>Feature sequence01 1793 1632 gene locus_tag LOCUS_00010 1793 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2258 1818 gene locus_tag LOCUS_00020 2258 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2610 3167 gene locus_tag LOCUS_00030 2610 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4644 3322 gene locus_tag LOCUS_00040 4644 3322 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_00040 6030 4843 gene locus_tag LOCUS_00050 6030 4843 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989837.1 protein_id gnl|my_center|LOCUS_00050 7013 6039 gene locus_tag LOCUS_00060 7013 6039 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_00060 8117 7110 gene locus_tag LOCUS_00070 8117 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8358 9338 gene locus_tag LOCUS_00080 8358 9338 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_00080 10131 9562 gene locus_tag LOCUS_00090 10131 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10463 11227 gene locus_tag LOCUS_00100 10463 11227 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 protein_id gnl|my_center|LOCUS_00100 12026 11427 gene locus_tag LOCUS_00110 12026 11427 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_00110 13436 12249 gene locus_tag LOCUS_00120 13436 12249 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_00120 13547 14467 gene locus_tag LOCUS_00130 gene fabD 13547 14467 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172505.1 protein_id gnl|my_center|LOCUS_00130 14534 15832 gene locus_tag LOCUS_00140 14534 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16936 16154 gene locus_tag LOCUS_00150 16936 16154 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_00150 18102 16999 gene locus_tag LOCUS_00160 18102 16999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18737 18099 gene locus_tag LOCUS_00170 18737 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20179 18737 gene locus_tag LOCUS_00180 20179 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20687 20166 gene locus_tag LOCUS_00190 20687 20166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20994 22901 gene locus_tag LOCUS_00200 20994 22901 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_00200 24824 23010 gene locus_tag LOCUS_00210 gene thrS 24824 23010 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_00210 26167 24977 gene locus_tag LOCUS_00220 26167 24977 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_00220 27056 26184 gene locus_tag LOCUS_00230 27056 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27208 27789 gene locus_tag LOCUS_00240 27208 27789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27779 28138 gene locus_tag LOCUS_00250 27779 28138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28158 29060 gene locus_tag LOCUS_00260 28158 29060 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920841.1 protein_id gnl|my_center|LOCUS_00260 30941 29259 gene locus_tag LOCUS_00270 gene ettA 30941 29259 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_00270 31766 31005 gene locus_tag LOCUS_00280 31766 31005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31866 33305 gene locus_tag LOCUS_00290 31866 33305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34843 33302 gene locus_tag LOCUS_00300 34843 33302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35544 34900 gene locus_tag LOCUS_00310 gene can 35544 34900 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_00310 36253 35621 gene locus_tag LOCUS_00320 36253 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36310 37410 gene locus_tag LOCUS_00330 36310 37410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37410 39746 gene locus_tag LOCUS_00340 37410 39746 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892265.1 protein_id gnl|my_center|LOCUS_00340 39721 41277 gene locus_tag LOCUS_00350 39721 41277 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_00350 42531 41635 gene locus_tag LOCUS_00360 gene metF 42531 41635 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_00360 43244 42708 gene locus_tag LOCUS_00370 43244 42708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43442 45418 gene locus_tag LOCUS_00380 43442 45418 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_00380 45431 46357 gene locus_tag LOCUS_00390 45431 46357 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_00390 46383 47135 gene locus_tag LOCUS_00400 46383 47135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47128 47874 gene locus_tag LOCUS_00410 47128 47874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_00410 47874 49580 gene locus_tag LOCUS_00420 47874 49580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49936 49577 gene locus_tag LOCUS_00430 49936 49577 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_00430 50264 49962 gene locus_tag LOCUS_00440 50264 49962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51726 50584 gene locus_tag LOCUS_00450 51726 50584 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_00450 52199 52960 gene locus_tag LOCUS_00460 52199 52960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 52939 53697 gene locus_tag LOCUS_00470 52939 53697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53820 54095 gene locus_tag LOCUS_00480 53820 54095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54293 54673 gene locus_tag LOCUS_00490 54293 54673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54735 55667 gene locus_tag LOCUS_00500 gene fabK 54735 55667 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080864.1 protein_id gnl|my_center|LOCUS_00500 56091 55870 gene locus_tag LOCUS_00510 56091 55870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57773 56568 gene locus_tag LOCUS_00520 gene zigA 57773 56568 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_00520 57921 58301 gene locus_tag LOCUS_00530 57921 58301 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444125.1 protein_id gnl|my_center|LOCUS_00530 59222 58572 gene locus_tag LOCUS_00540 59222 58572 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965238.1 protein_id gnl|my_center|LOCUS_00540 60082 59219 gene locus_tag LOCUS_00550 60082 59219 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860744.1 protein_id gnl|my_center|LOCUS_00550 60351 60602 gene locus_tag LOCUS_00560 60351 60602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 61320 62039 gene locus_tag LOCUS_00570 61320 62039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63009 62107 gene locus_tag LOCUS_00580 63009 62107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 63151 64785 gene locus_tag LOCUS_00590 63151 64785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 65345 64881 gene locus_tag LOCUS_00600 65345 64881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 66726 65536 gene locus_tag LOCUS_00610 66726 65536 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_00610 67925 66870 gene locus_tag LOCUS_00620 gene tdh 67925 66870 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422510.1 protein_id gnl|my_center|LOCUS_00620 68518 67952 gene locus_tag LOCUS_00630 68518 67952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 68640 69527 gene locus_tag LOCUS_00640 68640 69527 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_00640 69533 69982 gene locus_tag LOCUS_00650 69533 69982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 69983 70741 gene locus_tag LOCUS_00660 69983 70741 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_00660 70738 71211 gene locus_tag LOCUS_00670 70738 71211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71280 72989 gene locus_tag LOCUS_00680 71280 72989 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882976.1 protein_id gnl|my_center|LOCUS_00680 73005 73790 gene locus_tag LOCUS_00690 73005 73790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_00690 73793 74596 gene locus_tag LOCUS_00700 73793 74596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143324.1 protein_id gnl|my_center|LOCUS_00700 74956 78480 gene locus_tag LOCUS_00710 74956 78480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 79595 80167 gene locus_tag LOCUS_00720 79595 80167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 81341 80172 gene locus_tag LOCUS_00730 81341 80172 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404076.1 protein_id gnl|my_center|LOCUS_00730 81530 81345 gene locus_tag LOCUS_00740 81530 81345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 82757 81549 gene locus_tag LOCUS_00750 gene icd 82757 81549 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_00750 84497 82800 gene locus_tag LOCUS_00760 84497 82800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 86165 84501 gene locus_tag LOCUS_00770 86165 84501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 86911 87693 gene locus_tag LOCUS_00780 86911 87693 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_00780 87674 88585 gene locus_tag LOCUS_00790 87674 88585 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_00790 88680 89498 gene locus_tag LOCUS_00800 88680 89498 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082783.1 protein_id gnl|my_center|LOCUS_00800 90547 89552 gene locus_tag LOCUS_00810 90547 89552 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_00810 91365 90847 gene locus_tag LOCUS_00820 91365 90847 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_00820 91520 92191 gene locus_tag LOCUS_00830 91520 92191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 92234 92926 gene locus_tag LOCUS_00840 92234 92926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 93088 93924 gene locus_tag LOCUS_00850 93088 93924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 93964 95007 gene locus_tag LOCUS_00860 93964 95007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 95039 96106 gene locus_tag LOCUS_00870 95039 96106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_00870 96222 96926 gene locus_tag LOCUS_00880 96222 96926 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189846505.1 protein_id gnl|my_center|LOCUS_00880 97035 97754 gene locus_tag LOCUS_00890 97035 97754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 97906 98190 gene locus_tag LOCUS_00900 97906 98190 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_00900 98195 98458 gene locus_tag LOCUS_00910 98195 98458 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_00910 98518 99261 gene locus_tag LOCUS_00920 98518 99261 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_00920 99373 99765 gene locus_tag LOCUS_00930 99373 99765 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_00930 99871 100437 gene locus_tag LOCUS_00940 99871 100437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100912 101256 gene locus_tag LOCUS_00950 100912 101256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 101377 101814 gene locus_tag LOCUS_00960 101377 101814 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028406.1 protein_id gnl|my_center|LOCUS_00960 101928 102620 gene locus_tag LOCUS_00970 101928 102620 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948196.1 protein_id gnl|my_center|LOCUS_00970 102654 103475 gene locus_tag LOCUS_00980 102654 103475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 104017 103802 gene locus_tag LOCUS_00990 104017 103802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 104122 105021 gene locus_tag LOCUS_01000 104122 105021 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898106.1 protein_id gnl|my_center|LOCUS_01000 105872 106306 gene locus_tag LOCUS_01010 105872 106306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106344 107510 gene locus_tag LOCUS_01020 106344 107510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 107620 107916 gene locus_tag LOCUS_01030 107620 107916 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 protein_id gnl|my_center|LOCUS_01030 107849 108181 gene locus_tag LOCUS_01040 107849 108181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 108178 108405 gene locus_tag LOCUS_01050 108178 108405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 108692 111136 gene locus_tag LOCUS_01060 gene thrA 108692 111136 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_01060 111133 112077 gene locus_tag LOCUS_01070 111133 112077 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_01070 112074 113360 gene locus_tag LOCUS_01080 gene thrC 112074 113360 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_01080 113870 113424 gene locus_tag LOCUS_01090 113870 113424 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_01090 113934 114425 gene locus_tag LOCUS_01100 gene ribE 113934 114425 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021372.1 protein_id gnl|my_center|LOCUS_01100 114522 115796 gene locus_tag LOCUS_01110 114522 115796 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_01110 115828 116295 gene locus_tag LOCUS_01120 115828 116295 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_01120 116468 117343 gene locus_tag LOCUS_01130 116468 117343 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_01130 117321 117656 gene locus_tag LOCUS_01140 117321 117656 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976375.1 protein_id gnl|my_center|LOCUS_01140 117784 119352 gene locus_tag LOCUS_01150 117784 119352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 119437 120387 gene locus_tag LOCUS_01160 gene paaA 119437 120387 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_01160 120456 120737 gene locus_tag LOCUS_01170 gene paaB 120456 120737 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069460051.1 protein_id gnl|my_center|LOCUS_01170 120730 121494 gene locus_tag LOCUS_01180 gene paaC 120730 121494 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_01180 121488 121976 gene locus_tag LOCUS_01190 gene paaJ 121488 121976 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_01190 122205 122369 gene locus_tag LOCUS_01200 122205 122369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 123706 123341 gene locus_tag LOCUS_01210 123706 123341 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197194.1 protein_id gnl|my_center|LOCUS_01210 125006 123834 gene locus_tag LOCUS_01220 125006 123834 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243544.1 protein_id gnl|my_center|LOCUS_01220 127091 125016 gene locus_tag LOCUS_01230 127091 125016 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396305.1 protein_id gnl|my_center|LOCUS_01230 127188 127979 gene locus_tag LOCUS_01240 gene paaG 127188 127979 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_01240 128028 129200 gene locus_tag LOCUS_01250 128028 129200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 129348 129812 gene locus_tag LOCUS_01260 129348 129812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 129809 130201 gene locus_tag LOCUS_01270 129809 130201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 130204 131103 gene locus_tag LOCUS_01280 130204 131103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 131105 132955 gene locus_tag LOCUS_01290 131105 132955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 132988 133242 gene locus_tag LOCUS_01300 132988 133242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 133406 134605 gene locus_tag LOCUS_01310 gene paaJ 133406 134605 CDS product bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206197.1 protein_id gnl|my_center|LOCUS_01310 134609 135211 gene locus_tag LOCUS_01320 gene paaY 134609 135211 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_01320 135327 137348 gene locus_tag LOCUS_01330 gene paaZ 135327 137348 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399720.1 protein_id gnl|my_center|LOCUS_01330 137962 137501 gene locus_tag LOCUS_01340 137962 137501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 138386 139699 gene locus_tag LOCUS_01350 gene bioA 138386 139699 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_01350 139838 140269 gene locus_tag LOCUS_01360 139838 140269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 140762 141583 gene locus_tag LOCUS_01370 140762 141583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 141590 142522 gene locus_tag LOCUS_01380 141590 142522 CDS product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875246.1 protein_id gnl|my_center|LOCUS_01380 142515 143243 gene locus_tag LOCUS_01390 142515 143243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 143245 143535 gene locus_tag LOCUS_01400 143245 143535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 143547 143828 gene locus_tag LOCUS_01410 143547 143828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 143889 144161 gene locus_tag LOCUS_01420 143889 144161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 144254 146278 gene locus_tag LOCUS_01430 gene bcrD 144254 146278 CDS product SctV family type III secretion system export apparatus subunit BcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039314.1 protein_id gnl|my_center|LOCUS_01430 146275 146844 gene locus_tag LOCUS_01440 146275 146844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 146960 147250 gene locus_tag LOCUS_01450 146960 147250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 147263 147922 gene locus_tag LOCUS_01460 147263 147922 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661712.1 protein_id gnl|my_center|LOCUS_01460 148885 148142 gene locus_tag LOCUS_01470 148885 148142 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057528.1 protein_id gnl|my_center|LOCUS_01470 149976 148891 gene locus_tag LOCUS_01480 gene serC 149976 148891 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_01480 151190 149979 gene locus_tag LOCUS_01490 151190 149979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 152559 151330 gene locus_tag LOCUS_01500 152559 151330 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421517.1 protein_id gnl|my_center|LOCUS_01500 153491 152550 gene locus_tag LOCUS_01510 153491 152550 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614495.1 protein_id gnl|my_center|LOCUS_01510 153592 154959 gene locus_tag LOCUS_01520 153592 154959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965625.1 protein_id gnl|my_center|LOCUS_01520 154968 155747 gene locus_tag LOCUS_01530 154968 155747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_01530 155813 156937 gene locus_tag LOCUS_01540 155813 156937 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_01540 156930 158135 gene locus_tag LOCUS_01550 156930 158135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 158167 160188 gene locus_tag LOCUS_01560 158167 160188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 160252 161343 gene locus_tag LOCUS_01570 gene ychF 160252 161343 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071416.1 protein_id gnl|my_center|LOCUS_01570 161763 161981 gene locus_tag LOCUS_01580 161763 161981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 162296 163243 gene locus_tag LOCUS_01590 gene meaB 162296 163243 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_01590 163256 164407 gene locus_tag LOCUS_01600 163256 164407 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524568.1 protein_id gnl|my_center|LOCUS_01600 166191 164404 gene locus_tag LOCUS_01610 166191 164404 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_01610 166791 166210 gene locus_tag LOCUS_01620 166791 166210 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_01620 168718 166823 gene locus_tag LOCUS_01630 168718 166823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 168982 170364 gene locus_tag LOCUS_01640 168982 170364 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070251.1 protein_id gnl|my_center|LOCUS_01640 171430 170339 gene locus_tag LOCUS_01650 171430 170339 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225727.1 protein_id gnl|my_center|LOCUS_01650 171768 171439 gene locus_tag LOCUS_01660 171768 171439 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232998.1 protein_id gnl|my_center|LOCUS_01660 172330 171758 gene locus_tag LOCUS_01670 172330 171758 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_01670 172994 172497 gene locus_tag LOCUS_01680 172994 172497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 173711 173139 gene locus_tag LOCUS_01690 173711 173139 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_01690 175000 173816 gene locus_tag LOCUS_01700 gene purT 175000 173816 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_01700 177252 175012 gene locus_tag LOCUS_01710 177252 175012 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_01710 177368 178600 gene locus_tag LOCUS_01720 177368 178600 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_01720 178597 180804 gene locus_tag LOCUS_01730 178597 180804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 180905 182266 gene locus_tag LOCUS_01740 180905 182266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 182738 182250 gene locus_tag LOCUS_01750 182738 182250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 182883 182719 gene locus_tag LOCUS_01760 182883 182719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 183533 182880 gene locus_tag LOCUS_01770 183533 182880 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658321.1 protein_id gnl|my_center|LOCUS_01770 184561 183551 gene locus_tag LOCUS_01780 184561 183551 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_01780 185146 184568 gene locus_tag LOCUS_01790 185146 184568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 185583 186137 gene locus_tag LOCUS_01800 185583 186137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 187533 186391 gene locus_tag LOCUS_01810 187533 186391 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_01810 189037 187514 gene locus_tag LOCUS_01820 189037 187514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 191088 189160 gene locus_tag LOCUS_01830 191088 189160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 191648 192004 gene locus_tag LOCUS_01840 191648 192004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 192241 192873 gene locus_tag LOCUS_01850 192241 192873 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_01850 193643 192990 gene locus_tag LOCUS_01860 193643 192990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 194317 193694 gene locus_tag LOCUS_01870 gene pdxT 194317 193694 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081494.1 protein_id gnl|my_center|LOCUS_01870 195208 194327 gene locus_tag LOCUS_01880 gene pdxS 195208 194327 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_01880 195420 196133 gene locus_tag LOCUS_01890 195420 196133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 196149 196883 gene locus_tag LOCUS_01900 196149 196883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_01900 196934 198862 gene locus_tag LOCUS_01910 196934 198862 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_01910 198880 200118 gene locus_tag LOCUS_01920 198880 200118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 200203 200679 gene locus_tag LOCUS_01930 200203 200679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 200848 201282 gene locus_tag LOCUS_01940 200848 201282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 203810 201297 gene locus_tag LOCUS_01950 203810 201297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 203867 205171 gene locus_tag LOCUS_01960 203867 205171 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_01960 205177 206730 gene locus_tag LOCUS_01970 205177 206730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 207045 207887 gene locus_tag LOCUS_01980 207045 207887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 207942 211238 gene locus_tag LOCUS_01990 207942 211238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 211235 213805 gene locus_tag LOCUS_02000 211235 213805 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_02000 214046 214372 gene locus_tag LOCUS_02010 gene trxA 214046 214372 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_02010 214387 214587 gene locus_tag LOCUS_02020 gene thiS 214387 214587 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_02020 214667 215449 gene locus_tag LOCUS_02030 214667 215449 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_02030 215457 216056 gene locus_tag LOCUS_02040 gene thiE 215457 216056 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_02040 216068 217159 gene locus_tag LOCUS_02050 216068 217159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_02050 217473 217204 gene locus_tag LOCUS_02060 gene rpsT 217473 217204 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_02060 219404 217572 gene locus_tag LOCUS_02070 219404 217572 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 protein_id gnl|my_center|LOCUS_02070 220223 219411 gene locus_tag LOCUS_02080 gene mazG 220223 219411 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_02080 221944 220724 gene locus_tag LOCUS_02090 221944 220724 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400837.1 protein_id gnl|my_center|LOCUS_02090 223058 221976 gene locus_tag LOCUS_02100 gene tapT 223058 221976 CDS product type IVa pilus ATPase TapT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707389.1 protein_id gnl|my_center|LOCUS_02100 223606 224121 gene locus_tag LOCUS_02110 gene tpx 223606 224121 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_02110 224151 227687 gene locus_tag LOCUS_02120 gene mfd 224151 227687 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_02120 227811 228818 gene locus_tag LOCUS_02130 227811 228818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 228818 230227 gene locus_tag LOCUS_02140 228818 230227 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_02140 230316 232058 gene locus_tag LOCUS_02150 230316 232058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 232300 232106 gene locus_tag LOCUS_02160 232300 232106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 232540 233202 gene locus_tag LOCUS_02170 232540 233202 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913210.1 protein_id gnl|my_center|LOCUS_02170 233860 233267 gene locus_tag LOCUS_02180 233860 233267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 234117 234611 gene locus_tag LOCUS_02190 234117 234611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 234891 235340 gene locus_tag LOCUS_02200 234891 235340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 235337 235714 gene locus_tag LOCUS_02210 235337 235714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 236888 235926 gene locus_tag LOCUS_02220 236888 235926 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055164393.1 protein_id gnl|my_center|LOCUS_02220 237039 237701 gene locus_tag LOCUS_02230 237039 237701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 238018 237788 gene locus_tag LOCUS_02240 238018 237788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 237900 239066 gene locus_tag LOCUS_02250 237900 239066 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_02250 239059 240381 gene locus_tag LOCUS_02260 239059 240381 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003543.1 protein_id gnl|my_center|LOCUS_02260 241060 240422 gene locus_tag LOCUS_02270 241060 240422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 242508 241543 gene locus_tag LOCUS_02280 242508 241543 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_02280 242861 243754 gene locus_tag LOCUS_02290 242861 243754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 245013 243949 gene locus_tag LOCUS_02300 245013 243949 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_02300 245382 245588 gene locus_tag LOCUS_02310 245382 245588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 245662 246795 gene locus_tag LOCUS_02320 245662 246795 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_02320 246955 247380 gene locus_tag LOCUS_02330 246955 247380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 248501 247524 gene locus_tag LOCUS_02340 248501 247524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 248530 248724 gene locus_tag LOCUS_02350 248530 248724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 249986 248781 gene locus_tag LOCUS_02360 249986 248781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 250210 251481 gene locus_tag LOCUS_02370 gene gdhA 250210 251481 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_02370 251450 252310 gene locus_tag LOCUS_02380 gene rlmB 251450 252310 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_02380 252439 253443 gene locus_tag LOCUS_02390 gene trpS 252439 253443 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_02390 254044 255654 gene locus_tag LOCUS_02400 254044 255654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 255768 256670 gene locus_tag LOCUS_02410 gene scpA 255768 256670 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_02410 256683 257333 gene locus_tag LOCUS_02420 gene scpB 256683 257333 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_02420 257436 262433 gene locus_tag LOCUS_02430 257436 262433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 262764 263264 gene locus_tag LOCUS_02440 gene folK 262764 263264 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_02440 265692 263224 gene locus_tag LOCUS_02450 265692 263224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 266519 266286 gene locus_tag LOCUS_02460 266519 266286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 267604 266786 gene locus_tag LOCUS_02470 gene folP 267604 266786 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_02470 268271 267594 gene locus_tag LOCUS_02480 268271 267594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 268384 269658 gene locus_tag LOCUS_02490 268384 269658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 270016 269660 gene locus_tag LOCUS_02500 270016 269660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 270717 270004 gene locus_tag LOCUS_02510 270717 270004 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763646.1 protein_id gnl|my_center|LOCUS_02510 271238 270702 gene locus_tag LOCUS_02520 271238 270702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 271816 271238 gene locus_tag LOCUS_02530 271816 271238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 272361 271813 gene locus_tag LOCUS_02540 272361 271813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 272878 272354 gene locus_tag LOCUS_02550 272878 272354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 273202 272885 gene locus_tag LOCUS_02560 273202 272885 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668966.1 protein_id gnl|my_center|LOCUS_02560 273912 273214 gene locus_tag LOCUS_02570 273912 273214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 274063 274371 gene locus_tag LOCUS_02580 274063 274371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 274390 275151 gene locus_tag LOCUS_02590 274390 275151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 276213 275179 gene locus_tag LOCUS_02600 276213 275179 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_02600 276642 276568 gene locus_tag LOCUS_t00010 276642 276568 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 276875 276791 gene locus_tag LOCUS_t00020 276875 276791 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 277181 277106 gene locus_tag LOCUS_t00030 277181 277106 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 277363 277291 gene locus_tag LOCUS_t00040 277363 277291 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 277563 278255 gene locus_tag LOCUS_02610 277563 278255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 279356 278946 gene locus_tag LOCUS_02620 279356 278946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 279674 279375 gene locus_tag LOCUS_02630 279674 279375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 279861 281897 gene locus_tag LOCUS_02640 279861 281897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 282577 281894 gene locus_tag LOCUS_02650 282577 281894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 282758 283666 gene locus_tag LOCUS_02660 282758 283666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 284271 283657 gene locus_tag LOCUS_02670 284271 283657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 285914 284277 gene locus_tag LOCUS_02680 285914 284277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 285970 287673 gene locus_tag LOCUS_02690 285970 287673 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_02690 287687 289372 gene locus_tag LOCUS_02700 287687 289372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 289372 290061 gene locus_tag LOCUS_02710 289372 290061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 290214 290885 gene locus_tag LOCUS_02720 290214 290885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 292098 291838 gene locus_tag LOCUS_02730 292098 291838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 292321 292085 gene locus_tag LOCUS_02740 292321 292085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 292218 294323 gene locus_tag LOCUS_02750 292218 294323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence02 128 2563 gene locus_tag LOCUS_02760 128 2563 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_02760 2781 3113 gene locus_tag LOCUS_02770 2781 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4837 3569 gene locus_tag LOCUS_02780 4837 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5722 5934 gene locus_tag LOCUS_02790 5722 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 6181 6666 gene locus_tag LOCUS_02800 6181 6666 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_02800 6663 7160 gene locus_tag LOCUS_02810 6663 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7349 8683 gene locus_tag LOCUS_02820 7349 8683 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262994.1 protein_id gnl|my_center|LOCUS_02820 9146 9829 gene locus_tag LOCUS_02830 9146 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9975 10802 gene locus_tag LOCUS_02840 9975 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 10807 11577 gene locus_tag LOCUS_02850 10807 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 11645 13729 gene locus_tag LOCUS_02860 gene ppk1 11645 13729 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_02860 14983 13778 gene locus_tag LOCUS_02870 14983 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 16807 15290 gene locus_tag LOCUS_02880 16807 15290 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_02880 16874 18064 gene locus_tag LOCUS_02890 16874 18064 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_02890 18070 19266 gene locus_tag LOCUS_02900 18070 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 19662 19333 gene locus_tag LOCUS_02910 19662 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 19862 19710 gene locus_tag LOCUS_02920 gene rpmG 19862 19710 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_02920 20018 20737 gene locus_tag LOCUS_02930 20018 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 20737 22674 gene locus_tag LOCUS_02940 gene nadE 20737 22674 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_02940 22782 24128 gene locus_tag LOCUS_02950 22782 24128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 24152 25474 gene locus_tag LOCUS_02960 24152 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 26382 25429 gene locus_tag LOCUS_02970 26382 25429 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726985.1 protein_id gnl|my_center|LOCUS_02970 26436 26711 gene locus_tag LOCUS_02980 26436 26711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 26708 27691 gene locus_tag LOCUS_02990 26708 27691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726985.1 protein_id gnl|my_center|LOCUS_02990 27693 28373 gene locus_tag LOCUS_03000 27693 28373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967174.1 protein_id gnl|my_center|LOCUS_03000 28391 29110 gene locus_tag LOCUS_03010 28391 29110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 30063 29185 gene locus_tag LOCUS_03020 30063 29185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 31042 30380 gene locus_tag LOCUS_03030 gene aat 31042 30380 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_03030 31133 32284 gene locus_tag LOCUS_03040 31133 32284 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_03040 32393 38566 gene locus_tag LOCUS_03050 32393 38566 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_03050 38571 39392 gene locus_tag LOCUS_03060 38571 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 39835 39647 gene locus_tag LOCUS_03070 39835 39647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 41007 40246 gene locus_tag LOCUS_03080 41007 40246 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525218.1 protein_id gnl|my_center|LOCUS_03080 42345 41035 gene locus_tag LOCUS_03090 gene purD 42345 41035 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485333.1 protein_id gnl|my_center|LOCUS_03090 42455 50599 gene locus_tag LOCUS_03100 42455 50599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 50728 51339 gene locus_tag LOCUS_03110 50728 51339 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393261.1 protein_id gnl|my_center|LOCUS_03110 51654 53042 gene locus_tag LOCUS_03120 51654 53042 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_03120 53258 53608 gene locus_tag LOCUS_03130 53258 53608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 53852 54196 gene locus_tag LOCUS_03140 53852 54196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 56482 54563 gene locus_tag LOCUS_03150 56482 54563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 56885 57259 gene locus_tag LOCUS_03160 56885 57259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 57277 57891 gene locus_tag LOCUS_03170 57277 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 57938 59062 gene locus_tag LOCUS_03180 gene nhaA 57938 59062 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918338.1 protein_id gnl|my_center|LOCUS_03180 59690 59154 gene locus_tag LOCUS_03190 59690 59154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 59900 61444 gene locus_tag LOCUS_03200 59900 61444 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227856.1 protein_id gnl|my_center|LOCUS_03200 62392 61700 gene locus_tag LOCUS_03210 gene kdpE 62392 61700 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_03210 64919 62376 gene locus_tag LOCUS_03220 64919 62376 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_03220 65985 64948 gene locus_tag LOCUS_03230 65985 64948 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_03230 66536 65982 gene locus_tag LOCUS_03240 gene kdpC 66536 65982 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_03240 68579 66543 gene locus_tag LOCUS_03250 gene kdpB 68579 66543 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_03250 70068 68590 gene locus_tag LOCUS_03260 gene kdpA 70068 68590 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730077.1 protein_id gnl|my_center|LOCUS_03260 71125 70767 gene locus_tag LOCUS_tm00010 71125 70767 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 71495 72727 gene locus_tag LOCUS_03270 71495 72727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 73562 72870 gene locus_tag LOCUS_03280 73562 72870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 74657 73815 gene locus_tag LOCUS_03290 74657 73815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 74777 75346 gene locus_tag LOCUS_03300 74777 75346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 77205 75373 gene locus_tag LOCUS_03310 77205 75373 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_03310 77440 77237 gene locus_tag LOCUS_03320 77440 77237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 77563 77862 gene locus_tag LOCUS_03330 77563 77862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 78299 77949 gene locus_tag LOCUS_03340 78299 77949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 81341 78309 gene locus_tag LOCUS_03350 81341 78309 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_03350 82484 81357 gene locus_tag LOCUS_03360 82484 81357 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_03360 82543 83919 gene locus_tag LOCUS_03370 82543 83919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 83943 84263 gene locus_tag LOCUS_03380 83943 84263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 84365 85399 gene locus_tag LOCUS_03390 84365 85399 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_03390 85572 86453 gene locus_tag LOCUS_03400 gene mreC 85572 86453 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_03400 86457 86987 gene locus_tag LOCUS_03410 86457 86987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 86984 88867 gene locus_tag LOCUS_03420 gene mrdA 86984 88867 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_03420 88870 89988 gene locus_tag LOCUS_03430 gene rodA 88870 89988 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_03430 90867 90265 gene locus_tag LOCUS_03440 90867 90265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 91265 91891 gene locus_tag LOCUS_03450 91265 91891 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_03450 92155 92832 gene locus_tag LOCUS_03460 92155 92832 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_03460 93667 93311 gene locus_tag LOCUS_03470 93667 93311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 93857 94369 gene locus_tag LOCUS_03480 93857 94369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 95070 94876 gene locus_tag LOCUS_03490 95070 94876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 95460 95155 gene locus_tag LOCUS_03500 95460 95155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 95899 96933 gene locus_tag LOCUS_03510 95899 96933 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368474.1 protein_id gnl|my_center|LOCUS_03510 97103 97756 gene locus_tag LOCUS_03520 97103 97756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 97980 98789 gene locus_tag LOCUS_03530 gene proC 97980 98789 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_03530 98791 99090 gene locus_tag LOCUS_03540 98791 99090 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_03540 99584 99225 gene locus_tag LOCUS_03550 99584 99225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 100061 100399 gene locus_tag LOCUS_03560 100061 100399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 101231 100575 gene locus_tag LOCUS_03570 101231 100575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 101461 102180 gene locus_tag LOCUS_03580 gene grpE 101461 102180 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 protein_id gnl|my_center|LOCUS_03580 102343 104277 gene locus_tag LOCUS_03590 gene dnaK 102343 104277 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_03590 104401 105516 gene locus_tag LOCUS_03600 gene dnaJ 104401 105516 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 protein_id gnl|my_center|LOCUS_03600 105662 107557 gene locus_tag LOCUS_03610 105662 107557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 107607 109931 gene locus_tag LOCUS_03620 gene lon 107607 109931 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_03620 110798 111790 gene locus_tag LOCUS_03630 110798 111790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 112141 112431 gene locus_tag LOCUS_03640 112141 112431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 112929 112594 gene locus_tag LOCUS_03650 112929 112594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 113503 113279 gene locus_tag LOCUS_03660 113503 113279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 113865 114425 gene locus_tag LOCUS_03670 113865 114425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 114940 116163 gene locus_tag LOCUS_03680 114940 116163 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089743.1 protein_id gnl|my_center|LOCUS_03680 117612 116416 gene locus_tag LOCUS_03690 117612 116416 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_03690 118180 119856 gene locus_tag LOCUS_03700 118180 119856 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_03700 119915 120775 gene locus_tag LOCUS_03710 gene accD 119915 120775 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_03710 120855 123365 gene locus_tag LOCUS_03720 120855 123365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 123386 124114 gene locus_tag LOCUS_03730 123386 124114 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_03730 124153 124353 gene locus_tag LOCUS_03740 124153 124353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 124286 124759 gene locus_tag LOCUS_03750 124286 124759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 125032 124760 gene locus_tag LOCUS_03760 125032 124760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 125144 126199 gene locus_tag LOCUS_03770 gene rfbB 125144 126199 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_03770 126203 127096 gene locus_tag LOCUS_03780 gene rfbD 126203 127096 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_03780 127102 128196 gene locus_tag LOCUS_03790 127102 128196 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_03790 128215 129189 gene locus_tag LOCUS_03800 gene gmd 128215 129189 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_03800 129203 130180 gene locus_tag LOCUS_03810 129203 130180 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_03810 130177 131169 gene locus_tag LOCUS_03820 gene bioB 130177 131169 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_03820 131144 132286 gene locus_tag LOCUS_03830 131144 132286 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_03830 132274 133104 gene locus_tag LOCUS_03840 132274 133104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 134656 133127 gene locus_tag LOCUS_03850 134656 133127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 136202 135123 gene locus_tag LOCUS_03860 136202 135123 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228894.1 protein_id gnl|my_center|LOCUS_03860 137047 136199 gene locus_tag LOCUS_03870 137047 136199 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_03870 138094 137054 gene locus_tag LOCUS_03880 gene argC 138094 137054 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229001.1 protein_id gnl|my_center|LOCUS_03880 139091 138174 gene locus_tag LOCUS_03890 gene lysX 139091 138174 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_03890 139289 139107 gene locus_tag LOCUS_03900 gene lysW 139289 139107 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_03900 139430 140083 gene locus_tag LOCUS_03910 gene bioD 139430 140083 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_03910 140043 141254 gene locus_tag LOCUS_03920 140043 141254 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_03920 141254 141817 gene locus_tag LOCUS_03930 141254 141817 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444959.1 protein_id gnl|my_center|LOCUS_03930 141981 142244 gene locus_tag LOCUS_03940 141981 142244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 142368 143186 gene locus_tag LOCUS_03950 142368 143186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03950 144325 143225 gene locus_tag LOCUS_03960 144325 143225 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_03960 145554 144328 gene locus_tag LOCUS_03970 gene lptF 145554 144328 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938951.1 protein_id gnl|my_center|LOCUS_03970 145906 145703 gene locus_tag LOCUS_03980 145906 145703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 146147 146455 gene locus_tag LOCUS_03990 146147 146455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 146481 148253 gene locus_tag LOCUS_04000 146481 148253 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_04000 148431 148994 gene locus_tag LOCUS_04010 148431 148994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 150722 149283 gene locus_tag LOCUS_04020 150722 149283 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256733.1 protein_id gnl|my_center|LOCUS_04020 150981 151847 gene locus_tag LOCUS_04030 150981 151847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 153483 151780 gene locus_tag LOCUS_04040 153483 151780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 154222 153491 gene locus_tag LOCUS_04050 154222 153491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_04050 154893 154219 gene locus_tag LOCUS_04060 154893 154219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 155097 154906 gene locus_tag LOCUS_04070 155097 154906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 155403 157136 gene locus_tag LOCUS_04080 155403 157136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 157148 157756 gene locus_tag LOCUS_04090 157148 157756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 157838 157922 gene locus_tag LOCUS_t00050 157838 157922 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 158176 158631 gene locus_tag LOCUS_04100 158176 158631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 159130 158732 gene locus_tag LOCUS_04110 159130 158732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 160606 159146 gene locus_tag LOCUS_04120 160606 159146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 161499 160750 gene locus_tag LOCUS_04130 161499 160750 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_04130 162065 161499 gene locus_tag LOCUS_04140 162065 161499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 162093 163031 gene locus_tag LOCUS_04150 162093 163031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 165222 163138 gene locus_tag LOCUS_04160 165222 163138 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_04160 165644 165336 gene locus_tag LOCUS_04170 165644 165336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 165705 166361 gene locus_tag LOCUS_04180 gene queC 165705 166361 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_04180 166404 167000 gene locus_tag LOCUS_04190 166404 167000 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_04190 168230 167142 gene locus_tag LOCUS_04200 168230 167142 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_04200 169028 168231 gene locus_tag LOCUS_04210 169028 168231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 169184 170038 gene locus_tag LOCUS_04220 169184 170038 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_04220 170065 170673 gene locus_tag LOCUS_04230 170065 170673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 170715 171383 gene locus_tag LOCUS_04240 170715 171383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 171634 171721 gene locus_tag LOCUS_t00060 171634 171721 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 172026 172559 gene locus_tag LOCUS_04250 172026 172559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 172642 173103 gene locus_tag LOCUS_04260 172642 173103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 173161 173889 gene locus_tag LOCUS_04270 173161 173889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 173891 176311 gene locus_tag LOCUS_04280 173891 176311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 176372 177406 gene locus_tag LOCUS_04290 176372 177406 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_04290 178505 177393 gene locus_tag LOCUS_04300 178505 177393 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 protein_id gnl|my_center|LOCUS_04300 178565 179356 gene locus_tag LOCUS_04310 gene hisN 178565 179356 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_04310 179437 180945 gene locus_tag LOCUS_04320 gene lysS 179437 180945 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_04320 180942 182213 gene locus_tag LOCUS_04330 180942 182213 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_04330 182223 182906 gene locus_tag LOCUS_04340 gene lolD 182223 182906 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_04340 182906 185200 gene locus_tag LOCUS_04350 gene bamA 182906 185200 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_04350 186451 185459 gene locus_tag LOCUS_04360 186451 185459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 186871 188628 gene locus_tag LOCUS_04370 186871 188628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 189176 188688 gene locus_tag LOCUS_04380 189176 188688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 190526 189276 gene locus_tag LOCUS_04390 190526 189276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 191578 190562 gene locus_tag LOCUS_04400 191578 190562 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_04400 191644 192390 gene locus_tag LOCUS_04410 191644 192390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 192405 193874 gene locus_tag LOCUS_04420 192405 193874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 193877 195523 gene locus_tag LOCUS_04430 193877 195523 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_04430 195594 196040 gene locus_tag LOCUS_04440 195594 196040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 196059 196685 gene locus_tag LOCUS_04450 196059 196685 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_04450 196697 197095 gene locus_tag LOCUS_04460 196697 197095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 197177 197635 gene locus_tag LOCUS_04470 197177 197635 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261792.1 protein_id gnl|my_center|LOCUS_04470 197961 197886 gene locus_tag LOCUS_t00070 197961 197886 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 198073 198897 gene locus_tag LOCUS_04480 198073 198897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 198872 199438 gene locus_tag LOCUS_04490 198872 199438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 199617 199411 gene locus_tag LOCUS_04500 199617 199411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence03 1983 415 gene locus_tag LOCUS_04510 1983 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2065 2475 gene locus_tag LOCUS_04520 2065 2475 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933365.1 protein_id gnl|my_center|LOCUS_04520 2507 3724 gene locus_tag LOCUS_04530 gene sufS 2507 3724 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_04530 3721 4155 gene locus_tag LOCUS_04540 3721 4155 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_04540 4638 4207 gene locus_tag LOCUS_04550 4638 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4871 5584 gene locus_tag LOCUS_04560 4871 5584 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_04560 5874 6125 gene locus_tag LOCUS_04570 5874 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 7168 6656 gene locus_tag LOCUS_04580 gene ispF 7168 6656 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115651.1 protein_id gnl|my_center|LOCUS_04580 7239 7832 gene locus_tag LOCUS_04590 7239 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7995 8639 gene locus_tag LOCUS_04600 7995 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8933 9961 gene locus_tag LOCUS_04610 8933 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 10002 10532 gene locus_tag LOCUS_04620 10002 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 12046 10619 gene locus_tag LOCUS_04630 12046 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 13089 13667 gene locus_tag LOCUS_04640 13089 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13705 14328 gene locus_tag LOCUS_04650 13705 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 14860 14513 gene locus_tag LOCUS_04660 14860 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 15325 15068 gene locus_tag LOCUS_04670 15325 15068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 15602 16087 gene locus_tag LOCUS_04680 15602 16087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 16409 16639 gene locus_tag LOCUS_04690 16409 16639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 16949 16620 gene locus_tag LOCUS_04700 16949 16620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 17648 17187 gene locus_tag LOCUS_04710 gene tsaE 17648 17187 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957999.1 protein_id gnl|my_center|LOCUS_04710 19229 17655 gene locus_tag LOCUS_04720 19229 17655 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_04720 20608 19247 gene locus_tag LOCUS_04730 gene glmM 20608 19247 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_04730 21563 20610 gene locus_tag LOCUS_04740 21563 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 22534 21563 gene locus_tag LOCUS_04750 gene cdaA 22534 21563 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_04750 24446 22581 gene locus_tag LOCUS_04760 gene ftsH 24446 22581 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_04760 25654 24728 gene locus_tag LOCUS_04770 25654 24728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 26098 26580 gene locus_tag LOCUS_04780 26098 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 27480 26833 gene locus_tag LOCUS_04790 27480 26833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 28058 29734 gene locus_tag LOCUS_04800 28058 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 30494 29661 gene locus_tag LOCUS_04810 30494 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 30860 30570 gene locus_tag LOCUS_04820 30860 30570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 31378 30977 gene locus_tag LOCUS_04830 gene apaG 31378 30977 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_04830 32743 31484 gene locus_tag LOCUS_04840 gene purD 32743 31484 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197681.1 protein_id gnl|my_center|LOCUS_04840 32908 34683 gene locus_tag LOCUS_04850 32908 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 34667 35851 gene locus_tag LOCUS_04860 34667 35851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 37452 35863 gene locus_tag LOCUS_04870 gene purH 37452 35863 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814223.1 protein_id gnl|my_center|LOCUS_04870 40136 37779 gene locus_tag LOCUS_04880 40136 37779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 41122 40268 gene locus_tag LOCUS_04890 41122 40268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 42151 41201 gene locus_tag LOCUS_04900 42151 41201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 43110 42157 gene locus_tag LOCUS_04910 43110 42157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 45715 43112 gene locus_tag LOCUS_04920 gene mutS 45715 43112 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933169.1 protein_id gnl|my_center|LOCUS_04920 46388 45912 gene locus_tag LOCUS_04930 46388 45912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 47382 46405 gene locus_tag LOCUS_04940 47382 46405 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255193.1 protein_id gnl|my_center|LOCUS_04940 48156 47392 gene locus_tag LOCUS_04950 48156 47392 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_04950 49791 48232 gene locus_tag LOCUS_04960 gene panP 49791 48232 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253201.1 protein_id gnl|my_center|LOCUS_04960 50927 49791 gene locus_tag LOCUS_04970 50927 49791 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_04970 53119 50951 gene locus_tag LOCUS_04980 53119 50951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 53278 54156 gene locus_tag LOCUS_04990 53278 54156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 54269 55831 gene locus_tag LOCUS_05000 54269 55831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 56172 56594 gene locus_tag LOCUS_05010 56172 56594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 56736 57356 gene locus_tag LOCUS_05020 56736 57356 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_05020 57390 57578 gene locus_tag LOCUS_05030 57390 57578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 59130 57697 gene locus_tag LOCUS_05040 59130 57697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 60322 59237 gene locus_tag LOCUS_05050 gene rlmN 60322 59237 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_05050 60945 60535 gene locus_tag LOCUS_05060 gene ndk 60945 60535 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444482.1 protein_id gnl|my_center|LOCUS_05060 61583 61383 gene locus_tag LOCUS_05070 61583 61383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 61576 63135 gene locus_tag LOCUS_05080 61576 63135 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925712.1 protein_id gnl|my_center|LOCUS_05080 63789 63268 gene locus_tag LOCUS_05090 63789 63268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 63987 65042 gene locus_tag LOCUS_05100 63987 65042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 66183 65194 gene locus_tag LOCUS_05110 66183 65194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 66751 66434 gene locus_tag LOCUS_05120 66751 66434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 67587 67039 gene locus_tag LOCUS_05130 67587 67039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 68219 67584 gene locus_tag LOCUS_05140 68219 67584 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 protein_id gnl|my_center|LOCUS_05140 69159 68221 gene locus_tag LOCUS_05150 69159 68221 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 protein_id gnl|my_center|LOCUS_05150 69768 69172 gene locus_tag LOCUS_05160 69768 69172 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209770.1 protein_id gnl|my_center|LOCUS_05160 70991 69768 gene locus_tag LOCUS_05170 70991 69768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 71713 71147 gene locus_tag LOCUS_05180 71713 71147 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_05180 72540 71707 gene locus_tag LOCUS_05190 72540 71707 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965458.1 protein_id gnl|my_center|LOCUS_05190 73296 72712 gene locus_tag LOCUS_05200 73296 72712 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084923.1 protein_id gnl|my_center|LOCUS_05200 73470 73739 gene locus_tag LOCUS_05210 73470 73739 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189463936.1 protein_id gnl|my_center|LOCUS_05210 73749 73997 gene locus_tag LOCUS_05220 73749 73997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 74989 74117 gene locus_tag LOCUS_05230 gene sucD 74989 74117 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038208.1 protein_id gnl|my_center|LOCUS_05230 76162 74996 gene locus_tag LOCUS_05240 gene sucC 76162 74996 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_05240 77118 76186 gene locus_tag LOCUS_05250 gene mdh 77118 76186 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597533.1 protein_id gnl|my_center|LOCUS_05250 77433 77672 gene locus_tag LOCUS_05260 77433 77672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 77669 77890 gene locus_tag LOCUS_05270 77669 77890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 77896 78150 gene locus_tag LOCUS_05280 77896 78150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 78958 78650 gene locus_tag LOCUS_05290 78958 78650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 79764 79225 gene locus_tag LOCUS_05300 79764 79225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 83036 79875 gene locus_tag LOCUS_05310 83036 79875 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444671.1 protein_id gnl|my_center|LOCUS_05310 84310 83048 gene locus_tag LOCUS_05320 84310 83048 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946742.1 protein_id gnl|my_center|LOCUS_05320 85552 84323 gene locus_tag LOCUS_05330 85552 84323 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_05330 86060 85668 gene locus_tag LOCUS_05340 86060 85668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 87190 86141 gene locus_tag LOCUS_05350 87190 86141 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256870.1 protein_id gnl|my_center|LOCUS_05350 88579 87194 gene locus_tag LOCUS_05360 88579 87194 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279119.1 protein_id gnl|my_center|LOCUS_05360 89589 89017 gene locus_tag LOCUS_05370 89589 89017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 90827 89664 gene locus_tag LOCUS_05380 gene queG 90827 89664 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_05380 92514 90946 gene locus_tag LOCUS_05390 92514 90946 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173309.1 protein_id gnl|my_center|LOCUS_05390 92685 94223 gene locus_tag LOCUS_05400 92685 94223 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_05400 94326 95621 gene locus_tag LOCUS_05410 94326 95621 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_05410 95771 96373 gene locus_tag LOCUS_05420 95771 96373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 97619 96468 gene locus_tag LOCUS_05430 97619 96468 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_05430 99150 97630 gene locus_tag LOCUS_05440 gene zwf 99150 97630 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_05440 100080 99175 gene locus_tag LOCUS_05450 gene gnd 100080 99175 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933532.1 protein_id gnl|my_center|LOCUS_05450 101190 100084 gene locus_tag LOCUS_05460 101190 100084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 101489 101322 gene locus_tag LOCUS_05470 101489 101322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 101675 103477 gene locus_tag LOCUS_05480 gene pepF 101675 103477 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_05480 104602 103979 gene locus_tag LOCUS_05490 104602 103979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 106749 104923 gene locus_tag LOCUS_05500 106749 104923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 108979 108233 gene locus_tag LOCUS_05510 108979 108233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 109837 109439 gene locus_tag LOCUS_05520 gene rpsI 109837 109439 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_05520 110301 109864 gene locus_tag LOCUS_05530 gene rplM 110301 109864 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544931.1 protein_id gnl|my_center|LOCUS_05530 110751 110386 gene locus_tag LOCUS_05540 110751 110386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 111337 110765 gene locus_tag LOCUS_05550 111337 110765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 112110 111361 gene locus_tag LOCUS_05560 112110 111361 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_05560 114827 112107 gene locus_tag LOCUS_05570 gene polA 114827 112107 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250024.1 protein_id gnl|my_center|LOCUS_05570 116131 115277 gene locus_tag LOCUS_05580 116131 115277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 116859 116401 gene locus_tag LOCUS_05590 gene nusB 116859 116401 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_05590 117311 117757 gene locus_tag LOCUS_05600 117311 117757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 117748 118203 gene locus_tag LOCUS_05610 117748 118203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 118203 118847 gene locus_tag LOCUS_05620 118203 118847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 120564 118855 gene locus_tag LOCUS_05630 120564 118855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 120670 122106 gene locus_tag LOCUS_05640 120670 122106 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_05640 123927 122890 gene locus_tag LOCUS_05650 gene glk 123927 122890 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087321.1 protein_id gnl|my_center|LOCUS_05650 124698 125738 gene locus_tag LOCUS_05660 124698 125738 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_05660 125741 126202 gene locus_tag LOCUS_05670 gene trmL 125741 126202 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522909.1 protein_id gnl|my_center|LOCUS_05670 126234 127553 gene locus_tag LOCUS_05680 126234 127553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 127985 127680 gene locus_tag LOCUS_05690 127985 127680 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_05690 129320 127995 gene locus_tag LOCUS_05700 129320 127995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 130083 129334 gene locus_tag LOCUS_05710 gene sufC 130083 129334 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_05710 130830 134087 gene locus_tag LOCUS_05720 130830 134087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 135469 134864 gene locus_tag LOCUS_05730 135469 134864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 135872 135525 gene locus_tag LOCUS_05740 135872 135525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 136903 135905 gene locus_tag LOCUS_05750 136903 135905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 137108 137419 gene locus_tag LOCUS_05760 gene rplU 137108 137419 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 protein_id gnl|my_center|LOCUS_05760 137443 137700 gene locus_tag LOCUS_05770 gene rpmA 137443 137700 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_05770 137880 138917 gene locus_tag LOCUS_05780 gene obgE 137880 138917 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_05780 139055 139489 gene locus_tag LOCUS_05790 gene rsfS 139055 139489 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_05790 139471 140787 gene locus_tag LOCUS_05800 139471 140787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 140811 142373 gene locus_tag LOCUS_05810 gene gpmI 140811 142373 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_05810 143077 142796 gene locus_tag LOCUS_05820 143077 142796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 143475 143212 gene locus_tag LOCUS_05830 143475 143212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence04 156 356 gene locus_tag LOCUS_05840 156 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 401 844 gene locus_tag LOCUS_05850 401 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1448 1080 gene locus_tag LOCUS_05860 1448 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1589 2317 gene locus_tag LOCUS_05870 1589 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2362 3801 gene locus_tag LOCUS_05880 2362 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3826 4080 gene locus_tag LOCUS_05890 3826 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4543 4136 gene locus_tag LOCUS_05900 4543 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5990 5058 gene locus_tag LOCUS_05910 5990 5058 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_05910 6642 6016 gene locus_tag LOCUS_05920 6642 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6623 6802 gene locus_tag LOCUS_05930 6623 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7071 6790 gene locus_tag LOCUS_05940 7071 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 7610 7335 gene locus_tag LOCUS_05950 7610 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 7909 7619 gene locus_tag LOCUS_05960 7909 7619 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_05960 8025 7950 gene locus_tag LOCUS_t00080 8025 7950 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8888 8124 gene locus_tag LOCUS_05970 8888 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9641 8895 gene locus_tag LOCUS_05980 9641 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 9685 9610 gene locus_tag LOCUS_t00090 9685 9610 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9799 10857 gene locus_tag LOCUS_05990 9799 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 11229 10903 gene locus_tag LOCUS_06000 11229 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 12196 11234 gene locus_tag LOCUS_06010 gene secF 12196 11234 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_06010 13755 12208 gene locus_tag LOCUS_06020 gene secD 13755 12208 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_06020 14217 13771 gene locus_tag LOCUS_06030 14217 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 15429 14284 gene locus_tag LOCUS_06040 gene tgt 15429 14284 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546567.1 protein_id gnl|my_center|LOCUS_06040 16502 15426 gene locus_tag LOCUS_06050 gene queA 16502 15426 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_06050 17246 16506 gene locus_tag LOCUS_06060 17246 16506 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_06060 18637 17249 gene locus_tag LOCUS_06070 18637 17249 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_06070 19478 18699 gene locus_tag LOCUS_06080 19478 18699 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_06080 20698 19475 gene locus_tag LOCUS_06090 gene coaBC 20698 19475 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_06090 21291 20698 gene locus_tag LOCUS_06100 21291 20698 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972137.1 protein_id gnl|my_center|LOCUS_06100 21408 23657 gene locus_tag LOCUS_06110 21408 23657 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_06110 24401 23694 gene locus_tag LOCUS_06120 gene ispD 24401 23694 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288292.1 protein_id gnl|my_center|LOCUS_06120 25220 24522 gene locus_tag LOCUS_06130 25220 24522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 25840 25349 gene locus_tag LOCUS_06140 gene rimI 25840 25349 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583327.1 protein_id gnl|my_center|LOCUS_06140 28250 25803 gene locus_tag LOCUS_06150 gene pheT 28250 25803 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_06150 29282 28257 gene locus_tag LOCUS_06160 gene pheS 29282 28257 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_06160 29666 29316 gene locus_tag LOCUS_06170 gene rplT 29666 29316 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_06170 29902 29702 gene locus_tag LOCUS_06180 gene rpmI 29902 29702 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_06180 30735 30809 gene locus_tag LOCUS_t00100 30735 30809 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30749 31534 gene locus_tag LOCUS_06190 30749 31534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 32462 31473 gene locus_tag LOCUS_06200 32462 31473 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_06200 32631 32990 gene locus_tag LOCUS_06210 32631 32990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 33707 33783 gene locus_tag LOCUS_t00110 33707 33783 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 33902 33976 gene locus_tag LOCUS_t00120 33902 33976 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35421 34516 gene locus_tag LOCUS_06220 35421 34516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 36299 35418 gene locus_tag LOCUS_06230 36299 35418 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_06230 37408 36809 gene locus_tag LOCUS_06240 37408 36809 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450537.1 protein_id gnl|my_center|LOCUS_06240 38078 37569 gene locus_tag LOCUS_06250 38078 37569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 38199 39545 gene locus_tag LOCUS_06260 38199 39545 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_06260 40503 39556 gene locus_tag LOCUS_06270 40503 39556 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_06270 41286 40504 gene locus_tag LOCUS_06280 41286 40504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 43014 41374 gene locus_tag LOCUS_06290 43014 41374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 43279 44523 gene locus_tag LOCUS_06300 gene ftsA 43279 44523 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_06300 45542 44520 gene locus_tag LOCUS_06310 45542 44520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 45704 46300 gene locus_tag LOCUS_06320 45704 46300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 46676 46323 gene locus_tag LOCUS_06330 46676 46323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 47103 48296 gene locus_tag LOCUS_06340 47103 48296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 48293 49285 gene locus_tag LOCUS_06350 48293 49285 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679040.1 protein_id gnl|my_center|LOCUS_06350 49282 50133 gene locus_tag LOCUS_06360 49282 50133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 50126 50866 gene locus_tag LOCUS_06370 50126 50866 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_06370 52215 50869 gene locus_tag LOCUS_06380 52215 50869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 53763 52228 gene locus_tag LOCUS_06390 53763 52228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 54521 53763 gene locus_tag LOCUS_06400 54521 53763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 54888 55703 gene locus_tag LOCUS_06410 54888 55703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 56397 55696 gene locus_tag LOCUS_06420 56397 55696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 57554 56388 gene locus_tag LOCUS_06430 57554 56388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 58276 57536 gene locus_tag LOCUS_06440 58276 57536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 59780 58278 gene locus_tag LOCUS_06450 59780 58278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 60937 59780 gene locus_tag LOCUS_06460 gene rffA 60937 59780 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_06460 61414 61031 gene locus_tag LOCUS_06470 61414 61031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 61504 62739 gene locus_tag LOCUS_06480 61504 62739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 63383 62649 gene locus_tag LOCUS_06490 63383 62649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 64382 63390 gene locus_tag LOCUS_06500 64382 63390 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_06500 64760 64389 gene locus_tag LOCUS_06510 64760 64389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 67377 64780 gene locus_tag LOCUS_06520 gene infB 67377 64780 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_06520 67687 67388 gene locus_tag LOCUS_06530 67687 67388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 69279 67807 gene locus_tag LOCUS_06540 gene nusA 69279 67807 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_06540 69833 69321 gene locus_tag LOCUS_06550 69833 69321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 71367 70195 gene locus_tag LOCUS_06560 71367 70195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 72013 71528 gene locus_tag LOCUS_06570 gene greA 72013 71528 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_06570 75333 72031 gene locus_tag LOCUS_06580 gene carB 75333 72031 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_06580 76498 75344 gene locus_tag LOCUS_06590 gene carA 76498 75344 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_06590 77811 76501 gene locus_tag LOCUS_06600 77811 76501 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_06600 78773 77808 gene locus_tag LOCUS_06610 78773 77808 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_06610 79410 78787 gene locus_tag LOCUS_06620 gene pyrR 79410 78787 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_06620 79587 80240 gene locus_tag LOCUS_06630 79587 80240 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682319.1 protein_id gnl|my_center|LOCUS_06630 80422 81504 gene locus_tag LOCUS_06640 80422 81504 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405098.1 protein_id gnl|my_center|LOCUS_06640 82260 81448 gene locus_tag LOCUS_06650 82260 81448 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_06650 82615 82262 gene locus_tag LOCUS_06660 82615 82262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 82925 83119 gene locus_tag LOCUS_06670 82925 83119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 83061 83507 gene locus_tag LOCUS_06680 83061 83507 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_06680 84884 83502 gene locus_tag LOCUS_06690 gene mgtE 84884 83502 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_06690 85730 85098 gene locus_tag LOCUS_06700 85730 85098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 88060 87701 gene locus_tag LOCUS_06710 88060 87701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 88527 88117 gene locus_tag LOCUS_06720 88527 88117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 89868 88639 gene locus_tag LOCUS_06730 89868 88639 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_06730 91170 89896 gene locus_tag LOCUS_06740 91170 89896 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 protein_id gnl|my_center|LOCUS_06740 91193 91486 gene locus_tag LOCUS_06750 91193 91486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 91739 92620 gene locus_tag LOCUS_06760 91739 92620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 94454 92763 gene locus_tag LOCUS_06770 gene uvrC 94454 92763 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_06770 96465 94447 gene locus_tag LOCUS_06780 gene ligA 96465 94447 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_06780 97684 96431 gene locus_tag LOCUS_06790 97684 96431 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842681.1 protein_id gnl|my_center|LOCUS_06790 98853 97690 gene locus_tag LOCUS_06800 98853 97690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 99697 98867 gene locus_tag LOCUS_06810 99697 98867 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_06810 99759 100358 gene locus_tag LOCUS_06820 99759 100358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 101952 100348 gene locus_tag LOCUS_06830 101952 100348 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085850.1 protein_id gnl|my_center|LOCUS_06830 102599 102523 gene locus_tag LOCUS_t00130 102599 102523 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 104760 102700 gene locus_tag LOCUS_06840 gene rpoD 104760 102700 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_06840 106850 104961 gene locus_tag LOCUS_06850 106850 104961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 107016 107477 gene locus_tag LOCUS_06860 107016 107477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 108002 107610 gene locus_tag LOCUS_06870 108002 107610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 111001 108140 gene locus_tag LOCUS_06880 111001 108140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 111155 111955 gene locus_tag LOCUS_06890 111155 111955 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_06890 112023 112367 gene locus_tag LOCUS_06900 gene tatB 112023 112367 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115042.1 protein_id gnl|my_center|LOCUS_06900 112364 113092 gene locus_tag LOCUS_06910 gene tatC 112364 113092 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461250.1 protein_id gnl|my_center|LOCUS_06910 114061 113363 gene locus_tag LOCUS_06920 114061 113363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 114196 114876 gene locus_tag LOCUS_06930 114196 114876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 115511 114936 gene locus_tag LOCUS_06940 115511 114936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 115679 117253 gene locus_tag LOCUS_06950 gene nadB 115679 117253 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_06950 117232 117777 gene locus_tag LOCUS_06960 117232 117777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 117787 118425 gene locus_tag LOCUS_06970 117787 118425 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_06970 119258 118500 gene locus_tag LOCUS_06980 119258 118500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 119890 119375 gene locus_tag LOCUS_06990 119890 119375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921973.1 protein_id gnl|my_center|LOCUS_06990 120133 120978 gene locus_tag LOCUS_07000 120133 120978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 121479 121144 gene locus_tag LOCUS_07010 121479 121144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 121913 122947 gene locus_tag LOCUS_07020 121913 122947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 123189 123692 gene locus_tag LOCUS_07030 123189 123692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 124626 123832 gene locus_tag LOCUS_07040 124626 123832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 125231 125758 gene locus_tag LOCUS_07050 125231 125758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 125780 126787 gene locus_tag LOCUS_07060 125780 126787 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_07060 128234 126801 gene locus_tag LOCUS_07070 128234 126801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 129131 128688 gene locus_tag LOCUS_07080 129131 128688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 <130067 129249 gene locus_tag LOCUS_07090 <130067 129249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141784.1:DUF1972 domain-containing protein >Feature sequence05 1463 636 gene locus_tag LOCUS_07100 1463 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07100 2210 1770 gene locus_tag LOCUS_07110 gene ybeY 2210 1770 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_07110 3756 2122 gene locus_tag LOCUS_07120 3756 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6401 3753 gene locus_tag LOCUS_07130 gene alaS 6401 3753 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_07130 7069 6413 gene locus_tag LOCUS_07140 7069 6413 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736935.1 protein_id gnl|my_center|LOCUS_07140 7559 7062 gene locus_tag LOCUS_07150 7559 7062 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_07150 9437 7584 gene locus_tag LOCUS_07160 9437 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 10728 9439 gene locus_tag LOCUS_07170 gene rlmD 10728 9439 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_07170 11229 10729 gene locus_tag LOCUS_07180 11229 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 12661 11219 gene locus_tag LOCUS_07190 12661 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 12712 13143 gene locus_tag LOCUS_07200 gene ruvX 12712 13143 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_07200 13235 14521 gene locus_tag LOCUS_07210 gene mltG 13235 14521 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_07210 14521 15390 gene locus_tag LOCUS_07220 14521 15390 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_07220 15439 17493 gene locus_tag LOCUS_07230 15439 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 17544 18545 gene locus_tag LOCUS_07240 17544 18545 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_07240 18545 19417 gene locus_tag LOCUS_07250 18545 19417 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_07250 19446 23786 gene locus_tag LOCUS_07260 19446 23786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 23791 24390 gene locus_tag LOCUS_07270 23791 24390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 24534 24947 gene locus_tag LOCUS_07280 24534 24947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 27843 25108 gene locus_tag LOCUS_07290 gene ppc 27843 25108 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907814.1 protein_id gnl|my_center|LOCUS_07290 28373 28789 gene locus_tag LOCUS_07300 28373 28789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 29877 29554 gene locus_tag LOCUS_07310 29877 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 29770 30036 gene locus_tag LOCUS_07320 29770 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 30389 30748 gene locus_tag LOCUS_07330 30389 30748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 31447 32976 gene locus_tag LOCUS_07340 31447 32976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 33225 34535 gene locus_tag LOCUS_07350 33225 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 35911 36663 gene locus_tag LOCUS_07360 35911 36663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 37227 38498 gene locus_tag LOCUS_07370 37227 38498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 50940 38458 gene locus_tag LOCUS_07380 50940 38458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 52292 51141 gene locus_tag LOCUS_07390 gene pilU 52292 51141 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_07390 54382 52436 gene locus_tag LOCUS_07400 gene acs 54382 52436 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_07400 55980 54403 gene locus_tag LOCUS_07410 55980 54403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 56640 56065 gene locus_tag LOCUS_07420 56640 56065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 58054 56720 gene locus_tag LOCUS_07430 58054 56720 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_07430 58479 58784 gene locus_tag LOCUS_07440 gene rpsN 58479 58784 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495202.1 protein_id gnl|my_center|LOCUS_07440 58900 64809 gene locus_tag LOCUS_07450 58900 64809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 64816 67017 gene locus_tag LOCUS_07460 gene pbpC 64816 67017 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002102274.1 protein_id gnl|my_center|LOCUS_07460 67537 67004 gene locus_tag LOCUS_07470 67537 67004 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_07470 68324 67623 gene locus_tag LOCUS_07480 68324 67623 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 protein_id gnl|my_center|LOCUS_07480 68939 68631 gene locus_tag LOCUS_07490 68939 68631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 69449 69027 gene locus_tag LOCUS_07500 69449 69027 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_07500 70155 69469 gene locus_tag LOCUS_07510 70155 69469 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_07510 70531 70160 gene locus_tag LOCUS_07520 70531 70160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 71196 70534 gene locus_tag LOCUS_07530 71196 70534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 72203 71463 gene locus_tag LOCUS_07540 72203 71463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194458.1 protein_id gnl|my_center|LOCUS_07540 73104 72196 gene locus_tag LOCUS_07550 73104 72196 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_07550 73172 74095 gene locus_tag LOCUS_07560 gene trxB 73172 74095 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_07560 74662 74351 gene locus_tag LOCUS_07570 74662 74351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 75484 74711 gene locus_tag LOCUS_07580 75484 74711 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_07580 75976 75599 gene locus_tag LOCUS_07590 75976 75599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 76550 77998 gene locus_tag LOCUS_07600 gene dnaA 76550 77998 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_07600 78319 79437 gene locus_tag LOCUS_07610 gene dnaN 78319 79437 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_07610 79456 80604 gene locus_tag LOCUS_07620 gene recF 79456 80604 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475454.1 protein_id gnl|my_center|LOCUS_07620 80788 83256 gene locus_tag LOCUS_07630 gene gyrB 80788 83256 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 protein_id gnl|my_center|LOCUS_07630 83403 85982 gene locus_tag LOCUS_07640 gene gyrA 83403 85982 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_07640 85979 86974 gene locus_tag LOCUS_07650 85979 86974 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035460.1 protein_id gnl|my_center|LOCUS_07650 87221 87370 gene locus_tag LOCUS_07660 87221 87370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 88624 87437 gene locus_tag LOCUS_07670 88624 87437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_07670 89522 90595 gene locus_tag LOCUS_07680 89522 90595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 90943 91281 gene locus_tag LOCUS_07690 90943 91281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 91550 92155 gene locus_tag LOCUS_07700 91550 92155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 92780 92283 gene locus_tag LOCUS_07710 92780 92283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 93795 92974 gene locus_tag LOCUS_07720 93795 92974 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_07720 94616 93798 gene locus_tag LOCUS_07730 94616 93798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_07730 95515 94631 gene locus_tag LOCUS_07740 95515 94631 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_07740 98304 95626 gene locus_tag LOCUS_07750 gene secA 98304 95626 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_07750 99525 98308 gene locus_tag LOCUS_07760 gene splB 99525 98308 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 protein_id gnl|my_center|LOCUS_07760 100137 99613 gene locus_tag LOCUS_07770 100137 99613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 100659 100144 gene locus_tag LOCUS_07780 100659 100144 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_07780 100853 101461 gene locus_tag LOCUS_07790 100853 101461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 103738 101501 gene locus_tag LOCUS_07800 103738 101501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 105219 103735 gene locus_tag LOCUS_07810 105219 103735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 105502 107223 gene locus_tag LOCUS_07820 105502 107223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 109859 107403 gene locus_tag LOCUS_07830 109859 107403 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_07830 111217 109856 gene locus_tag LOCUS_07840 111217 109856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 112737 111223 gene locus_tag LOCUS_07850 112737 111223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 113495 112734 gene locus_tag LOCUS_07860 113495 112734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 114256 113492 gene locus_tag LOCUS_07870 114256 113492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 114457 115917 gene locus_tag LOCUS_07880 114457 115917 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_07880 115938 116912 gene locus_tag LOCUS_07890 115938 116912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 117777 117073 gene locus_tag LOCUS_07900 117777 117073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 119678 117792 gene locus_tag LOCUS_07910 gene mnmG 119678 117792 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105594.1 protein_id gnl|my_center|LOCUS_07910 119869 120990 gene locus_tag LOCUS_07920 119869 120990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 121086 121526 gene locus_tag LOCUS_07930 gene dtd 121086 121526 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 protein_id gnl|my_center|LOCUS_07930 121529 121981 gene locus_tag LOCUS_07940 121529 121981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 123563 122157 gene locus_tag LOCUS_07950 gene mnmE 123563 122157 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_07950 125309 123579 gene locus_tag LOCUS_07960 gene yidC 125309 123579 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence06 5865 382 gene locus_tag LOCUS_07970 gene uvrA 5865 382 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_07970 5927 6826 gene locus_tag LOCUS_07980 5927 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7138 6833 gene locus_tag LOCUS_07990 7138 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7668 7138 gene locus_tag LOCUS_08000 7668 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 8032 7733 gene locus_tag LOCUS_08010 8032 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 8664 8029 gene locus_tag LOCUS_08020 8664 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 10190 8661 gene locus_tag LOCUS_08030 10190 8661 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090750.1 protein_id gnl|my_center|LOCUS_08030 11080 10181 gene locus_tag LOCUS_08040 11080 10181 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_08040 11577 11077 gene locus_tag LOCUS_08050 11577 11077 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_08050 14240 11793 gene locus_tag LOCUS_08060 14240 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 16258 14450 gene locus_tag LOCUS_08070 gene typA 16258 14450 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_08070 17609 16281 gene locus_tag LOCUS_08080 17609 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 18433 17615 gene locus_tag LOCUS_08090 18433 17615 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938949.1 protein_id gnl|my_center|LOCUS_08090 18472 19122 gene locus_tag LOCUS_08100 18472 19122 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364337.1 protein_id gnl|my_center|LOCUS_08100 19129 19797 gene locus_tag LOCUS_08110 19129 19797 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_08110 20582 19779 gene locus_tag LOCUS_08120 20582 19779 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_08120 21101 20583 gene locus_tag LOCUS_08130 21101 20583 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_08130 22025 21234 gene locus_tag LOCUS_08140 22025 21234 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067764.1 protein_id gnl|my_center|LOCUS_08140 23097 22015 gene locus_tag LOCUS_08150 23097 22015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 24497 23094 gene locus_tag LOCUS_08160 24497 23094 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_08160 25785 24505 gene locus_tag LOCUS_08170 gene kynU 25785 24505 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_08170 26813 25788 gene locus_tag LOCUS_08180 26813 25788 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_08180 27235 26816 gene locus_tag LOCUS_08190 27235 26816 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762169.1 protein_id gnl|my_center|LOCUS_08190 27632 27402 gene locus_tag LOCUS_08200 27632 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 29230 27770 gene locus_tag LOCUS_08210 29230 27770 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_08210 29347 29733 gene locus_tag LOCUS_08220 29347 29733 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939916.1 protein_id gnl|my_center|LOCUS_08220 30857 29775 gene locus_tag LOCUS_08230 30857 29775 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096798.1 protein_id gnl|my_center|LOCUS_08230 31396 30857 gene locus_tag LOCUS_08240 gene purE 31396 30857 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106314.1 protein_id gnl|my_center|LOCUS_08240 31434 31808 gene locus_tag LOCUS_08250 31434 31808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 31826 32071 gene locus_tag LOCUS_08260 31826 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 32345 32635 gene locus_tag LOCUS_08270 32345 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 33080 32640 gene locus_tag LOCUS_08280 gene arfB 33080 32640 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_08280 33158 36019 gene locus_tag LOCUS_08290 gene gcvP 33158 36019 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_08290 36022 36834 gene locus_tag LOCUS_08300 36022 36834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 36831 37376 gene locus_tag LOCUS_08310 36831 37376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 37401 38558 gene locus_tag LOCUS_08320 37401 38558 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861703.1 protein_id gnl|my_center|LOCUS_08320 39126 38602 gene locus_tag LOCUS_08330 gene pal 39126 38602 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_08330 39736 39281 gene locus_tag LOCUS_08340 39736 39281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 41097 39943 gene locus_tag LOCUS_08350 41097 39943 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256338.1 protein_id gnl|my_center|LOCUS_08350 41137 42159 gene locus_tag LOCUS_08360 41137 42159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 42159 43358 gene locus_tag LOCUS_08370 42159 43358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 45019 43418 gene locus_tag LOCUS_08380 45019 43418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 46324 45176 gene locus_tag LOCUS_08390 46324 45176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 46604 47410 gene locus_tag LOCUS_08400 46604 47410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 47414 49135 gene locus_tag LOCUS_08410 47414 49135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 49724 50887 gene locus_tag LOCUS_08420 49724 50887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 50900 51550 gene locus_tag LOCUS_08430 50900 51550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 52348 51854 gene locus_tag LOCUS_08440 52348 51854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 54110 52359 gene locus_tag LOCUS_08450 54110 52359 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_08450 54331 55428 gene locus_tag LOCUS_08460 54331 55428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 55464 57098 gene locus_tag LOCUS_08470 55464 57098 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337065.1 protein_id gnl|my_center|LOCUS_08470 57109 57957 gene locus_tag LOCUS_08480 57109 57957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 57961 58860 gene locus_tag LOCUS_08490 57961 58860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 58882 59280 gene locus_tag LOCUS_08500 58882 59280 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_08500 60226 59492 gene locus_tag LOCUS_08510 60226 59492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 60695 60991 gene locus_tag LOCUS_08520 60695 60991 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_08520 61004 61270 gene locus_tag LOCUS_08530 61004 61270 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_08530 61452 62777 gene locus_tag LOCUS_08540 61452 62777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 62774 64330 gene locus_tag LOCUS_08550 62774 64330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 65795 64332 gene locus_tag LOCUS_08560 65795 64332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 65899 68133 gene locus_tag LOCUS_08570 65899 68133 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119377.1 protein_id gnl|my_center|LOCUS_08570 68178 70133 gene locus_tag LOCUS_08580 68178 70133 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_08580 71789 70233 gene locus_tag LOCUS_08590 71789 70233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 73261 71981 gene locus_tag LOCUS_08600 73261 71981 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_08600 74563 73385 gene locus_tag LOCUS_08610 74563 73385 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_08610 75560 74568 gene locus_tag LOCUS_08620 75560 74568 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947921.1 protein_id gnl|my_center|LOCUS_08620 75571 76020 gene locus_tag LOCUS_08630 gene mce 75571 76020 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978533.1 protein_id gnl|my_center|LOCUS_08630 76075 76332 gene locus_tag LOCUS_08640 76075 76332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 76334 76594 gene locus_tag LOCUS_08650 76334 76594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 76801 76989 gene locus_tag LOCUS_08660 76801 76989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 77082 78431 gene locus_tag LOCUS_08670 gene ffh 77082 78431 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_08670 78458 78880 gene locus_tag LOCUS_08680 78458 78880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 80211 79336 gene locus_tag LOCUS_08690 80211 79336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 81660 80227 gene locus_tag LOCUS_08700 81660 80227 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072721720.1 protein_id gnl|my_center|LOCUS_08700 82484 81657 gene locus_tag LOCUS_08710 82484 81657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 82542 83819 gene locus_tag LOCUS_08720 gene trmD 82542 83819 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938137.1 protein_id gnl|my_center|LOCUS_08720 84354 84088 gene locus_tag LOCUS_08730 84354 84088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 84791 84591 gene locus_tag LOCUS_08740 84791 84591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 86096 84834 gene locus_tag LOCUS_08750 86096 84834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 86805 86209 gene locus_tag LOCUS_08760 86805 86209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 86932 87549 gene locus_tag LOCUS_08770 86932 87549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 87655 88599 gene locus_tag LOCUS_08780 87655 88599 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122730.1 protein_id gnl|my_center|LOCUS_08780 88754 91024 gene locus_tag LOCUS_08790 88754 91024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 91223 91296 gene locus_tag LOCUS_t00140 91223 91296 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 91562 92647 gene locus_tag LOCUS_08800 91562 92647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 92634 92978 gene locus_tag LOCUS_08810 92634 92978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 93191 92928 gene locus_tag LOCUS_08820 93191 92928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 93985 93395 gene locus_tag LOCUS_08830 93985 93395 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_08830 94397 94813 gene locus_tag LOCUS_08840 94397 94813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 95327 95845 gene locus_tag LOCUS_08850 95327 95845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 96499 96035 gene locus_tag LOCUS_08860 96499 96035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 98083 96596 gene locus_tag LOCUS_08870 98083 96596 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_08870 98321 98524 gene locus_tag LOCUS_08880 98321 98524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 99817 98552 gene locus_tag LOCUS_08890 99817 98552 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_08890 99961 101316 gene locus_tag LOCUS_08900 gene hisS 99961 101316 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_08900 101370 101843 gene locus_tag LOCUS_08910 101370 101843 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_08910 101865 103235 gene locus_tag LOCUS_08920 101865 103235 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_08920 103863 104543 gene locus_tag LOCUS_08930 103863 104543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 104933 105463 gene locus_tag LOCUS_08940 104933 105463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence07 1048 269 gene locus_tag LOCUS_08950 1048 269 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565800.1 protein_id gnl|my_center|LOCUS_08950 1797 1048 gene locus_tag LOCUS_08960 1797 1048 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_08960 2368 1814 gene locus_tag LOCUS_08970 gene frr 2368 1814 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_08970 3088 2381 gene locus_tag LOCUS_08980 gene pyrH 3088 2381 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_08980 3815 3180 gene locus_tag LOCUS_08990 gene tsf 3815 3180 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_08990 4913 4026 gene locus_tag LOCUS_09000 gene rpsB 4913 4026 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938173.1 protein_id gnl|my_center|LOCUS_09000 5245 6882 gene locus_tag LOCUS_09010 gene murJ 5245 6882 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_09010 6864 7439 gene locus_tag LOCUS_09020 6864 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 7587 8564 gene locus_tag LOCUS_09030 7587 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 10663 8807 gene locus_tag LOCUS_09040 10663 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 10766 11845 gene locus_tag LOCUS_09050 10766 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 13252 11909 gene locus_tag LOCUS_09060 gene ahcY 13252 11909 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117570.1 protein_id gnl|my_center|LOCUS_09060 14145 13417 gene locus_tag LOCUS_09070 gene yycF 14145 13417 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722073.1 protein_id gnl|my_center|LOCUS_09070 15143 14214 gene locus_tag LOCUS_09080 15143 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 15203 16870 gene locus_tag LOCUS_09090 15203 16870 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_09090 16880 17500 gene locus_tag LOCUS_09100 16880 17500 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_09100 17675 19078 gene locus_tag LOCUS_09110 17675 19078 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253014.1 protein_id gnl|my_center|LOCUS_09110 19343 19062 gene locus_tag LOCUS_09120 19343 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 21178 19769 gene locus_tag LOCUS_09130 21178 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09130 21954 21181 gene locus_tag LOCUS_09140 21954 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 22718 21969 gene locus_tag LOCUS_09150 22718 21969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_09150 23700 22699 gene locus_tag LOCUS_09160 gene dusB 23700 22699 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_09160 25516 23927 gene locus_tag LOCUS_09170 gene guaA 25516 23927 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_09170 27064 25577 gene locus_tag LOCUS_09180 gene guaB 27064 25577 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_09180 29238 27640 gene locus_tag LOCUS_09190 29238 27640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 30183 29248 gene locus_tag LOCUS_09200 gene era 30183 29248 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546764.1 protein_id gnl|my_center|LOCUS_09200 30341 30937 gene locus_tag LOCUS_09210 30341 30937 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_09210 31430 30996 gene locus_tag LOCUS_09220 31430 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 32352 31723 gene locus_tag LOCUS_09230 32352 31723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 33764 32751 gene locus_tag LOCUS_09240 33764 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 35206 33752 gene locus_tag LOCUS_09250 gene mtaB 35206 33752 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080813.1 protein_id gnl|my_center|LOCUS_09250 36323 35187 gene locus_tag LOCUS_09260 gene mnmA 36323 35187 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_09260 37662 36328 gene locus_tag LOCUS_09270 37662 36328 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_09270 37774 39654 gene locus_tag LOCUS_09280 37774 39654 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_09280 39654 40664 gene locus_tag LOCUS_09290 39654 40664 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030782.1 protein_id gnl|my_center|LOCUS_09290 41631 40726 gene locus_tag LOCUS_09300 41631 40726 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130548.1 protein_id gnl|my_center|LOCUS_09300 42736 41636 gene locus_tag LOCUS_09310 42736 41636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 42929 43744 gene locus_tag LOCUS_09320 gene aroF 42929 43744 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_09320 43737 45062 gene locus_tag LOCUS_09330 43737 45062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 45073 46134 gene locus_tag LOCUS_09340 45073 46134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 49565 46146 gene locus_tag LOCUS_09350 49565 46146 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_09350 50946 49555 gene locus_tag LOCUS_09360 50946 49555 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_09360 51344 50943 gene locus_tag LOCUS_09370 51344 50943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 51376 51705 gene locus_tag LOCUS_09380 51376 51705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 53259 51649 gene locus_tag LOCUS_09390 53259 51649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 53207 53773 gene locus_tag LOCUS_09400 53207 53773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 55390 53858 gene locus_tag LOCUS_09410 55390 53858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 56183 55479 gene locus_tag LOCUS_09420 56183 55479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 57382 56357 gene locus_tag LOCUS_09430 57382 56357 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_09430 58603 57398 gene locus_tag LOCUS_09440 58603 57398 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_09440 59347 58640 gene locus_tag LOCUS_09450 59347 58640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 60460 62058 gene locus_tag LOCUS_09460 60460 62058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 62055 63971 gene locus_tag LOCUS_09470 62055 63971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 65306 63981 gene locus_tag LOCUS_09480 65306 63981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 65883 65329 gene locus_tag LOCUS_09490 gene rpoE 65883 65329 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_09490 66228 66632 gene locus_tag LOCUS_09500 66228 66632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 67885 66716 gene locus_tag LOCUS_09510 67885 66716 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_09510 68538 67903 gene locus_tag LOCUS_09520 68538 67903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 68687 69367 gene locus_tag LOCUS_09530 68687 69367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 70807 69356 gene locus_tag LOCUS_09540 gene rimO 70807 69356 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_09540 71580 70822 gene locus_tag LOCUS_09550 71580 70822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 72162 73265 gene locus_tag LOCUS_09560 72162 73265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 74171 73494 gene locus_tag LOCUS_09570 gene phoU 74171 73494 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_09570 75001 74180 gene locus_tag LOCUS_09580 gene pstB 75001 74180 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_09580 75863 75006 gene locus_tag LOCUS_09590 gene pstA 75863 75006 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256173.1 protein_id gnl|my_center|LOCUS_09590 76756 75872 gene locus_tag LOCUS_09600 gene pstC 76756 75872 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_09600 77775 76765 gene locus_tag LOCUS_09610 77775 76765 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_09610 79211 77970 gene locus_tag LOCUS_09620 79211 77970 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545208.1 protein_id gnl|my_center|LOCUS_09620 79939 79244 gene locus_tag LOCUS_09630 79939 79244 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_09630 80071 81189 gene locus_tag LOCUS_09640 80071 81189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 84005 81471 gene locus_tag LOCUS_09650 84005 81471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 84742 84104 gene locus_tag LOCUS_09660 84742 84104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 84861 85232 gene locus_tag LOCUS_09670 84861 85232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 86986 85367 gene locus_tag LOCUS_09680 86986 85367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 87434 88147 gene locus_tag LOCUS_09690 87434 88147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 88563 88384 gene locus_tag LOCUS_09700 88563 88384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 89246 89563 gene locus_tag LOCUS_09710 89246 89563 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212552.1 protein_id gnl|my_center|LOCUS_09710 91377 89560 gene locus_tag LOCUS_09720 gene aspS 91377 89560 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_09720 92489 91392 gene locus_tag LOCUS_09730 92489 91392 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929231.1 protein_id gnl|my_center|LOCUS_09730 93710 92499 gene locus_tag LOCUS_09740 gene alaC 93710 92499 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_09740 94633 93707 gene locus_tag LOCUS_09750 gene lipA 94633 93707 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071392.1 protein_id gnl|my_center|LOCUS_09750 95379 94654 gene locus_tag LOCUS_09760 95379 94654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 95420 96079 gene locus_tag LOCUS_09770 gene coaE 95420 96079 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_09770 96072 96740 gene locus_tag LOCUS_09780 gene purN 96072 96740 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532446.1 protein_id gnl|my_center|LOCUS_09780 97380 96934 gene locus_tag LOCUS_09790 97380 96934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 97772 98155 gene locus_tag LOCUS_09800 97772 98155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 98709 99035 gene locus_tag LOCUS_09810 98709 99035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 99041 100363 gene locus_tag LOCUS_09820 99041 100363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 100594 101571 gene locus_tag LOCUS_09830 100594 101571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 104010 102313 gene locus_tag LOCUS_09840 104010 102313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence08 557 1060 gene locus_tag LOCUS_09850 557 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1681 1160 gene locus_tag LOCUS_09860 1681 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 3347 1638 gene locus_tag LOCUS_09870 3347 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4056 3394 gene locus_tag LOCUS_09880 4056 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4455 4060 gene locus_tag LOCUS_09890 4455 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4796 4470 gene locus_tag LOCUS_09900 4796 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5116 4805 gene locus_tag LOCUS_09910 5116 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 7842 5113 gene locus_tag LOCUS_09920 7842 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 8383 7916 gene locus_tag LOCUS_09930 8383 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 8880 8401 gene locus_tag LOCUS_09940 8880 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10135 8942 gene locus_tag LOCUS_09950 10135 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 10970 10146 gene locus_tag LOCUS_09960 10970 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 11719 10970 gene locus_tag LOCUS_09970 11719 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 12156 11731 gene locus_tag LOCUS_09980 12156 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 12996 12169 gene locus_tag LOCUS_09990 12996 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 14601 13408 gene locus_tag LOCUS_10000 14601 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 15300 17513 gene locus_tag LOCUS_10010 15300 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 17517 19667 gene locus_tag LOCUS_10020 17517 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 19768 20376 gene locus_tag LOCUS_10030 19768 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 21920 20385 gene locus_tag LOCUS_10040 21920 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 22665 21928 gene locus_tag LOCUS_10050 22665 21928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 22749 23486 gene locus_tag LOCUS_10060 gene ubiE 22749 23486 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_10060 23486 24130 gene locus_tag LOCUS_10070 23486 24130 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391642.1 protein_id gnl|my_center|LOCUS_10070 24136 25212 gene locus_tag LOCUS_10080 24136 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 25236 26345 gene locus_tag LOCUS_10090 gene mqnE 25236 26345 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_10090 26360 28258 gene locus_tag LOCUS_10100 26360 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 28994 28284 gene locus_tag LOCUS_10110 gene rsmI 28994 28284 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016568902.1 protein_id gnl|my_center|LOCUS_10110 29051 30088 gene locus_tag LOCUS_10120 29051 30088 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_10120 30085 30825 gene locus_tag LOCUS_10130 30085 30825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 32004 31120 gene locus_tag LOCUS_10140 32004 31120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 36722 32007 gene locus_tag LOCUS_10150 36722 32007 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_10150 38076 36853 gene locus_tag LOCUS_10160 38076 36853 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_10160 38419 38048 gene locus_tag LOCUS_10170 38419 38048 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_10170 39440 38436 gene locus_tag LOCUS_10180 gene ispB 39440 38436 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693233.1 protein_id gnl|my_center|LOCUS_10180 39828 39753 gene locus_tag LOCUS_t00150 39828 39753 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 39946 40659 gene locus_tag LOCUS_10190 39946 40659 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257634.1 protein_id gnl|my_center|LOCUS_10190 41012 40940 gene locus_tag LOCUS_t00160 41012 40940 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 41361 41068 gene locus_tag LOCUS_10200 41361 41068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 41403 41972 gene locus_tag LOCUS_10210 gene rsmD 41403 41972 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104349.1 protein_id gnl|my_center|LOCUS_10210 41991 42476 gene locus_tag LOCUS_10220 gene coaD 41991 42476 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_10220 42541 42849 gene locus_tag LOCUS_10230 42541 42849 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_10230 43557 43482 gene locus_tag LOCUS_t00170 43557 43482 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 44595 43774 gene locus_tag LOCUS_10240 44595 43774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 45086 44808 gene locus_tag LOCUS_10250 45086 44808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 45326 46414 gene locus_tag LOCUS_10260 45326 46414 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_10260 46649 48025 gene locus_tag LOCUS_10270 gene purF 46649 48025 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546301.1 protein_id gnl|my_center|LOCUS_10270 48403 48038 gene locus_tag LOCUS_10280 48403 48038 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969154.1 protein_id gnl|my_center|LOCUS_10280 48646 48422 gene locus_tag LOCUS_10290 48646 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 48889 49425 gene locus_tag LOCUS_10300 48889 49425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 49431 49877 gene locus_tag LOCUS_10310 49431 49877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 51679 49874 gene locus_tag LOCUS_10320 51679 49874 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971371.1 protein_id gnl|my_center|LOCUS_10320 51832 53457 gene locus_tag LOCUS_10330 51832 53457 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_10330 53454 54800 gene locus_tag LOCUS_10340 53454 54800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 55098 54766 gene locus_tag LOCUS_10350 55098 54766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 55969 55091 gene locus_tag LOCUS_10360 55969 55091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 56550 55972 gene locus_tag LOCUS_10370 56550 55972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 57997 56552 gene locus_tag LOCUS_10380 57997 56552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 58864 58061 gene locus_tag LOCUS_10390 58864 58061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 59310 58861 gene locus_tag LOCUS_10400 59310 58861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 60032 59307 gene locus_tag LOCUS_10410 60032 59307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 60526 60074 gene locus_tag LOCUS_10420 gene gspG 60526 60074 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_10420 61046 60639 gene locus_tag LOCUS_10430 61046 60639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 61156 62838 gene locus_tag LOCUS_10440 61156 62838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 64598 63507 gene locus_tag LOCUS_10450 64598 63507 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244040.1 protein_id gnl|my_center|LOCUS_10450 66255 65035 gene locus_tag LOCUS_10460 66255 65035 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029466.1 protein_id gnl|my_center|LOCUS_10460 67909 66287 gene locus_tag LOCUS_10470 gene gspE 67909 66287 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138174.1 protein_id gnl|my_center|LOCUS_10470 70864 67931 gene locus_tag LOCUS_10480 70864 67931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 71761 70871 gene locus_tag LOCUS_10490 71761 70871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 72414 71857 gene locus_tag LOCUS_10500 72414 71857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 73121 72417 gene locus_tag LOCUS_10510 73121 72417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 73950 73363 gene locus_tag LOCUS_10520 73950 73363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 76387 74129 gene locus_tag LOCUS_10530 76387 74129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 76604 77182 gene locus_tag LOCUS_10540 gene pgsA 76604 77182 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_10540 77245 78597 gene locus_tag LOCUS_10550 77245 78597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 79550 78606 gene locus_tag LOCUS_10560 79550 78606 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_10560 79784 80428 gene locus_tag LOCUS_10570 79784 80428 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_10570 80596 83862 gene locus_tag LOCUS_10580 80596 83862 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_10580 83994 85313 gene locus_tag LOCUS_10590 83994 85313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence09 <1 1862 gene locus_tag LOCUS_10600 <1 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268402.1:heme lyase CcmF/NrfE family subunit 1855 2115 gene locus_tag LOCUS_10610 1855 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2115 2765 gene locus_tag LOCUS_10620 2115 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2762 3463 gene locus_tag LOCUS_10630 2762 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3478 4200 gene locus_tag LOCUS_10640 3478 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4210 4362 gene locus_tag LOCUS_10650 4210 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4359 5237 gene locus_tag LOCUS_10660 gene galU 4359 5237 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965632.1 protein_id gnl|my_center|LOCUS_10660 5250 9917 gene locus_tag LOCUS_10670 5250 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 9936 13595 gene locus_tag LOCUS_10680 gene metH 9936 13595 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970331.1 protein_id gnl|my_center|LOCUS_10680 13649 13903 gene locus_tag LOCUS_10690 13649 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 14316 13936 gene locus_tag LOCUS_10700 14316 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 15080 14313 gene locus_tag LOCUS_10710 15080 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 15660 16535 gene locus_tag LOCUS_10720 15660 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 17301 18290 gene locus_tag LOCUS_10730 17301 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 18464 18898 gene locus_tag LOCUS_10740 18464 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 19000 19461 gene locus_tag LOCUS_10750 19000 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 20733 19765 gene locus_tag LOCUS_10760 20733 19765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 21842 20865 gene locus_tag LOCUS_10770 21842 20865 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_10770 23335 21863 gene locus_tag LOCUS_10780 23335 21863 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_10780 23513 24616 gene locus_tag LOCUS_10790 23513 24616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 25310 24609 gene locus_tag LOCUS_10800 25310 24609 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932146.1 protein_id gnl|my_center|LOCUS_10800 25741 25316 gene locus_tag LOCUS_10810 25741 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 26439 25888 gene locus_tag LOCUS_10820 26439 25888 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_10820 26663 28678 gene locus_tag LOCUS_10830 gene tkt 26663 28678 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944033.1 protein_id gnl|my_center|LOCUS_10830 28888 29478 gene locus_tag LOCUS_10840 28888 29478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 29491 31125 gene locus_tag LOCUS_10850 29491 31125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 31697 31389 gene locus_tag LOCUS_10860 31697 31389 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069459013.1 protein_id gnl|my_center|LOCUS_10860 33413 31758 gene locus_tag LOCUS_10870 33413 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 33777 34844 gene locus_tag LOCUS_10880 33777 34844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 34850 36718 gene locus_tag LOCUS_10890 34850 36718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 36759 39524 gene locus_tag LOCUS_10900 36759 39524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 39528 42017 gene locus_tag LOCUS_10910 39528 42017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 42191 44326 gene locus_tag LOCUS_10920 42191 44326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 44329 46758 gene locus_tag LOCUS_10930 44329 46758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 46761 49559 gene locus_tag LOCUS_10940 46761 49559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 50626 49556 gene locus_tag LOCUS_10950 50626 49556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 51072 50629 gene locus_tag LOCUS_10960 51072 50629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 51318 51112 gene locus_tag LOCUS_10970 51318 51112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 52104 51433 gene locus_tag LOCUS_10980 52104 51433 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026784112.1 protein_id gnl|my_center|LOCUS_10980 52129 52761 gene locus_tag LOCUS_10990 52129 52761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 52882 53259 gene locus_tag LOCUS_11000 52882 53259 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_11000 55182 53305 gene locus_tag LOCUS_11010 55182 53305 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_11010 55248 56234 gene locus_tag LOCUS_11020 55248 56234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 56231 57025 gene locus_tag LOCUS_11030 56231 57025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 57009 57440 gene locus_tag LOCUS_11040 57009 57440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 57462 58679 gene locus_tag LOCUS_11050 57462 58679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 59269 58766 gene locus_tag LOCUS_11060 59269 58766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 59852 59301 gene locus_tag LOCUS_11070 59852 59301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 60066 60902 gene locus_tag LOCUS_11080 gene folE2 60066 60902 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_11080 62450 61116 gene locus_tag LOCUS_11090 62450 61116 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_11090 64809 62710 gene locus_tag LOCUS_11100 64809 62710 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_11100 66181 64781 gene locus_tag LOCUS_11110 gene lpdA 66181 64781 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_11110 66360 66435 gene locus_tag LOCUS_t00180 66360 66435 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66819 67523 gene locus_tag LOCUS_11120 gene rpiA 66819 67523 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790542.1 protein_id gnl|my_center|LOCUS_11120 67535 69043 gene locus_tag LOCUS_11130 gene proS 67535 69043 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_11130 69412 69675 gene locus_tag LOCUS_11140 69412 69675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 69675 70061 gene locus_tag LOCUS_11150 69675 70061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 71201 70242 gene locus_tag LOCUS_11160 71201 70242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 71404 72543 gene locus_tag LOCUS_11170 71404 72543 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_11170 72933 72625 gene locus_tag LOCUS_11180 72933 72625 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_11180 73239 72940 gene locus_tag LOCUS_11190 73239 72940 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_11190 74766 73414 gene locus_tag LOCUS_11200 74766 73414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 74866 75312 gene locus_tag LOCUS_11210 74866 75312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 77308 75380 gene locus_tag LOCUS_11220 77308 75380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 79784 77418 gene locus_tag LOCUS_11230 79784 77418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 79962 80960 gene locus_tag LOCUS_11240 79962 80960 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_11240 80941 82182 gene locus_tag LOCUS_11250 gene lpxB 80941 82182 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_11250 82236 84023 gene locus_tag LOCUS_11260 gene msbA 82236 84023 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_11260 84198 85301 gene locus_tag LOCUS_11270 84198 85301 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_11270 85492 86481 gene locus_tag LOCUS_11280 gene lpxK 85492 86481 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence10 2019 2396 gene locus_tag LOCUS_11290 2019 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2772 2434 gene locus_tag LOCUS_11300 2772 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3059 3262 gene locus_tag LOCUS_11310 3059 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3468 3632 gene locus_tag LOCUS_11320 3468 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4154 4816 gene locus_tag LOCUS_11330 4154 4816 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113115.1 protein_id gnl|my_center|LOCUS_11330 5948 5139 gene locus_tag LOCUS_11340 5948 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 6315 5959 gene locus_tag LOCUS_11350 6315 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6514 7959 gene locus_tag LOCUS_11360 6514 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8485 8904 gene locus_tag LOCUS_11370 8485 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 9956 8991 gene locus_tag LOCUS_11380 9956 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 10360 12234 gene locus_tag LOCUS_11390 10360 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13006 12353 gene locus_tag LOCUS_11400 13006 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 13152 13409 gene locus_tag LOCUS_11410 13152 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 13570 13487 gene locus_tag LOCUS_t00190 13570 13487 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14268 13756 gene locus_tag LOCUS_11420 14268 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 15060 14281 gene locus_tag LOCUS_11430 gene tpiA 15060 14281 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_11430 16086 15088 gene locus_tag LOCUS_11440 gene gap 16086 15088 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_11440 16536 17333 gene locus_tag LOCUS_11450 gene tolQ 16536 17333 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_11450 17475 17885 gene locus_tag LOCUS_11460 gene tolR 17475 17885 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_11460 17920 18855 gene locus_tag LOCUS_11470 17920 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 19583 19957 gene locus_tag LOCUS_11480 19583 19957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 19977 20864 gene locus_tag LOCUS_11490 19977 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 20877 22727 gene locus_tag LOCUS_11500 20877 22727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 22741 23103 gene locus_tag LOCUS_11510 22741 23103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 23208 24497 gene locus_tag LOCUS_11520 gene tolB 23208 24497 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_11520 24923 25387 gene locus_tag LOCUS_11530 gene pal 24923 25387 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_11530 25471 26211 gene locus_tag LOCUS_11540 25471 26211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 26230 27204 gene locus_tag LOCUS_11550 26230 27204 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930543.1 protein_id gnl|my_center|LOCUS_11550 27229 28224 gene locus_tag LOCUS_11560 27229 28224 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_11560 28227 28865 gene locus_tag LOCUS_11570 28227 28865 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463955.1 protein_id gnl|my_center|LOCUS_11570 28843 29625 gene locus_tag LOCUS_11580 gene pgeF 28843 29625 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518935.1 protein_id gnl|my_center|LOCUS_11580 29702 29935 gene locus_tag LOCUS_11590 29702 29935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 30117 31844 gene locus_tag LOCUS_11600 30117 31844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 34923 31855 gene locus_tag LOCUS_11610 34923 31855 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947422.1 protein_id gnl|my_center|LOCUS_11610 36391 35000 gene locus_tag LOCUS_11620 36391 35000 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096692.1 protein_id gnl|my_center|LOCUS_11620 37407 36919 gene locus_tag LOCUS_11630 37407 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 37738 38787 gene locus_tag LOCUS_11640 gene asd 37738 38787 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 protein_id gnl|my_center|LOCUS_11640 39055 38816 gene locus_tag LOCUS_11650 39055 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 39214 40008 gene locus_tag LOCUS_11660 gene truA 39214 40008 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_11660 42549 40156 gene locus_tag LOCUS_11670 gene mrcB 42549 40156 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197283.1 protein_id gnl|my_center|LOCUS_11670 42772 43491 gene locus_tag LOCUS_11680 42772 43491 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_11680 43494 44138 gene locus_tag LOCUS_11690 gene ruvA 43494 44138 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393643.1 protein_id gnl|my_center|LOCUS_11690 44363 45457 gene locus_tag LOCUS_11700 gene ruvB 44363 45457 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_11700 45719 47941 gene locus_tag LOCUS_11710 45719 47941 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_11710 48652 49512 gene locus_tag LOCUS_11720 48652 49512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 49673 50677 gene locus_tag LOCUS_11730 gene fbp 49673 50677 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_11730 50726 51292 gene locus_tag LOCUS_11740 50726 51292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 53552 51324 gene locus_tag LOCUS_11750 53552 51324 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_11750 53652 55046 gene locus_tag LOCUS_11760 53652 55046 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_11760 55128 56057 gene locus_tag LOCUS_11770 55128 56057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 56130 56543 gene locus_tag LOCUS_11780 56130 56543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 56609 56881 gene locus_tag LOCUS_11790 56609 56881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 56883 57281 gene locus_tag LOCUS_11800 56883 57281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 57811 57386 gene locus_tag LOCUS_11810 57811 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 58578 57958 gene locus_tag LOCUS_11820 58578 57958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 58891 59376 gene locus_tag LOCUS_11830 58891 59376 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_11830 59481 62942 gene locus_tag LOCUS_11840 gene dnaE 59481 62942 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_11840 62946 63974 gene locus_tag LOCUS_11850 62946 63974 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_11850 64342 63995 gene locus_tag LOCUS_11860 64342 63995 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_11860 64541 65986 gene locus_tag LOCUS_11870 gene dacB 64541 65986 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809423.1 protein_id gnl|my_center|LOCUS_11870 66063 67241 gene locus_tag LOCUS_11880 66063 67241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 67385 67945 gene locus_tag LOCUS_11890 67385 67945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 67965 69287 gene locus_tag LOCUS_11900 67965 69287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 70505 69528 gene locus_tag LOCUS_11910 70505 69528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 71103 71588 gene locus_tag LOCUS_11920 71103 71588 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_11920 71625 72143 gene locus_tag LOCUS_11930 71625 72143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 72859 72170 gene locus_tag LOCUS_11940 72859 72170 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201863.1 protein_id gnl|my_center|LOCUS_11940 73770 72856 gene locus_tag LOCUS_11950 73770 72856 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499591.1 protein_id gnl|my_center|LOCUS_11950 73833 74891 gene locus_tag LOCUS_11960 73833 74891 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_11960 74898 76985 gene locus_tag LOCUS_11970 gene uvrB 74898 76985 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11970 77816 77010 gene locus_tag LOCUS_11980 77816 77010 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_11980 77887 78327 gene locus_tag LOCUS_11990 77887 78327 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_11990 78347 79822 gene locus_tag LOCUS_12000 78347 79822 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_12000 79827 80843 gene locus_tag LOCUS_12010 79827 80843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 81100 82146 gene locus_tag LOCUS_12020 gene tsaD 81100 82146 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546527.1 protein_id gnl|my_center|LOCUS_12020 82146 83027 gene locus_tag LOCUS_12030 gene rsmA 82146 83027 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_12030 83333 83055 gene locus_tag LOCUS_12040 83333 83055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 84079 83600 gene locus_tag LOCUS_12050 84079 83600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 84938 84072 gene locus_tag LOCUS_12060 84938 84072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 84937 85134 gene locus_tag LOCUS_12070 84937 85134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 85141 85353 gene locus_tag LOCUS_12080 gene rpmE 85141 85353 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_12080 85397 85921 gene locus_tag LOCUS_12090 85397 85921 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence11 1264 2640 gene locus_tag LOCUS_12100 1264 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3042 2668 gene locus_tag LOCUS_12110 gene gcvH 3042 2668 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531953.1 protein_id gnl|my_center|LOCUS_12110 4201 3065 gene locus_tag LOCUS_12120 gene gcvT 4201 3065 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_12120 5095 4229 gene locus_tag LOCUS_12130 gene folD 5095 4229 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_12130 5247 6359 gene locus_tag LOCUS_12140 gene ald 5247 6359 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_12140 7128 6847 gene locus_tag LOCUS_12150 7128 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7942 7148 gene locus_tag LOCUS_12160 gene minD 7942 7148 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_12160 8969 7968 gene locus_tag LOCUS_12170 8969 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9203 10621 gene locus_tag LOCUS_12180 gene gltX 9203 10621 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_12180 11723 10746 gene locus_tag LOCUS_12190 11723 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 12034 12537 gene locus_tag LOCUS_12200 gene ftnA 12034 12537 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348910.1 protein_id gnl|my_center|LOCUS_12200 13598 12807 gene locus_tag LOCUS_12210 13598 12807 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 protein_id gnl|my_center|LOCUS_12210 13738 13665 gene locus_tag LOCUS_t00200 13738 13665 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13898 13971 gene locus_tag LOCUS_t00210 13898 13971 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14980 14333 gene locus_tag LOCUS_12220 gene rpoE 14980 14333 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_12220 15840 15229 gene locus_tag LOCUS_12230 15840 15229 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 protein_id gnl|my_center|LOCUS_12230 16678 16028 gene locus_tag LOCUS_12240 gene gmk 16678 16028 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_12240 17585 16683 gene locus_tag LOCUS_12250 17585 16683 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_12250 18571 17585 gene locus_tag LOCUS_12260 18571 17585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 19358 18579 gene locus_tag LOCUS_12270 19358 18579 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_12270 20385 19351 gene locus_tag LOCUS_12280 gene waaF 20385 19351 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_12280 21124 20405 gene locus_tag LOCUS_12290 21124 20405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 21842 21111 gene locus_tag LOCUS_12300 21842 21111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 22933 21839 gene locus_tag LOCUS_12310 22933 21839 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_12310 23862 22906 gene locus_tag LOCUS_12320 23862 22906 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_12320 24444 23875 gene locus_tag LOCUS_12330 gene gmhB 24444 23875 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_12330 25640 24627 gene locus_tag LOCUS_12340 25640 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 25950 26099 gene locus_tag LOCUS_12350 25950 26099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 26184 27266 gene locus_tag LOCUS_12360 26184 27266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 27301 28080 gene locus_tag LOCUS_12370 27301 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 28065 29018 gene locus_tag LOCUS_12380 gene rfbB 28065 29018 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 protein_id gnl|my_center|LOCUS_12380 29018 29707 gene locus_tag LOCUS_12390 29018 29707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 29725 30249 gene locus_tag LOCUS_12400 29725 30249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 30519 31190 gene locus_tag LOCUS_12410 30519 31190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 31603 31274 gene locus_tag LOCUS_12420 31603 31274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 33204 31828 gene locus_tag LOCUS_12430 gene argH 33204 31828 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_12430 33417 33860 gene locus_tag LOCUS_12440 gene argR 33417 33860 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_12440 33880 34935 gene locus_tag LOCUS_12450 33880 34935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404941.1 protein_id gnl|my_center|LOCUS_12450 34925 35989 gene locus_tag LOCUS_12460 gene argC 34925 35989 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879563.1 protein_id gnl|my_center|LOCUS_12460 35997 36995 gene locus_tag LOCUS_12470 35997 36995 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_12470 36992 37885 gene locus_tag LOCUS_12480 gene argB 36992 37885 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_12480 38012 39211 gene locus_tag LOCUS_12490 38012 39211 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_12490 39291 39671 gene locus_tag LOCUS_12500 39291 39671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 40335 39790 gene locus_tag LOCUS_12510 40335 39790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 40710 41798 gene locus_tag LOCUS_12520 40710 41798 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_12520 42672 41869 gene locus_tag LOCUS_12530 42672 41869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 43961 43131 gene locus_tag LOCUS_12540 43961 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 45660 44908 gene locus_tag LOCUS_12550 45660 44908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 45874 47088 gene locus_tag LOCUS_12560 45874 47088 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_12560 47178 47705 gene locus_tag LOCUS_12570 47178 47705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 48156 47746 gene locus_tag LOCUS_12580 48156 47746 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_12580 49274 48186 gene locus_tag LOCUS_12590 49274 48186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 49751 50491 gene locus_tag LOCUS_12600 49751 50491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 51073 50891 gene locus_tag LOCUS_12610 51073 50891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 51909 51106 gene locus_tag LOCUS_12620 51909 51106 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_12620 51957 52358 gene locus_tag LOCUS_12630 51957 52358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 52837 52761 gene locus_tag LOCUS_t00220 52837 52761 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 53642 52890 gene locus_tag LOCUS_12640 53642 52890 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 protein_id gnl|my_center|LOCUS_12640 53855 55855 gene locus_tag LOCUS_12650 gene dxs 53855 55855 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_12650 56135 56785 gene locus_tag LOCUS_12660 56135 56785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 57374 56868 gene locus_tag LOCUS_12670 57374 56868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 59575 57977 gene locus_tag LOCUS_12680 59575 57977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 60258 59572 gene locus_tag LOCUS_12690 60258 59572 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538099.1 protein_id gnl|my_center|LOCUS_12690 60497 61006 gene locus_tag LOCUS_12700 60497 61006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 62593 61121 gene locus_tag LOCUS_12710 gene lnt 62593 61121 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_12710 64153 62867 gene locus_tag LOCUS_12720 gene eno 64153 62867 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_12720 64295 64600 gene locus_tag LOCUS_12730 64295 64600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 64611 64958 gene locus_tag LOCUS_12740 64611 64958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 64989 66257 gene locus_tag LOCUS_12750 gene tyrS 64989 66257 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_12750 66269 68086 gene locus_tag LOCUS_12760 66269 68086 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_12760 68132 69292 gene locus_tag LOCUS_12770 68132 69292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 69442 69369 gene locus_tag LOCUS_t00230 69442 69369 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 70199 69468 gene locus_tag LOCUS_12780 70199 69468 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_12780 70893 70231 gene locus_tag LOCUS_12790 70893 70231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 71630 70917 gene locus_tag LOCUS_12800 gene lepB 71630 70917 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938005.1 protein_id gnl|my_center|LOCUS_12800 73454 71646 gene locus_tag LOCUS_12810 gene lepA 73454 71646 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_12810 74409 73441 gene locus_tag LOCUS_12820 74409 73441 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_12820 75353 74409 gene locus_tag LOCUS_12830 75353 74409 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_12830 76831 75506 gene locus_tag LOCUS_12840 76831 75506 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_12840 78386 76962 gene locus_tag LOCUS_12850 78386 76962 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_12850 79576 78401 gene locus_tag LOCUS_12860 79576 78401 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_12860 80735 79578 gene locus_tag LOCUS_12870 80735 79578 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 protein_id gnl|my_center|LOCUS_12870 81898 80798 gene locus_tag LOCUS_12880 81898 80798 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_12880 83300 83854 gene locus_tag LOCUS_12890 83300 83854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence12 397 603 gene locus_tag LOCUS_12900 397 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 634 915 gene locus_tag LOCUS_12910 gene rpsQ 634 915 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_12910 953 1321 gene locus_tag LOCUS_12920 gene rplN 953 1321 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536525.1 protein_id gnl|my_center|LOCUS_12920 1325 1711 gene locus_tag LOCUS_12930 gene rplX 1325 1711 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943475.1 protein_id gnl|my_center|LOCUS_12930 1744 2280 gene locus_tag LOCUS_12940 gene rplE 1744 2280 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_12940 2324 2722 gene locus_tag LOCUS_12950 gene rpsH 2324 2722 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975181.1 protein_id gnl|my_center|LOCUS_12950 2740 3288 gene locus_tag LOCUS_12960 gene rplF 2740 3288 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_12960 3311 3673 gene locus_tag LOCUS_12970 gene rplR 3311 3673 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_12970 3712 4275 gene locus_tag LOCUS_12980 gene rpsE 3712 4275 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_12980 4295 4483 gene locus_tag LOCUS_12990 gene rpmD 4295 4483 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_12990 4507 4971 gene locus_tag LOCUS_13000 gene rplO 4507 4971 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_13000 5073 6422 gene locus_tag LOCUS_13010 gene secY 5073 6422 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_13010 6453 7010 gene locus_tag LOCUS_13020 6453 7010 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_13020 7022 7804 gene locus_tag LOCUS_13030 gene map 7022 7804 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_13030 8037 8417 gene locus_tag LOCUS_13040 gene rpsM 8037 8417 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_13040 8465 8893 gene locus_tag LOCUS_13050 gene rpsK 8465 8893 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_13050 8952 9578 gene locus_tag LOCUS_13060 gene rpsD 8952 9578 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_13060 9611 10639 gene locus_tag LOCUS_13070 9611 10639 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_13070 10663 11172 gene locus_tag LOCUS_13080 gene rplQ 10663 11172 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 protein_id gnl|my_center|LOCUS_13080 11186 11953 gene locus_tag LOCUS_13090 11186 11953 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_13090 12080 12685 gene locus_tag LOCUS_13100 12080 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 12682 13668 gene locus_tag LOCUS_13110 12682 13668 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_13110 13668 15338 gene locus_tag LOCUS_13120 13668 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 15352 15792 gene locus_tag LOCUS_13130 15352 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 16819 15800 gene locus_tag LOCUS_13140 16819 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 17025 17678 gene locus_tag LOCUS_13150 17025 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 19603 17690 gene locus_tag LOCUS_13160 19603 17690 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660465.1 protein_id gnl|my_center|LOCUS_13160 21342 19630 gene locus_tag LOCUS_13170 gene argS 21342 19630 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_13170 21707 22258 gene locus_tag LOCUS_13180 21707 22258 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_13180 22423 25386 gene locus_tag LOCUS_13190 22423 25386 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_13190 25405 26736 gene locus_tag LOCUS_13200 gene nrfD 25405 26736 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_13200 26758 27282 gene locus_tag LOCUS_13210 26758 27282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 27272 27859 gene locus_tag LOCUS_13220 27272 27859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 27871 29205 gene locus_tag LOCUS_13230 27871 29205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_13230 29965 30867 gene locus_tag LOCUS_13240 29965 30867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 31000 33249 gene locus_tag LOCUS_13250 31000 33249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 34444 33254 gene locus_tag LOCUS_13260 34444 33254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 34549 35184 gene locus_tag LOCUS_13270 34549 35184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 35400 36125 gene locus_tag LOCUS_13280 35400 36125 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_13280 36267 36734 gene locus_tag LOCUS_13290 36267 36734 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_13290 36737 37072 gene locus_tag LOCUS_13300 36737 37072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 37069 37638 gene locus_tag LOCUS_13310 37069 37638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 37985 38431 gene locus_tag LOCUS_13320 37985 38431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 39686 38433 gene locus_tag LOCUS_13330 39686 38433 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461867.1 protein_id gnl|my_center|LOCUS_13330 40179 39916 gene locus_tag LOCUS_13340 40179 39916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 40447 41688 gene locus_tag LOCUS_13350 40447 41688 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103263.1 protein_id gnl|my_center|LOCUS_13350 41685 42275 gene locus_tag LOCUS_13360 41685 42275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 43195 42278 gene locus_tag LOCUS_13370 gene htpX 43195 42278 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264281.1 protein_id gnl|my_center|LOCUS_13370 43393 49605 gene locus_tag LOCUS_13380 43393 49605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 50005 49595 gene locus_tag LOCUS_13390 50005 49595 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_13390 50310 50002 gene locus_tag LOCUS_13400 50310 50002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 50918 50313 gene locus_tag LOCUS_13410 50918 50313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 51026 51592 gene locus_tag LOCUS_13420 51026 51592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 53815 51752 gene locus_tag LOCUS_13430 gene feoB 53815 51752 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_13430 54081 53827 gene locus_tag LOCUS_13440 gene feoA 54081 53827 CDS product ferrous iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948358.1 protein_id gnl|my_center|LOCUS_13440 54371 56245 gene locus_tag LOCUS_13450 54371 56245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 56950 56324 gene locus_tag LOCUS_13460 56950 56324 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_13460 57297 56962 gene locus_tag LOCUS_13470 57297 56962 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_13470 58853 57435 gene locus_tag LOCUS_13480 gene thiC 58853 57435 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_13480 58983 59858 gene locus_tag LOCUS_13490 gene ubiA 58983 59858 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_13490 60846 60022 gene locus_tag LOCUS_13500 60846 60022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_13500 61113 60859 gene locus_tag LOCUS_13510 61113 60859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 61159 61860 gene locus_tag LOCUS_13520 61159 61860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 62100 61891 gene locus_tag LOCUS_13530 62100 61891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 62261 63106 gene locus_tag LOCUS_13540 gene thyX 62261 63106 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_13540 63187 63306 gene locus_tag LOCUS_13550 63187 63306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 63380 63904 gene locus_tag LOCUS_13560 63380 63904 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020434.1 protein_id gnl|my_center|LOCUS_13560 64149 63868 gene locus_tag LOCUS_13570 64149 63868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 64536 65891 gene locus_tag LOCUS_13580 64536 65891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 66384 65944 gene locus_tag LOCUS_13590 66384 65944 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_13590 66565 67122 gene locus_tag LOCUS_13600 66565 67122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 67471 68511 gene locus_tag LOCUS_13610 gene plsX 67471 68511 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_13610 68535 69275 gene locus_tag LOCUS_13620 gene fabG 68535 69275 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_13620 69459 69701 gene locus_tag LOCUS_13630 gene acpP 69459 69701 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_13630 69824 70276 gene locus_tag LOCUS_13640 gene nrdR 69824 70276 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_13640 70302 71333 gene locus_tag LOCUS_13650 gene ribD 70302 71333 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150441.1 protein_id gnl|my_center|LOCUS_13650 71803 72135 gene locus_tag LOCUS_13660 71803 72135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 72135 73379 gene locus_tag LOCUS_13670 72135 73379 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_13670 73511 73690 gene locus_tag LOCUS_13680 73511 73690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 74911 73844 gene locus_tag LOCUS_13690 gene cax 74911 73844 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395855.1 protein_id gnl|my_center|LOCUS_13690 75044 76087 gene locus_tag LOCUS_13700 75044 76087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 77043 76153 gene locus_tag LOCUS_13710 77043 76153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 77197 79305 gene locus_tag LOCUS_13720 77197 79305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 79302 79607 gene locus_tag LOCUS_13730 79302 79607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 79676 81778 gene locus_tag LOCUS_13740 79676 81778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence13 1533 3272 gene locus_tag LOCUS_13750 gene dnaX 1533 3272 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_13750 3272 3907 gene locus_tag LOCUS_13760 gene recR 3272 3907 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886844.1 protein_id gnl|my_center|LOCUS_13760 4509 3919 gene locus_tag LOCUS_13770 4509 3919 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_13770 5240 4557 gene locus_tag LOCUS_13780 5240 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6606 5224 gene locus_tag LOCUS_13790 6606 5224 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_13790 7391 6609 gene locus_tag LOCUS_13800 7391 6609 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13800 7502 7966 gene locus_tag LOCUS_13810 7502 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8119 7901 gene locus_tag LOCUS_13820 8119 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8355 9500 gene locus_tag LOCUS_13830 8355 9500 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_13830 9802 10818 gene locus_tag LOCUS_13840 9802 10818 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_13840 13200 11143 gene locus_tag LOCUS_13850 gene pcrA 13200 11143 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_13850 13539 13315 gene locus_tag LOCUS_13860 13539 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 13663 14298 gene locus_tag LOCUS_13870 13663 14298 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958173.1 protein_id gnl|my_center|LOCUS_13870 14304 15110 gene locus_tag LOCUS_13880 14304 15110 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_13880 15112 15855 gene locus_tag LOCUS_13890 15112 15855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_13890 15973 17064 gene locus_tag LOCUS_13900 15973 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 17153 17617 gene locus_tag LOCUS_13910 gene mlaD 17153 17617 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_13910 17637 18239 gene locus_tag LOCUS_13920 17637 18239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_13920 19531 18287 gene locus_tag LOCUS_13930 gene hemW 19531 18287 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_13930 20296 19550 gene locus_tag LOCUS_13940 20296 19550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 20932 20315 gene locus_tag LOCUS_13950 gene lepB 20932 20315 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_13950 21339 21022 gene locus_tag LOCUS_13960 21339 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 21872 21435 gene locus_tag LOCUS_13970 21872 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 22042 23670 gene locus_tag LOCUS_13980 gene pilB 22042 23670 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_13980 23891 24136 gene locus_tag LOCUS_13990 23891 24136 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_13990 24117 24410 gene locus_tag LOCUS_14000 24117 24410 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 protein_id gnl|my_center|LOCUS_14000 25389 24508 gene locus_tag LOCUS_14010 25389 24508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 26226 25768 gene locus_tag LOCUS_14020 26226 25768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 26382 28181 gene locus_tag LOCUS_14030 gene recJ 26382 28181 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938203.1 protein_id gnl|my_center|LOCUS_14030 28664 29668 gene locus_tag LOCUS_14040 28664 29668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 29749 30576 gene locus_tag LOCUS_14050 gene suhB 29749 30576 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370312.1 protein_id gnl|my_center|LOCUS_14050 31384 30569 gene locus_tag LOCUS_14060 31384 30569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 31539 32387 gene locus_tag LOCUS_14070 31539 32387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 32392 33057 gene locus_tag LOCUS_14080 32392 33057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 33059 33682 gene locus_tag LOCUS_14090 gene ehuA 33059 33682 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272242.1 protein_id gnl|my_center|LOCUS_14090 33814 34566 gene locus_tag LOCUS_14100 33814 34566 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861417.1 protein_id gnl|my_center|LOCUS_14100 34576 35616 gene locus_tag LOCUS_14110 34576 35616 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_14110 35822 36481 gene locus_tag LOCUS_14120 35822 36481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 38743 36779 gene locus_tag LOCUS_14130 38743 36779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 40622 38853 gene locus_tag LOCUS_14140 40622 38853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 41916 40738 gene locus_tag LOCUS_14150 41916 40738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 42110 42520 gene locus_tag LOCUS_14160 42110 42520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 43330 42602 gene locus_tag LOCUS_14170 43330 42602 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_14170 43450 43809 gene locus_tag LOCUS_14180 gene rplS 43450 43809 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436293.1 protein_id gnl|my_center|LOCUS_14180 44800 44099 gene locus_tag LOCUS_14190 44800 44099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 47016 44917 gene locus_tag LOCUS_14200 47016 44917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 47977 47009 gene locus_tag LOCUS_14210 47977 47009 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868892.1 protein_id gnl|my_center|LOCUS_14210 48292 48005 gene locus_tag LOCUS_14220 48292 48005 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 protein_id gnl|my_center|LOCUS_14220 48511 49458 gene locus_tag LOCUS_14230 gene nadA 48511 49458 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_14230 49467 50627 gene locus_tag LOCUS_14240 49467 50627 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_14240 51355 50822 gene locus_tag LOCUS_14250 51355 50822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 52235 51564 gene locus_tag LOCUS_14260 52235 51564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 52714 52394 gene locus_tag LOCUS_14270 52714 52394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 54600 52732 gene locus_tag LOCUS_14280 gene glmS 54600 52732 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_14280 56037 54610 gene locus_tag LOCUS_14290 56037 54610 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_14290 56204 56794 gene locus_tag LOCUS_14300 56204 56794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 57242 56826 gene locus_tag LOCUS_14310 57242 56826 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356559.1 protein_id gnl|my_center|LOCUS_14310 58725 57262 gene locus_tag LOCUS_14320 gene atpD 58725 57262 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_14320 59570 58764 gene locus_tag LOCUS_14330 gene atpG 59570 58764 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544924.1 protein_id gnl|my_center|LOCUS_14330 61251 59668 gene locus_tag LOCUS_14340 gene atpA 61251 59668 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_14340 61876 61295 gene locus_tag LOCUS_14350 gene atpH 61876 61295 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_14350 62390 61881 gene locus_tag LOCUS_14360 62390 61881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 62836 62399 gene locus_tag LOCUS_14370 62836 62399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 63209 62862 gene locus_tag LOCUS_14380 63209 62862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 63381 64364 gene locus_tag LOCUS_14390 63381 64364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 65855 64572 gene locus_tag LOCUS_14400 65855 64572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 66717 65890 gene locus_tag LOCUS_14410 66717 65890 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546810.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence14 1085 795 gene locus_tag LOCUS_14420 1085 795 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015462.1 protein_id gnl|my_center|LOCUS_14420 1334 1615 gene locus_tag LOCUS_14430 1334 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2840 2112 gene locus_tag LOCUS_14440 2840 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3945 3181 gene locus_tag LOCUS_14450 3945 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4685 3942 gene locus_tag LOCUS_14460 4685 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6446 4848 gene locus_tag LOCUS_14470 6446 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 10257 6535 gene locus_tag LOCUS_14480 gene purL 10257 6535 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_14480 11753 10260 gene locus_tag LOCUS_14490 11753 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 12875 11754 gene locus_tag LOCUS_14500 12875 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 12962 14140 gene locus_tag LOCUS_14510 12962 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 14140 14691 gene locus_tag LOCUS_14520 gene def 14140 14691 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 protein_id gnl|my_center|LOCUS_14520 14706 15692 gene locus_tag LOCUS_14530 gene fmt 14706 15692 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958586.1 protein_id gnl|my_center|LOCUS_14530 15685 16344 gene locus_tag LOCUS_14540 gene rpe 15685 16344 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_14540 16520 16972 gene locus_tag LOCUS_14550 16520 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 17092 17721 gene locus_tag LOCUS_14560 gene plsY 17092 17721 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_14560 17730 18698 gene locus_tag LOCUS_14570 gene rfaD 17730 18698 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932927.1 protein_id gnl|my_center|LOCUS_14570 19801 18836 gene locus_tag LOCUS_14580 19801 18836 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_14580 21991 19928 gene locus_tag LOCUS_14590 21991 19928 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_14590 22067 22453 gene locus_tag LOCUS_14600 22067 22453 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_14600 22664 22461 gene locus_tag LOCUS_14610 22664 22461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 23384 24640 gene locus_tag LOCUS_14620 gene clpX 23384 24640 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_14620 25421 24720 gene locus_tag LOCUS_14630 25421 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 26656 25532 gene locus_tag LOCUS_14640 26656 25532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 27045 26695 gene locus_tag LOCUS_14650 27045 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 27743 27219 gene locus_tag LOCUS_14660 gene lspA 27743 27219 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_14660 30966 27721 gene locus_tag LOCUS_14670 gene ileS 30966 27721 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873497.1 protein_id gnl|my_center|LOCUS_14670 32224 30989 gene locus_tag LOCUS_14680 32224 30989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 32335 33507 gene locus_tag LOCUS_14690 32335 33507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 35445 34033 gene locus_tag LOCUS_14700 35445 34033 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_14700 35623 36003 gene locus_tag LOCUS_14710 35623 36003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 36013 36324 gene locus_tag LOCUS_14720 36013 36324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 36306 37088 gene locus_tag LOCUS_14730 36306 37088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 37099 37941 gene locus_tag LOCUS_14740 37099 37941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 39380 37974 gene locus_tag LOCUS_14750 gene sufB 39380 37974 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_14750 39718 40089 gene locus_tag LOCUS_14760 39718 40089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 40112 40756 gene locus_tag LOCUS_14770 gene tmk 40112 40756 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546833.1 protein_id gnl|my_center|LOCUS_14770 40774 41799 gene locus_tag LOCUS_14780 40774 41799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 41820 43790 gene locus_tag LOCUS_14790 gene metG 41820 43790 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_14790 43796 45481 gene locus_tag LOCUS_14800 43796 45481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 45710 46276 gene locus_tag LOCUS_14810 45710 46276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 46727 46362 gene locus_tag LOCUS_14820 46727 46362 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_14820 46909 46724 gene locus_tag LOCUS_14830 46909 46724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 47047 47871 gene locus_tag LOCUS_14840 47047 47871 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946646.1 protein_id gnl|my_center|LOCUS_14840 47873 48628 gene locus_tag LOCUS_14850 47873 48628 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763098.1 protein_id gnl|my_center|LOCUS_14850 49193 48768 gene locus_tag LOCUS_14860 49193 48768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 49434 50201 gene locus_tag LOCUS_14870 49434 50201 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_14870 50254 50784 gene locus_tag LOCUS_14880 50254 50784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 51264 50935 gene locus_tag LOCUS_14890 51264 50935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 52781 51261 gene locus_tag LOCUS_14900 52781 51261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 52854 53897 gene locus_tag LOCUS_14910 52854 53897 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_14910 53908 54969 gene locus_tag LOCUS_14920 gene ykfB 53908 54969 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_14920 55165 54914 gene locus_tag LOCUS_14930 55165 54914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 55631 55182 gene locus_tag LOCUS_14940 55631 55182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 56075 55725 gene locus_tag LOCUS_14950 56075 55725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 56600 56510 gene locus_tag LOCUS_t00240 56600 56510 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57284 56853 gene locus_tag LOCUS_14960 gene tadA 57284 56853 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_14960 58283 58207 gene locus_tag LOCUS_t00250 58283 58207 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58473 58563 gene locus_tag LOCUS_t00260 58473 58563 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 816 331 gene locus_tag LOCUS_14970 816 331 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_14970 1019 1645 gene locus_tag LOCUS_14980 1019 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1648 2865 gene locus_tag LOCUS_14990 gene nuoD 1648 2865 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_14990 3119 3679 gene locus_tag LOCUS_15000 gene nuoE 3119 3679 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_15000 3718 5049 gene locus_tag LOCUS_15010 gene nuoF 3718 5049 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_15010 5060 6787 gene locus_tag LOCUS_15020 5060 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6797 7906 gene locus_tag LOCUS_15030 gene nuoH 6797 7906 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_15030 7934 8536 gene locus_tag LOCUS_15040 7934 8536 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_15040 8517 8849 gene locus_tag LOCUS_15050 gene nuoK 8517 8849 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_15050 8849 10792 gene locus_tag LOCUS_15060 gene nuoL 8849 10792 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_15060 10796 12301 gene locus_tag LOCUS_15070 10796 12301 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_15070 12298 13761 gene locus_tag LOCUS_15080 12298 13761 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_15080 13758 15077 gene locus_tag LOCUS_15090 gene purB 13758 15077 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_15090 15080 15322 gene locus_tag LOCUS_15100 15080 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 15340 16023 gene locus_tag LOCUS_15110 gene purQ 15340 16023 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369271.1 protein_id gnl|my_center|LOCUS_15110 17161 16844 gene locus_tag LOCUS_15120 17161 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 18551 17235 gene locus_tag LOCUS_15130 gene pepP 18551 17235 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444958.1 protein_id gnl|my_center|LOCUS_15130 18686 19084 gene locus_tag LOCUS_15140 18686 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 19089 19931 gene locus_tag LOCUS_15150 gene dapF 19089 19931 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_15150 19953 20816 gene locus_tag LOCUS_15160 gene dapA 19953 20816 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_15160 20819 21589 gene locus_tag LOCUS_15170 gene dapB 20819 21589 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_15170 23478 21955 gene locus_tag LOCUS_15180 23478 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 23927 23478 gene locus_tag LOCUS_15190 23927 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 25440 23929 gene locus_tag LOCUS_15200 25440 23929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 27103 25430 gene locus_tag LOCUS_15210 27103 25430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 27292 28860 gene locus_tag LOCUS_15220 27292 28860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 28862 29035 gene locus_tag LOCUS_15230 28862 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 29067 29285 gene locus_tag LOCUS_15240 29067 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 29325 30404 gene locus_tag LOCUS_15250 29325 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 30382 31800 gene locus_tag LOCUS_15260 30382 31800 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_15260 31816 32742 gene locus_tag LOCUS_15270 31816 32742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 32739 33656 gene locus_tag LOCUS_15280 32739 33656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 33860 34468 gene locus_tag LOCUS_15290 33860 34468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 34604 35779 gene locus_tag LOCUS_15300 34604 35779 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_15300 35807 36250 gene locus_tag LOCUS_15310 35807 36250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 36783 37226 gene locus_tag LOCUS_15320 36783 37226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 37970 37389 gene locus_tag LOCUS_15330 37970 37389 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_15330 38801 37980 gene locus_tag LOCUS_15340 38801 37980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 39382 38810 gene locus_tag LOCUS_15350 39382 38810 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_15350 40767 39394 gene locus_tag LOCUS_15360 gene miaB 40767 39394 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880136.1 protein_id gnl|my_center|LOCUS_15360 41671 40793 gene locus_tag LOCUS_15370 41671 40793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 42090 41695 gene locus_tag LOCUS_15380 42090 41695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 42364 42107 gene locus_tag LOCUS_15390 42364 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 42678 43490 gene locus_tag LOCUS_15400 42678 43490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_15400 43598 44521 gene locus_tag LOCUS_15410 gene speB 43598 44521 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_15410 44547 46472 gene locus_tag LOCUS_15420 gene speA 44547 46472 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_15420 47827 47105 gene locus_tag LOCUS_15430 47827 47105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15430 48104 47934 gene locus_tag LOCUS_15440 48104 47934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 48185 48442 gene locus_tag LOCUS_15450 48185 48442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 48693 49274 gene locus_tag LOCUS_15460 48693 49274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 49755 49354 gene locus_tag LOCUS_15470 49755 49354 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_15470 <51611 50063 gene locus_tag LOCUS_15480 <51611 50063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228394.1:methylmalonyl-CoA mutase family protein >Feature sequence16 1327 149 gene locus_tag LOCUS_15490 gene alr 1327 149 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181633.1 protein_id gnl|my_center|LOCUS_15490 1828 1412 gene locus_tag LOCUS_15500 1828 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1928 2917 gene locus_tag LOCUS_15510 1928 2917 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_15510 2917 3807 gene locus_tag LOCUS_15520 2917 3807 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_15520 3797 4381 gene locus_tag LOCUS_15530 3797 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4381 5364 gene locus_tag LOCUS_15540 4381 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 5361 7310 gene locus_tag LOCUS_15550 5361 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 7321 9255 gene locus_tag LOCUS_15560 7321 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 9252 9983 gene locus_tag LOCUS_15570 9252 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 11092 9980 gene locus_tag LOCUS_15580 11092 9980 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_15580 11896 11588 gene locus_tag LOCUS_15590 11896 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 12893 11922 gene locus_tag LOCUS_15600 12893 11922 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_15600 13468 13091 gene locus_tag LOCUS_15610 13468 13091 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_15610 14051 17317 gene locus_tag LOCUS_15620 14051 17317 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873439.1 protein_id gnl|my_center|LOCUS_15620 17369 18457 gene locus_tag LOCUS_15630 17369 18457 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_15630 19309 19797 gene locus_tag LOCUS_15640 19309 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 20979 20092 gene locus_tag LOCUS_15650 gene lpxI 20979 20092 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_15650 21797 20994 gene locus_tag LOCUS_15660 gene lpxA 21797 20994 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 protein_id gnl|my_center|LOCUS_15660 22268 21810 gene locus_tag LOCUS_15670 gene fabZ 22268 21810 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_15670 22808 22296 gene locus_tag LOCUS_15680 22808 22296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 23667 22933 gene locus_tag LOCUS_15690 gene cmoA 23667 22933 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_15690 23680 24567 gene locus_tag LOCUS_15700 23680 24567 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948525.1 protein_id gnl|my_center|LOCUS_15700 24648 25271 gene locus_tag LOCUS_15710 24648 25271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 25290 25919 gene locus_tag LOCUS_15720 25290 25919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 27651 25897 gene locus_tag LOCUS_15730 27651 25897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 28124 27666 gene locus_tag LOCUS_15740 28124 27666 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765622.1 protein_id gnl|my_center|LOCUS_15740 29168 28137 gene locus_tag LOCUS_15750 29168 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 29219 30328 gene locus_tag LOCUS_15760 gene corA 29219 30328 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_15760 30936 30370 gene locus_tag LOCUS_15770 30936 30370 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404639.1 protein_id gnl|my_center|LOCUS_15770 30940 31425 gene locus_tag LOCUS_15780 30940 31425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 31895 31437 gene locus_tag LOCUS_15790 31895 31437 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 protein_id gnl|my_center|LOCUS_15790 31990 32547 gene locus_tag LOCUS_15800 gene efp 31990 32547 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626504.1 protein_id gnl|my_center|LOCUS_15800 34261 32582 gene locus_tag LOCUS_15810 34261 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 34226 34996 gene locus_tag LOCUS_15820 34226 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 35047 36219 gene locus_tag LOCUS_15830 35047 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 36747 36241 gene locus_tag LOCUS_15840 36747 36241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 38231 36798 gene locus_tag LOCUS_15850 38231 36798 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_15850 39123 38248 gene locus_tag LOCUS_15860 39123 38248 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057477.1 protein_id gnl|my_center|LOCUS_15860 39265 39582 gene locus_tag LOCUS_15870 39265 39582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 39707 40951 gene locus_tag LOCUS_15880 39707 40951 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_15880 41149 41514 gene locus_tag LOCUS_15890 41149 41514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 42456 41488 gene locus_tag LOCUS_15900 42456 41488 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171654.1 protein_id gnl|my_center|LOCUS_15900 43240 42434 gene locus_tag LOCUS_15910 43240 42434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 43976 43650 gene locus_tag LOCUS_15920 43976 43650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 45299 44148 gene locus_tag LOCUS_15930 45299 44148 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_15930 45966 45577 gene locus_tag LOCUS_15940 45966 45577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence17 251 1363 gene locus_tag LOCUS_15950 251 1363 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036455.1 protein_id gnl|my_center|LOCUS_15950 1671 1405 gene locus_tag LOCUS_15960 1671 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1916 1671 gene locus_tag LOCUS_15970 1916 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3132 1924 gene locus_tag LOCUS_15980 3132 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3385 3143 gene locus_tag LOCUS_15990 3385 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3457 4185 gene locus_tag LOCUS_16000 3457 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5692 4187 gene locus_tag LOCUS_16010 5692 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 6427 5834 gene locus_tag LOCUS_16020 6427 5834 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_16020 6612 8627 gene locus_tag LOCUS_16030 6612 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 8627 9967 gene locus_tag LOCUS_16040 8627 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 10150 12546 gene locus_tag LOCUS_16050 10150 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 12569 13969 gene locus_tag LOCUS_16060 12569 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 14255 16309 gene locus_tag LOCUS_16070 14255 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 16448 16828 gene locus_tag LOCUS_16080 16448 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 16921 17238 gene locus_tag LOCUS_16090 16921 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 17256 17597 gene locus_tag LOCUS_16100 17256 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 17982 17743 gene locus_tag LOCUS_16110 gene rpmB 17982 17743 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809459.1 protein_id gnl|my_center|LOCUS_16110 19412 18219 gene locus_tag LOCUS_16120 gene recA 19412 18219 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532151.1 protein_id gnl|my_center|LOCUS_16120 20144 19470 gene locus_tag LOCUS_16130 gene lexA 20144 19470 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_16130 20295 20981 gene locus_tag LOCUS_16140 20295 20981 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505733.1 protein_id gnl|my_center|LOCUS_16140 21627 21953 gene locus_tag LOCUS_16150 21627 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 21957 23165 gene locus_tag LOCUS_16160 21957 23165 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_16160 24112 23711 gene locus_tag LOCUS_16170 24112 23711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 24174 25550 gene locus_tag LOCUS_16180 24174 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 25538 27037 gene locus_tag LOCUS_16190 25538 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 27315 27241 gene locus_tag LOCUS_t00270 27315 27241 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27856 28764 gene locus_tag LOCUS_16200 27856 28764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 28707 29000 gene locus_tag LOCUS_16210 28707 29000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 29118 28972 gene locus_tag LOCUS_16220 29118 28972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 29288 30871 gene locus_tag LOCUS_16230 29288 30871 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_16230 31025 33025 gene locus_tag LOCUS_16240 31025 33025 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768562.1 protein_id gnl|my_center|LOCUS_16240 33441 33112 gene locus_tag LOCUS_16250 33441 33112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 33630 36602 gene locus_tag LOCUS_16260 gene pruA 33630 36602 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940575.1 protein_id gnl|my_center|LOCUS_16260 36922 39141 gene locus_tag LOCUS_16270 36922 39141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 39138 40607 gene locus_tag LOCUS_16280 39138 40607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 40604 41011 gene locus_tag LOCUS_16290 40604 41011 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_16290 41179 41850 gene locus_tag LOCUS_16300 41179 41850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 42440 42057 gene locus_tag LOCUS_16310 42440 42057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 43376 42612 gene locus_tag LOCUS_16320 43376 42612 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_16320 44858 43410 gene locus_tag LOCUS_16330 44858 43410 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_16330 45450 44881 gene locus_tag LOCUS_16340 45450 44881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence18 <1 515 gene locus_tag LOCUS_16350 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142923.1:penicillin-binding protein 2 606 2114 gene locus_tag LOCUS_16360 606 2114 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946652.1 protein_id gnl|my_center|LOCUS_16360 2131 3630 gene locus_tag LOCUS_16370 2131 3630 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243999.1 protein_id gnl|my_center|LOCUS_16370 3611 4693 gene locus_tag LOCUS_16380 gene mraY 3611 4693 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_16380 4698 6167 gene locus_tag LOCUS_16390 gene murD 4698 6167 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_16390 6164 7297 gene locus_tag LOCUS_16400 gene ftsW 6164 7297 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545997.1 protein_id gnl|my_center|LOCUS_16400 7307 8431 gene locus_tag LOCUS_16410 gene murG 7307 8431 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_16410 8498 9955 gene locus_tag LOCUS_16420 gene murC 8498 9955 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_16420 9927 10877 gene locus_tag LOCUS_16430 gene murB 9927 10877 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437020.1 protein_id gnl|my_center|LOCUS_16430 10973 12154 gene locus_tag LOCUS_16440 10973 12154 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_16440 12159 13154 gene locus_tag LOCUS_16450 12159 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 13426 13178 gene locus_tag LOCUS_16460 13426 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 14213 13524 gene locus_tag LOCUS_16470 14213 13524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 14909 14301 gene locus_tag LOCUS_16480 14909 14301 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_16480 16318 14915 gene locus_tag LOCUS_16490 16318 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 17396 16329 gene locus_tag LOCUS_16500 gene xerC 17396 16329 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_16500 18225 17464 gene locus_tag LOCUS_16510 18225 17464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 21124 18215 gene locus_tag LOCUS_16520 21124 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 21266 22717 gene locus_tag LOCUS_16530 21266 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 22845 23021 gene locus_tag LOCUS_16540 22845 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 23100 24230 gene locus_tag LOCUS_16550 23100 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 24231 26156 gene locus_tag LOCUS_16560 24231 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 26163 28004 gene locus_tag LOCUS_16570 26163 28004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 27997 28854 gene locus_tag LOCUS_16580 27997 28854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 28859 29053 gene locus_tag LOCUS_16590 28859 29053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 29100 29963 gene locus_tag LOCUS_16600 29100 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 29995 31638 gene locus_tag LOCUS_16610 29995 31638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 31649 32497 gene locus_tag LOCUS_16620 31649 32497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 32510 33394 gene locus_tag LOCUS_16630 32510 33394 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_16630 33405 34787 gene locus_tag LOCUS_16640 33405 34787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 34789 36294 gene locus_tag LOCUS_16650 34789 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 36301 38751 gene locus_tag LOCUS_16660 36301 38751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 38781 39767 gene locus_tag LOCUS_16670 38781 39767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 39775 41169 gene locus_tag LOCUS_16680 39775 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 41723 42178 gene locus_tag LOCUS_16690 41723 42178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 42573 42761 gene locus_tag LOCUS_16700 42573 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 42912 43079 gene locus_tag LOCUS_16710 42912 43079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 43076 43537 gene locus_tag LOCUS_16720 43076 43537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 43679 44428 gene locus_tag LOCUS_16730 43679 44428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 44569 44826 gene locus_tag LOCUS_16740 44569 44826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence19 1407 1823 gene locus_tag LOCUS_16750 1407 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1960 2256 gene locus_tag LOCUS_16760 1960 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3247 2258 gene locus_tag LOCUS_16770 3247 2258 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 protein_id gnl|my_center|LOCUS_16770 4054 3284 gene locus_tag LOCUS_16780 gene asd 4054 3284 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 protein_id gnl|my_center|LOCUS_16780 4906 4112 gene locus_tag LOCUS_16790 4906 4112 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_16790 5250 5897 gene locus_tag LOCUS_16800 5250 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 7762 5894 gene locus_tag LOCUS_16810 7762 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8955 7768 gene locus_tag LOCUS_16820 8955 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 10238 9030 gene locus_tag LOCUS_16830 10238 9030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_16830 10924 10247 gene locus_tag LOCUS_16840 10924 10247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262011.1 protein_id gnl|my_center|LOCUS_16840 11894 10911 gene locus_tag LOCUS_16850 11894 10911 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969385.1 protein_id gnl|my_center|LOCUS_16850 12241 13389 gene locus_tag LOCUS_16860 12241 13389 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201906.1 protein_id gnl|my_center|LOCUS_16860 13405 14328 gene locus_tag LOCUS_16870 13405 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 14407 15384 gene locus_tag LOCUS_16880 14407 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 17422 15653 gene locus_tag LOCUS_16890 gene hflX 17422 15653 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_16890 19109 17697 gene locus_tag LOCUS_16900 19109 17697 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989704.1 protein_id gnl|my_center|LOCUS_16900 20339 19113 gene locus_tag LOCUS_16910 20339 19113 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_16910 21358 20561 gene locus_tag LOCUS_16920 gene thiD 21358 20561 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_16920 21621 21358 gene locus_tag LOCUS_16930 gene infA 21621 21358 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_16930 21935 21636 gene locus_tag LOCUS_16940 21935 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 22986 22015 gene locus_tag LOCUS_16950 22986 22015 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_16950 24240 23188 gene locus_tag LOCUS_16960 gene miaA 24240 23188 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811584.1 protein_id gnl|my_center|LOCUS_16960 26174 24258 gene locus_tag LOCUS_16970 gene mutL 26174 24258 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_16970 27261 26167 gene locus_tag LOCUS_16980 27261 26167 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_16980 27265 27738 gene locus_tag LOCUS_16990 gene rfaE2 27265 27738 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_16990 28579 27821 gene locus_tag LOCUS_17000 28579 27821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 29454 28921 gene locus_tag LOCUS_17010 29454 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 30799 29804 gene locus_tag LOCUS_17020 30799 29804 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_17020 31301 30819 gene locus_tag LOCUS_17030 31301 30819 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_17030 31848 31426 gene locus_tag LOCUS_17040 31848 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 32581 32192 gene locus_tag LOCUS_17050 32581 32192 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 protein_id gnl|my_center|LOCUS_17050 33026 32610 gene locus_tag LOCUS_17060 gene mscL 33026 32610 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 protein_id gnl|my_center|LOCUS_17060 34831 33056 gene locus_tag LOCUS_17070 34831 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 35539 34961 gene locus_tag LOCUS_17080 35539 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 36788 35523 gene locus_tag LOCUS_17090 36788 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 37861 36770 gene locus_tag LOCUS_17100 37861 36770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 37961 39583 gene locus_tag LOCUS_17110 37961 39583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 40289 39501 gene locus_tag LOCUS_17120 gene pssA 40289 39501 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 protein_id gnl|my_center|LOCUS_17120 40674 40925 gene locus_tag LOCUS_17130 gene rpoZ 40674 40925 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_17130 41002 43173 gene locus_tag LOCUS_17140 41002 43173 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence20 51 141 gene locus_tag LOCUS_t00280 51 141 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 813 295 gene locus_tag LOCUS_17150 813 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1218 931 gene locus_tag LOCUS_17160 1218 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1809 1237 gene locus_tag LOCUS_17170 1809 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2603 1812 gene locus_tag LOCUS_17180 2603 1812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_17180 3702 2608 gene locus_tag LOCUS_17190 3702 2608 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294607.1 protein_id gnl|my_center|LOCUS_17190 3994 3692 gene locus_tag LOCUS_17200 3994 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4080 4262 gene locus_tag LOCUS_17210 4080 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 5216 4245 gene locus_tag LOCUS_17220 5216 4245 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_17220 6552 5263 gene locus_tag LOCUS_17230 gene serS 6552 5263 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869753.1 protein_id gnl|my_center|LOCUS_17230 6978 6595 gene locus_tag LOCUS_17240 6978 6595 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258556.1 protein_id gnl|my_center|LOCUS_17240 7564 6896 gene locus_tag LOCUS_17250 gene rnhB 7564 6896 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021956.1 protein_id gnl|my_center|LOCUS_17250 7681 7968 gene locus_tag LOCUS_17260 gene gatC 7681 7968 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_17260 7989 9473 gene locus_tag LOCUS_17270 gene gatA 7989 9473 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_17270 9499 10935 gene locus_tag LOCUS_17280 gene gatB 9499 10935 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_17280 12011 11250 gene locus_tag LOCUS_17290 12011 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 12256 13251 gene locus_tag LOCUS_17300 12256 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 14242 13211 gene locus_tag LOCUS_17310 14242 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 14850 14239 gene locus_tag LOCUS_17320 14850 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 15124 14861 gene locus_tag LOCUS_17330 15124 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 15154 17175 gene locus_tag LOCUS_17340 15154 17175 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206629.1 protein_id gnl|my_center|LOCUS_17340 17184 17537 gene locus_tag LOCUS_17350 17184 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 17555 18217 gene locus_tag LOCUS_17360 17555 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 18249 19262 gene locus_tag LOCUS_17370 18249 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 19441 20865 gene locus_tag LOCUS_17380 gene sthA 19441 20865 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081884.1 protein_id gnl|my_center|LOCUS_17380 20868 22241 gene locus_tag LOCUS_17390 20868 22241 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_17390 23661 22243 gene locus_tag LOCUS_17400 23661 22243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 25179 23854 gene locus_tag LOCUS_17410 25179 23854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 26287 25277 gene locus_tag LOCUS_17420 26287 25277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 27689 26313 gene locus_tag LOCUS_17430 gene accC 27689 26313 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_17430 28261 27707 gene locus_tag LOCUS_17440 gene accB 28261 27707 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_17440 28803 28363 gene locus_tag LOCUS_17450 gene aroQ 28803 28363 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986444.1 protein_id gnl|my_center|LOCUS_17450 29306 28806 gene locus_tag LOCUS_17460 29306 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 30398 29403 gene locus_tag LOCUS_17470 30398 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 31117 30419 gene locus_tag LOCUS_17480 31117 30419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 33116 31158 gene locus_tag LOCUS_17490 33116 31158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 33115 33306 gene locus_tag LOCUS_17500 33115 33306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 34047 33364 gene locus_tag LOCUS_17510 34047 33364 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_17510 34702 34088 gene locus_tag LOCUS_17520 34702 34088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 35812 34706 gene locus_tag LOCUS_17530 gene pilM 35812 34706 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_17530 36048 38471 gene locus_tag LOCUS_17540 36048 38471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 40155 38479 gene locus_tag LOCUS_17550 40155 38479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 41767 40250 gene locus_tag LOCUS_17560 gene mpl 41767 40250 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_17560 <42566 41779 gene locus_tag LOCUS_17570 <42566 41779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555126.1:MBL fold metallo-hydrolase >Feature sequence21 596 1324 gene locus_tag LOCUS_17580 596 1324 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141006.1 protein_id gnl|my_center|LOCUS_17580 2458 1484 gene locus_tag LOCUS_17590 2458 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2605 2934 gene locus_tag LOCUS_17600 2605 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3041 4030 gene locus_tag LOCUS_17610 3041 4030 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_17610 4136 4654 gene locus_tag LOCUS_17620 4136 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 4748 5050 gene locus_tag LOCUS_17630 4748 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 6109 5003 gene locus_tag LOCUS_17640 6109 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6734 6102 gene locus_tag LOCUS_17650 6734 6102 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_17650 7789 6731 gene locus_tag LOCUS_17660 7789 6731 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_17660 7886 8209 gene locus_tag LOCUS_17670 7886 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 8196 9779 gene locus_tag LOCUS_17680 8196 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 10163 11674 gene locus_tag LOCUS_r00010 10163 11674 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 12098 15165 gene locus_tag LOCUS_r00020 12098 15165 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 15521 16174 gene locus_tag LOCUS_17690 15521 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 17771 19681 gene locus_tag LOCUS_17700 17771 19681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 19671 20603 gene locus_tag LOCUS_17710 19671 20603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_17710 20600 21397 gene locus_tag LOCUS_17720 20600 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 21394 22167 gene locus_tag LOCUS_17730 21394 22167 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_17730 23427 22258 gene locus_tag LOCUS_17740 23427 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 23680 24234 gene locus_tag LOCUS_17750 23680 24234 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369672.1 protein_id gnl|my_center|LOCUS_17750 24801 24696 gene locus_tag LOCUS_r00030 24801 24696 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 25289 24909 gene locus_tag LOCUS_17760 25289 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 25824 26381 gene locus_tag LOCUS_17770 25824 26381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 26552 27880 gene locus_tag LOCUS_17780 gene argG 26552 27880 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189990.1 protein_id gnl|my_center|LOCUS_17780 28012 29250 gene locus_tag LOCUS_17790 28012 29250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 29712 29224 gene locus_tag LOCUS_17800 29712 29224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 30048 29800 gene locus_tag LOCUS_17810 30048 29800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 30230 31045 gene locus_tag LOCUS_17820 30230 31045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 31093 32289 gene locus_tag LOCUS_17830 31093 32289 CDS product TIGR03118 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928497.1 protein_id gnl|my_center|LOCUS_17830 32252 32896 gene locus_tag LOCUS_17840 32252 32896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 32921 33451 gene locus_tag LOCUS_17850 32921 33451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 33438 34472 gene locus_tag LOCUS_17860 33438 34472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 35082 34429 gene locus_tag LOCUS_17870 35082 34429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 35322 37496 gene locus_tag LOCUS_17880 gene btuB 35322 37496 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228170.1 protein_id gnl|my_center|LOCUS_17880 37594 38856 gene locus_tag LOCUS_17890 37594 38856 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence22 827 393 gene locus_tag LOCUS_17900 827 393 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546638.1 protein_id gnl|my_center|LOCUS_17900 1083 1388 gene locus_tag LOCUS_17910 1083 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1418 1777 gene locus_tag LOCUS_17920 1418 1777 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530023.1 protein_id gnl|my_center|LOCUS_17920 1898 2872 gene locus_tag LOCUS_17930 1898 2872 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_17930 6493 3062 gene locus_tag LOCUS_17940 6493 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 8104 7367 gene locus_tag LOCUS_17950 8104 7367 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 protein_id gnl|my_center|LOCUS_17950 8473 9069 gene locus_tag LOCUS_17960 8473 9069 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 protein_id gnl|my_center|LOCUS_17960 9292 9570 gene locus_tag LOCUS_17970 9292 9570 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_17970 9557 9802 gene locus_tag LOCUS_17980 9557 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_17980 12455 10110 gene locus_tag LOCUS_17990 12455 10110 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_17990 13389 12445 gene locus_tag LOCUS_18000 13389 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 14158 13433 gene locus_tag LOCUS_18010 14158 13433 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_18010 17183 14148 gene locus_tag LOCUS_18020 17183 14148 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_18020 18111 17185 gene locus_tag LOCUS_18030 18111 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 19384 18119 gene locus_tag LOCUS_18040 19384 18119 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938994.1 protein_id gnl|my_center|LOCUS_18040 21786 19375 gene locus_tag LOCUS_18050 21786 19375 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_18050 22021 21812 gene locus_tag LOCUS_18060 22021 21812 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_18060 22431 22195 gene locus_tag LOCUS_18070 22431 22195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 22608 23189 gene locus_tag LOCUS_18080 22608 23189 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939026.1 protein_id gnl|my_center|LOCUS_18080 23198 23392 gene locus_tag LOCUS_18090 23198 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 23942 23523 gene locus_tag LOCUS_18100 23942 23523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 26594 24276 gene locus_tag LOCUS_18110 26594 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 27693 26599 gene locus_tag LOCUS_18120 27693 26599 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_18120 28097 28744 gene locus_tag LOCUS_18130 28097 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 29119 29044 gene locus_tag LOCUS_t00290 29119 29044 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 30596 29364 gene locus_tag LOCUS_18140 gene dprA 30596 29364 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654772.1 protein_id gnl|my_center|LOCUS_18140 30768 32753 gene locus_tag LOCUS_18150 30768 32753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 32750 33910 gene locus_tag LOCUS_18160 32750 33910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 34075 35526 gene locus_tag LOCUS_18170 gene pyk 34075 35526 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_18170 35811 35623 gene locus_tag LOCUS_18180 35811 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 36359 35910 gene locus_tag LOCUS_18190 gene dut 36359 35910 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993670.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence23 435 1196 gene locus_tag LOCUS_18200 435 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2441 1470 gene locus_tag LOCUS_18210 2441 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3868 2561 gene locus_tag LOCUS_18220 3868 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5175 3874 gene locus_tag LOCUS_18230 5175 3874 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_18230 5526 5194 gene locus_tag LOCUS_18240 5526 5194 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_18240 5665 5592 gene locus_tag LOCUS_t00300 5665 5592 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6776 7264 gene locus_tag LOCUS_18250 6776 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 8638 7712 gene locus_tag LOCUS_18260 8638 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 11300 9663 gene locus_tag LOCUS_18270 11300 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 12253 11297 gene locus_tag LOCUS_18280 gene cmoB 12253 11297 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564730.1 protein_id gnl|my_center|LOCUS_18280 12325 13068 gene locus_tag LOCUS_18290 12325 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 14591 13065 gene locus_tag LOCUS_18300 14591 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_18300 14643 15110 gene locus_tag LOCUS_18310 14643 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 15113 15754 gene locus_tag LOCUS_18320 15113 15754 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_18320 15756 16757 gene locus_tag LOCUS_18330 gene dapD 15756 16757 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_18330 18993 16819 gene locus_tag LOCUS_18340 gene fadJ 18993 16819 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 protein_id gnl|my_center|LOCUS_18340 19090 19509 gene locus_tag LOCUS_18350 19090 19509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 21086 19869 gene locus_tag LOCUS_18360 gene metK 21086 19869 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_18360 22046 21168 gene locus_tag LOCUS_18370 gene rapZ 22046 21168 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_18370 22380 22039 gene locus_tag LOCUS_18380 22380 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 23848 22448 gene locus_tag LOCUS_18390 gene rpoN 23848 22448 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_18390 24146 23949 gene locus_tag LOCUS_18400 24146 23949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 25347 24115 gene locus_tag LOCUS_18410 25347 24115 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_18410 26266 25481 gene locus_tag LOCUS_18420 gene lptB 26266 25481 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_18420 26796 26266 gene locus_tag LOCUS_18430 26796 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 27478 26882 gene locus_tag LOCUS_18440 27478 26882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 28339 27491 gene locus_tag LOCUS_18450 gene kdsA 28339 27491 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724637.1 protein_id gnl|my_center|LOCUS_18450 30042 28348 gene locus_tag LOCUS_18460 30042 28348 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_18460 30969 30178 gene locus_tag LOCUS_18470 gene kdsB 30969 30178 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_18470 31816 31028 gene locus_tag LOCUS_18480 31816 31028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 33122 31809 gene locus_tag LOCUS_18490 gene pcnB 33122 31809 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943862.1 protein_id gnl|my_center|LOCUS_18490 33373 33825 gene locus_tag LOCUS_18500 33373 33825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 33822 34217 gene locus_tag LOCUS_18510 33822 34217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 34201 35106 gene locus_tag LOCUS_18520 34201 35106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence24 317 901 gene locus_tag LOCUS_18530 317 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1131 1613 gene locus_tag LOCUS_18540 1131 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2260 2781 gene locus_tag LOCUS_18550 2260 2781 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060155.1 protein_id gnl|my_center|LOCUS_18550 2847 3194 gene locus_tag LOCUS_18560 2847 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3408 3881 gene locus_tag LOCUS_18570 3408 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3991 5001 gene locus_tag LOCUS_18580 3991 5001 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_18580 7612 5003 gene locus_tag LOCUS_18590 gene clpB 7612 5003 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_18590 9877 7745 gene locus_tag LOCUS_18600 9877 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 9959 11077 gene locus_tag LOCUS_18610 gene prfA 9959 11077 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_18610 11058 11966 gene locus_tag LOCUS_18620 gene prmC 11058 11966 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 protein_id gnl|my_center|LOCUS_18620 11972 13258 gene locus_tag LOCUS_18630 gene murA 11972 13258 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_18630 13264 13935 gene locus_tag LOCUS_18640 13264 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 13945 15183 gene locus_tag LOCUS_18650 gene fabF 13945 15183 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_18650 15183 16226 gene locus_tag LOCUS_18660 15183 16226 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_18660 17203 16712 gene locus_tag LOCUS_18670 17203 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 17373 18107 gene locus_tag LOCUS_18680 17373 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 18110 19060 gene locus_tag LOCUS_18690 18110 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 19839 19051 gene locus_tag LOCUS_18700 19839 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 20426 19836 gene locus_tag LOCUS_18710 20426 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 20936 20514 gene locus_tag LOCUS_18720 gene brxB 20936 20514 CDS product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 protein_id gnl|my_center|LOCUS_18720 21614 21027 gene locus_tag LOCUS_18730 21614 21027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 21667 22677 gene locus_tag LOCUS_18740 21667 22677 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_18740 22677 23492 gene locus_tag LOCUS_18750 22677 23492 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521519.1 protein_id gnl|my_center|LOCUS_18750 23495 24280 gene locus_tag LOCUS_18760 23495 24280 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965773.1 protein_id gnl|my_center|LOCUS_18760 24849 25313 gene locus_tag LOCUS_18770 24849 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 25754 25368 gene locus_tag LOCUS_18780 25754 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 26332 26895 gene locus_tag LOCUS_18790 26332 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 28096 26945 gene locus_tag LOCUS_18800 gene bshA 28096 26945 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_18800 28851 28093 gene locus_tag LOCUS_18810 gene bshB1 28851 28093 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_18810 30023 28848 gene locus_tag LOCUS_18820 30023 28848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 30753 30034 gene locus_tag LOCUS_18830 30753 30034 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932718.1 protein_id gnl|my_center|LOCUS_18830 30878 31768 gene locus_tag LOCUS_18840 30878 31768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 32844 31774 gene locus_tag LOCUS_18850 32844 31774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 32949 33731 gene locus_tag LOCUS_18860 gene panB 32949 33731 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_18860 33751 34218 gene locus_tag LOCUS_18870 gene smpB 33751 34218 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_18870 34566 34225 gene locus_tag LOCUS_18880 34566 34225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence25 1243 227 gene locus_tag LOCUS_18890 1243 227 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_18890 1362 2360 gene locus_tag LOCUS_18900 1362 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2490 2672 gene locus_tag LOCUS_18910 2490 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 3865 2765 gene locus_tag LOCUS_18920 3865 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4451 3867 gene locus_tag LOCUS_18930 4451 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4554 6998 gene locus_tag LOCUS_18940 gene leuS 4554 6998 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_18940 7346 7020 gene locus_tag LOCUS_18950 7346 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 8642 7482 gene locus_tag LOCUS_18960 8642 7482 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_18960 9443 8652 gene locus_tag LOCUS_18970 9443 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 9597 10304 gene locus_tag LOCUS_18980 9597 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 10367 11851 gene locus_tag LOCUS_18990 10367 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 12801 11878 gene locus_tag LOCUS_19000 12801 11878 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_19000 13260 12832 gene locus_tag LOCUS_19010 13260 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 13963 13337 gene locus_tag LOCUS_19020 13963 13337 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_19020 14497 13976 gene locus_tag LOCUS_19030 14497 13976 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454132.1 protein_id gnl|my_center|LOCUS_19030 15583 14603 gene locus_tag LOCUS_19040 15583 14603 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_19040 16554 15601 gene locus_tag LOCUS_19050 gene pdhA 16554 15601 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980946.1 protein_id gnl|my_center|LOCUS_19050 17124 17867 gene locus_tag LOCUS_19060 17124 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 17864 18916 gene locus_tag LOCUS_19070 17864 18916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 18963 19859 gene locus_tag LOCUS_19080 18963 19859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 21129 20479 gene locus_tag LOCUS_19090 21129 20479 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_19090 21381 22553 gene locus_tag LOCUS_19100 21381 22553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 23929 22568 gene locus_tag LOCUS_19110 23929 22568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 24943 23942 gene locus_tag LOCUS_19120 24943 23942 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_19120 25015 25803 gene locus_tag LOCUS_19130 25015 25803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 26638 25850 gene locus_tag LOCUS_19140 26638 25850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 27063 26638 gene locus_tag LOCUS_19150 27063 26638 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_19150 27406 27092 gene locus_tag LOCUS_19160 27406 27092 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_19160 28652 27522 gene locus_tag LOCUS_19170 28652 27522 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_19170 28782 29549 gene locus_tag LOCUS_19180 28782 29549 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971139.1 protein_id gnl|my_center|LOCUS_19180 29546 31000 gene locus_tag LOCUS_19190 29546 31000 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_19190 31238 32254 gene locus_tag LOCUS_19200 31238 32254 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_19200 32384 32538 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtcacgagtgctttcagaa >Feature sequence26 573 866 gene locus_tag LOCUS_19210 573 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 888 2015 gene locus_tag LOCUS_19220 gene pfp 888 2015 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_19220 2281 2012 gene locus_tag LOCUS_19230 2281 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2590 3540 gene locus_tag LOCUS_19240 2590 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3611 4408 gene locus_tag LOCUS_19250 3611 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4489 5853 gene locus_tag LOCUS_19260 4489 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6153 7409 gene locus_tag LOCUS_19270 6153 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7684 7869 gene locus_tag LOCUS_19280 7684 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 8340 9272 gene locus_tag LOCUS_19290 8340 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 9320 10780 gene locus_tag LOCUS_19300 9320 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 10921 11925 gene locus_tag LOCUS_19310 10921 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 11932 12858 gene locus_tag LOCUS_19320 11932 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 12875 15046 gene locus_tag LOCUS_19330 gene flhA 12875 15046 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_19330 15043 17547 gene locus_tag LOCUS_19340 15043 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 17571 19085 gene locus_tag LOCUS_19350 17571 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 19118 20398 gene locus_tag LOCUS_19360 19118 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 20398 21312 gene locus_tag LOCUS_19370 20398 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 21309 21536 gene locus_tag LOCUS_19380 21309 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 21520 22008 gene locus_tag LOCUS_19390 21520 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 22012 23121 gene locus_tag LOCUS_19400 22012 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 23145 23816 gene locus_tag LOCUS_19410 gene fliP 23145 23816 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316820.1 protein_id gnl|my_center|LOCUS_19410 23837 24103 gene locus_tag LOCUS_19420 23837 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 24091 24822 gene locus_tag LOCUS_19430 24091 24822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 24883 25602 gene locus_tag LOCUS_19440 24883 25602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 25654 26379 gene locus_tag LOCUS_19450 25654 26379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 26541 26810 gene locus_tag LOCUS_19460 gene rpsO 26541 26810 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_19460 26926 29022 gene locus_tag LOCUS_19470 gene pnp 26926 29022 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence27 <1 1198 gene locus_tag LOCUS_19480 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837486.1:trigger factor 1219 1830 gene locus_tag LOCUS_19490 gene clpP 1219 1830 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_19490 2054 3289 gene locus_tag LOCUS_19500 gene clpX 2054 3289 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_19500 3590 6073 gene locus_tag LOCUS_19510 gene lon 3590 6073 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367948.1 protein_id gnl|my_center|LOCUS_19510 6769 6844 gene locus_tag LOCUS_t00310 6769 6844 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7156 7232 gene locus_tag LOCUS_t00320 7156 7232 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7467 8108 gene locus_tag LOCUS_19520 7467 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 8653 8216 gene locus_tag LOCUS_19530 8653 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 9178 8873 gene locus_tag LOCUS_19540 9178 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 9448 10287 gene locus_tag LOCUS_19550 9448 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 10280 11068 gene locus_tag LOCUS_19560 10280 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 11092 11910 gene locus_tag LOCUS_19570 11092 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 13145 11907 gene locus_tag LOCUS_19580 13145 11907 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_19580 13424 15745 gene locus_tag LOCUS_19590 gene purL 13424 15745 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_19590 17728 15827 gene locus_tag LOCUS_19600 gene dnaK 17728 15827 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_19600 17969 17721 gene locus_tag LOCUS_19610 17969 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 19227 18292 gene locus_tag LOCUS_19620 19227 18292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 19472 19547 gene locus_tag LOCUS_t00330 19472 19547 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19605 19961 gene locus_tag LOCUS_19630 19605 19961 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_19630 20136 21020 gene locus_tag LOCUS_19640 20136 21020 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_19640 21034 22713 gene locus_tag LOCUS_19650 gene recN 21034 22713 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131352.1 protein_id gnl|my_center|LOCUS_19650 22888 23730 gene locus_tag LOCUS_19660 22888 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 23788 23861 gene locus_tag LOCUS_t00340 23788 23861 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25156 24356 gene locus_tag LOCUS_19670 25156 24356 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104756978.1 protein_id gnl|my_center|LOCUS_19670 25882 25334 gene locus_tag LOCUS_19680 25882 25334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 26152 28671 gene locus_tag LOCUS_19690 26152 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence28 1598 174 gene locus_tag LOCUS_19700 1598 174 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_19700 1758 2363 gene locus_tag LOCUS_19710 1758 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2541 3206 gene locus_tag LOCUS_19720 2541 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 4133 3216 gene locus_tag LOCUS_19730 4133 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4211 5749 gene locus_tag LOCUS_19740 4211 5749 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_19740 5861 6139 gene locus_tag LOCUS_19750 5861 6139 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_19750 6108 6422 gene locus_tag LOCUS_19760 6108 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 6422 7339 gene locus_tag LOCUS_19770 6422 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 7311 7949 gene locus_tag LOCUS_19780 gene pdxH 7311 7949 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_19780 8995 10125 gene locus_tag LOCUS_19790 8995 10125 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_19790 10315 10641 gene locus_tag LOCUS_19800 10315 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 10747 12195 gene locus_tag LOCUS_19810 10747 12195 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945973.1 protein_id gnl|my_center|LOCUS_19810 12192 15002 gene locus_tag LOCUS_19820 12192 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 15489 15007 gene locus_tag LOCUS_19830 15489 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 15910 16278 gene locus_tag LOCUS_19840 15910 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 18856 16355 gene locus_tag LOCUS_19850 18856 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 20106 18961 gene locus_tag LOCUS_19860 gene ispG 20106 18961 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_19860 20469 20194 gene locus_tag LOCUS_19870 20469 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 21448 20519 gene locus_tag LOCUS_19880 21448 20519 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941981.1 protein_id gnl|my_center|LOCUS_19880 21635 22108 gene locus_tag LOCUS_19890 21635 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 22299 22814 gene locus_tag LOCUS_19900 22299 22814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 22820 23665 gene locus_tag LOCUS_19910 22820 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 23730 25292 gene locus_tag LOCUS_19920 23730 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 25561 25316 gene locus_tag LOCUS_19930 25561 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 25735 26406 gene locus_tag LOCUS_19940 gene thiE 25735 26406 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_19940 26597 26358 gene locus_tag LOCUS_19950 26597 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 27464 26829 gene locus_tag LOCUS_19960 27464 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence29 277 2238 gene locus_tag LOCUS_19970 277 2238 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_19970 2281 2853 gene locus_tag LOCUS_19980 2281 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4575 2932 gene locus_tag LOCUS_19990 gene groL 4575 2932 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_19990 4889 4602 gene locus_tag LOCUS_20000 gene groES 4889 4602 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_20000 5174 6112 gene locus_tag LOCUS_20010 5174 6112 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_20010 7170 6394 gene locus_tag LOCUS_20020 7170 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 7283 7840 gene locus_tag LOCUS_20030 7283 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 7864 8286 gene locus_tag LOCUS_20040 7864 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 8690 8998 gene locus_tag LOCUS_20050 8690 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 9105 9605 gene locus_tag LOCUS_20060 9105 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 11080 9611 gene locus_tag LOCUS_20070 11080 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 11835 11086 gene locus_tag LOCUS_20080 11835 11086 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_20080 13775 11862 gene locus_tag LOCUS_20090 13775 11862 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_20090 14506 13775 gene locus_tag LOCUS_20100 14506 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_20100 15444 14575 gene locus_tag LOCUS_20110 15444 14575 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109472687.1 protein_id gnl|my_center|LOCUS_20110 16358 15465 gene locus_tag LOCUS_20120 16358 15465 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_20120 17130 16360 gene locus_tag LOCUS_20130 17130 16360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 protein_id gnl|my_center|LOCUS_20130 17187 18899 gene locus_tag LOCUS_20140 17187 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 19225 23796 gene locus_tag LOCUS_20150 19225 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 24747 25013 gene locus_tag LOCUS_20160 24747 25013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence30 2 151 gene locus_tag LOCUS_20170 2 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 758 264 gene locus_tag LOCUS_20180 758 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1847 1590 gene locus_tag LOCUS_20190 1847 1590 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919773.1 protein_id gnl|my_center|LOCUS_20190 4704 1849 gene locus_tag LOCUS_20200 4704 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5544 4708 gene locus_tag LOCUS_20210 5544 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 6327 5548 gene locus_tag LOCUS_20220 6327 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6613 6335 gene locus_tag LOCUS_20230 6613 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 7380 6631 gene locus_tag LOCUS_20240 gene pscR 7380 6631 CDS product SctR family type III secretion system export apparatus subunit PscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087674.1 protein_id gnl|my_center|LOCUS_20240 7955 7377 gene locus_tag LOCUS_20250 7955 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 8263 7955 gene locus_tag LOCUS_20260 8263 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 8458 9153 gene locus_tag LOCUS_20270 gene pyrF 8458 9153 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259755.1 protein_id gnl|my_center|LOCUS_20270 9334 11400 gene locus_tag LOCUS_20280 9334 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 11743 11519 gene locus_tag LOCUS_20290 11743 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 12497 11976 gene locus_tag LOCUS_20300 12497 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 12963 13553 gene locus_tag LOCUS_20310 12963 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 13633 16059 gene locus_tag LOCUS_20320 13633 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 16062 16817 gene locus_tag LOCUS_20330 16062 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 18067 17480 gene locus_tag LOCUS_20340 18067 17480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 18216 18722 gene locus_tag LOCUS_20350 18216 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 19641 18808 gene locus_tag LOCUS_20360 19641 18808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 20120 22477 gene locus_tag LOCUS_20370 20120 22477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 22811 22497 gene locus_tag LOCUS_20380 22811 22497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 23200 22826 gene locus_tag LOCUS_20390 gene erpA 23200 22826 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 protein_id gnl|my_center|LOCUS_20390 23653 24159 gene locus_tag LOCUS_20400 23653 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence31 1988 3007 gene locus_tag LOCUS_20410 1988 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3023 5671 gene locus_tag LOCUS_20420 3023 5671 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_20420 5692 6582 gene locus_tag LOCUS_20430 gene nadC 5692 6582 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_20430 6589 7443 gene locus_tag LOCUS_20440 6589 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 7487 8104 gene locus_tag LOCUS_20450 7487 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 8503 8207 gene locus_tag LOCUS_20460 8503 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 9372 8497 gene locus_tag LOCUS_20470 9372 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 10308 9499 gene locus_tag LOCUS_20480 10308 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 10920 12386 gene locus_tag LOCUS_20490 10920 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 12396 13499 gene locus_tag LOCUS_20500 12396 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 13528 14961 gene locus_tag LOCUS_20510 gene dnaB 13528 14961 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_20510 16789 15932 gene locus_tag LOCUS_20520 16789 15932 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_20520 17829 16837 gene locus_tag LOCUS_20530 17829 16837 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_20530 21425 18504 gene locus_tag LOCUS_20540 21425 18504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence32 596 3253 gene locus_tag LOCUS_20550 gene topA 596 3253 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812879.1 protein_id gnl|my_center|LOCUS_20550 3408 3785 gene locus_tag LOCUS_20560 3408 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3757 4374 gene locus_tag LOCUS_20570 3757 4374 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_20570 4387 4929 gene locus_tag LOCUS_20580 gene hpt 4387 4929 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 protein_id gnl|my_center|LOCUS_20580 6309 5128 gene locus_tag LOCUS_20590 6309 5128 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_20590 6895 9726 gene locus_tag LOCUS_20600 6895 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 10605 9748 gene locus_tag LOCUS_20610 10605 9748 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_20610 11277 10909 gene locus_tag LOCUS_20620 11277 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 12223 11513 gene locus_tag LOCUS_20630 12223 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 13998 12628 gene locus_tag LOCUS_20640 gene lat 13998 12628 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869888.1 protein_id gnl|my_center|LOCUS_20640 14132 15649 gene locus_tag LOCUS_20650 14132 15649 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_20650 15923 15699 gene locus_tag LOCUS_20660 15923 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 16419 15898 gene locus_tag LOCUS_20670 16419 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 16730 16434 gene locus_tag LOCUS_20680 16730 16434 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_20680 17092 16751 gene locus_tag LOCUS_20690 17092 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 17364 17570 gene locus_tag LOCUS_20700 17364 17570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 17756 19243 gene locus_tag LOCUS_20710 17756 19243 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence33 2328 715 gene locus_tag LOCUS_20720 2328 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6515 2373 gene locus_tag LOCUS_20730 6515 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 6678 7781 gene locus_tag LOCUS_20740 6678 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 8253 7843 gene locus_tag LOCUS_20750 8253 7843 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_20750 9181 8492 gene locus_tag LOCUS_20760 9181 8492 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_20760 9288 10628 gene locus_tag LOCUS_20770 9288 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10811 11929 gene locus_tag LOCUS_20780 10811 11929 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 protein_id gnl|my_center|LOCUS_20780 12774 12040 gene locus_tag LOCUS_20790 12774 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 13484 12771 gene locus_tag LOCUS_20800 13484 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 13633 14340 gene locus_tag LOCUS_20810 13633 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 14353 15369 gene locus_tag LOCUS_20820 14353 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 15376 16197 gene locus_tag LOCUS_20830 15376 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 16436 17251 gene locus_tag LOCUS_20840 gene trpA 16436 17251 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_20840 17248 18270 gene locus_tag LOCUS_20850 gene aroF 17248 18270 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_20850 18274 19710 gene locus_tag LOCUS_20860 18274 19710 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_20860 19698 20285 gene locus_tag LOCUS_20870 19698 20285 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792933.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence34 <1 540 gene locus_tag LOCUS_20880 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222365.1:heavy metal translocating P-type ATPase 1603 836 gene locus_tag LOCUS_20890 1603 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1727 2860 gene locus_tag LOCUS_20900 1727 2860 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870134.1 protein_id gnl|my_center|LOCUS_20900 3977 2838 gene locus_tag LOCUS_20910 3977 2838 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_20910 4715 4263 gene locus_tag LOCUS_20920 4715 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 6817 4925 gene locus_tag LOCUS_20930 6817 4925 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970197.1 protein_id gnl|my_center|LOCUS_20930 13552 7136 gene locus_tag LOCUS_20940 13552 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 13999 13748 gene locus_tag LOCUS_20950 13999 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 14854 15225 gene locus_tag LOCUS_20960 gene rpsL 14854 15225 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_20960 15282 15752 gene locus_tag LOCUS_20970 gene rpsG 15282 15752 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_20970 15800 17908 gene locus_tag LOCUS_20980 gene fusA 15800 17908 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence35 1578 3443 gene locus_tag LOCUS_20990 1578 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3437 5446 gene locus_tag LOCUS_21000 3437 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6297 5461 gene locus_tag LOCUS_21010 6297 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 6353 7378 gene locus_tag LOCUS_21020 6353 7378 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553997.1 protein_id gnl|my_center|LOCUS_21020 8770 7409 gene locus_tag LOCUS_21030 8770 7409 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695173.1 protein_id gnl|my_center|LOCUS_21030 9538 8921 gene locus_tag LOCUS_21040 9538 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 10624 9647 gene locus_tag LOCUS_21050 gene manA 10624 9647 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661081.1 protein_id gnl|my_center|LOCUS_21050 10953 10672 gene locus_tag LOCUS_21060 10953 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 12021 11047 gene locus_tag LOCUS_21070 gene aroC 12021 11047 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_21070 13219 12044 gene locus_tag LOCUS_21080 gene aroA 13219 12044 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_21080 14244 13270 gene locus_tag LOCUS_21090 gene aroB 14244 13270 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_21090 15508 14303 gene locus_tag LOCUS_21100 gene trpB 15508 14303 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_21100 16113 15505 gene locus_tag LOCUS_21110 16113 15505 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_21110 16909 16103 gene locus_tag LOCUS_21120 gene trpC 16909 16103 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_21120 <17624 16906 gene locus_tag LOCUS_21130 <17624 16906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962675.1:anthranilate phosphoribosyltransferase >Feature sequence36 499 669 gene locus_tag LOCUS_21140 499 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 679 957 gene locus_tag LOCUS_21150 679 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1647 1865 gene locus_tag LOCUS_21160 1647 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1862 2260 gene locus_tag LOCUS_21170 1862 2260 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228775.1 protein_id gnl|my_center|LOCUS_21170 2422 3576 gene locus_tag LOCUS_21180 2422 3576 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_21180 3601 4770 gene locus_tag LOCUS_21190 gene hppD 3601 4770 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_21190 4792 5799 gene locus_tag LOCUS_21200 4792 5799 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_21200 5832 6791 gene locus_tag LOCUS_21210 5832 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 6881 7963 gene locus_tag LOCUS_21220 gene rlmC 6881 7963 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071254.1 protein_id gnl|my_center|LOCUS_21220 8176 8601 gene locus_tag LOCUS_21230 8176 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 8762 9307 gene locus_tag LOCUS_21240 8762 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 9803 9318 gene locus_tag LOCUS_21250 9803 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 11223 9796 gene locus_tag LOCUS_21260 gene ccoG 11223 9796 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_21260 11791 11228 gene locus_tag LOCUS_21270 11791 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11958 11788 gene locus_tag LOCUS_21280 11958 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 14120 11961 gene locus_tag LOCUS_21290 gene ccoN 14120 11961 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_21290 14941 14270 gene locus_tag LOCUS_21300 14941 14270 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615371.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence37 609 1052 gene locus_tag LOCUS_21310 609 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1665 2222 gene locus_tag LOCUS_21320 1665 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2237 2611 gene locus_tag LOCUS_21330 2237 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 3404 2880 gene locus_tag LOCUS_21340 3404 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4240 3722 gene locus_tag LOCUS_21350 4240 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4495 5058 gene locus_tag LOCUS_21360 4495 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5055 6449 gene locus_tag LOCUS_21370 gene sctN 5055 6449 CDS product type III secretion system ATPase SctN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176697.1 protein_id gnl|my_center|LOCUS_21370 6818 7804 gene locus_tag LOCUS_21380 6818 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 7795 8736 gene locus_tag LOCUS_21390 7795 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 9832 8702 gene locus_tag LOCUS_21400 9832 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 11669 9825 gene locus_tag LOCUS_21410 11669 9825 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_21410 12385 11675 gene locus_tag LOCUS_21420 12385 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 13302 12382 gene locus_tag LOCUS_21430 13302 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence38 314 1012 gene locus_tag LOCUS_21440 gene rplA 314 1012 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_21440 1054 1584 gene locus_tag LOCUS_21450 gene rplJ 1054 1584 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_21450 1634 2017 gene locus_tag LOCUS_21460 gene rplL 1634 2017 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_21460 2365 6912 gene locus_tag LOCUS_21470 gene rpoB 2365 6912 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_21470 6947 11032 gene locus_tag LOCUS_21480 gene rpoC 6947 11032 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_21480 11352 11158 gene locus_tag LOCUS_21490 11352 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 11420 11575 gene locus_tag LOCUS_21500 11420 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 11600 12676 gene locus_tag LOCUS_21510 gene ispE 11600 12676 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352368.1 protein_id gnl|my_center|LOCUS_21510 12656 12730 gene locus_tag LOCUS_t00350 12656 12730 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 644 216 gene locus_tag LOCUS_21520 644 216 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_21520 2158 644 gene locus_tag LOCUS_21530 2158 644 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_21530 3219 2167 gene locus_tag LOCUS_21540 3219 2167 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_21540 3958 3209 gene locus_tag LOCUS_21550 3958 3209 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_21550 5759 4497 gene locus_tag LOCUS_21560 5759 4497 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053783.1 protein_id gnl|my_center|LOCUS_21560 5984 7312 gene locus_tag LOCUS_21570 5984 7312 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656113.1 protein_id gnl|my_center|LOCUS_21570 9181 7322 gene locus_tag LOCUS_21580 9181 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 9272 11314 gene locus_tag LOCUS_21590 9272 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 11330 12061 gene locus_tag LOCUS_21600 11330 12061 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence40 328 591 gene locus_tag LOCUS_21610 328 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 596 850 gene locus_tag LOCUS_21620 596 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1163 1318 gene locus_tag LOCUS_21630 1163 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1992 1339 gene locus_tag LOCUS_21640 1992 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2136 2975 gene locus_tag LOCUS_21650 2136 2975 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210797.1 protein_id gnl|my_center|LOCUS_21650 2990 3409 gene locus_tag LOCUS_21660 2990 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4058 3591 gene locus_tag LOCUS_21670 4058 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 5213 4392 gene locus_tag LOCUS_21680 5213 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 5840 6706 gene locus_tag LOCUS_21690 5840 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814201.1 protein_id gnl|my_center|LOCUS_21690 6720 7211 gene locus_tag LOCUS_21700 6720 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405531.1 protein_id gnl|my_center|LOCUS_21700 7648 7208 gene locus_tag LOCUS_21710 gene mntR 7648 7208 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 protein_id gnl|my_center|LOCUS_21710 7789 8598 gene locus_tag LOCUS_21720 7789 8598 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_21720 8591 9379 gene locus_tag LOCUS_21730 8591 9379 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_21730 9387 10313 gene locus_tag LOCUS_21740 9387 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 10297 11589 gene locus_tag LOCUS_21750 10297 11589 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_21750 12052 11696 gene locus_tag LOCUS_21760 12052 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence41 431 1225 gene locus_tag LOCUS_21770 431 1225 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_21770 1256 2086 gene locus_tag LOCUS_21780 1256 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2083 2760 gene locus_tag LOCUS_21790 2083 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2766 3608 gene locus_tag LOCUS_21800 gene prmA 2766 3608 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_21800 4069 3659 gene locus_tag LOCUS_21810 4069 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4355 5533 gene locus_tag LOCUS_21820 4355 5533 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_21820 5640 7553 gene locus_tag LOCUS_21830 5640 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 8613 7984 gene locus_tag LOCUS_21840 8613 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 9178 8627 gene locus_tag LOCUS_21850 gene rplI 9178 8627 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_21850 9642 9235 gene locus_tag LOCUS_21860 9642 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 10344 9757 gene locus_tag LOCUS_21870 gene pth 10344 9757 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_21870 11049 10363 gene locus_tag LOCUS_21880 11049 10363 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence42 <1 1686 gene locus_tag LOCUS_21890 <1 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337384.1:ATP-dependent Clp protease ATP-binding subunit ClpA 2658 1738 gene locus_tag LOCUS_21900 2658 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3199 3717 gene locus_tag LOCUS_21910 3199 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4130 3849 gene locus_tag LOCUS_21920 4130 3849 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305420.1 protein_id gnl|my_center|LOCUS_21920 4202 5101 gene locus_tag LOCUS_21930 gene rocF 4202 5101 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167867.1 protein_id gnl|my_center|LOCUS_21930 5426 5857 gene locus_tag LOCUS_21940 gene dksA 5426 5857 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545075.1 protein_id gnl|my_center|LOCUS_21940 6615 6538 gene locus_tag LOCUS_t00360 6615 6538 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6717 7805 gene locus_tag LOCUS_21950 6717 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 8469 7837 gene locus_tag LOCUS_21960 gene rdgB 8469 7837 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_21960 9209 8481 gene locus_tag LOCUS_21970 gene rph 9209 8481 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260978.1 protein_id gnl|my_center|LOCUS_21970 9277 9945 gene locus_tag LOCUS_21980 9277 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 9949 10521 gene locus_tag LOCUS_21990 9949 10521 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence43 917 228 gene locus_tag LOCUS_22000 917 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3109 1388 gene locus_tag LOCUS_22010 3109 1388 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_22010 3812 3141 gene locus_tag LOCUS_22020 gene cmk 3812 3141 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_22020 4230 4505 gene locus_tag LOCUS_22030 4230 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 5289 4651 gene locus_tag LOCUS_22040 5289 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 5327 7186 gene locus_tag LOCUS_22050 5327 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 7738 7400 gene locus_tag LOCUS_22060 7738 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 8433 7837 gene locus_tag LOCUS_22070 gene infC 8433 7837 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014629997.1 protein_id gnl|my_center|LOCUS_22070 8884 10470 gene locus_tag LOCUS_22080 gene pckA 8884 10470 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108804.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence44 438 830 gene locus_tag LOCUS_22090 438 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 845 1279 gene locus_tag LOCUS_22100 845 1279 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358004.1 protein_id gnl|my_center|LOCUS_22100 4318 1265 gene locus_tag LOCUS_22110 4318 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_22110 5202 4429 gene locus_tag LOCUS_22120 5202 4429 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392476.1 protein_id gnl|my_center|LOCUS_22120 6156 5209 gene locus_tag LOCUS_22130 6156 5209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867902.1 protein_id gnl|my_center|LOCUS_22130 7066 6149 gene locus_tag LOCUS_22140 7066 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942146.1 protein_id gnl|my_center|LOCUS_22140 7158 8429 gene locus_tag LOCUS_22150 7158 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 8500 10020 gene locus_tag LOCUS_22160 8500 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 10387 10010 gene locus_tag LOCUS_22170 10387 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence45 981 193 gene locus_tag LOCUS_22180 981 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_22180 1384 1115 gene locus_tag LOCUS_22190 1384 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1950 1387 gene locus_tag LOCUS_22200 1950 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1997 3820 gene locus_tag LOCUS_22210 1997 3820 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_22210 3840 4343 gene locus_tag LOCUS_22220 3840 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 4439 4594 gene locus_tag LOCUS_22230 4439 4594 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_22230 5700 4642 gene locus_tag LOCUS_22240 5700 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 8686 5663 gene locus_tag LOCUS_22250 8686 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 <10352 8985 gene locus_tag LOCUS_22260 <10352 8985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776294.1:DNA recombination protein RmuC >Feature sequence46 388 1365 gene locus_tag LOCUS_22270 388 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3061 1613 gene locus_tag LOCUS_22280 3061 1613 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518852.1 protein_id gnl|my_center|LOCUS_22280 4303 3080 gene locus_tag LOCUS_22290 gene yhbH 4303 3080 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963900.1 protein_id gnl|my_center|LOCUS_22290 6397 4457 gene locus_tag LOCUS_22300 6397 4457 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518851.1 protein_id gnl|my_center|LOCUS_22300 6978 6601 gene locus_tag LOCUS_22310 6978 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 7078 7425 gene locus_tag LOCUS_22320 7078 7425 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140931.1 protein_id gnl|my_center|LOCUS_22320 7464 8237 gene locus_tag LOCUS_22330 7464 8237 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_22330 8242 9405 gene locus_tag LOCUS_22340 8242 9405 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence47 696 391 gene locus_tag LOCUS_22350 696 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1370 714 gene locus_tag LOCUS_22360 1370 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22360 1844 4201 gene locus_tag LOCUS_22370 1844 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4419 5237 gene locus_tag LOCUS_22380 4419 5237 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_22380 5230 6183 gene locus_tag LOCUS_22390 gene coxB 5230 6183 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220059.1 protein_id gnl|my_center|LOCUS_22390 6203 7831 gene locus_tag LOCUS_22400 gene ctaD 6203 7831 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102008.1 protein_id gnl|my_center|LOCUS_22400 7851 8459 gene locus_tag LOCUS_22410 7851 8459 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_22410 8502 8984 gene locus_tag LOCUS_22420 8502 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence48 287 206 gene locus_tag LOCUS_t00370 287 206 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 386 312 gene locus_tag LOCUS_t00380 386 312 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1999 947 gene locus_tag LOCUS_22430 1999 947 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 protein_id gnl|my_center|LOCUS_22430 2429 2076 gene locus_tag LOCUS_22440 2429 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2532 3422 gene locus_tag LOCUS_22450 gene nhaR 2532 3422 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_22450 3528 4550 gene locus_tag LOCUS_22460 3528 4550 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_22460 4547 5623 gene locus_tag LOCUS_22470 4547 5623 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929099.1 protein_id gnl|my_center|LOCUS_22470 6712 5627 gene locus_tag LOCUS_22480 6712 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 7315 6788 gene locus_tag LOCUS_22490 7315 6788 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164013248.1 protein_id gnl|my_center|LOCUS_22490 8112 7288 gene locus_tag LOCUS_22500 8112 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence49 2391 706 gene locus_tag LOCUS_22510 2391 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3367 2381 gene locus_tag LOCUS_22520 3367 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3790 3377 gene locus_tag LOCUS_22530 3790 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4794 3811 gene locus_tag LOCUS_22540 4794 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 6927 4915 gene locus_tag LOCUS_22550 6927 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 8144 6927 gene locus_tag LOCUS_22560 8144 6927 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_22560 <8818 8163 gene locus_tag LOCUS_22570 <8818 8163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942137.1:type IV-A pilus assembly ATPase PilB >Feature sequence50 1620 1294 gene locus_tag LOCUS_22580 1620 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2590 1640 gene locus_tag LOCUS_22590 gene rsmH 2590 1640 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_22590 3168 2593 gene locus_tag LOCUS_22600 gene mraZ 3168 2593 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073909.1 protein_id gnl|my_center|LOCUS_22600 3980 3420 gene locus_tag LOCUS_22610 3980 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4294 4605 gene locus_tag LOCUS_22620 4294 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5770 4700 gene locus_tag LOCUS_22630 5770 4700 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_22630 6268 6576 gene locus_tag LOCUS_22640 6268 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 7834 6713 gene locus_tag LOCUS_22650 7834 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence51 531 845 gene locus_tag LOCUS_22660 gene rpsJ 531 845 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_22660 884 1528 gene locus_tag LOCUS_22670 gene rplC 884 1528 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_22670 1539 2213 gene locus_tag LOCUS_22680 gene rplD 1539 2213 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403580.1 protein_id gnl|my_center|LOCUS_22680 2452 4431 gene locus_tag LOCUS_22690 2452 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 4660 4406 gene locus_tag LOCUS_22700 4660 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5125 4712 gene locus_tag LOCUS_22710 5125 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 5540 5833 gene locus_tag LOCUS_22720 5540 5833 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385319.1 protein_id gnl|my_center|LOCUS_22720 5852 6676 gene locus_tag LOCUS_22730 gene rplB 5852 6676 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_22730 6689 6982 gene locus_tag LOCUS_22740 gene rpsS 6689 6982 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_22740 7003 7368 gene locus_tag LOCUS_22750 gene rplV 7003 7368 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_22750 7373 8044 gene locus_tag LOCUS_22760 gene rpsC 7373 8044 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence52 49 972 gene locus_tag LOCUS_22770 49 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 969 2804 gene locus_tag LOCUS_22780 969 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2903 4063 gene locus_tag LOCUS_22790 2903 4063 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965727.1 protein_id gnl|my_center|LOCUS_22790 5531 4080 gene locus_tag LOCUS_22800 5531 4080 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974780.1 protein_id gnl|my_center|LOCUS_22800 5739 6995 gene locus_tag LOCUS_22810 5739 6995 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence53 951 739 gene locus_tag LOCUS_22820 951 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1005 2186 gene locus_tag LOCUS_22830 1005 2186 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_22830 2183 3931 gene locus_tag LOCUS_22840 2183 3931 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_22840 4017 4553 gene locus_tag LOCUS_22850 gene dcd 4017 4553 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051821.1 protein_id gnl|my_center|LOCUS_22850 5113 4556 gene locus_tag LOCUS_22860 5113 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5390 5091 gene locus_tag LOCUS_22870 5390 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5368 6186 gene locus_tag LOCUS_22880 gene surE 5368 6186 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_22880 6284 6619 gene locus_tag LOCUS_22890 gene clpS 6284 6619 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975286.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence54 2436 952 gene locus_tag LOCUS_22900 2436 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3705 2770 gene locus_tag LOCUS_22910 3705 2770 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_22910 5569 3848 gene locus_tag LOCUS_22920 5569 3848 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_22920 6916 5663 gene locus_tag LOCUS_22930 6916 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence55 784 2034 gene locus_tag LOCUS_22940 gene rho 784 2034 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_22940 2521 2949 gene locus_tag LOCUS_22950 2521 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 4645 3116 gene locus_tag LOCUS_22960 4645 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence56 435 1202 gene locus_tag LOCUS_22970 gene lgt 435 1202 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772080.1 protein_id gnl|my_center|LOCUS_22970 1212 2132 gene locus_tag LOCUS_22980 1212 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2388 2753 gene locus_tag LOCUS_22990 2388 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 3355 4065 gene locus_tag LOCUS_23000 3355 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence57 949 1491 gene locus_tag LOCUS_23010 949 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 <2605 1622 gene locus_tag LOCUS_23020 <2605 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869387.1:ABC transporter substrate-binding protein >Feature sequence58 553 401 gene locus_tag LOCUS_23030 553 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 678 753 gene locus_tag LOCUS_t00390 678 753 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1062 1247 gene locus_tag LOCUS_23040 1062 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1273 2022 gene locus_tag LOCUS_23050 1273 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence59 82 339 gene locus_tag LOCUS_23060 82 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 468 1283 gene locus_tag LOCUS_23070 468 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1609 1307 gene locus_tag LOCUS_23080 1609 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 <2129 1612 gene locus_tag LOCUS_23090 <2129 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256313.1:glycosyltransferase family 2 protein >Feature sequence60 <1966 1185 gene locus_tag LOCUS_23100 <1966 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931819.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase