOCUS_71560 83 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71560 3192 3959 gene locus_tag LOCUS_71570 3192 3959 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337436.1 protein_id gnl|my_center|LOCUS_71570 4647 4051 gene locus_tag LOCUS_71580 4647 4051 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_71580 6320 4839 gene locus_tag LOCUS_71590 6320 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_71590 6402 6596 gene locus_tag LOCUS_71600 6402 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 8165 6738 gene locus_tag LOCUS_71610 8165 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_71610 10044 8320 gene locus_tag LOCUS_71620 10044 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 10326 13634 gene locus_tag LOCUS_71630 10326 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71630 >Feature sequence344 <1 1996 gene locus_tag LOCUS_71640 <1 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120362.1:PQQ-binding-like beta-propeller repeat protein 3926 2202 gene locus_tag LOCUS_71650 3926 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71650 4547 4858 gene locus_tag LOCUS_71660 4547 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 4958 6289 gene locus_tag LOCUS_71670 4958 6289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815858.1 protein_id gnl|my_center|LOCUS_71670 7027 6368 gene locus_tag LOCUS_71680 7027 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 7516 7052 gene locus_tag LOCUS_71690 7516 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 7823 11002 gene locus_tag LOCUS_71700 7823 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71700 11052 12050 gene locus_tag LOCUS_71710 11052 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71710 12231 13628 gene locus_tag LOCUS_71720 12231 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 >Feature sequence345 788 2281 gene locus_tag LOCUS_71730 788 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 protein_id gnl|my_center|LOCUS_71730 2644 2309 gene locus_tag LOCUS_71740 2644 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71740 2625 3956 gene locus_tag LOCUS_71750 2625 3956 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 protein_id gnl|my_center|LOCUS_71750 4910 4062 gene locus_tag LOCUS_71760 4910 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329547.1 protein_id gnl|my_center|LOCUS_71760 5148 6371 gene locus_tag LOCUS_71770 gene ribA 5148 6371 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123761.1 protein_id gnl|my_center|LOCUS_71770 8807 6474 gene locus_tag LOCUS_71780 8807 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 10569 8866 gene locus_tag LOCUS_71790 10569 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71790 12863 10575 gene locus_tag LOCUS_71800 gene pilM 12863 10575 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_71800 >Feature sequence346 1822 1010 gene locus_tag LOCUS_71810 1822 1010 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_71810 3848 2061 gene locus_tag LOCUS_71820 3848 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71820 4308 3973 gene locus_tag LOCUS_71830 4308 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 5487 4453 gene locus_tag LOCUS_71840 5487 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 6648 5500 gene locus_tag LOCUS_71850 6648 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71850 7355 8143 gene locus_tag LOCUS_71860 gene tpiA 7355 8143 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_71860 8161 8643 gene locus_tag LOCUS_71870 8161 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71870 8843 9727 gene locus_tag LOCUS_71880 8843 9727 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615387.1 protein_id gnl|my_center|LOCUS_71880 9730 10311 gene locus_tag LOCUS_71890 gene gmk 9730 10311 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326728.1 protein_id gnl|my_center|LOCUS_71890 10317 10580 gene locus_tag LOCUS_71900 10317 10580 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326729.1 protein_id gnl|my_center|LOCUS_71900 10577 11122 gene locus_tag LOCUS_71910 10577 11122 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121238.1 protein_id gnl|my_center|LOCUS_71910 11122 11793 gene locus_tag LOCUS_71920 11122 11793 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_71920 11897 12928 gene locus_tag LOCUS_71930 11897 12928 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_71930 13346 12951 gene locus_tag LOCUS_71940 13346 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71940 >Feature sequence347 237 1271 gene locus_tag LOCUS_71950 237 1271 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 protein_id gnl|my_center|LOCUS_71950 1619 1344 gene locus_tag LOCUS_71960 1619 1344 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_71960 1940 4699 gene locus_tag LOCUS_71970 1940 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921435.1 protein_id gnl|my_center|LOCUS_71970 4892 5497 gene locus_tag LOCUS_71980 4892 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71980 6717 5542 gene locus_tag LOCUS_71990 6717 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 7651 6740 gene locus_tag LOCUS_72000 gene ubiA 7651 6740 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_72000 8648 7953 gene locus_tag LOCUS_72010 8648 7953 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_72010 9319 8645 gene locus_tag LOCUS_72020 gene ubiE 9319 8645 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_72020 9798 10904 gene locus_tag LOCUS_72030 9798 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72030 11595 10873 gene locus_tag LOCUS_72040 11595 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 <13452 11777 gene locus_tag LOCUS_72050 <13452 11777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332180.1:SpoIIE family protein phosphatase >Feature sequence348 1167 2285 gene locus_tag LOCUS_72060 1167 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72060 2939 2310 gene locus_tag LOCUS_72070 2939 2310 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922484.1 protein_id gnl|my_center|LOCUS_72070 3983 2991 gene locus_tag LOCUS_72080 3983 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 4156 5919 gene locus_tag LOCUS_72090 4156 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72090 6078 6878 gene locus_tag LOCUS_72100 6078 6878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_72100 8195 6900 gene locus_tag LOCUS_72110 8195 6900 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_72110 8936 8493 gene locus_tag LOCUS_72120 8936 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72120 >Feature sequence349 480 133 gene locus_tag LOCUS_72130 480 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72130 1504 623 gene locus_tag LOCUS_72140 1504 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 10766 1821 gene locus_tag LOCUS_72150 10766 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72150 12522 11245 gene locus_tag LOCUS_72160 12522 11245 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921346.1 protein_id gnl|my_center|LOCUS_72160 >Feature sequence350 1 363 gene locus_tag LOCUS_72170 1 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72170 2072 582 gene locus_tag LOCUS_72180 2072 582 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_72180 2229 3791 gene locus_tag LOCUS_72190 2229 3791 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_72190 4223 6073 gene locus_tag LOCUS_72200 4223 6073 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922256.1 protein_id gnl|my_center|LOCUS_72200 6089 7681 gene locus_tag LOCUS_72210 6089 7681 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922193.1 protein_id gnl|my_center|LOCUS_72210 8205 9326 gene locus_tag LOCUS_72220 8205 9326 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122798.1 protein_id gnl|my_center|LOCUS_72220 9333 11861 gene locus_tag LOCUS_72230 9333 11861 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922339.1 protein_id gnl|my_center|LOCUS_72230 13111 11852 gene locus_tag LOCUS_72240 13111 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72240 >Feature sequence351 3326 426 gene locus_tag LOCUS_72250 3326 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72250 5217 3349 gene locus_tag LOCUS_72260 5217 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72260 5984 5214 gene locus_tag LOCUS_72270 5984 5214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_72270 8262 6043 gene locus_tag LOCUS_72280 8262 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72280 8540 8382 gene locus_tag LOCUS_72290 8540 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72290 8951 10945 gene locus_tag LOCUS_72300 8951 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72300 10983 11150 gene locus_tag LOCUS_72310 10983 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 12066 11563 gene locus_tag LOCUS_72320 12066 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72320 12423 12608 gene locus_tag LOCUS_72330 12423 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72330 13246 12551 gene locus_tag LOCUS_72340 13246 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72340 >Feature sequence352 1 1218 gene locus_tag LOCUS_72350 1 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 1606 2928 gene locus_tag LOCUS_72360 1606 2928 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_72360 4418 3228 gene locus_tag LOCUS_72370 gene nagA 4418 3228 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_72370 4631 5560 gene locus_tag LOCUS_72380 4631 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72380 5574 6533 gene locus_tag LOCUS_72390 5574 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 6751 8424 gene locus_tag LOCUS_72400 6751 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72400 8649 9527 gene locus_tag LOCUS_72410 8649 9527 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_72410 12044 9549 gene locus_tag LOCUS_72420 12044 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72420 13113 12076 gene locus_tag LOCUS_72430 13113 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72430 >Feature sequence353 85 981 gene locus_tag LOCUS_72440 gene folD 85 981 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_72440 1213 1770 gene locus_tag LOCUS_72450 1213 1770 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_72450 1767 2639 gene locus_tag LOCUS_72460 1767 2639 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_72460 2654 7183 gene locus_tag LOCUS_72470 2654 7183 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_72470 7180 7731 gene locus_tag LOCUS_72480 7180 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 7875 8555 gene locus_tag LOCUS_72490 7875 8555 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_72490 8560 9441 gene locus_tag LOCUS_72500 8560 9441 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_72500 9627 10109 gene locus_tag LOCUS_72510 9627 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72510 >Feature sequence354 821 27 gene locus_tag LOCUS_72520 821 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 1936 821 gene locus_tag LOCUS_72530 1936 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72530 2629 2129 gene locus_tag LOCUS_72540 2629 2129 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123255.1 protein_id gnl|my_center|LOCUS_72540 3274 2723 gene locus_tag LOCUS_72550 3274 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72550 3666 3334 gene locus_tag LOCUS_72560 3666 3334 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940565.1 protein_id gnl|my_center|LOCUS_72560 4116 4724 gene locus_tag LOCUS_72570 4116 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72570 4711 5115 gene locus_tag LOCUS_72580 4711 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72580 5167 5367 gene locus_tag LOCUS_72590 5167 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72590 5364 5609 gene locus_tag LOCUS_72600 5364 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72600 6534 6352 gene locus_tag LOCUS_72610 6534 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72610 7398 6718 gene locus_tag LOCUS_72620 7398 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 7766 8122 gene locus_tag LOCUS_72630 7766 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72630 8741 8169 gene locus_tag LOCUS_72640 8741 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72640 8655 8834 gene locus_tag LOCUS_72650 8655 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 10517 8934 gene locus_tag LOCUS_72660 10517 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72660 11037 10618 gene locus_tag LOCUS_72670 11037 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 11794 11024 gene locus_tag LOCUS_72680 11794 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 12016 12402 gene locus_tag LOCUS_72690 12016 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 12983 12744 gene locus_tag LOCUS_72700 12983 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 >Feature sequence355 702 1685 gene locus_tag LOCUS_72710 gene galE 702 1685 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_72710 2347 1682 gene locus_tag LOCUS_72720 2347 1682 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530054.1 protein_id gnl|my_center|LOCUS_72720 2731 3006 gene locus_tag LOCUS_72730 2731 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 4025 3108 gene locus_tag LOCUS_72740 4025 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 4428 6095 gene locus_tag LOCUS_72750 4428 6095 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_72750 6244 7212 gene locus_tag LOCUS_72760 6244 7212 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024505124.1 protein_id gnl|my_center|LOCUS_72760 9047 7362 gene locus_tag LOCUS_72770 9047 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72770 10828 9044 gene locus_tag LOCUS_72780 10828 9044 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_72780 11541 11861 gene locus_tag LOCUS_72790 11541 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 11913 12716 gene locus_tag LOCUS_72800 11913 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72800 >Feature sequence356 1110 376 gene locus_tag LOCUS_72810 1110 376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_72810 2510 1107 gene locus_tag LOCUS_72820 2510 1107 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939710.1 protein_id gnl|my_center|LOCUS_72820 3043 2513 gene locus_tag LOCUS_72830 3043 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72830 3556 3053 gene locus_tag LOCUS_72840 3556 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72840 4172 3618 gene locus_tag LOCUS_72850 4172 3618 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390290.1 protein_id gnl|my_center|LOCUS_72850 4937 4503 gene locus_tag LOCUS_72860 4937 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72860 5794 5096 gene locus_tag LOCUS_72870 5794 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72870 6315 7166 gene locus_tag LOCUS_72880 6315 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72880 7163 7360 gene locus_tag LOCUS_72890 7163 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72890 7429 8124 gene locus_tag LOCUS_72900 7429 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 8485 9807 gene locus_tag LOCUS_72910 gene zraS 8485 9807 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704019.1 protein_id gnl|my_center|LOCUS_72910 9800 11137 gene locus_tag LOCUS_72920 9800 11137 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_72920 11300 12067 gene locus_tag LOCUS_72930 11300 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72930 12070 12747 gene locus_tag LOCUS_72940 12070 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72940 >Feature sequence357 219 1235 gene locus_tag LOCUS_72950 219 1235 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324413.1 protein_id gnl|my_center|LOCUS_72950 4838 1260 gene locus_tag LOCUS_72960 4838 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72960 6246 4864 gene locus_tag LOCUS_72970 6246 4864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_72970 9415 6425 gene locus_tag LOCUS_72980 9415 6425 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615526.1 protein_id gnl|my_center|LOCUS_72980 11266 9932 gene locus_tag LOCUS_72990 11266 9932 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922280.1 protein_id gnl|my_center|LOCUS_72990 11454 12812 gene locus_tag LOCUS_73000 11454 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73000 >Feature sequence358 954 1187 gene locus_tag LOCUS_73010 954 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73010 1571 1242 gene locus_tag LOCUS_73020 1571 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324801.1 protein_id gnl|my_center|LOCUS_73020 1741 2157 gene locus_tag LOCUS_73030 1741 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326661.1 protein_id gnl|my_center|LOCUS_73030 2178 2444 gene locus_tag LOCUS_73040 2178 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73040 2569 2339 gene locus_tag LOCUS_73050 2569 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73050 3865 2693 gene locus_tag LOCUS_73060 3865 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921862.1 protein_id gnl|my_center|LOCUS_73060 4167 4382 gene locus_tag LOCUS_73070 4167 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73070 4618 5484 gene locus_tag LOCUS_73080 4618 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73080 7499 5493 gene locus_tag LOCUS_73090 7499 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73090 8869 7604 gene locus_tag LOCUS_73100 8869 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 9113 10228 gene locus_tag LOCUS_73110 9113 10228 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_73110 11276 10332 gene locus_tag LOCUS_73120 11276 10332 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_73120 11521 12867 gene locus_tag LOCUS_73130 11521 12867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112480.1 protein_id gnl|my_center|LOCUS_73130 >Feature sequence359 588 3020 gene locus_tag LOCUS_73140 588 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_73140 3090 3851 gene locus_tag LOCUS_73150 3090 3851 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_73150 4056 4751 gene locus_tag LOCUS_73160 4056 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73160 6034 4808 gene locus_tag LOCUS_73170 6034 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_73170 8498 6147 gene locus_tag LOCUS_73180 8498 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 9062 8547 gene locus_tag LOCUS_73190 9062 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73190 9634 9227 gene locus_tag LOCUS_73200 9634 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73200 9992 9543 gene locus_tag LOCUS_73210 9992 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73210 11455 10133 gene locus_tag LOCUS_73220 11455 10133 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_73220 11888 12355 gene locus_tag LOCUS_73230 11888 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73230 >Feature sequence360 63 1703 gene locus_tag LOCUS_73240 63 1703 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_73240 2088 3287 gene locus_tag LOCUS_73250 gene tuf 2088 3287 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_73250 3418 4227 gene locus_tag LOCUS_73260 3418 4227 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922423.1 protein_id gnl|my_center|LOCUS_73260 5053 4229 gene locus_tag LOCUS_73270 5053 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73270 6176 5247 gene locus_tag LOCUS_73280 6176 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73280 6897 6481 gene locus_tag LOCUS_73290 6897 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73290 7602 7357 gene locus_tag LOCUS_73300 7602 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73300 8094 7876 gene locus_tag LOCUS_73310 8094 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73310 9983 8739 gene locus_tag LOCUS_73320 9983 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73320 10229 10621 gene locus_tag LOCUS_73330 10229 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73330 10599 12035 gene locus_tag LOCUS_73340 10599 12035 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_73340 <12783 12189 gene locus_tag LOCUS_73350 <12783 12189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256063.1:protein-tyrosine phosphatase family protein >Feature sequence361 471 4 gene locus_tag LOCUS_73360 471 4 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_73360 2835 544 gene locus_tag LOCUS_73370 2835 544 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_73370 3185 2892 gene locus_tag LOCUS_73380 3185 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73380 4110 3265 gene locus_tag LOCUS_73390 4110 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73390 4268 4453 gene locus_tag LOCUS_73400 4268 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 4656 5675 gene locus_tag LOCUS_73410 gene floA 4656 5675 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327752.1 protein_id gnl|my_center|LOCUS_73410 5819 6814 gene locus_tag LOCUS_73420 5819 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 6858 7598 gene locus_tag LOCUS_73430 6858 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 8783 7617 gene locus_tag LOCUS_73440 8783 7617 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_73440 9805 8798 gene locus_tag LOCUS_73450 9805 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73450 11118 9802 gene locus_tag LOCUS_73460 11118 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 11551 11342 gene locus_tag LOCUS_73470 gene csrA 11551 11342 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_73470 11916 12341 gene locus_tag LOCUS_73480 11916 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73480 >Feature sequence362 88 1167 gene locus_tag LOCUS_73490 88 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 2805 1381 gene locus_tag LOCUS_73500 2805 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_73500 4395 2860 gene locus_tag LOCUS_73510 4395 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 4857 5489 gene locus_tag LOCUS_73520 4857 5489 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_73520 5486 11557 gene locus_tag LOCUS_73530 5486 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73530 >Feature sequence363 1872 100 gene locus_tag LOCUS_73540 1872 100 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_73540 2345 5011 gene locus_tag LOCUS_73550 2345 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73550 6927 5287 gene locus_tag LOCUS_73560 gene purH 6927 5287 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_73560 7742 7068 gene locus_tag LOCUS_73570 gene purN 7742 7068 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_73570 8061 9014 gene locus_tag LOCUS_73580 gene fmt 8061 9014 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123937.1 protein_id gnl|my_center|LOCUS_73580 10256 9021 gene locus_tag LOCUS_73590 gene manA 10256 9021 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877219.1 protein_id gnl|my_center|LOCUS_73590 >Feature sequence364 160 1767 gene locus_tag LOCUS_73600 160 1767 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_73600 2740 3933 gene locus_tag LOCUS_73610 2740 3933 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144157.1 protein_id gnl|my_center|LOCUS_73610 3957 7058 gene locus_tag LOCUS_73620 3957 7058 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_73620 8970 7183 gene locus_tag LOCUS_73630 8970 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73630 10307 9093 gene locus_tag LOCUS_73640 10307 9093 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_73640 11018 10362 gene locus_tag LOCUS_73650 11018 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73650 12279 11203 gene locus_tag LOCUS_73660 12279 11203 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_73660 >Feature sequence365 996 142 gene locus_tag LOCUS_73670 996 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73670 2076 1162 gene locus_tag LOCUS_73680 2076 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73680 5344 2276 gene locus_tag LOCUS_73690 5344 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 5667 6317 gene locus_tag LOCUS_73700 5667 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73700 6444 6647 gene locus_tag LOCUS_73710 6444 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73710 8160 6880 gene locus_tag LOCUS_73720 8160 6880 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027183.1 protein_id gnl|my_center|LOCUS_73720 8473 9912 gene locus_tag LOCUS_73730 8473 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_73730 10892 9984 gene locus_tag LOCUS_73740 10892 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73740 12262 11075 gene locus_tag LOCUS_73750 12262 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73750 >Feature sequence366 2183 1074 gene locus_tag LOCUS_73760 2183 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73760 3527 2235 gene locus_tag LOCUS_73770 3527 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73770 5526 3589 gene locus_tag LOCUS_73780 5526 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73780 6415 5744 gene locus_tag LOCUS_73790 gene eda 6415 5744 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966878.1 protein_id gnl|my_center|LOCUS_73790 7416 6436 gene locus_tag LOCUS_73800 gene rbsC 7416 6436 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_73800 8955 7438 gene locus_tag LOCUS_73810 gene gguA 8955 7438 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583992.1 protein_id gnl|my_center|LOCUS_73810 9982 9014 gene locus_tag LOCUS_73820 9982 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 11192 10041 gene locus_tag LOCUS_73830 11192 10041 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_73830 11448 12152 gene locus_tag LOCUS_73840 11448 12152 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532967.1 protein_id gnl|my_center|LOCUS_73840 12212 12427 gene locus_tag LOCUS_73850 12212 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 12578 12496 gene locus_tag LOCUS_t00460 12578 12496 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence367 993 1994 gene locus_tag LOCUS_73860 993 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73860 2016 2771 gene locus_tag LOCUS_73870 2016 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 4966 3185 gene locus_tag LOCUS_73880 gene dnaK 4966 3185 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_73880 5795 5007 gene locus_tag LOCUS_73890 5795 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73890 6086 5796 gene locus_tag LOCUS_73900 6086 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73900 8585 6147 gene locus_tag LOCUS_73910 8585 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73910 8866 10140 gene locus_tag LOCUS_73920 8866 10140 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_73920 >Feature sequence368 3895 944 gene locus_tag LOCUS_73930 3895 944 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_73930 4207 5637 gene locus_tag LOCUS_73940 4207 5637 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_73940 6176 5634 gene locus_tag LOCUS_73950 6176 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 11173 6173 gene locus_tag LOCUS_73960 11173 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 12392 11841 gene locus_tag LOCUS_73970 12392 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 >Feature sequence369 292 675 gene locus_tag LOCUS_73980 292 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73980 675 1103 gene locus_tag LOCUS_73990 675 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73990 1106 1564 gene locus_tag LOCUS_74000 1106 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74000 1580 1780 gene locus_tag LOCUS_74010 1580 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74010 1780 2847 gene locus_tag LOCUS_74020 1780 2847 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_74020 5673 3319 gene locus_tag LOCUS_74030 5673 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74030 6826 5735 gene locus_tag LOCUS_74040 6826 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74040 8201 6837 gene locus_tag LOCUS_74050 8201 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74050 8744 8202 gene locus_tag LOCUS_74060 8744 8202 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921864.1 protein_id gnl|my_center|LOCUS_74060 9883 9635 gene locus_tag LOCUS_74070 9883 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74070 10628 10017 gene locus_tag LOCUS_74080 10628 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74080 11384 10731 gene locus_tag LOCUS_74090 11384 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74090 11845 11381 gene locus_tag LOCUS_74100 11845 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74100 12416 11778 gene locus_tag LOCUS_74110 12416 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74110 >Feature sequence370 <1 1725 gene locus_tag LOCUS_74120 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943566.1:selenite/tellurite reduction operon c-type cytochrome ExtM 2391 1732 gene locus_tag LOCUS_74130 2391 1732 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_74130 4109 2508 gene locus_tag LOCUS_74140 4109 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814206.1 protein_id gnl|my_center|LOCUS_74140 5134 4106 gene locus_tag LOCUS_74150 5134 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 5399 6601 gene locus_tag LOCUS_74160 5399 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74160 6499 6711 gene locus_tag LOCUS_74170 6499 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74170 6727 7146 gene locus_tag LOCUS_74180 6727 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 7158 7325 gene locus_tag LOCUS_74190 7158 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74190 7405 7331 gene locus_tag LOCUS_t00470 7405 7331 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7576 7845 gene locus_tag LOCUS_74200 7576 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74200 7969 7790 gene locus_tag LOCUS_74210 7969 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74210 8381 8103 gene locus_tag LOCUS_74220 8381 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 8608 8450 gene locus_tag LOCUS_74230 8608 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74230 8871 10274 gene locus_tag LOCUS_74240 8871 10274 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_74240 10308 12056 gene locus_tag LOCUS_74250 10308 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 >Feature sequence371 1959 211 gene locus_tag LOCUS_74260 1959 211 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_74260 3038 1989 gene locus_tag LOCUS_74270 3038 1989 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_74270 4006 3080 gene locus_tag LOCUS_74280 4006 3080 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_74280 6717 4252 gene locus_tag LOCUS_74290 6717 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74290 6980 7531 gene locus_tag LOCUS_74300 6980 7531 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_74300 7669 11868 gene locus_tag LOCUS_74310 7669 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74310 12318 11995 gene locus_tag LOCUS_74320 12318 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74320 >Feature sequence372 1444 131 gene locus_tag LOCUS_74330 1444 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74330 1777 3006 gene locus_tag LOCUS_74340 1777 3006 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_74340 4497 3034 gene locus_tag LOCUS_74350 4497 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 4706 6880 gene locus_tag LOCUS_74360 4706 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74360 6893 8248 gene locus_tag LOCUS_74370 6893 8248 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_74370 8550 8885 gene locus_tag LOCUS_74380 8550 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74380 8889 9497 gene locus_tag LOCUS_74390 8889 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74390 9574 11283 gene locus_tag LOCUS_74400 9574 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74400 11372 12541 gene locus_tag LOCUS_74410 11372 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74410 >Feature sequence373 2266 1136 gene locus_tag LOCUS_74420 2266 1136 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_74420 3489 2263 gene locus_tag LOCUS_74430 3489 2263 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666936.1 protein_id gnl|my_center|LOCUS_74430 4463 3600 gene locus_tag LOCUS_74440 4463 3600 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_74440 5841 4882 gene locus_tag LOCUS_74450 5841 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74450 6303 6704 gene locus_tag LOCUS_74460 6303 6704 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968539.1 protein_id gnl|my_center|LOCUS_74460 6976 6701 gene locus_tag LOCUS_74470 6976 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74470 7916 8845 gene locus_tag LOCUS_74480 7916 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74480 >Feature sequence374 1009 2817 gene locus_tag LOCUS_74490 1009 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74490 3325 4047 gene locus_tag LOCUS_74500 3325 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74500 4289 4744 gene locus_tag LOCUS_74510 4289 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74510 5788 4946 gene locus_tag LOCUS_74520 5788 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74520 6268 5933 gene locus_tag LOCUS_74530 6268 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74530 6759 6250 gene locus_tag LOCUS_74540 6759 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74540 6903 7334 gene locus_tag LOCUS_74550 6903 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74550 8710 9894 gene locus_tag LOCUS_74560 8710 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74560 10373 10080 gene locus_tag LOCUS_74570 10373 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74570 10465 10905 gene locus_tag LOCUS_74580 10465 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74580 10902 11081 gene locus_tag LOCUS_74590 10902 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74590 <12535 11094 gene locus_tag LOCUS_74600 <12535 11094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120669.1:VWA domain-containing protein >Feature sequence375 218 772 gene locus_tag LOCUS_74610 218 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74610 3939 1423 gene locus_tag LOCUS_74620 3939 1423 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_74620 4386 4024 gene locus_tag LOCUS_74630 4386 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74630 5594 4479 gene locus_tag LOCUS_74640 gene dnaN 5594 4479 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_74640 7023 5929 gene locus_tag LOCUS_74650 7023 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74650 8280 7135 gene locus_tag LOCUS_74660 8280 7135 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123330.1 protein_id gnl|my_center|LOCUS_74660 8170 8379 gene locus_tag LOCUS_74670 8170 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74670 8638 9330 gene locus_tag LOCUS_74680 8638 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615698.1 protein_id gnl|my_center|LOCUS_74680 10403 9432 gene locus_tag LOCUS_74690 10403 9432 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920841.1 protein_id gnl|my_center|LOCUS_74690 11102 10425 gene locus_tag LOCUS_74700 11102 10425 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_74700 11346 11846 gene locus_tag LOCUS_74710 11346 11846 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_74710 >Feature sequence376 <1 3360 gene locus_tag LOCUS_74720 <1 3360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202977.1:cobaltochelatase subunit CobN 4942 3452 gene locus_tag LOCUS_74730 4942 3452 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_74730 5209 7245 gene locus_tag LOCUS_74740 5209 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74740 7562 8188 gene locus_tag LOCUS_74750 7562 8188 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_74750 <12492 8240 gene locus_tag LOCUS_74760 <12492 8240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121034.1:DNA repair ATPase >Feature sequence377 424 1875 gene locus_tag LOCUS_74770 gene hemG 424 1875 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_74770 5766 2491 gene locus_tag LOCUS_74780 5766 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 6164 7342 gene locus_tag LOCUS_74790 6164 7342 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_74790 7712 8350 gene locus_tag LOCUS_74800 7712 8350 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335125.1 protein_id gnl|my_center|LOCUS_74800 9554 8424 gene locus_tag LOCUS_74810 9554 8424 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_74810 10997 9645 gene locus_tag LOCUS_74820 10997 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74820 11201 12241 gene locus_tag LOCUS_74830 11201 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74830 >Feature sequence378 <1 849 gene locus_tag LOCUS_74840 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121245.1:VWA domain-containing protein 2304 913 gene locus_tag LOCUS_74850 2304 913 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_74850 3970 2342 gene locus_tag LOCUS_74860 gene ggt 3970 2342 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_74860 4395 5363 gene locus_tag LOCUS_74870 4395 5363 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_74870 5799 7109 gene locus_tag LOCUS_74880 5799 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74880 7999 7160 gene locus_tag LOCUS_74890 7999 7160 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_74890 8089 9339 gene locus_tag LOCUS_74900 gene pepT 8089 9339 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121359.1 protein_id gnl|my_center|LOCUS_74900 9689 9913 gene locus_tag LOCUS_74910 9689 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74910 10229 9906 gene locus_tag LOCUS_74920 10229 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 10323 11504 gene locus_tag LOCUS_74930 gene metK 10323 11504 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_74930 >Feature sequence379 3483 229 gene locus_tag LOCUS_74940 3483 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74940 5381 3501 gene locus_tag LOCUS_74950 5381 3501 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_74950 5493 6290 gene locus_tag LOCUS_74960 5493 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74960 8584 6344 gene locus_tag LOCUS_74970 8584 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74970 9302 8607 gene locus_tag LOCUS_74980 9302 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74980 11317 9323 gene locus_tag LOCUS_74990 11317 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74990 >Feature sequence380 4440 1807 gene locus_tag LOCUS_75000 4440 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75000 5016 4594 gene locus_tag LOCUS_75010 5016 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75010 6365 5370 gene locus_tag LOCUS_75020 6365 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75020 6933 6460 gene locus_tag LOCUS_75030 6933 6460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_75030 9064 6926 gene locus_tag LOCUS_75040 9064 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75040 9344 11110 gene locus_tag LOCUS_75050 9344 11110 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_75050 >Feature sequence381 1778 93 gene locus_tag LOCUS_75060 1778 93 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921618.1 protein_id gnl|my_center|LOCUS_75060 5120 2439 gene locus_tag LOCUS_75070 5120 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75070 6462 5485 gene locus_tag LOCUS_75080 6462 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75080 8090 6723 gene locus_tag LOCUS_75090 8090 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75090 8231 8710 gene locus_tag LOCUS_75100 8231 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75100 8771 9169 gene locus_tag LOCUS_75110 8771 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75110 9620 9339 gene locus_tag LOCUS_75120 9620 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75120 >Feature sequence382 675 106 gene locus_tag LOCUS_75130 675 106 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_75130 1344 760 gene locus_tag LOCUS_75140 1344 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75140 1493 2104 gene locus_tag LOCUS_75150 gene rdgB 1493 2104 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_75150 2192 3718 gene locus_tag LOCUS_75160 2192 3718 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922613.1 protein_id gnl|my_center|LOCUS_75160 3906 5111 gene locus_tag LOCUS_75170 3906 5111 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_75170 5141 7030 gene locus_tag LOCUS_75180 5141 7030 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_75180 7060 8013 gene locus_tag LOCUS_75190 7060 8013 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224948.1 protein_id gnl|my_center|LOCUS_75190 9460 8141 gene locus_tag LOCUS_75200 9460 8141 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_75200 10652 9561 gene locus_tag LOCUS_75210 10652 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75210 10951 12237 gene locus_tag LOCUS_75220 10951 12237 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_75220 >Feature sequence383 3342 451 gene locus_tag LOCUS_75230 3342 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75230 5486 3354 gene locus_tag LOCUS_75240 5486 3354 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_75240 6899 5490 gene locus_tag LOCUS_75250 6899 5490 CDS product DUF4380 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393519.1 protein_id gnl|my_center|LOCUS_75250 8458 7088 gene locus_tag LOCUS_75260 8458 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75260 8827 8582 gene locus_tag LOCUS_75270 8827 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75270 9259 9011 gene locus_tag LOCUS_75280 9259 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75280 9425 10693 gene locus_tag LOCUS_75290 9425 10693 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_75290 11225 11467 gene locus_tag LOCUS_75300 11225 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75300 <12327 11577 gene locus_tag LOCUS_75310 <12327 11577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326116.1:ThuA domain-containing protein >Feature sequence384 2073 190 gene locus_tag LOCUS_75320 2073 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75320 3282 2311 gene locus_tag LOCUS_75330 3282 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75330 3681 3896 gene locus_tag LOCUS_75340 3681 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75340 4282 3908 gene locus_tag LOCUS_75350 4282 3908 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_75350 4411 5607 gene locus_tag LOCUS_75360 4411 5607 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_75360 5713 6114 gene locus_tag LOCUS_75370 5713 6114 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_75370 6095 8236 gene locus_tag LOCUS_75380 6095 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75380 8377 8604 gene locus_tag LOCUS_75390 8377 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75390 8925 11252 gene locus_tag LOCUS_75400 8925 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75400 >Feature sequence385 512 709 gene locus_tag LOCUS_75410 512 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75410 1743 793 gene locus_tag LOCUS_75420 1743 793 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_75420 3058 1784 gene locus_tag LOCUS_75430 3058 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75430 3683 3051 gene locus_tag LOCUS_75440 3683 3051 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_75440 3910 4818 gene locus_tag LOCUS_75450 3910 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75450 5351 5088 gene locus_tag LOCUS_75460 5351 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75460 5799 9272 gene locus_tag LOCUS_75470 5799 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75470 9386 10732 gene locus_tag LOCUS_75480 9386 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75480 10854 12065 gene locus_tag LOCUS_75490 10854 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75490 >Feature sequence386 330 617 gene locus_tag LOCUS_75500 330 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75500 674 1291 gene locus_tag LOCUS_75510 674 1291 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_75510 1759 2742 gene locus_tag LOCUS_75520 1759 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75520 6104 2772 gene locus_tag LOCUS_75530 6104 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75530 12140 6156 gene locus_tag LOCUS_75540 12140 6156 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_75540 >Feature sequence387 745 71 gene locus_tag LOCUS_75550 745 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75550 2399 825 gene locus_tag LOCUS_75560 2399 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75560 3108 3671 gene locus_tag LOCUS_75570 3108 3671 CDS product transcription termination/antitermination NusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327462.1 protein_id gnl|my_center|LOCUS_75570 3777 5105 gene locus_tag LOCUS_75580 3777 5105 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_75580 5169 6341 gene locus_tag LOCUS_75590 gene rffA 5169 6341 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_75590 6383 7369 gene locus_tag LOCUS_75600 6383 7369 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390553.1 protein_id gnl|my_center|LOCUS_75600 7366 8076 gene locus_tag LOCUS_75610 7366 8076 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 protein_id gnl|my_center|LOCUS_75610 8073 9050 gene locus_tag LOCUS_75620 8073 9050 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035859.1 protein_id gnl|my_center|LOCUS_75620 9244 10767 gene locus_tag LOCUS_75630 9244 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75630 10944 11567 gene locus_tag LOCUS_75640 10944 11567 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256807.1 protein_id gnl|my_center|LOCUS_75640 11568 11810 gene locus_tag LOCUS_75650 11568 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75650 >Feature sequence388 797 2767 gene locus_tag LOCUS_75660 797 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75660 2800 5997 gene locus_tag LOCUS_75670 2800 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75670 >Feature sequence389 1435 1641 gene locus_tag LOCUS_75680 1435 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75680 1711 2307 gene locus_tag LOCUS_75690 1711 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75690 2919 3269 gene locus_tag LOCUS_75700 2919 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75700 3152 4012 gene locus_tag LOCUS_75710 3152 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75710 5787 4300 gene locus_tag LOCUS_75720 5787 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75720 6415 7569 gene locus_tag LOCUS_75730 6415 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75730 7626 7799 gene locus_tag LOCUS_75740 7626 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75740 8697 8170 gene locus_tag LOCUS_75750 8697 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75750 9160 8600 gene locus_tag LOCUS_75760 9160 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75760 9621 10946 gene locus_tag LOCUS_75770 9621 10946 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_75770 10943 12010 gene locus_tag LOCUS_75780 10943 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75780 >Feature sequence390 41 1219 gene locus_tag LOCUS_75790 41 1219 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256035.1 protein_id gnl|my_center|LOCUS_75790 1216 2382 gene locus_tag LOCUS_75800 1216 2382 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_75800 2558 2875 gene locus_tag LOCUS_75810 2558 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75810 2863 3081 gene locus_tag LOCUS_75820 2863 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75820 4243 3116 gene locus_tag LOCUS_75830 4243 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75830 5706 4255 gene locus_tag LOCUS_75840 5706 4255 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_75840 7780 5708 gene locus_tag LOCUS_75850 7780 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75850 7779 8000 gene locus_tag LOCUS_75860 7779 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75860 8311 8051 gene locus_tag LOCUS_75870 8311 8051 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_75870 8588 8304 gene locus_tag LOCUS_75880 8588 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75880 9952 8852 gene locus_tag LOCUS_75890 9952 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75890 10977 9949 gene locus_tag LOCUS_75900 10977 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75900 >Feature sequence391 3988 3470 gene locus_tag LOCUS_75910 3988 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75910 4205 4396 gene locus_tag LOCUS_75920 4205 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75920 5420 4836 gene locus_tag LOCUS_75930 5420 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75930 6076 5402 gene locus_tag LOCUS_75940 6076 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 6537 6073 gene locus_tag LOCUS_75950 6537 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75950 6755 7234 gene locus_tag LOCUS_75960 6755 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75960 7146 7427 gene locus_tag LOCUS_75970 7146 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75970 8046 7669 gene locus_tag LOCUS_75980 8046 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75980 8771 9121 gene locus_tag LOCUS_75990 8771 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75990 9118 9480 gene locus_tag LOCUS_76000 9118 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76000 10022 9507 gene locus_tag LOCUS_76010 10022 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76010 10214 10741 gene locus_tag LOCUS_76020 10214 10741 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_76020 <11935 10738 gene locus_tag LOCUS_76030 <11935 10738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615717.1:HEAT repeat domain-containing protein >Feature sequence392 4086 2029 gene locus_tag LOCUS_76040 4086 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76040 5309 4149 gene locus_tag LOCUS_76050 5309 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76050 7264 5774 gene locus_tag LOCUS_76060 7264 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76060 8281 7373 gene locus_tag LOCUS_76070 8281 7373 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_76070 8689 10947 gene locus_tag LOCUS_76080 8689 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76080 11772 10951 gene locus_tag LOCUS_76090 11772 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76090 >Feature sequence393 1440 121 gene locus_tag LOCUS_76100 1440 121 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_76100 2925 1459 gene locus_tag LOCUS_76110 2925 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76110 3338 4810 gene locus_tag LOCUS_76120 3338 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76120 6638 4989 gene locus_tag LOCUS_76130 6638 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76130 6906 8534 gene locus_tag LOCUS_76140 6906 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76140 11100 8701 gene locus_tag LOCUS_76150 11100 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76150 >Feature sequence394 2662 1829 gene locus_tag LOCUS_76160 2662 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76160 2882 3175 gene locus_tag LOCUS_76170 2882 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76170 3172 3642 gene locus_tag LOCUS_76180 3172 3642 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_76180 4869 3658 gene locus_tag LOCUS_76190 4869 3658 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_76190 8597 5064 gene locus_tag LOCUS_76200 8597 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76200 10093 8804 gene locus_tag LOCUS_76210 10093 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76210 11559 10090 gene locus_tag LOCUS_76220 11559 10090 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_76220 >Feature sequence395 4058 501 gene locus_tag LOCUS_76230 4058 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76230 6656 4146 gene locus_tag LOCUS_76240 6656 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76240 10252 6671 gene locus_tag LOCUS_76250 10252 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76250 10367 10546 gene locus_tag LOCUS_76260 10367 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76260 10764 11546 gene locus_tag LOCUS_76270 gene fabG 10764 11546 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_76270 >Feature sequence396 173 3835 gene locus_tag LOCUS_76280 173 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76280 5616 3907 gene locus_tag LOCUS_76290 5616 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76290 5994 6257 gene locus_tag LOCUS_76300 5994 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76300 6627 6265 gene locus_tag LOCUS_76310 6627 6265 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_76310 7959 6895 gene locus_tag LOCUS_76320 7959 6895 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_76320 8145 9035 gene locus_tag LOCUS_76330 8145 9035 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_76330 <11792 9135 gene locus_tag LOCUS_76340 <11792 9135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089481.1:FAD-dependent oxidoreductase >Feature sequence397 718 2727 gene locus_tag LOCUS_76350 718 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76350 3032 2829 gene locus_tag LOCUS_76360 3032 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76360 5095 3032 gene locus_tag LOCUS_76370 5095 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76370 5434 9021 gene locus_tag LOCUS_76380 5434 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76380 11452 9101 gene locus_tag LOCUS_76390 11452 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76390 >Feature sequence398 177 1163 gene locus_tag LOCUS_76400 177 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76400 2427 1150 gene locus_tag LOCUS_76410 2427 1150 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_76410 3445 2744 gene locus_tag LOCUS_76420 3445 2744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_76420 4344 3424 gene locus_tag LOCUS_76430 4344 3424 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_76430 4449 5780 gene locus_tag LOCUS_76440 4449 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76440 5820 7352 gene locus_tag LOCUS_76450 5820 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76450 7578 7426 gene locus_tag LOCUS_76460 7578 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76460 7718 8392 gene locus_tag LOCUS_76470 7718 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76470 8641 9636 gene locus_tag LOCUS_76480 8641 9636 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331126.1 protein_id gnl|my_center|LOCUS_76480 9686 10945 gene locus_tag LOCUS_76490 9686 10945 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_76490 10965 11219 gene locus_tag LOCUS_76500 10965 11219 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_76500 >Feature sequence399 1351 620 gene locus_tag LOCUS_76510 1351 620 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_76510 2773 1373 gene locus_tag LOCUS_76520 2773 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76520 4849 2945 gene locus_tag LOCUS_76530 4849 2945 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766740.1 protein_id gnl|my_center|LOCUS_76530 6625 4916 gene locus_tag LOCUS_76540 6625 4916 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_76540 7264 6638 gene locus_tag LOCUS_76550 7264 6638 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_76550 7417 7962 gene locus_tag LOCUS_76560 7417 7962 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_76560 8003 11563 gene locus_tag LOCUS_76570 8003 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76570 >Feature sequence400 <1 1464 gene locus_tag LOCUS_76580 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117992.1:arylsulfatase 1682 5002 gene locus_tag LOCUS_76590 1682 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76590 7052 5019 gene locus_tag LOCUS_76600 7052 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76600 8244 7036 gene locus_tag LOCUS_76610 8244 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76610 9616 8507 gene locus_tag LOCUS_76620 9616 8507 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108907.1 protein_id gnl|my_center|LOCUS_76620 11081 9708 gene locus_tag LOCUS_76630 11081 9708 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_76630 >Feature sequence401 153 2936 gene locus_tag LOCUS_76640 153 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108901.1 protein_id gnl|my_center|LOCUS_76640 3016 4035 gene locus_tag LOCUS_76650 3016 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76650 4577 4236 gene locus_tag LOCUS_76660 4577 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76660 4850 5707 gene locus_tag LOCUS_76670 4850 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76670 7000 5738 gene locus_tag LOCUS_76680 gene fabF 7000 5738 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_76680 7247 7008 gene locus_tag LOCUS_76690 7247 7008 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_76690 8166 7381 gene locus_tag LOCUS_76700 gene fabG 8166 7381 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_76700 9129 8218 gene locus_tag LOCUS_76710 gene fabD 9129 8218 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_76710 11491 9512 gene locus_tag LOCUS_76720 11491 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76720 >Feature sequence402 476 658 gene locus_tag LOCUS_76730 476 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76730 1916 690 gene locus_tag LOCUS_76740 1916 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76740 2647 1913 gene locus_tag LOCUS_76750 2647 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76750 7978 3650 gene locus_tag LOCUS_76760 7978 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76760 8701 8252 gene locus_tag LOCUS_76770 8701 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76770 9685 9338 gene locus_tag LOCUS_76780 9685 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76780 9961 10908 gene locus_tag LOCUS_76790 9961 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76790 >Feature sequence403 44 766 gene locus_tag LOCUS_76800 44 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76800 859 2418 gene locus_tag LOCUS_76810 859 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76810 2545 3933 gene locus_tag LOCUS_76820 2545 3933 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_76820 6661 4355 gene locus_tag LOCUS_76830 6661 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76830 6993 6736 gene locus_tag LOCUS_76840 6993 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76840 6877 8436 gene locus_tag LOCUS_76850 6877 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76850 8730 9854 gene locus_tag LOCUS_76860 8730 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76860 10073 11023 gene locus_tag LOCUS_76870 10073 11023 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445392.1 protein_id gnl|my_center|LOCUS_76870 11410 11177 gene locus_tag LOCUS_76880 11410 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76880 >Feature sequence404 779 570 gene locus_tag LOCUS_76890 779 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76890 873 2573 gene locus_tag LOCUS_76900 873 2573 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_76900 3125 5473 gene locus_tag LOCUS_76910 3125 5473 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122735.1 protein_id gnl|my_center|LOCUS_76910 5792 5640 gene locus_tag LOCUS_76920 5792 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76920 5880 6893 gene locus_tag LOCUS_76930 5880 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76930 7065 8630 gene locus_tag LOCUS_76940 gene gltX 7065 8630 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_76940 8648 10375 gene locus_tag LOCUS_76950 8648 10375 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_76950 10388 10828 gene locus_tag LOCUS_76960 10388 10828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442707.1 protein_id gnl|my_center|LOCUS_76960 >Feature sequence405 1368 103 gene locus_tag LOCUS_76970 1368 103 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_76970 1751 1476 gene locus_tag LOCUS_76980 1751 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76980 3579 1894 gene locus_tag LOCUS_76990 3579 1894 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817390.1 protein_id gnl|my_center|LOCUS_76990 4253 3615 gene locus_tag LOCUS_77000 4253 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77000 4777 4253 gene locus_tag LOCUS_77010 4777 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77010 6187 4814 gene locus_tag LOCUS_77020 6187 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77020 7105 6443 gene locus_tag LOCUS_77030 7105 6443 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325534.1 protein_id gnl|my_center|LOCUS_77030 7280 8707 gene locus_tag LOCUS_77040 7280 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77040 9666 8767 gene locus_tag LOCUS_77050 9666 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77050 9971 11539 gene locus_tag LOCUS_77060 9971 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77060 >Feature sequence406 429 668 gene locus_tag LOCUS_77070 429 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77070 888 724 gene locus_tag LOCUS_77080 888 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77080 1263 1649 gene locus_tag LOCUS_77090 1263 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77090 2062 1676 gene locus_tag LOCUS_77100 gene crcB 2062 1676 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_77100 2292 2579 gene locus_tag LOCUS_77110 gene groES 2292 2579 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_77110 2638 3762 gene locus_tag LOCUS_77120 2638 3762 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_77120 4680 5096 gene locus_tag LOCUS_77130 4680 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77130 >Feature sequence407 449 601 gene locus_tag LOCUS_77140 449 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77140 1872 556 gene locus_tag LOCUS_77150 1872 556 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_77150 3339 1924 gene locus_tag LOCUS_77160 gene ahcY 3339 1924 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_77160 4078 3344 gene locus_tag LOCUS_77170 4078 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77170 4828 4145 gene locus_tag LOCUS_77180 4828 4145 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_77180 5078 5221 gene locus_tag LOCUS_77190 5078 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77190 6608 5325 gene locus_tag LOCUS_77200 6608 5325 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_77200 7181 6642 gene locus_tag LOCUS_77210 7181 6642 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_77210 7695 7306 gene locus_tag LOCUS_77220 7695 7306 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_77220 8237 7764 gene locus_tag LOCUS_77230 8237 7764 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 protein_id gnl|my_center|LOCUS_77230 8512 10275 gene locus_tag LOCUS_77240 8512 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77240 <11473 10337 gene locus_tag LOCUS_77250 <11473 10337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121350.1:tandem-95 repeat protein >Feature sequence408 123 2570 gene locus_tag LOCUS_77260 123 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77260 2695 3258 gene locus_tag LOCUS_77270 2695 3258 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_77270 3367 7362 gene locus_tag LOCUS_77280 3367 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77280 7490 7729 gene locus_tag LOCUS_77290 7490 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77290 8060 7722 gene locus_tag LOCUS_77300 8060 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77300 >Feature sequence409 1171 296 gene locus_tag LOCUS_77310 1171 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77310 2994 1402 gene locus_tag LOCUS_77320 2994 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77320 3638 3129 gene locus_tag LOCUS_77330 3638 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77330 4281 3778 gene locus_tag LOCUS_77340 gene tnpA 4281 3778 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_77340 6281 4530 gene locus_tag LOCUS_77350 6281 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77350 7667 6282 gene locus_tag LOCUS_77360 7667 6282 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338343.1 protein_id gnl|my_center|LOCUS_77360 8248 8601 gene locus_tag LOCUS_77370 8248 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77370 8714 9109 gene locus_tag LOCUS_77380 8714 9109 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615449.1 protein_id gnl|my_center|LOCUS_77380 9461 10888 gene locus_tag LOCUS_77390 9461 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77390 10903 11238 gene locus_tag LOCUS_77400 10903 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77400 >Feature sequence410 <1 752 gene locus_tag LOCUS_77410 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326116.1:ThuA domain-containing protein 1058 816 gene locus_tag LOCUS_77420 1058 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77420 1766 1128 gene locus_tag LOCUS_77430 1766 1128 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_77430 2242 2664 gene locus_tag LOCUS_77440 2242 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77440 4307 2676 gene locus_tag LOCUS_77450 4307 2676 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777006.1 protein_id gnl|my_center|LOCUS_77450 6314 4629 gene locus_tag LOCUS_77460 6314 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77460 6566 7486 gene locus_tag LOCUS_77470 6566 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77470 9366 8050 gene locus_tag LOCUS_77480 9366 8050 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_77480 10419 9397 gene locus_tag LOCUS_77490 10419 9397 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_77490 >Feature sequence411 3248 4606 gene locus_tag LOCUS_77500 3248 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77500 4892 5986 gene locus_tag LOCUS_77510 4892 5986 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 protein_id gnl|my_center|LOCUS_77510 6857 6216 gene locus_tag LOCUS_77520 6857 6216 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_77520 7762 6914 gene locus_tag LOCUS_77530 7762 6914 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_77530 9078 7759 gene locus_tag LOCUS_77540 9078 7759 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_77540 10054 9080 gene locus_tag LOCUS_77550 10054 9080 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142189.1 protein_id gnl|my_center|LOCUS_77550 10932 10150 gene locus_tag LOCUS_77560 10932 10150 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340251.1 protein_id gnl|my_center|LOCUS_77560 >Feature sequence412 505 1881 gene locus_tag LOCUS_77570 505 1881 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_77570 2342 4216 gene locus_tag LOCUS_77580 2342 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77580 4434 5057 gene locus_tag LOCUS_77590 4434 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77590 6497 5196 gene locus_tag LOCUS_77600 6497 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77600 7090 8415 gene locus_tag LOCUS_77610 7090 8415 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706702.1 protein_id gnl|my_center|LOCUS_77610 8623 10134 gene locus_tag LOCUS_77620 8623 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77620 10116 10370 gene locus_tag LOCUS_77630 10116 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77630 >Feature sequence413 2284 911 gene locus_tag LOCUS_77640 2284 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77640 3368 2412 gene locus_tag LOCUS_77650 3368 2412 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_77650 3527 5659 gene locus_tag LOCUS_77660 3527 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77660 9258 5779 gene locus_tag LOCUS_77670 9258 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77670 >Feature sequence414 2123 1374 gene locus_tag LOCUS_77680 2123 1374 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_77680 3774 2149 gene locus_tag LOCUS_77690 gene serA 3774 2149 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_77690 4902 3805 gene locus_tag LOCUS_77700 gene serC 4902 3805 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_77700 5207 5533 gene locus_tag LOCUS_77710 5207 5533 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102734.1 protein_id gnl|my_center|LOCUS_77710 5611 6576 gene locus_tag LOCUS_77720 5611 6576 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_77720 7284 6589 gene locus_tag LOCUS_77730 7284 6589 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816749.1 protein_id gnl|my_center|LOCUS_77730 7960 7571 gene locus_tag LOCUS_77740 7960 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201511.1 protein_id gnl|my_center|LOCUS_77740 9055 8345 gene locus_tag LOCUS_77750 9055 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77750 9548 9036 gene locus_tag LOCUS_77760 9548 9036 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008652955.1 protein_id gnl|my_center|LOCUS_77760 10434 9712 gene locus_tag LOCUS_77770 10434 9712 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325534.1 protein_id gnl|my_center|LOCUS_77770 11162 10623 gene locus_tag LOCUS_77780 11162 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77780 >Feature sequence415 <1 2622 gene locus_tag LOCUS_77790 <1 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome 2667 3656 gene locus_tag LOCUS_77800 2667 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77800 4526 3702 gene locus_tag LOCUS_77810 4526 3702 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_77810 4701 5663 gene locus_tag LOCUS_77820 4701 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77820 5834 6397 gene locus_tag LOCUS_77830 5834 6397 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_77830 7945 6530 gene locus_tag LOCUS_77840 7945 6530 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_77840 9515 8034 gene locus_tag LOCUS_77850 9515 8034 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_77850 9874 9620 gene locus_tag LOCUS_77860 9874 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77860 9907 10806 gene locus_tag LOCUS_77870 9907 10806 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_77870 >Feature sequence416 280 1245 gene locus_tag LOCUS_77880 280 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77880 4630 1298 gene locus_tag LOCUS_77890 4630 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77890 4971 4663 gene locus_tag LOCUS_77900 4971 4663 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868508.1 protein_id gnl|my_center|LOCUS_77900 5358 5200 gene locus_tag LOCUS_77910 5358 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77910 5475 6977 gene locus_tag LOCUS_77920 5475 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77920 9714 7831 gene locus_tag LOCUS_77930 9714 7831 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_77930 >Feature sequence417 415 1068 gene locus_tag LOCUS_77940 415 1068 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_77940 1629 1135 gene locus_tag LOCUS_77950 gene nrdR 1629 1135 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_77950 1816 2475 gene locus_tag LOCUS_77960 1816 2475 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121686.1 protein_id gnl|my_center|LOCUS_77960 3447 2593 gene locus_tag LOCUS_77970 3447 2593 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_77970 3626 4927 gene locus_tag LOCUS_77980 3626 4927 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121268.1 protein_id gnl|my_center|LOCUS_77980 4942 5754 gene locus_tag LOCUS_77990 gene proC 4942 5754 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_77990 5756 5986 gene locus_tag LOCUS_78000 5756 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78000 6421 6984 gene locus_tag LOCUS_78010 6421 6984 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340258.1 protein_id gnl|my_center|LOCUS_78010 7085 7474 gene locus_tag LOCUS_78020 7085 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78020 7474 10926 gene locus_tag LOCUS_78030 gene ileS 7474 10926 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434976.1 protein_id gnl|my_center|LOCUS_78030 >Feature sequence418 1109 96 gene locus_tag LOCUS_78040 1109 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78040 1282 2862 gene locus_tag LOCUS_78050 1282 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78050 3495 4034 gene locus_tag LOCUS_78060 3495 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78060 4185 4745 gene locus_tag LOCUS_78070 4185 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78070 4807 6867 gene locus_tag LOCUS_78080 4807 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78080 6873 10178 gene locus_tag LOCUS_78090 6873 10178 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_78090 >Feature sequence419 <1 1212 gene locus_tag LOCUS_78100 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140908.1:WD40 repeat domain-containing protein 1269 2291 gene locus_tag LOCUS_78110 1269 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78110 2365 3822 gene locus_tag LOCUS_78120 2365 3822 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_78120 6321 4369 gene locus_tag LOCUS_78130 6321 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78130 7618 6398 gene locus_tag LOCUS_78140 7618 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78140 8037 7663 gene locus_tag LOCUS_78150 8037 7663 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 protein_id gnl|my_center|LOCUS_78150 9608 8115 gene locus_tag LOCUS_78160 9608 8115 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_78160 >Feature sequence420 2 949 gene locus_tag LOCUS_78170 2 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78170 3347 1275 gene locus_tag LOCUS_78180 3347 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78180 3318 3551 gene locus_tag LOCUS_78190 3318 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78190 3558 5477 gene locus_tag LOCUS_78200 3558 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78200 7269 5680 gene locus_tag LOCUS_78210 7269 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78210 9031 7511 gene locus_tag LOCUS_78220 9031 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78220 >Feature sequence421 228 1100 gene locus_tag LOCUS_78230 228 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78230 1279 2391 gene locus_tag LOCUS_78240 gene yedE 1279 2391 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545330.1 protein_id gnl|my_center|LOCUS_78240 2588 2809 gene locus_tag LOCUS_78250 2588 2809 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546446.1 protein_id gnl|my_center|LOCUS_78250 2811 3038 gene locus_tag LOCUS_78260 2811 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78260 3049 4188 gene locus_tag LOCUS_78270 3049 4188 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_78270 4311 7889 gene locus_tag LOCUS_78280 4311 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78280 9518 7944 gene locus_tag LOCUS_78290 9518 7944 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121139.1 protein_id gnl|my_center|LOCUS_78290 10187 9525 gene locus_tag LOCUS_78300 10187 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78300 10084 10350 gene locus_tag LOCUS_78310 10084 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78310 >Feature sequence422 1302 142 gene locus_tag LOCUS_78320 1302 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78320 1890 3071 gene locus_tag LOCUS_78330 1890 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78330 6960 3139 gene locus_tag LOCUS_78340 6960 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78340 7901 7308 gene locus_tag LOCUS_78350 7901 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78350 9089 8061 gene locus_tag LOCUS_78360 9089 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78360 9997 9083 gene locus_tag LOCUS_78370 9997 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78370 10768 10034 gene locus_tag LOCUS_78380 10768 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78380 >Feature sequence423 6447 1459 gene locus_tag LOCUS_78390 6447 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78390 10156 6578 gene locus_tag LOCUS_78400 10156 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78400 <10868 10288 gene locus_tag LOCUS_78410 <10868 10288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123154.1:sigma-70 family RNA polymerase sigma factor >Feature sequence424 820 1125 gene locus_tag LOCUS_78420 gene lsrG 820 1125 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175221.1 protein_id gnl|my_center|LOCUS_78420 4240 1139 gene locus_tag LOCUS_78430 4240 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78430 5932 4496 gene locus_tag LOCUS_78440 5932 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78440 6603 6013 gene locus_tag LOCUS_78450 6603 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78450 6952 9504 gene locus_tag LOCUS_78460 6952 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78460 >Feature sequence425 25 1896 gene locus_tag LOCUS_78470 25 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78470 5030 2061 gene locus_tag LOCUS_78480 5030 2061 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_78480 7828 5345 gene locus_tag LOCUS_78490 7828 5345 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_78490 9227 8079 gene locus_tag LOCUS_78500 9227 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78500 9322 9819 gene locus_tag LOCUS_78510 9322 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78510 >Feature sequence426 366 169 gene locus_tag LOCUS_78520 366 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78520 278 1066 gene locus_tag LOCUS_78530 278 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78530 1895 1083 gene locus_tag LOCUS_78540 1895 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78540 2129 2647 gene locus_tag LOCUS_78550 2129 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78550 3945 2644 gene locus_tag LOCUS_78560 3945 2644 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_78560 4117 4299 gene locus_tag LOCUS_78570 4117 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78570 4300 5547 gene locus_tag LOCUS_78580 4300 5547 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_78580 5617 6783 gene locus_tag LOCUS_78590 5617 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78590 7841 6822 gene locus_tag LOCUS_78600 7841 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78600 8971 7784 gene locus_tag LOCUS_78610 8971 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78610 9598 9008 gene locus_tag LOCUS_78620 9598 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78620 >Feature sequence427 <1 1902 gene locus_tag LOCUS_78630 <1 1902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 2052 3158 gene locus_tag LOCUS_78640 2052 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78640 3232 4368 gene locus_tag LOCUS_78650 3232 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78650 4390 5127 gene locus_tag LOCUS_78660 4390 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78660 5225 5581 gene locus_tag LOCUS_78670 5225 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78670 5759 6220 gene locus_tag LOCUS_78680 5759 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78680 6353 6736 gene locus_tag LOCUS_78690 6353 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78690 6869 8533 gene locus_tag LOCUS_78700 6869 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78700 8606 9937 gene locus_tag LOCUS_78710 8606 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78710 10204 10458 gene locus_tag LOCUS_78720 10204 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78720 10392 10619 gene locus_tag LOCUS_78730 10392 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78730 >Feature sequence428 <1 1254 gene locus_tag LOCUS_78740 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464264.1:bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein 1629 3443 gene locus_tag LOCUS_78750 1629 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78750 3474 4406 gene locus_tag LOCUS_78760 3474 4406 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_78760 6539 4581 gene locus_tag LOCUS_78770 6539 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78770 6517 6774 gene locus_tag LOCUS_78780 6517 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78780 7666 7091 gene locus_tag LOCUS_78790 7666 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78790 9671 7806 gene locus_tag LOCUS_78800 9671 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78800 10267 9668 gene locus_tag LOCUS_78810 10267 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78810 >Feature sequence429 <1 1001 gene locus_tag LOCUS_78820 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973343.1:altronate dehydratase family protein 977 2128 gene locus_tag LOCUS_78830 977 2128 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_78830 3277 2252 gene locus_tag LOCUS_78840 gene ychF 3277 2252 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_78840 3727 4890 gene locus_tag LOCUS_78850 3727 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78850 4796 5347 gene locus_tag LOCUS_78860 4796 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78860 6772 5339 gene locus_tag LOCUS_78870 gene dnaB 6772 5339 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118493.1 protein_id gnl|my_center|LOCUS_78870 7714 7121 gene locus_tag LOCUS_78880 gene rplI 7714 7121 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_78880 8178 7711 gene locus_tag LOCUS_78890 8178 7711 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_78890 8783 8307 gene locus_tag LOCUS_78900 8783 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78900 9367 8804 gene locus_tag LOCUS_78910 gene pth 9367 8804 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_78910 10032 9400 gene locus_tag LOCUS_78920 10032 9400 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_78920 10572 10213 gene locus_tag LOCUS_78930 10572 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78930 >Feature sequence430 373 2925 gene locus_tag LOCUS_78940 373 2925 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_78940 3139 4017 gene locus_tag LOCUS_78950 3139 4017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_78950 4037 4855 gene locus_tag LOCUS_78960 4037 4855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_78960 4953 6140 gene locus_tag LOCUS_78970 4953 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78970 6612 6187 gene locus_tag LOCUS_78980 6612 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78980 7016 8326 gene locus_tag LOCUS_78990 7016 8326 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329509.1 protein_id gnl|my_center|LOCUS_78990 9948 8386 gene locus_tag LOCUS_79000 9948 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79000 <10670 9991 gene locus_tag LOCUS_79010 <10670 9991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_117213798.1:RICIN domain-containing protein >Feature sequence431 773 594 gene locus_tag LOCUS_79020 773 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79020 969 2282 gene locus_tag LOCUS_79030 969 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79030 2494 3900 gene locus_tag LOCUS_79040 2494 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79040 4242 5564 gene locus_tag LOCUS_79050 4242 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332518.1 protein_id gnl|my_center|LOCUS_79050 5779 6606 gene locus_tag LOCUS_79060 gene ricT 5779 6606 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 protein_id gnl|my_center|LOCUS_79060 6612 7025 gene locus_tag LOCUS_79070 6612 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_79070 7425 9038 gene locus_tag LOCUS_79080 7425 9038 CDS product C25 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260597.1 protein_id gnl|my_center|LOCUS_79080 10619 9330 gene locus_tag LOCUS_79090 10619 9330 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922489.1 protein_id gnl|my_center|LOCUS_79090 >Feature sequence432 627 5549 gene locus_tag LOCUS_79100 627 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79100 5663 9031 gene locus_tag LOCUS_79110 5663 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79110 >Feature sequence433 8700 4963 gene locus_tag LOCUS_79120 8700 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79120 9149 9688 gene locus_tag LOCUS_79130 9149 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79130 9883 9665 gene locus_tag LOCUS_79140 9883 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79140 >Feature sequence434 1539 82 gene locus_tag LOCUS_79150 1539 82 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_79150 3384 1768 gene locus_tag LOCUS_79160 3384 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79160 3651 3890 gene locus_tag LOCUS_79170 3651 3890 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_79170 3902 5770 gene locus_tag LOCUS_79180 3902 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79180 5803 6792 gene locus_tag LOCUS_79190 5803 6792 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_79190 6895 7173 gene locus_tag LOCUS_79200 6895 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79200 7519 7259 gene locus_tag LOCUS_79210 7519 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79210 7882 7523 gene locus_tag LOCUS_79220 7882 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79220 8064 8894 gene locus_tag LOCUS_79230 8064 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79230 8956 9597 gene locus_tag LOCUS_79240 8956 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79240 10567 10055 gene locus_tag LOCUS_79250 10567 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79250 >Feature sequence435 <1 683 gene locus_tag LOCUS_79260 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119310.1:AGE family epimerase/isomerase 2001 823 gene locus_tag LOCUS_79270 2001 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79270 3527 2064 gene locus_tag LOCUS_79280 3527 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79280 4264 3560 gene locus_tag LOCUS_79290 4264 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79290 4684 5562 gene locus_tag LOCUS_79300 4684 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79300 5820 5993 gene locus_tag LOCUS_79310 5820 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79310 6386 7315 gene locus_tag LOCUS_79320 6386 7315 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 protein_id gnl|my_center|LOCUS_79320 10174 7382 gene locus_tag LOCUS_79330 10174 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616081.1 protein_id gnl|my_center|LOCUS_79330 >Feature sequence436 3062 1572 gene locus_tag LOCUS_79340 3062 1572 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108647.1 protein_id gnl|my_center|LOCUS_79340 4452 3373 gene locus_tag LOCUS_79350 4452 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79350 5463 4489 gene locus_tag LOCUS_79360 5463 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79360 6878 5460 gene locus_tag LOCUS_79370 6878 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79370 7270 6881 gene locus_tag LOCUS_79380 7270 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79380 9474 7876 gene locus_tag LOCUS_79390 9474 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79390 10172 9471 gene locus_tag LOCUS_79400 10172 9471 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615971.1 protein_id gnl|my_center|LOCUS_79400 >Feature sequence437 1451 225 gene locus_tag LOCUS_79410 1451 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79410 1863 3053 gene locus_tag LOCUS_79420 1863 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79420 3055 4485 gene locus_tag LOCUS_79430 3055 4485 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_79430 5830 4562 gene locus_tag LOCUS_79440 5830 4562 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_79440 6064 7533 gene locus_tag LOCUS_79450 6064 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79450 7530 9017 gene locus_tag LOCUS_79460 7530 9017 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_79460 >Feature sequence438 610 3369 gene locus_tag LOCUS_79470 gene gyrA 610 3369 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_79470 4304 3456 gene locus_tag LOCUS_79480 4304 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79480 4548 4366 gene locus_tag LOCUS_79490 4548 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79490 4583 5815 gene locus_tag LOCUS_79500 4583 5815 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_79500 5970 6956 gene locus_tag LOCUS_79510 5970 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79510 <10388 6985 gene locus_tag LOCUS_79520 <10388 6985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616086.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence439 115 1356 gene locus_tag LOCUS_79530 115 1356 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_79530 1377 2531 gene locus_tag LOCUS_79540 1377 2531 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_79540 4353 2683 gene locus_tag LOCUS_79550 4353 2683 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_79550 4694 4350 gene locus_tag LOCUS_79560 4694 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79560 5765 4758 gene locus_tag LOCUS_79570 5765 4758 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 protein_id gnl|my_center|LOCUS_79570 7269 5779 gene locus_tag LOCUS_79580 7269 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79580 10251 7309 gene locus_tag LOCUS_79590 10251 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79590 >Feature sequence440 126 545 gene locus_tag LOCUS_79600 126 545 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877569.1 protein_id gnl|my_center|LOCUS_79600 1438 5385 gene locus_tag LOCUS_79610 1438 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79610 6735 5548 gene locus_tag LOCUS_79620 6735 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79620 >Feature sequence441 333 121 gene locus_tag LOCUS_79630 333 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79630 1430 525 gene locus_tag LOCUS_79640 1430 525 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258066.1 protein_id gnl|my_center|LOCUS_79640 2833 1442 gene locus_tag LOCUS_79650 2833 1442 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_79650 4292 2958 gene locus_tag LOCUS_79660 4292 2958 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_79660 6162 4306 gene locus_tag LOCUS_79670 6162 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79670 6574 9279 gene locus_tag LOCUS_79680 6574 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79680 >Feature sequence442 3463 236 gene locus_tag LOCUS_79690 3463 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79690 3899 4933 gene locus_tag LOCUS_79700 3899 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79700 7432 5003 gene locus_tag LOCUS_79710 7432 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79710 9198 7507 gene locus_tag LOCUS_79720 9198 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79720 <10288 9287 gene locus_tag LOCUS_79730 <10288 9287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122824.1:SLC13 family permease >Feature sequence443 597 25 gene locus_tag LOCUS_79740 597 25 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947306.1 protein_id gnl|my_center|LOCUS_79740 2573 642 gene locus_tag LOCUS_79750 2573 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79750 3940 2570 gene locus_tag LOCUS_79760 3940 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79760 5835 3937 gene locus_tag LOCUS_79770 5835 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79770 6666 5860 gene locus_tag LOCUS_79780 6666 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79780 7425 6745 gene locus_tag LOCUS_79790 7425 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79790 9901 7532 gene locus_tag LOCUS_79800 9901 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79800 >Feature sequence444 3486 2911 gene locus_tag LOCUS_79810 3486 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79810 6849 3559 gene locus_tag LOCUS_79820 6849 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79820 7456 7172 gene locus_tag LOCUS_79830 7456 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79830 10220 7545 gene locus_tag LOCUS_79840 10220 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79840 >Feature sequence445 770 507 gene locus_tag LOCUS_79850 770 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79850 1133 882 gene locus_tag LOCUS_79860 1133 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146535257.1 protein_id gnl|my_center|LOCUS_79860 1534 1310 gene locus_tag LOCUS_79870 1534 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79870 3069 1597 gene locus_tag LOCUS_79880 3069 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79880 3844 3239 gene locus_tag LOCUS_79890 3844 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79890 4124 3942 gene locus_tag LOCUS_79900 4124 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79900 4449 4090 gene locus_tag LOCUS_79910 4449 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79910 6105 4456 gene locus_tag LOCUS_79920 6105 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79920 6677 6102 gene locus_tag LOCUS_79930 6677 6102 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_79930 6944 7429 gene locus_tag LOCUS_79940 6944 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79940 7438 8742 gene locus_tag LOCUS_79950 7438 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79950 9114 8887 gene locus_tag LOCUS_79960 9114 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79960 >Feature sequence446 30 104 gene locus_tag LOCUS_t00480 30 104 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 640 65 gene locus_tag LOCUS_79970 640 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79970 1634 777 gene locus_tag LOCUS_79980 1634 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79980 1879 4071 gene locus_tag LOCUS_79990 1879 4071 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921918.1 protein_id gnl|my_center|LOCUS_79990 4248 4874 gene locus_tag LOCUS_80000 4248 4874 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_80000 5110 6384 gene locus_tag LOCUS_80010 5110 6384 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_80010 7826 6516 gene locus_tag LOCUS_80020 7826 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328143.1 protein_id gnl|my_center|LOCUS_80020 8324 9220 gene locus_tag LOCUS_80030 8324 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923059.1 protein_id gnl|my_center|LOCUS_80030 >Feature sequence447 411 1943 gene locus_tag LOCUS_80040 411 1943 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_80040 2438 3433 gene locus_tag LOCUS_80050 2438 3433 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122130.1 protein_id gnl|my_center|LOCUS_80050 3563 3952 gene locus_tag LOCUS_80060 3563 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80060 3979 5826 gene locus_tag LOCUS_80070 3979 5826 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_80070 5835 6863 gene locus_tag LOCUS_80080 5835 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80080 6972 8099 gene locus_tag LOCUS_80090 6972 8099 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333030.1 protein_id gnl|my_center|LOCUS_80090 8255 9952 gene locus_tag LOCUS_80100 8255 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80100 >Feature sequence448 1993 440 gene locus_tag LOCUS_80110 1993 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80110 3781 2249 gene locus_tag LOCUS_80120 3781 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80120 4335 3904 gene locus_tag LOCUS_80130 4335 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80130 4653 4504 gene locus_tag LOCUS_80140 4653 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80140 4857 6188 gene locus_tag LOCUS_80150 4857 6188 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_80150 7641 6457 gene locus_tag LOCUS_80160 7641 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80160 9989 7932 gene locus_tag LOCUS_80170 9989 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80170 >Feature sequence449 2106 1441 gene locus_tag LOCUS_80180 2106 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80180 2319 3671 gene locus_tag LOCUS_80190 2319 3671 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_80190 4726 3803 gene locus_tag LOCUS_80200 4726 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80200 5256 8132 gene locus_tag LOCUS_80210 5256 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80210 8178 9416 gene locus_tag LOCUS_80220 8178 9416 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_80220 >Feature sequence450 277 1728 gene locus_tag LOCUS_80230 277 1728 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_80230 1847 2533 gene locus_tag LOCUS_80240 1847 2533 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_80240 2660 3955 gene locus_tag LOCUS_80250 2660 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80250 9091 4952 gene locus_tag LOCUS_80260 9091 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80260 9516 9103 gene locus_tag LOCUS_80270 9516 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80270