>Feature sequence001 <1 1104 gene locus_tag LOCUS_00010 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926994.1:AMP-dependent synthetase/ligase 1299 3257 gene locus_tag LOCUS_00020 1299 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3972 3397 gene locus_tag LOCUS_00030 3972 3397 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709451.1 protein_id gnl|my_center|LOCUS_00030 5295 4000 gene locus_tag LOCUS_00040 5295 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5789 5364 gene locus_tag LOCUS_00050 5789 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6896 5814 gene locus_tag LOCUS_00060 6896 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7440 6997 gene locus_tag LOCUS_00070 7440 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7745 7542 gene locus_tag LOCUS_00080 7745 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9516 7843 gene locus_tag LOCUS_00090 9516 7843 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_00090 9758 10609 gene locus_tag LOCUS_00100 9758 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680323.1 protein_id gnl|my_center|LOCUS_00100 11208 10606 gene locus_tag LOCUS_00110 11208 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11771 11517 gene locus_tag LOCUS_00120 11771 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13186 11807 gene locus_tag LOCUS_00130 gene purD 13186 11807 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228217.1 protein_id gnl|my_center|LOCUS_00130 13812 13183 gene locus_tag LOCUS_00140 13812 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14767 13805 gene locus_tag LOCUS_00150 gene purM 14767 13805 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527676.1 protein_id gnl|my_center|LOCUS_00150 16167 14764 gene locus_tag LOCUS_00160 gene purF 16167 14764 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_00160 16309 16950 gene locus_tag LOCUS_00170 16309 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18665 17013 gene locus_tag LOCUS_00180 18665 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19261 18770 gene locus_tag LOCUS_00190 19261 18770 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_00190 19404 20246 gene locus_tag LOCUS_00200 19404 20246 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669892.1 protein_id gnl|my_center|LOCUS_00200 20257 21384 gene locus_tag LOCUS_00210 20257 21384 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677016.1 protein_id gnl|my_center|LOCUS_00210 21500 21682 gene locus_tag LOCUS_00220 21500 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21984 21760 gene locus_tag LOCUS_00230 21984 21760 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_00230 22110 23015 gene locus_tag LOCUS_00240 22110 23015 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_00240 23060 24043 gene locus_tag LOCUS_00250 23060 24043 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_00250 24167 24829 gene locus_tag LOCUS_00260 24167 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24912 26210 gene locus_tag LOCUS_00270 gene eno 24912 26210 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682247.1 protein_id gnl|my_center|LOCUS_00270 26388 27608 gene locus_tag LOCUS_00280 26388 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28056 27694 gene locus_tag LOCUS_00290 28056 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556699.1 protein_id gnl|my_center|LOCUS_00290 28531 29814 gene locus_tag LOCUS_00300 gene asnS 28531 29814 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_00300 30579 29851 gene locus_tag LOCUS_00310 30579 29851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_00310 31517 30576 gene locus_tag LOCUS_00320 31517 30576 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence002 893 318 gene locus_tag LOCUS_00330 893 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 1069 3675 gene locus_tag LOCUS_00340 1069 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 4912 3662 gene locus_tag LOCUS_00350 4912 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 5712 4909 gene locus_tag LOCUS_00360 5712 4909 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048245.1 protein_id gnl|my_center|LOCUS_00360 5834 6334 gene locus_tag LOCUS_00370 5834 6334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680200.1 protein_id gnl|my_center|LOCUS_00370 6336 7685 gene locus_tag LOCUS_00380 6336 7685 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_00380 8648 7773 gene locus_tag LOCUS_00390 8648 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 10685 8670 gene locus_tag LOCUS_00400 gene yihQ 10685 8670 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380854.1 protein_id gnl|my_center|LOCUS_00400 11739 10843 gene locus_tag LOCUS_00410 11739 10843 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957234.1 protein_id gnl|my_center|LOCUS_00410 12973 12095 gene locus_tag LOCUS_00420 12973 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 13157 14098 gene locus_tag LOCUS_00430 13157 14098 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_00430 14215 14730 gene locus_tag LOCUS_00440 14215 14730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 14737 16743 gene locus_tag LOCUS_00450 14737 16743 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_00450 16897 18132 gene locus_tag LOCUS_00460 16897 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 19318 18188 gene locus_tag LOCUS_00470 19318 18188 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_00470 19755 19330 gene locus_tag LOCUS_00480 19755 19330 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_00480 20116 19769 gene locus_tag LOCUS_00490 20116 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 21676 20132 gene locus_tag LOCUS_00500 21676 20132 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_00500 22184 21774 gene locus_tag LOCUS_00510 gene mce 22184 21774 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_00510 23395 22181 gene locus_tag LOCUS_00520 23395 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 23799 23401 gene locus_tag LOCUS_00530 23799 23401 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_00530 25479 23812 gene locus_tag LOCUS_00540 25479 23812 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_00540 26030 25491 gene locus_tag LOCUS_00550 26030 25491 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_00550 26869 26009 gene locus_tag LOCUS_00560 26869 26009 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869712.1 protein_id gnl|my_center|LOCUS_00560 28002 26869 gene locus_tag LOCUS_00570 28002 26869 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_00570 28267 27995 gene locus_tag LOCUS_00580 28267 27995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 28816 29553 gene locus_tag LOCUS_00590 28816 29553 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392692.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence003 <1 2754 gene locus_tag LOCUS_00600 <1 2754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920602.1:FlgD immunoglobulin-like domain containing protein 4829 2835 gene locus_tag LOCUS_00610 4829 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4961 5245 gene locus_tag LOCUS_00620 4961 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 5403 7280 gene locus_tag LOCUS_00630 5403 7280 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_00630 7962 7387 gene locus_tag LOCUS_00640 7962 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 8750 7959 gene locus_tag LOCUS_00650 8750 7959 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_00650 11278 8747 gene locus_tag LOCUS_00660 11278 8747 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926991.1 protein_id gnl|my_center|LOCUS_00660 12492 11554 gene locus_tag LOCUS_00670 gene murB 12492 11554 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680945.1 protein_id gnl|my_center|LOCUS_00670 12689 14116 gene locus_tag LOCUS_00680 12689 14116 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_00680 14153 14686 gene locus_tag LOCUS_00690 14153 14686 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_00690 14676 15284 gene locus_tag LOCUS_00700 14676 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15281 15844 gene locus_tag LOCUS_00710 15281 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 15841 17568 gene locus_tag LOCUS_00720 15841 17568 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680944.1 protein_id gnl|my_center|LOCUS_00720 17762 19045 gene locus_tag LOCUS_00730 17762 19045 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938499.1 protein_id gnl|my_center|LOCUS_00730 19297 20532 gene locus_tag LOCUS_00740 19297 20532 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673293.1 protein_id gnl|my_center|LOCUS_00740 20547 21602 gene locus_tag LOCUS_00750 20547 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 21648 22148 gene locus_tag LOCUS_00760 21648 22148 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_00760 22296 23999 gene locus_tag LOCUS_00770 22296 23999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 24050 25411 gene locus_tag LOCUS_00780 24050 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 25742 26476 gene locus_tag LOCUS_00790 25742 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 <28648 26538 gene locus_tag LOCUS_00800 <28648 26538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680562.1:ATP-dependent DNA helicase RecG >Feature sequence004 1996 1538 gene locus_tag LOCUS_00810 1996 1538 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869552.1 protein_id gnl|my_center|LOCUS_00810 4114 2174 gene locus_tag LOCUS_00820 4114 2174 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169336296.1 protein_id gnl|my_center|LOCUS_00820 6437 4245 gene locus_tag LOCUS_00830 6437 4245 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681835.1 protein_id gnl|my_center|LOCUS_00830 6591 7175 gene locus_tag LOCUS_00840 gene thiF 6591 7175 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939369.1 protein_id gnl|my_center|LOCUS_00840 7172 7375 gene locus_tag LOCUS_00850 7172 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 8570 7425 gene locus_tag LOCUS_00860 8570 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 8996 8589 gene locus_tag LOCUS_00870 8996 8589 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_00870 9638 9012 gene locus_tag LOCUS_00880 9638 9012 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_00880 10146 9730 gene locus_tag LOCUS_00890 10146 9730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_00890 10832 10305 gene locus_tag LOCUS_00900 10832 10305 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951420.1 protein_id gnl|my_center|LOCUS_00900 11643 10924 gene locus_tag LOCUS_00910 11643 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12621 11716 gene locus_tag LOCUS_00920 12621 11716 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 protein_id gnl|my_center|LOCUS_00920 14180 12618 gene locus_tag LOCUS_00930 14180 12618 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099547.1 protein_id gnl|my_center|LOCUS_00930 14725 16374 gene locus_tag LOCUS_00940 gene pruA 14725 16374 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_00940 17607 16507 gene locus_tag LOCUS_00950 17607 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 17751 18146 gene locus_tag LOCUS_00960 17751 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 18198 18551 gene locus_tag LOCUS_00970 18198 18551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18660 20168 gene locus_tag LOCUS_00980 18660 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 20187 21677 gene locus_tag LOCUS_00990 20187 21677 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_00990 21688 22590 gene locus_tag LOCUS_01000 21688 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 22583 23473 gene locus_tag LOCUS_01010 22583 23473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 23540 25006 gene locus_tag LOCUS_01020 gene proS 23540 25006 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933157.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence005 3996 2134 gene locus_tag LOCUS_01030 3996 2134 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_01030 4174 4416 gene locus_tag LOCUS_01040 4174 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4525 4953 gene locus_tag LOCUS_01050 gene rplM 4525 4953 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682116.1 protein_id gnl|my_center|LOCUS_01050 4967 5359 gene locus_tag LOCUS_01060 gene rpsI 4967 5359 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682117.1 protein_id gnl|my_center|LOCUS_01060 5363 5995 gene locus_tag LOCUS_01070 5363 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 6085 6741 gene locus_tag LOCUS_01080 6085 6741 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682388.1 protein_id gnl|my_center|LOCUS_01080 7095 7892 gene locus_tag LOCUS_01090 7095 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7876 9516 gene locus_tag LOCUS_01100 7876 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 9513 9890 gene locus_tag LOCUS_01110 9513 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 9887 11647 gene locus_tag LOCUS_01120 9887 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 11628 12785 gene locus_tag LOCUS_01130 11628 12785 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_01130 12933 15914 gene locus_tag LOCUS_01140 12933 15914 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_01140 15929 16492 gene locus_tag LOCUS_01150 15929 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 16497 18080 gene locus_tag LOCUS_01160 16497 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 18250 19431 gene locus_tag LOCUS_01170 18250 19431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 19746 19501 gene locus_tag LOCUS_01180 19746 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_01180 20379 19942 gene locus_tag LOCUS_01190 20379 19942 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668975.1 protein_id gnl|my_center|LOCUS_01190 21330 20578 gene locus_tag LOCUS_01200 21330 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence006 <1 567 gene locus_tag LOCUS_01210 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678733.1:PhoH family protein 554 2785 gene locus_tag LOCUS_01220 554 2785 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678734.1 protein_id gnl|my_center|LOCUS_01220 2772 3227 gene locus_tag LOCUS_01230 gene ybeY 2772 3227 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668517.1 protein_id gnl|my_center|LOCUS_01230 3224 4030 gene locus_tag LOCUS_01240 3224 4030 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_01240 4032 6116 gene locus_tag LOCUS_01250 4032 6116 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678736.1 protein_id gnl|my_center|LOCUS_01250 6354 7700 gene locus_tag LOCUS_01260 gene gdhA 6354 7700 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766346.1 protein_id gnl|my_center|LOCUS_01260 8029 9789 gene locus_tag LOCUS_01270 8029 9789 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_01270 9803 10303 gene locus_tag LOCUS_01280 9803 10303 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_01280 11340 10429 gene locus_tag LOCUS_01290 11340 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 11563 14409 gene locus_tag LOCUS_01300 11563 14409 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 protein_id gnl|my_center|LOCUS_01300 14413 16236 gene locus_tag LOCUS_01310 14413 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 16245 19238 gene locus_tag LOCUS_01320 16245 19238 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_01320 19235 20149 gene locus_tag LOCUS_01330 19235 20149 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 protein_id gnl|my_center|LOCUS_01330 21223 20231 gene locus_tag LOCUS_01340 21223 20231 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence007 357 1547 gene locus_tag LOCUS_01350 357 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 1547 2281 gene locus_tag LOCUS_01360 1547 2281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681678.1 protein_id gnl|my_center|LOCUS_01360 2278 3465 gene locus_tag LOCUS_01370 2278 3465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_01370 3462 5114 gene locus_tag LOCUS_01380 3462 5114 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 protein_id gnl|my_center|LOCUS_01380 5111 5803 gene locus_tag LOCUS_01390 5111 5803 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_01390 9234 5815 gene locus_tag LOCUS_01400 9234 5815 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887385.1 protein_id gnl|my_center|LOCUS_01400 10664 9231 gene locus_tag LOCUS_01410 10664 9231 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228152.1 protein_id gnl|my_center|LOCUS_01410 12101 10674 gene locus_tag LOCUS_01420 12101 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 13012 12437 gene locus_tag LOCUS_01430 13012 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 14061 13081 gene locus_tag LOCUS_01440 14061 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 14982 14482 gene locus_tag LOCUS_01450 14982 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 15376 14969 gene locus_tag LOCUS_01460 15376 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 16606 15395 gene locus_tag LOCUS_01470 16606 15395 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_01470 16820 17347 gene locus_tag LOCUS_01480 16820 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_01480 18530 17511 gene locus_tag LOCUS_01490 18530 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 18754 19755 gene locus_tag LOCUS_01500 18754 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 19752 20369 gene locus_tag LOCUS_01510 19752 20369 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_01510 20366 21022 gene locus_tag LOCUS_01520 20366 21022 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 protein_id gnl|my_center|LOCUS_01520 21036 21635 gene locus_tag LOCUS_01530 gene nqrE 21036 21635 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 protein_id gnl|my_center|LOCUS_01530 >Feature sequence008 23 1111 gene locus_tag LOCUS_01540 23 1111 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673627.1 protein_id gnl|my_center|LOCUS_01540 1104 1748 gene locus_tag LOCUS_01550 1104 1748 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667217.1 protein_id gnl|my_center|LOCUS_01550 3693 1930 gene locus_tag LOCUS_01560 3693 1930 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918481.1 protein_id gnl|my_center|LOCUS_01560 4595 3690 gene locus_tag LOCUS_01570 4595 3690 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190237.1 protein_id gnl|my_center|LOCUS_01570 5230 4592 gene locus_tag LOCUS_01580 5230 4592 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870051.1 protein_id gnl|my_center|LOCUS_01580 5604 5227 gene locus_tag LOCUS_01590 5604 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01590 5698 5770 gene locus_tag LOCUS_t00010 5698 5770 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6847 6338 gene locus_tag LOCUS_01600 6847 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 7029 7102 gene locus_tag LOCUS_t00020 7029 7102 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7819 7295 gene locus_tag LOCUS_01610 7819 7295 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_01610 8853 7819 gene locus_tag LOCUS_01620 8853 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 9885 8890 gene locus_tag LOCUS_01630 9885 8890 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647231.1 protein_id gnl|my_center|LOCUS_01630 12284 9882 gene locus_tag LOCUS_01640 12284 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 12899 12348 gene locus_tag LOCUS_01650 12899 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 14832 13102 gene locus_tag LOCUS_01660 14832 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 15261 17132 gene locus_tag LOCUS_01670 gene aspS 15261 17132 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_01670 17244 17879 gene locus_tag LOCUS_01680 17244 17879 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 protein_id gnl|my_center|LOCUS_01680 18476 18003 gene locus_tag LOCUS_01690 18476 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 18617 19510 gene locus_tag LOCUS_01700 18617 19510 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_01700 19507 20322 gene locus_tag LOCUS_01710 19507 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 20309 20683 gene locus_tag LOCUS_01720 20309 20683 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687512.1 protein_id gnl|my_center|LOCUS_01720 20647 20781 gene locus_tag LOCUS_01730 20647 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence009 529 2010 gene locus_tag LOCUS_01740 gene dnaA 529 2010 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_01740 2388 3491 gene locus_tag LOCUS_01750 gene dnaN 2388 3491 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_01750 3548 4639 gene locus_tag LOCUS_01760 gene recF 3548 4639 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681135.1 protein_id gnl|my_center|LOCUS_01760 4620 5255 gene locus_tag LOCUS_01770 4620 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 5387 5542 gene locus_tag LOCUS_01780 gene rpmH 5387 5542 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667651.1 protein_id gnl|my_center|LOCUS_01780 5653 5925 gene locus_tag LOCUS_01790 5653 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6140 8005 gene locus_tag LOCUS_01800 gene yidC 6140 8005 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_01800 8093 8836 gene locus_tag LOCUS_01810 8093 8836 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_01810 9454 8927 gene locus_tag LOCUS_01820 9454 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 9607 11046 gene locus_tag LOCUS_01830 9607 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 12408 11071 gene locus_tag LOCUS_01840 12408 11071 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338923.1 protein_id gnl|my_center|LOCUS_01840 12490 13602 gene locus_tag LOCUS_01850 gene corA 12490 13602 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_01850 13778 15121 gene locus_tag LOCUS_01860 gene rsxC 13778 15121 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682097.1 protein_id gnl|my_center|LOCUS_01860 15108 16121 gene locus_tag LOCUS_01870 15108 16121 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002685644.1 protein_id gnl|my_center|LOCUS_01870 16118 16747 gene locus_tag LOCUS_01880 16118 16747 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_01880 16749 17390 gene locus_tag LOCUS_01890 16749 17390 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670120.1 protein_id gnl|my_center|LOCUS_01890 17387 17956 gene locus_tag LOCUS_01900 17387 17956 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670118.1 protein_id gnl|my_center|LOCUS_01900 17967 18803 gene locus_tag LOCUS_01910 17967 18803 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669703.1 protein_id gnl|my_center|LOCUS_01910 18891 20093 gene locus_tag LOCUS_01920 18891 20093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence010 1876 2058 gene locus_tag LOCUS_01930 1876 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 2342 4048 gene locus_tag LOCUS_01940 2342 4048 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_01940 4175 5947 gene locus_tag LOCUS_01950 4175 5947 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_01950 7009 5996 gene locus_tag LOCUS_01960 7009 5996 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_01960 7855 7070 gene locus_tag LOCUS_01970 7855 7070 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_01970 9021 7882 gene locus_tag LOCUS_01980 9021 7882 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_01980 9559 9173 gene locus_tag LOCUS_01990 9559 9173 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_01990 10461 9616 gene locus_tag LOCUS_02000 10461 9616 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_02000 11301 10522 gene locus_tag LOCUS_02010 11301 10522 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_02010 13223 11505 gene locus_tag LOCUS_02020 13223 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 13454 14455 gene locus_tag LOCUS_02030 gene argF 13454 14455 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_02030 14803 14570 gene locus_tag LOCUS_02040 14803 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 14897 15673 gene locus_tag LOCUS_02050 14897 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 15685 17007 gene locus_tag LOCUS_02060 15685 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 17028 17744 gene locus_tag LOCUS_02070 17028 17744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 protein_id gnl|my_center|LOCUS_02070 17741 19000 gene locus_tag LOCUS_02080 17741 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence011 1547 795 gene locus_tag LOCUS_02090 1547 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 1824 3200 gene locus_tag LOCUS_02100 gene rpoN 1824 3200 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_02100 3316 3606 gene locus_tag LOCUS_02110 3316 3606 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671537.1 protein_id gnl|my_center|LOCUS_02110 3613 5007 gene locus_tag LOCUS_02120 3613 5007 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876107.1 protein_id gnl|my_center|LOCUS_02120 5063 6052 gene locus_tag LOCUS_02130 gene hprK 5063 6052 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_02130 6075 6341 gene locus_tag LOCUS_02140 6075 6341 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_02140 6338 8140 gene locus_tag LOCUS_02150 6338 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 8157 9527 gene locus_tag LOCUS_02160 8157 9527 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_02160 9524 10123 gene locus_tag LOCUS_02170 gene lexA 9524 10123 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_02170 10125 11129 gene locus_tag LOCUS_02180 gene holA 10125 11129 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681969.1 protein_id gnl|my_center|LOCUS_02180 11342 13204 gene locus_tag LOCUS_02190 11342 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 14071 13298 gene locus_tag LOCUS_02200 14071 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 15734 14127 gene locus_tag LOCUS_02210 15734 14127 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_02210 16100 15780 gene locus_tag LOCUS_02220 16100 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 17165 16107 gene locus_tag LOCUS_02230 17165 16107 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956680.1 protein_id gnl|my_center|LOCUS_02230 18097 17255 gene locus_tag LOCUS_02240 gene purQ 18097 17255 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_02240 <19672 18107 gene locus_tag LOCUS_02250 <19672 18107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942279.1:phosphoribosylformylglycinamidine synthase subunit PurS >Feature sequence012 329 787 gene locus_tag LOCUS_02260 329 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 784 1017 gene locus_tag LOCUS_02270 784 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1014 1691 gene locus_tag LOCUS_02280 1014 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1688 1987 gene locus_tag LOCUS_02290 1688 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1984 2283 gene locus_tag LOCUS_02300 1984 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2280 2825 gene locus_tag LOCUS_02310 2280 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2822 4402 gene locus_tag LOCUS_02320 2822 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4587 4408 gene locus_tag LOCUS_02330 4587 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4697 4918 gene locus_tag LOCUS_02340 4697 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4915 5250 gene locus_tag LOCUS_02350 4915 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5379 6377 gene locus_tag LOCUS_02360 5379 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6374 6553 gene locus_tag LOCUS_02370 6374 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 6550 10068 gene locus_tag LOCUS_02380 6550 10068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 10065 10424 gene locus_tag LOCUS_02390 10065 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 10414 10866 gene locus_tag LOCUS_02400 10414 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 10941 11129 gene locus_tag LOCUS_02410 10941 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11126 11344 gene locus_tag LOCUS_02420 11126 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 11348 11797 gene locus_tag LOCUS_02430 11348 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 11809 12477 gene locus_tag LOCUS_02440 11809 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 protein_id gnl|my_center|LOCUS_02440 12470 12709 gene locus_tag LOCUS_02450 12470 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12767 12937 gene locus_tag LOCUS_02460 12767 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12934 13767 gene locus_tag LOCUS_02470 12934 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 13996 14592 gene locus_tag LOCUS_02480 13996 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 14589 16028 gene locus_tag LOCUS_02490 14589 16028 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 protein_id gnl|my_center|LOCUS_02490 16028 17506 gene locus_tag LOCUS_02500 16028 17506 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566295.1 protein_id gnl|my_center|LOCUS_02500 17503 18612 gene locus_tag LOCUS_02510 17503 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 18609 18914 gene locus_tag LOCUS_02520 18609 18914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence013 <1 744 gene locus_tag LOCUS_02530 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225184.1:LuxR family transcriptional regulator 899 2245 gene locus_tag LOCUS_02540 899 2245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_02540 3231 2341 gene locus_tag LOCUS_02550 3231 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4472 3339 gene locus_tag LOCUS_02560 4472 3339 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889130.1 protein_id gnl|my_center|LOCUS_02560 5753 4620 gene locus_tag LOCUS_02570 5753 4620 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_02570 5912 5766 gene locus_tag LOCUS_02580 5912 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 7189 5915 gene locus_tag LOCUS_02590 7189 5915 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868891.1 protein_id gnl|my_center|LOCUS_02590 7777 7205 gene locus_tag LOCUS_02600 7777 7205 CDS product DUF6305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016768.1 protein_id gnl|my_center|LOCUS_02600 9591 7903 gene locus_tag LOCUS_02610 gene ggt 9591 7903 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_02610 9848 10537 gene locus_tag LOCUS_02620 9848 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 11396 10545 gene locus_tag LOCUS_02630 11396 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 12003 11536 gene locus_tag LOCUS_02640 12003 11536 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080162.1 protein_id gnl|my_center|LOCUS_02640 12156 13418 gene locus_tag LOCUS_02650 12156 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 14486 13422 gene locus_tag LOCUS_02660 14486 13422 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008215.1 protein_id gnl|my_center|LOCUS_02660 15233 14544 gene locus_tag LOCUS_02670 15233 14544 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_02670 15348 15938 gene locus_tag LOCUS_02680 15348 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 16049 16525 gene locus_tag LOCUS_02690 16049 16525 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_02690 16616 17458 gene locus_tag LOCUS_02700 16616 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 18053 17694 gene locus_tag LOCUS_02710 18053 17694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence014 1977 736 gene locus_tag LOCUS_02720 1977 736 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250501.1 protein_id gnl|my_center|LOCUS_02720 2229 2062 gene locus_tag LOCUS_02730 2229 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3424 2684 gene locus_tag LOCUS_02740 gene truA 3424 2684 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_02740 3804 3442 gene locus_tag LOCUS_02750 3804 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5137 3815 gene locus_tag LOCUS_02760 5137 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 6027 5344 gene locus_tag LOCUS_02770 6027 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6196 7719 gene locus_tag LOCUS_02780 6196 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8427 7930 gene locus_tag LOCUS_02790 8427 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 8691 10007 gene locus_tag LOCUS_02800 8691 10007 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906058.1 protein_id gnl|my_center|LOCUS_02800 10172 10612 gene locus_tag LOCUS_02810 10172 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 10609 12528 gene locus_tag LOCUS_02820 10609 12528 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_02820 12528 13115 gene locus_tag LOCUS_02830 12528 13115 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_02830 13118 13717 gene locus_tag LOCUS_02840 13118 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 13721 14908 gene locus_tag LOCUS_02850 13721 14908 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_02850 14975 15745 gene locus_tag LOCUS_02860 14975 15745 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_02860 15829 16482 gene locus_tag LOCUS_02870 15829 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 <18016 16489 gene locus_tag LOCUS_02880 <18016 16489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940946.1:B12-binding domain-containing radical SAM protein >Feature sequence015 718 224 gene locus_tag LOCUS_02890 718 224 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_02890 862 1578 gene locus_tag LOCUS_02900 862 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1691 4297 gene locus_tag LOCUS_02910 1691 4297 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943149.1 protein_id gnl|my_center|LOCUS_02910 5120 4341 gene locus_tag LOCUS_02920 5120 4341 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250859.1 protein_id gnl|my_center|LOCUS_02920 5388 5101 gene locus_tag LOCUS_02930 5388 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02930 6299 5385 gene locus_tag LOCUS_02940 gene lipA 6299 5385 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_02940 6961 6296 gene locus_tag LOCUS_02950 6961 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 7144 8316 gene locus_tag LOCUS_02960 7144 8316 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938231.1 protein_id gnl|my_center|LOCUS_02960 9468 8416 gene locus_tag LOCUS_02970 9468 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9572 13468 gene locus_tag LOCUS_02980 9572 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13470 14003 gene locus_tag LOCUS_02990 13470 14003 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_02990 14003 16762 gene locus_tag LOCUS_03000 14003 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence016 544 20 gene locus_tag LOCUS_03010 544 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 841 1422 gene locus_tag LOCUS_03020 841 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 1478 3079 gene locus_tag LOCUS_03030 1478 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3221 5410 gene locus_tag LOCUS_03040 3221 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5407 10632 gene locus_tag LOCUS_03050 5407 10632 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_03050 10629 13475 gene locus_tag LOCUS_03060 10629 13475 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_03060 13472 13672 gene locus_tag LOCUS_03070 13472 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 13665 13868 gene locus_tag LOCUS_03080 13665 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 13865 14299 gene locus_tag LOCUS_03090 13865 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 14296 14865 gene locus_tag LOCUS_03100 14296 14865 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948683.1 protein_id gnl|my_center|LOCUS_03100 14862 16475 gene locus_tag LOCUS_03110 14862 16475 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230225.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence017 <1 1038 gene locus_tag LOCUS_03120 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389160.1:chemotaxis response regulator protein-glutamate methylesterase 1035 1514 gene locus_tag LOCUS_03130 1035 1514 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_03130 1525 1905 gene locus_tag LOCUS_03140 1525 1905 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_03140 1902 2426 gene locus_tag LOCUS_03150 1902 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3499 2420 gene locus_tag LOCUS_03160 3499 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4127 3477 gene locus_tag LOCUS_03170 4127 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5569 4124 gene locus_tag LOCUS_03180 5569 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5722 7386 gene locus_tag LOCUS_03190 5722 7386 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941379.1 protein_id gnl|my_center|LOCUS_03190 7449 8090 gene locus_tag LOCUS_03200 7449 8090 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_03200 8654 8178 gene locus_tag LOCUS_03210 8654 8178 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390240.1 protein_id gnl|my_center|LOCUS_03210 8709 9056 gene locus_tag LOCUS_03220 8709 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 9078 9302 gene locus_tag LOCUS_03230 9078 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 9478 9299 gene locus_tag LOCUS_03240 9478 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 10344 9577 gene locus_tag LOCUS_03250 10344 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 10952 10344 gene locus_tag LOCUS_03260 10952 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 11134 12276 gene locus_tag LOCUS_03270 11134 12276 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_03270 12332 13066 gene locus_tag LOCUS_03280 gene surE 12332 13066 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_03280 13075 13761 gene locus_tag LOCUS_03290 13075 13761 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680214.1 protein_id gnl|my_center|LOCUS_03290 13758 15932 gene locus_tag LOCUS_03300 13758 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680210.1 protein_id gnl|my_center|LOCUS_03300 16024 16097 gene locus_tag LOCUS_t00030 16024 16097 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16130 16214 gene locus_tag LOCUS_t00040 16130 16214 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16264 16761 gene locus_tag LOCUS_03310 16264 16761 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671181.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence018 <1 989 gene locus_tag LOCUS_03320 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669886.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1848 1039 gene locus_tag LOCUS_03330 1848 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 3623 1875 gene locus_tag LOCUS_03340 3623 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956828.1 protein_id gnl|my_center|LOCUS_03340 4549 3620 gene locus_tag LOCUS_03350 4549 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5527 4874 gene locus_tag LOCUS_03360 5527 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6265 5549 gene locus_tag LOCUS_03370 6265 5549 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_03370 6662 6279 gene locus_tag LOCUS_03380 6662 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7250 6699 gene locus_tag LOCUS_03390 7250 6699 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668265.1 protein_id gnl|my_center|LOCUS_03390 8233 7433 gene locus_tag LOCUS_03400 8233 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8314 9105 gene locus_tag LOCUS_03410 8314 9105 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_03410 10230 9136 gene locus_tag LOCUS_03420 10230 9136 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_03420 11237 10494 gene locus_tag LOCUS_03430 11237 10494 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675248.1 protein_id gnl|my_center|LOCUS_03430 12127 11219 gene locus_tag LOCUS_03440 12127 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 13708 12200 gene locus_tag LOCUS_03450 13708 12200 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003289.1 protein_id gnl|my_center|LOCUS_03450 13807 14310 gene locus_tag LOCUS_03460 13807 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 14312 15454 gene locus_tag LOCUS_03470 14312 15454 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678981.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence019 41 1862 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgcccttcgcgggcgcgtggattgaaac 2072 2677 gene locus_tag LOCUS_03480 2072 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 2941 2720 gene locus_tag LOCUS_03490 2941 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 5190 3004 gene locus_tag LOCUS_03500 5190 3004 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681580.1 protein_id gnl|my_center|LOCUS_03500 6280 5363 gene locus_tag LOCUS_03510 6280 5363 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_03510 8190 6409 gene locus_tag LOCUS_03520 8190 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 8329 9156 gene locus_tag LOCUS_03530 8329 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 9751 9278 gene locus_tag LOCUS_03540 9751 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 10001 10891 gene locus_tag LOCUS_03550 10001 10891 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_03550 10888 11373 gene locus_tag LOCUS_03560 10888 11373 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369299.1 protein_id gnl|my_center|LOCUS_03560 11370 12797 gene locus_tag LOCUS_03570 11370 12797 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404498.1 protein_id gnl|my_center|LOCUS_03570 14898 12802 gene locus_tag LOCUS_03580 14898 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 15935 15135 gene locus_tag LOCUS_03590 15935 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence020 <1 643 gene locus_tag LOCUS_03600 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001168062.1:3-deoxy-7-phosphoheptulonate synthase AroF 2112 694 gene locus_tag LOCUS_03610 gene gnd 2112 694 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_03610 2462 2292 gene locus_tag LOCUS_03620 2462 2292 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_03620 4536 2575 gene locus_tag LOCUS_03630 4536 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4658 5803 gene locus_tag LOCUS_03640 4658 5803 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_03640 5937 7688 gene locus_tag LOCUS_03650 5937 7688 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668661.1 protein_id gnl|my_center|LOCUS_03650 7733 9943 gene locus_tag LOCUS_03660 7733 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 10885 9992 gene locus_tag LOCUS_03670 10885 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 12207 10882 gene locus_tag LOCUS_03680 12207 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 13910 12204 gene locus_tag LOCUS_03690 13910 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 14527 13907 gene locus_tag LOCUS_03700 14527 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 15363 14581 gene locus_tag LOCUS_03710 15363 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 <16205 15391 gene locus_tag LOCUS_03720 <16205 15391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680846.1:DUF5312 domain-containing protein >Feature sequence021 1797 877 gene locus_tag LOCUS_03730 1797 877 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677091.1 protein_id gnl|my_center|LOCUS_03730 2825 1794 gene locus_tag LOCUS_03740 2825 1794 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669950.1 protein_id gnl|my_center|LOCUS_03740 3385 2825 gene locus_tag LOCUS_03750 3385 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4490 3483 gene locus_tag LOCUS_03760 4490 3483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258072.1 protein_id gnl|my_center|LOCUS_03760 5230 4511 gene locus_tag LOCUS_03770 5230 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5474 6604 gene locus_tag LOCUS_03780 5474 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 9034 6728 gene locus_tag LOCUS_03790 9034 6728 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792925.1 protein_id gnl|my_center|LOCUS_03790 9584 9012 gene locus_tag LOCUS_03800 9584 9012 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_03800 11164 9581 gene locus_tag LOCUS_03810 11164 9581 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_03810 12742 11390 gene locus_tag LOCUS_03820 12742 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12956 15244 gene locus_tag LOCUS_03830 gene plpD 12956 15244 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_03830 15269 15976 gene locus_tag LOCUS_03840 15269 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 16091 16172 gene locus_tag LOCUS_t00050 16091 16172 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 1048 806 gene locus_tag LOCUS_03850 1048 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 2769 1306 gene locus_tag LOCUS_03860 gene pyk 2769 1306 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_03860 4541 2916 gene locus_tag LOCUS_03870 4541 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 4667 5083 gene locus_tag LOCUS_03880 4667 5083 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_03880 5080 7218 gene locus_tag LOCUS_03890 5080 7218 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_03890 7267 9000 gene locus_tag LOCUS_03900 7267 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 9410 8997 gene locus_tag LOCUS_03910 9410 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 12040 9407 gene locus_tag LOCUS_03920 12040 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11975 12196 gene locus_tag LOCUS_03930 11975 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 14215 12311 gene locus_tag LOCUS_03940 14215 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 15196 14279 gene locus_tag LOCUS_03950 15196 14279 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_03950 <15913 15207 gene locus_tag LOCUS_03960 <15913 15207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942704.1:HDOD domain-containing protein >Feature sequence023 77 1894 gene locus_tag LOCUS_03970 77 1894 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149454.1 protein_id gnl|my_center|LOCUS_03970 1903 2721 gene locus_tag LOCUS_03980 1903 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2718 4109 gene locus_tag LOCUS_03990 2718 4109 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_03990 4111 4803 gene locus_tag LOCUS_04000 gene pgmB 4111 4803 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_04000 4892 5869 gene locus_tag LOCUS_04010 4892 5869 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989346.1 protein_id gnl|my_center|LOCUS_04010 6188 7696 gene locus_tag LOCUS_04020 6188 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 7918 7766 gene locus_tag LOCUS_04030 7918 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7979 8506 gene locus_tag LOCUS_04040 7979 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 8774 8424 gene locus_tag LOCUS_04050 8774 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9874 8813 gene locus_tag LOCUS_04060 gene rsgA 9874 8813 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_04060 10234 10758 gene locus_tag LOCUS_04070 10234 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 10864 11634 gene locus_tag LOCUS_04080 gene nfsA 10864 11634 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244098.1 protein_id gnl|my_center|LOCUS_04080 11676 12167 gene locus_tag LOCUS_04090 11676 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 12160 12564 gene locus_tag LOCUS_04100 12160 12564 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072996.1 protein_id gnl|my_center|LOCUS_04100 13862 12582 gene locus_tag LOCUS_04110 13862 12582 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_04110 <15265 13853 gene locus_tag LOCUS_04120 <15265 13853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096407.1:sugar phosphorylase >Feature sequence024 6859 3368 gene locus_tag LOCUS_04130 gene rpoB 6859 3368 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680361.1 protein_id gnl|my_center|LOCUS_04130 7096 6911 gene locus_tag LOCUS_04140 7096 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7550 7170 gene locus_tag LOCUS_04150 gene rplL 7550 7170 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036117.1 protein_id gnl|my_center|LOCUS_04150 8213 7671 gene locus_tag LOCUS_04160 gene rplJ 8213 7671 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680363.1 protein_id gnl|my_center|LOCUS_04160 8901 8218 gene locus_tag LOCUS_04170 gene rplA 8901 8218 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667601.1 protein_id gnl|my_center|LOCUS_04170 9336 8905 gene locus_tag LOCUS_04180 gene rplK 9336 8905 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_04180 10112 9555 gene locus_tag LOCUS_04190 gene nusG 10112 9555 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_04190 10307 10125 gene locus_tag LOCUS_04200 10307 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 10444 10370 gene locus_tag LOCUS_t00060 10444 10370 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10775 10602 gene locus_tag LOCUS_04210 gene rpmG 10775 10602 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_04210 10979 10907 gene locus_tag LOCUS_t00070 10979 10907 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12690 11089 gene locus_tag LOCUS_04220 gene murJ 12690 11089 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_04220 12822 14708 gene locus_tag LOCUS_04230 12822 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence025 1362 1081 gene locus_tag LOCUS_04240 1362 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2940 1885 gene locus_tag LOCUS_04250 2940 1885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670594.1 protein_id gnl|my_center|LOCUS_04250 3154 3957 gene locus_tag LOCUS_04260 gene udp 3154 3957 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_04260 4049 4627 gene locus_tag LOCUS_04270 4049 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5330 4737 gene locus_tag LOCUS_04280 5330 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5523 5359 gene locus_tag LOCUS_04290 5523 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5918 5520 gene locus_tag LOCUS_04300 5918 5520 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328395.1 protein_id gnl|my_center|LOCUS_04300 7123 5951 gene locus_tag LOCUS_04310 7123 5951 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667812.1 protein_id gnl|my_center|LOCUS_04310 7377 7120 gene locus_tag LOCUS_04320 7377 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 8614 7370 gene locus_tag LOCUS_04330 8614 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 9047 8664 gene locus_tag LOCUS_04340 gene rplS 9047 8664 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670222.1 protein_id gnl|my_center|LOCUS_04340 9777 9010 gene locus_tag LOCUS_04350 gene trmD 9777 9010 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_04350 10301 9774 gene locus_tag LOCUS_04360 gene rimM 10301 9774 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159892.1 protein_id gnl|my_center|LOCUS_04360 10627 10394 gene locus_tag LOCUS_04370 10627 10394 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_04370 10932 10681 gene locus_tag LOCUS_04380 gene rpsP 10932 10681 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_04380 11129 12109 gene locus_tag LOCUS_04390 11129 12109 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680981.1 protein_id gnl|my_center|LOCUS_04390 12265 14169 gene locus_tag LOCUS_04400 12265 14169 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_04400 14403 14654 gene locus_tag LOCUS_04410 14403 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence026 38 895 gene locus_tag LOCUS_04420 38 895 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524828.1 protein_id gnl|my_center|LOCUS_04420 916 1767 gene locus_tag LOCUS_04430 916 1767 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_04430 1787 2713 gene locus_tag LOCUS_04440 1787 2713 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948290.1 protein_id gnl|my_center|LOCUS_04440 2832 3971 gene locus_tag LOCUS_04450 2832 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 6283 3968 gene locus_tag LOCUS_04460 6283 3968 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_04460 7335 6280 gene locus_tag LOCUS_04470 7335 6280 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966245.1 protein_id gnl|my_center|LOCUS_04470 7454 10951 gene locus_tag LOCUS_04480 7454 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 11036 11386 gene locus_tag LOCUS_04490 11036 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 12364 11480 gene locus_tag LOCUS_04500 12364 11480 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460600.1 protein_id gnl|my_center|LOCUS_04500 13826 12399 gene locus_tag LOCUS_04510 13826 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 14574 13867 gene locus_tag LOCUS_04520 14574 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence027 3 1360 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcgcccgcgaagggcgcgac 1954 1664 gene locus_tag LOCUS_04530 gene cas2 1954 1664 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_04530 2988 1957 gene locus_tag LOCUS_04540 gene cas1c 2988 1957 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_04540 3644 2985 gene locus_tag LOCUS_04550 gene cas4 3644 2985 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_04550 4675 3797 gene locus_tag LOCUS_04560 gene cas7c 4675 3797 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_04560 6445 4694 gene locus_tag LOCUS_04570 gene cas8c 6445 4694 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_04570 7179 6442 gene locus_tag LOCUS_04580 gene cas5c 7179 6442 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_04580 8580 7192 gene locus_tag LOCUS_04590 8580 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 8488 8763 gene locus_tag LOCUS_04600 8488 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 9079 9471 gene locus_tag LOCUS_04610 9079 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 10611 9646 gene locus_tag LOCUS_04620 10611 9646 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_04620 10851 11756 gene locus_tag LOCUS_04630 10851 11756 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_04630 13763 11808 gene locus_tag LOCUS_04640 gene priA 13763 11808 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_04640 <14490 13789 gene locus_tag LOCUS_04650 <14490 13789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680465.1:uracil-DNA glycosylase >Feature sequence028 4368 2713 gene locus_tag LOCUS_04660 4368 2713 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_04660 6423 4399 gene locus_tag LOCUS_04670 6423 4399 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_04670 6791 8047 gene locus_tag LOCUS_04680 6791 8047 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095472.1 protein_id gnl|my_center|LOCUS_04680 8232 9146 gene locus_tag LOCUS_04690 8232 9146 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_04690 9143 10000 gene locus_tag LOCUS_04700 9143 10000 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_04700 10016 11071 gene locus_tag LOCUS_04710 10016 11071 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994395.1 protein_id gnl|my_center|LOCUS_04710 11112 12146 gene locus_tag LOCUS_04720 11112 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence029 244 1374 gene locus_tag LOCUS_04730 244 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1503 2201 gene locus_tag LOCUS_04740 gene pyrH 1503 2201 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_04740 2422 4512 gene locus_tag LOCUS_04750 2422 4512 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986476.1 protein_id gnl|my_center|LOCUS_04750 4700 6487 gene locus_tag LOCUS_04760 4700 6487 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_04760 6497 6733 gene locus_tag LOCUS_04770 6497 6733 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 protein_id gnl|my_center|LOCUS_04770 6736 7428 gene locus_tag LOCUS_04780 6736 7428 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_04780 8504 7515 gene locus_tag LOCUS_04790 8504 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 9601 8528 gene locus_tag LOCUS_04800 9601 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 10563 9598 gene locus_tag LOCUS_04810 10563 9598 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326134.1 protein_id gnl|my_center|LOCUS_04810 11362 10568 gene locus_tag LOCUS_04820 11362 10568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_04820 13506 11359 gene locus_tag LOCUS_04830 13506 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence030 2165 81 gene locus_tag LOCUS_04840 2165 81 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681033.1 protein_id gnl|my_center|LOCUS_04840 2436 3707 gene locus_tag LOCUS_04850 2436 3707 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_04850 5003 3918 gene locus_tag LOCUS_04860 5003 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5765 5412 gene locus_tag LOCUS_tm00010 5765 5412 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 7008 5905 gene locus_tag LOCUS_04870 gene mnmA 7008 5905 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_04870 7178 8290 gene locus_tag LOCUS_04880 7178 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 8428 9570 gene locus_tag LOCUS_04890 8428 9570 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566189.1 protein_id gnl|my_center|LOCUS_04890 9586 9741 gene locus_tag LOCUS_04900 9586 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 10095 11264 gene locus_tag LOCUS_04910 gene trpB 10095 11264 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111170.1 protein_id gnl|my_center|LOCUS_04910 12475 11261 gene locus_tag LOCUS_04920 12475 11261 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682387.1 protein_id gnl|my_center|LOCUS_04920 12948 12736 gene locus_tag LOCUS_04930 gene rpmE 12948 12736 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_04930 <13985 13063 gene locus_tag LOCUS_04940 <13985 13063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668994.1:transcription termination factor Rho >Feature sequence031 1824 1357 gene locus_tag LOCUS_04950 1824 1357 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_04950 2934 1933 gene locus_tag LOCUS_04960 2934 1933 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840062.1 protein_id gnl|my_center|LOCUS_04960 4427 2931 gene locus_tag LOCUS_04970 gene gltX 4427 2931 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_04970 6108 4600 gene locus_tag LOCUS_04980 6108 4600 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_04980 6314 7717 gene locus_tag LOCUS_04990 6314 7717 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_04990 7714 8004 gene locus_tag LOCUS_05000 7714 8004 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224148.1 protein_id gnl|my_center|LOCUS_05000 8296 8078 gene locus_tag LOCUS_05010 8296 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 8253 9446 gene locus_tag LOCUS_05020 8253 9446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769298.1 protein_id gnl|my_center|LOCUS_05020 9446 9877 gene locus_tag LOCUS_05030 9446 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 10693 9923 gene locus_tag LOCUS_05040 gene rnc 10693 9923 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_05040 10966 10730 gene locus_tag LOCUS_05050 gene acpP 10966 10730 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670497.1 protein_id gnl|my_center|LOCUS_05050 11169 10981 gene locus_tag LOCUS_05060 gene rpmF 11169 10981 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670496.1 protein_id gnl|my_center|LOCUS_05060 11780 11289 gene locus_tag LOCUS_05070 gene coaD 11780 11289 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678956.1 protein_id gnl|my_center|LOCUS_05070 11896 13593 gene locus_tag LOCUS_05080 gene lnt 11896 13593 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680216.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence032 <1 1858 gene locus_tag LOCUS_05090 <1 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666949.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1871 4453 gene locus_tag LOCUS_05100 gene gyrA 1871 4453 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_05100 5812 4526 gene locus_tag LOCUS_05110 5812 4526 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258575.1 protein_id gnl|my_center|LOCUS_05110 8104 5855 gene locus_tag LOCUS_05120 8104 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 8711 8208 gene locus_tag LOCUS_05130 8711 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9774 8767 gene locus_tag LOCUS_05140 9774 8767 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256287.1 protein_id gnl|my_center|LOCUS_05140 10043 11803 gene locus_tag LOCUS_05150 10043 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 12187 11849 gene locus_tag LOCUS_05160 12187 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 12635 12234 gene locus_tag LOCUS_05170 12635 12234 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_05170 <13931 12632 gene locus_tag LOCUS_05180 <13931 12632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000558138.1:PAS domain-containing protein >Feature sequence033 984 25 gene locus_tag LOCUS_05190 984 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 1100 2149 gene locus_tag LOCUS_05200 1100 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2146 2958 gene locus_tag LOCUS_05210 2146 2958 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_05210 4975 3197 gene locus_tag LOCUS_05220 4975 3197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_05220 6882 4972 gene locus_tag LOCUS_05230 6882 4972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_05230 7151 9265 gene locus_tag LOCUS_05240 7151 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9262 10434 gene locus_tag LOCUS_05250 9262 10434 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727108.1 protein_id gnl|my_center|LOCUS_05250 11500 10577 gene locus_tag LOCUS_05260 11500 10577 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_05260 12975 11503 gene locus_tag LOCUS_05270 gene xylB 12975 11503 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_05270 13456 12986 gene locus_tag LOCUS_05280 13456 12986 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276566.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence034 2180 945 gene locus_tag LOCUS_05290 gene sbcD 2180 945 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681053.1 protein_id gnl|my_center|LOCUS_05290 3509 2262 gene locus_tag LOCUS_05300 3509 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4060 3506 gene locus_tag LOCUS_05310 4060 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4998 4666 gene locus_tag LOCUS_05320 4998 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5548 5072 gene locus_tag LOCUS_05330 5548 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5791 7698 gene locus_tag LOCUS_05340 5791 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 7757 10039 gene locus_tag LOCUS_05350 7757 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 10119 10637 gene locus_tag LOCUS_05360 10119 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 10696 11472 gene locus_tag LOCUS_05370 10696 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 13715 11469 gene locus_tag LOCUS_05380 13715 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence035 2267 4975 gene locus_tag LOCUS_05390 2267 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 5074 5997 gene locus_tag LOCUS_05400 5074 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 6063 6431 gene locus_tag LOCUS_05410 6063 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8823 6418 gene locus_tag LOCUS_05420 8823 6418 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_05420 8999 9436 gene locus_tag LOCUS_05430 8999 9436 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732458.1 protein_id gnl|my_center|LOCUS_05430 9547 12132 gene locus_tag LOCUS_05440 9547 12132 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228248.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence036 662 54 gene locus_tag LOCUS_05450 662 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 791 1291 gene locus_tag LOCUS_05460 791 1291 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_05460 1680 1288 gene locus_tag LOCUS_05470 1680 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1679 2188 gene locus_tag LOCUS_05480 1679 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4307 2217 gene locus_tag LOCUS_05490 4307 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 4537 4310 gene locus_tag LOCUS_05500 4537 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 6566 4527 gene locus_tag LOCUS_05510 6566 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6701 7804 gene locus_tag LOCUS_05520 6701 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8338 7841 gene locus_tag LOCUS_05530 8338 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9925 8372 gene locus_tag LOCUS_05540 9925 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10796 9954 gene locus_tag LOCUS_05550 gene galU 10796 9954 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721336.1 protein_id gnl|my_center|LOCUS_05550 11041 12369 gene locus_tag LOCUS_05560 11041 12369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_05560 12393 13169 gene locus_tag LOCUS_05570 12393 13169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667427.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence037 1511 477 gene locus_tag LOCUS_05580 1511 477 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_05580 1656 3530 gene locus_tag LOCUS_05590 1656 3530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_05590 3533 5347 gene locus_tag LOCUS_05600 3533 5347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_05600 5405 6238 gene locus_tag LOCUS_05610 5405 6238 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943194.1 protein_id gnl|my_center|LOCUS_05610 6969 6235 gene locus_tag LOCUS_05620 6969 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 7202 8677 gene locus_tag LOCUS_05630 7202 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 8677 9324 gene locus_tag LOCUS_05640 8677 9324 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_05640 9598 10692 gene locus_tag LOCUS_05650 9598 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 10792 11547 gene locus_tag LOCUS_05660 gene fabG 10792 11547 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_05660 11641 11967 gene locus_tag LOCUS_05670 11641 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 11983 13068 gene locus_tag LOCUS_05680 11983 13068 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence038 1899 550 gene locus_tag LOCUS_05690 1899 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3093 2035 gene locus_tag LOCUS_05700 gene mglC 3093 2035 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275119.1 protein_id gnl|my_center|LOCUS_05700 4620 3106 gene locus_tag LOCUS_05710 gene mglA 4620 3106 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255020.1 protein_id gnl|my_center|LOCUS_05710 5718 4720 gene locus_tag LOCUS_05720 gene mglB 5718 4720 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 protein_id gnl|my_center|LOCUS_05720 6064 5789 gene locus_tag LOCUS_05730 6064 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7041 6259 gene locus_tag LOCUS_05740 7041 6259 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766786.1 protein_id gnl|my_center|LOCUS_05740 7395 7051 gene locus_tag LOCUS_05750 7395 7051 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_05750 8429 7452 gene locus_tag LOCUS_05760 8429 7452 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053995180.1 protein_id gnl|my_center|LOCUS_05760 8687 9172 gene locus_tag LOCUS_05770 8687 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 9346 9945 gene locus_tag LOCUS_05780 9346 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 11142 10009 gene locus_tag LOCUS_05790 gene alr 11142 10009 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05790 11486 12628 gene locus_tag LOCUS_05800 11486 12628 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence039 325 1083 gene locus_tag LOCUS_05810 325 1083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_05810 1131 1931 gene locus_tag LOCUS_05820 1131 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1989 2741 gene locus_tag LOCUS_05830 1989 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2838 3416 gene locus_tag LOCUS_05840 2838 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3540 4889 gene locus_tag LOCUS_05850 3540 4889 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_05850 5846 4896 gene locus_tag LOCUS_05860 5846 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 6301 5843 gene locus_tag LOCUS_05870 6301 5843 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_05870 6945 6298 gene locus_tag LOCUS_05880 6945 6298 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_05880 7080 8987 gene locus_tag LOCUS_05890 gene recQ 7080 8987 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681287.1 protein_id gnl|my_center|LOCUS_05890 10499 9048 gene locus_tag LOCUS_05900 10499 9048 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_05900 13129 10487 gene locus_tag LOCUS_05910 13129 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence040 2913 754 gene locus_tag LOCUS_05920 2913 754 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_05920 4347 3238 gene locus_tag LOCUS_05930 4347 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4273 4827 gene locus_tag LOCUS_05940 4273 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 4980 5795 gene locus_tag LOCUS_05950 gene proC 4980 5795 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_05950 7210 5831 gene locus_tag LOCUS_05960 7210 5831 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_05960 7920 7207 gene locus_tag LOCUS_05970 7920 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9385 8054 gene locus_tag LOCUS_05980 9385 8054 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_05980 10641 9499 gene locus_tag LOCUS_05990 10641 9499 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112517.1 protein_id gnl|my_center|LOCUS_05990 11564 10854 gene locus_tag LOCUS_06000 11564 10854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_06000 12322 11564 gene locus_tag LOCUS_06010 12322 11564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925352.1 protein_id gnl|my_center|LOCUS_06010 13371 12319 gene locus_tag LOCUS_06020 13371 12319 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence041 3493 2366 gene locus_tag LOCUS_06030 3493 2366 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_06030 4999 3638 gene locus_tag LOCUS_06040 4999 3638 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_06040 6477 5311 gene locus_tag LOCUS_06050 gene metK 6477 5311 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_06050 6873 7724 gene locus_tag LOCUS_06060 6873 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 8388 7771 gene locus_tag LOCUS_06070 8388 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8541 10040 gene locus_tag LOCUS_06080 gene glpK 8541 10040 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_06080 10099 10962 gene locus_tag LOCUS_06090 10099 10962 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760477.1 protein_id gnl|my_center|LOCUS_06090 10973 11428 gene locus_tag LOCUS_06100 10973 11428 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932326.1 protein_id gnl|my_center|LOCUS_06100 11425 12195 gene locus_tag LOCUS_06110 11425 12195 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_06110 12206 13456 gene locus_tag LOCUS_06120 12206 13456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence042 2664 1867 gene locus_tag LOCUS_06130 gene whiG 2664 1867 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_06130 3473 2661 gene locus_tag LOCUS_06140 3473 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4485 3562 gene locus_tag LOCUS_06150 4485 3562 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_06150 5751 4489 gene locus_tag LOCUS_06160 gene flhF 5751 4489 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556869.1 protein_id gnl|my_center|LOCUS_06160 7845 5755 gene locus_tag LOCUS_06170 gene flhA 7845 5755 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889723.1 protein_id gnl|my_center|LOCUS_06170 9189 7873 gene locus_tag LOCUS_06180 gene flhB 9189 7873 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680909.1 protein_id gnl|my_center|LOCUS_06180 9962 9186 gene locus_tag LOCUS_06190 gene fliR 9962 9186 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673318.1 protein_id gnl|my_center|LOCUS_06190 10239 9970 gene locus_tag LOCUS_06200 gene fliQ 10239 9970 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_06200 11167 10256 gene locus_tag LOCUS_06210 gene fliP 11167 10256 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680826.1 protein_id gnl|my_center|LOCUS_06210 11823 11164 gene locus_tag LOCUS_06220 11823 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 13180 11984 gene locus_tag LOCUS_06230 13180 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence043 <1 553 gene locus_tag LOCUS_06240 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein 662 1231 gene locus_tag LOCUS_06250 662 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1218 1694 gene locus_tag LOCUS_06260 1218 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1711 2166 gene locus_tag LOCUS_06270 1711 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2207 2635 gene locus_tag LOCUS_06280 2207 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3097 2744 gene locus_tag LOCUS_06290 3097 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3617 3108 gene locus_tag LOCUS_06300 3617 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3710 5512 gene locus_tag LOCUS_06310 gene pepF 3710 5512 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_06310 5628 6740 gene locus_tag LOCUS_06320 5628 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6860 9010 gene locus_tag LOCUS_06330 6860 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9103 11526 gene locus_tag LOCUS_06340 9103 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence044 2943 361 gene locus_tag LOCUS_06350 2943 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3159 5273 gene locus_tag LOCUS_06360 3159 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6813 5293 gene locus_tag LOCUS_06370 6813 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8270 6813 gene locus_tag LOCUS_06380 8270 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8453 9325 gene locus_tag LOCUS_06390 8453 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 10108 9623 gene locus_tag LOCUS_06400 10108 9623 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679987.1 protein_id gnl|my_center|LOCUS_06400 11372 10119 gene locus_tag LOCUS_06410 gene manA 11372 10119 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877219.1 protein_id gnl|my_center|LOCUS_06410 13059 11482 gene locus_tag LOCUS_06420 13059 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence045 2300 1257 gene locus_tag LOCUS_06430 gene ftsA 2300 1257 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_06430 3525 2491 gene locus_tag LOCUS_06440 3525 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4660 3518 gene locus_tag LOCUS_06450 gene ftsW 4660 3518 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_06450 5756 4674 gene locus_tag LOCUS_06460 gene mraY 5756 4674 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_06460 7241 5769 gene locus_tag LOCUS_06470 gene murF 7241 5769 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678687.1 protein_id gnl|my_center|LOCUS_06470 7524 7234 gene locus_tag LOCUS_06480 7524 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8528 7521 gene locus_tag LOCUS_06490 gene rsmH 8528 7521 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_06490 8980 8537 gene locus_tag LOCUS_06500 gene mraZ 8980 8537 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_06500 9154 9396 gene locus_tag LOCUS_06510 9154 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679006.1 protein_id gnl|my_center|LOCUS_06510 9584 10627 gene locus_tag LOCUS_06520 gene rsmH 9584 10627 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_06520 11325 10630 gene locus_tag LOCUS_06530 11325 10630 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668791.1 protein_id gnl|my_center|LOCUS_06530 12293 11325 gene locus_tag LOCUS_06540 12293 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 <12854 12290 gene locus_tag LOCUS_06550 <12854 12290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002677985.1:HD domain-containing protein >Feature sequence046 522 1619 gene locus_tag LOCUS_06560 522 1619 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_06560 1726 3411 gene locus_tag LOCUS_06570 1726 3411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_06570 3408 4505 gene locus_tag LOCUS_06580 3408 4505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_06580 4507 5457 gene locus_tag LOCUS_06590 4507 5457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_06590 5535 7316 gene locus_tag LOCUS_06600 5535 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 7313 7975 gene locus_tag LOCUS_06610 7313 7975 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 protein_id gnl|my_center|LOCUS_06610 8098 9423 gene locus_tag LOCUS_06620 8098 9423 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925100.1 protein_id gnl|my_center|LOCUS_06620 10815 9511 gene locus_tag LOCUS_06630 10815 9511 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_06630 10947 12677 gene locus_tag LOCUS_06640 gene ade 10947 12677 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence047 602 1054 gene locus_tag LOCUS_06650 602 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1073 1489 gene locus_tag LOCUS_06660 1073 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1643 2374 gene locus_tag LOCUS_06670 1643 2374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669611.1 protein_id gnl|my_center|LOCUS_06670 2371 3831 gene locus_tag LOCUS_06680 2371 3831 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679548.1 protein_id gnl|my_center|LOCUS_06680 3841 5187 gene locus_tag LOCUS_06690 3841 5187 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669609.1 protein_id gnl|my_center|LOCUS_06690 5201 5974 gene locus_tag LOCUS_06700 5201 5974 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679546.1 protein_id gnl|my_center|LOCUS_06700 5985 7376 gene locus_tag LOCUS_06710 5985 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 7444 8163 gene locus_tag LOCUS_06720 7444 8163 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_06720 8164 9492 gene locus_tag LOCUS_06730 8164 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 10362 9586 gene locus_tag LOCUS_06740 10362 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 11050 10472 gene locus_tag LOCUS_06750 11050 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 12646 11147 gene locus_tag LOCUS_06760 12646 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence048 2438 1350 gene locus_tag LOCUS_06770 2438 1350 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_06770 2755 3753 gene locus_tag LOCUS_06780 2755 3753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_06780 3909 6116 gene locus_tag LOCUS_06790 3909 6116 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969389.1 protein_id gnl|my_center|LOCUS_06790 6130 7230 gene locus_tag LOCUS_06800 6130 7230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969390.1 protein_id gnl|my_center|LOCUS_06800 7318 8244 gene locus_tag LOCUS_06810 7318 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 11027 8352 gene locus_tag LOCUS_06820 11027 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence049 1336 119 gene locus_tag LOCUS_06830 gene fabF 1336 119 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_06830 2105 1359 gene locus_tag LOCUS_06840 gene fabG 2105 1359 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872488.1 protein_id gnl|my_center|LOCUS_06840 3117 2197 gene locus_tag LOCUS_06850 3117 2197 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681776.1 protein_id gnl|my_center|LOCUS_06850 3299 3610 gene locus_tag LOCUS_06860 3299 3610 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706891.1 protein_id gnl|my_center|LOCUS_06860 4554 3607 gene locus_tag LOCUS_06870 4554 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 4649 5629 gene locus_tag LOCUS_06880 4649 5629 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_06880 5722 6585 gene locus_tag LOCUS_06890 gene thyX 5722 6585 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_06890 8639 6588 gene locus_tag LOCUS_06900 gene ygjK 8639 6588 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_06900 10399 8636 gene locus_tag LOCUS_06910 10399 8636 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975928.1 protein_id gnl|my_center|LOCUS_06910 <12266 10396 gene locus_tag LOCUS_06920 <12266 10396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010706828.1:beta-galactosidase subunit alpha >Feature sequence050 987 364 gene locus_tag LOCUS_06930 987 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1213 3174 gene locus_tag LOCUS_06940 1213 3174 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726299.1 protein_id gnl|my_center|LOCUS_06940 3306 4313 gene locus_tag LOCUS_06950 3306 4313 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289380.1 protein_id gnl|my_center|LOCUS_06950 6391 4307 gene locus_tag LOCUS_06960 6391 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7190 6489 gene locus_tag LOCUS_06970 7190 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7973 7254 gene locus_tag LOCUS_06980 7973 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 8639 7995 gene locus_tag LOCUS_06990 8639 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9716 8796 gene locus_tag LOCUS_07000 9716 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10677 9709 gene locus_tag LOCUS_07010 10677 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 11743 10745 gene locus_tag LOCUS_07020 11743 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence051 3400 131 gene locus_tag LOCUS_07030 3400 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3915 3397 gene locus_tag LOCUS_07040 gene nuoE 3915 3397 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_07040 4110 5084 gene locus_tag LOCUS_07050 4110 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 5132 5389 gene locus_tag LOCUS_07060 5132 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6127 5441 gene locus_tag LOCUS_07070 6127 5441 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_07070 6209 7150 gene locus_tag LOCUS_07080 6209 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 7248 7874 gene locus_tag LOCUS_07090 7248 7874 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence052 757 1788 gene locus_tag LOCUS_07100 757 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1801 2622 gene locus_tag LOCUS_07110 1801 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2981 2541 gene locus_tag LOCUS_07120 2981 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3091 3018 gene locus_tag LOCUS_t00080 3091 3018 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4317 3166 gene locus_tag LOCUS_07130 4317 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675036.1 protein_id gnl|my_center|LOCUS_07130 5073 4342 gene locus_tag LOCUS_07140 5073 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6317 5154 gene locus_tag LOCUS_07150 6317 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 7101 6328 gene locus_tag LOCUS_07160 7101 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 8683 7229 gene locus_tag LOCUS_07170 gene mtaB 8683 7229 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_07170 9316 8684 gene locus_tag LOCUS_07180 9316 8684 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679583.1 protein_id gnl|my_center|LOCUS_07180 9674 9306 gene locus_tag LOCUS_07190 9674 9306 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669698.1 protein_id gnl|my_center|LOCUS_07190 10721 9684 gene locus_tag LOCUS_07200 gene rsmA 10721 9684 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_07200 11853 10603 gene locus_tag LOCUS_07210 11853 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence053 <1 923 gene locus_tag LOCUS_07220 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679142.1:bifunctional oligoribonuclease/PAP phosphatase NrnA 1175 2137 gene locus_tag LOCUS_07230 1175 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2147 2740 gene locus_tag LOCUS_07240 gene rdgB 2147 2740 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_07240 2748 4025 gene locus_tag LOCUS_07250 2748 4025 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_07250 6403 4244 gene locus_tag LOCUS_07260 6403 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7779 6427 gene locus_tag LOCUS_07270 7779 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7940 9481 gene locus_tag LOCUS_07280 7940 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 9977 9561 gene locus_tag LOCUS_07290 gene iscR 9977 9561 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688879.1 protein_id gnl|my_center|LOCUS_07290 10973 10110 gene locus_tag LOCUS_07300 10973 10110 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679607.1 protein_id gnl|my_center|LOCUS_07300 11815 11171 gene locus_tag LOCUS_07310 11815 11171 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence054 996 229 gene locus_tag LOCUS_07320 996 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1087 1782 gene locus_tag LOCUS_07330 1087 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3124 1790 gene locus_tag LOCUS_07340 3124 1790 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388514.1 protein_id gnl|my_center|LOCUS_07340 4007 3393 gene locus_tag LOCUS_07350 4007 3393 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_07350 5058 4114 gene locus_tag LOCUS_07360 5058 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 6039 5068 gene locus_tag LOCUS_07370 6039 5068 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937586.1 protein_id gnl|my_center|LOCUS_07370 6117 6404 gene locus_tag LOCUS_07380 6117 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 7265 6417 gene locus_tag LOCUS_07390 7265 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_07390 7364 7981 gene locus_tag LOCUS_07400 7364 7981 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_07400 7992 8879 gene locus_tag LOCUS_07410 7992 8879 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_07410 8971 9498 gene locus_tag LOCUS_07420 8971 9498 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_07420 10493 9666 gene locus_tag LOCUS_07430 10493 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 10657 11400 gene locus_tag LOCUS_07440 10657 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence055 1239 1961 gene locus_tag LOCUS_07450 1239 1961 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_07450 2838 2068 gene locus_tag LOCUS_07460 2838 2068 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057070.1 protein_id gnl|my_center|LOCUS_07460 3477 2914 gene locus_tag LOCUS_07470 3477 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3586 4686 gene locus_tag LOCUS_07480 3586 4686 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_07480 5539 4868 gene locus_tag LOCUS_07490 5539 4868 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668595.1 protein_id gnl|my_center|LOCUS_07490 7242 5746 gene locus_tag LOCUS_07500 gene gltA 7242 5746 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_07500 8120 7239 gene locus_tag LOCUS_07510 8120 7239 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_07510 10016 8121 gene locus_tag LOCUS_07520 10016 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10237 11010 gene locus_tag LOCUS_07530 10237 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence056 2163 1684 gene locus_tag LOCUS_07540 2163 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8387 2160 gene locus_tag LOCUS_07550 8387 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 9739 8402 gene locus_tag LOCUS_07560 9739 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10272 9757 gene locus_tag LOCUS_07570 10272 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 11000 10272 gene locus_tag LOCUS_07580 11000 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 11494 10997 gene locus_tag LOCUS_07590 11494 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence057 119 316 gene locus_tag LOCUS_07600 119 316 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_07600 1096 320 gene locus_tag LOCUS_07610 1096 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2328 1090 gene locus_tag LOCUS_07620 2328 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3392 2325 gene locus_tag LOCUS_07630 3392 2325 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_07630 4582 3389 gene locus_tag LOCUS_07640 4582 3389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_07640 4712 5596 gene locus_tag LOCUS_07650 4712 5596 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682316.1 protein_id gnl|my_center|LOCUS_07650 5607 6656 gene locus_tag LOCUS_07660 5607 6656 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680516.1 protein_id gnl|my_center|LOCUS_07660 7730 6681 gene locus_tag LOCUS_07670 7730 6681 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379303.1 protein_id gnl|my_center|LOCUS_07670 7994 9208 gene locus_tag LOCUS_07680 7994 9208 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114397.1 protein_id gnl|my_center|LOCUS_07680 9317 10255 gene locus_tag LOCUS_07690 9317 10255 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_07690 10252 11076 gene locus_tag LOCUS_07700 10252 11076 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114402.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence058 <1 565 gene locus_tag LOCUS_07710 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786401.1:histidinol-phosphatase note possible pseudo, internal stop codon 823 1725 gene locus_tag LOCUS_07720 823 1725 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_07720 1722 2675 gene locus_tag LOCUS_07730 1722 2675 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_07730 5925 2809 gene locus_tag LOCUS_07740 5925 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7979 5913 gene locus_tag LOCUS_07750 7979 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 9289 8087 gene locus_tag LOCUS_07760 9289 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 9424 9750 gene locus_tag LOCUS_07770 9424 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9747 10283 gene locus_tag LOCUS_07780 9747 10283 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670683.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence059 <1 1514 gene locus_tag LOCUS_07790 <1 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678847.1:penicillin-binding protein 1511 3382 gene locus_tag LOCUS_07800 1511 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4688 3717 gene locus_tag LOCUS_07810 4688 3717 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_07810 4938 5504 gene locus_tag LOCUS_07820 4938 5504 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_07820 6699 5488 gene locus_tag LOCUS_07830 6699 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6837 8189 gene locus_tag LOCUS_07840 gene ffh 6837 8189 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668253.1 protein_id gnl|my_center|LOCUS_07840 8351 8542 gene locus_tag LOCUS_07850 gene rpmB 8351 8542 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_07850 8702 9556 gene locus_tag LOCUS_07860 8702 9556 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100746074.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence060 339 1592 gene locus_tag LOCUS_07870 gene recA 339 1592 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_07870 1596 2105 gene locus_tag LOCUS_07880 gene folK 1596 2105 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_07880 2112 2903 gene locus_tag LOCUS_07890 2112 2903 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_07890 2887 3720 gene locus_tag LOCUS_07900 2887 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4048 3803 gene locus_tag LOCUS_07910 4048 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3959 4453 gene locus_tag LOCUS_07920 3959 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4613 6964 gene locus_tag LOCUS_07930 gene rpsA 4613 6964 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679883.1 protein_id gnl|my_center|LOCUS_07930 7040 8551 gene locus_tag LOCUS_07940 7040 8551 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_07940 8556 9269 gene locus_tag LOCUS_07950 8556 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence061 1857 31 gene locus_tag LOCUS_07960 1857 31 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748873.1 protein_id gnl|my_center|LOCUS_07960 2085 4163 gene locus_tag LOCUS_07970 2085 4163 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986498.1 protein_id gnl|my_center|LOCUS_07970 4221 5354 gene locus_tag LOCUS_07980 gene alr 4221 5354 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_07980 5351 6247 gene locus_tag LOCUS_07990 gene dapF 5351 6247 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_07990 6247 7500 gene locus_tag LOCUS_08000 gene alr 6247 7500 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08000 7497 8444 gene locus_tag LOCUS_08010 7497 8444 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08010 8487 8696 gene locus_tag LOCUS_08020 8487 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08020 8693 9490 gene locus_tag LOCUS_08030 8693 9490 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_08030 9500 10450 gene locus_tag LOCUS_08040 9500 10450 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_08040 <11188 10447 gene locus_tag LOCUS_08050 <11188 10447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393651.1:gamma-glutamyl-gamma-aminobutyrate hydrolase family protein >Feature sequence062 3208 1559 gene locus_tag LOCUS_08060 3208 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3158 3421 gene locus_tag LOCUS_08070 3158 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4948 3539 gene locus_tag LOCUS_08080 4948 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5003 5950 gene locus_tag LOCUS_08090 5003 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6587 5937 gene locus_tag LOCUS_08100 6587 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7509 6589 gene locus_tag LOCUS_08110 7509 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7957 7694 gene locus_tag LOCUS_08120 7957 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 8204 8130 gene locus_tag LOCUS_t00090 8204 8130 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8390 10615 gene locus_tag LOCUS_08130 8390 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence063 783 2678 gene locus_tag LOCUS_08140 gene btuB 783 2678 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172310.1 protein_id gnl|my_center|LOCUS_08140 3882 2737 gene locus_tag LOCUS_08150 3882 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4807 3926 gene locus_tag LOCUS_08160 4807 3926 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_08160 5194 5018 gene locus_tag LOCUS_08170 5194 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5738 5502 gene locus_tag LOCUS_08180 5738 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 6431 6763 gene locus_tag LOCUS_08190 6431 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 7320 6796 gene locus_tag LOCUS_08200 7320 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8240 7272 gene locus_tag LOCUS_08210 8240 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 8385 9272 gene locus_tag LOCUS_08220 8385 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 9438 9866 gene locus_tag LOCUS_08230 9438 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 10117 9815 gene locus_tag LOCUS_08240 10117 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence064 3490 110 gene locus_tag LOCUS_08250 3490 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 5112 3487 gene locus_tag LOCUS_08260 5112 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920589.1 protein_id gnl|my_center|LOCUS_08260 5382 5128 gene locus_tag LOCUS_08270 5382 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5278 7173 gene locus_tag LOCUS_08280 gene uvrC 5278 7173 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_08280 7170 7853 gene locus_tag LOCUS_08290 7170 7853 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875893.1 protein_id gnl|my_center|LOCUS_08290 8622 7900 gene locus_tag LOCUS_08300 8622 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10523 8661 gene locus_tag LOCUS_08310 10523 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence065 385 696 gene locus_tag LOCUS_08320 385 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 790 2418 gene locus_tag LOCUS_08330 790 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4688 2502 gene locus_tag LOCUS_08340 4688 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6183 4690 gene locus_tag LOCUS_08350 6183 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 7791 6205 gene locus_tag LOCUS_08360 7791 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 8734 8453 gene locus_tag LOCUS_08370 8734 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8872 10233 gene locus_tag LOCUS_08380 8872 10233 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence066 43 771 gene locus_tag LOCUS_08390 43 771 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_08390 1439 993 gene locus_tag LOCUS_08400 1439 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2435 1491 gene locus_tag LOCUS_08410 2435 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2587 3549 gene locus_tag LOCUS_08420 2587 3549 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_08420 4078 3716 gene locus_tag LOCUS_08430 4078 3716 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337489.1 protein_id gnl|my_center|LOCUS_08430 4601 4308 gene locus_tag LOCUS_08440 4601 4308 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_08440 4768 5061 gene locus_tag LOCUS_08450 4768 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5135 6610 gene locus_tag LOCUS_08460 gene rny 5135 6610 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681149.1 protein_id gnl|my_center|LOCUS_08460 6749 7534 gene locus_tag LOCUS_08470 6749 7534 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_08470 7750 9771 gene locus_tag LOCUS_08480 7750 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 10532 9768 gene locus_tag LOCUS_08490 10532 9768 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence067 <1 944 gene locus_tag LOCUS_08500 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002674379.1:ATP-binding protein 1913 1098 gene locus_tag LOCUS_08510 1913 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2057 2827 gene locus_tag LOCUS_08520 2057 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681806.1 protein_id gnl|my_center|LOCUS_08520 2912 4738 gene locus_tag LOCUS_08530 2912 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4735 6297 gene locus_tag LOCUS_08540 4735 6297 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458911.1 protein_id gnl|my_center|LOCUS_08540 7088 6294 gene locus_tag LOCUS_08550 7088 6294 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_08550 9574 7085 gene locus_tag LOCUS_08560 9574 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 <10901 9571 gene locus_tag LOCUS_08570 <10901 9571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680776.1:DEAD/DEAH box helicase >Feature sequence068 179 763 gene locus_tag LOCUS_08580 179 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1422 778 gene locus_tag LOCUS_08590 1422 778 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_08590 2778 1660 gene locus_tag LOCUS_08600 2778 1660 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_08600 2941 3816 gene locus_tag LOCUS_08610 2941 3816 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_08610 3827 4918 gene locus_tag LOCUS_08620 3827 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5002 6063 gene locus_tag LOCUS_08630 5002 6063 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_08630 6120 6905 gene locus_tag LOCUS_08640 6120 6905 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920173.1 protein_id gnl|my_center|LOCUS_08640 7019 7684 gene locus_tag LOCUS_08650 7019 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7705 7866 gene locus_tag LOCUS_08660 7705 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 8032 9459 gene locus_tag LOCUS_08670 8032 9459 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_08670 9456 10025 gene locus_tag LOCUS_08680 9456 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10070 10654 gene locus_tag LOCUS_08690 10070 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence069 1704 763 gene locus_tag LOCUS_08700 1704 763 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_08700 2871 1759 gene locus_tag LOCUS_08710 2871 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3075 4310 gene locus_tag LOCUS_08720 gene tyrS 3075 4310 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682133.1 protein_id gnl|my_center|LOCUS_08720 7167 4735 gene locus_tag LOCUS_08730 7167 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7416 8372 gene locus_tag LOCUS_08740 7416 8372 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_08740 8365 9609 gene locus_tag LOCUS_08750 8365 9609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_08750 10387 9704 gene locus_tag LOCUS_08760 10387 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence070 706 257 gene locus_tag LOCUS_08770 706 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1729 815 gene locus_tag LOCUS_08780 1729 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2257 1829 gene locus_tag LOCUS_08790 2257 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2462 4114 gene locus_tag LOCUS_08800 gene groL 2462 4114 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670719.1 protein_id gnl|my_center|LOCUS_08800 4499 5659 gene locus_tag LOCUS_08810 gene rpsA 4499 5659 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_08810 5915 6991 gene locus_tag LOCUS_08820 5915 6991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941886.1 protein_id gnl|my_center|LOCUS_08820 6988 8856 gene locus_tag LOCUS_08830 6988 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 9055 10470 gene locus_tag LOCUS_08840 9055 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence071 <1 504 gene locus_tag LOCUS_08850 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942511.1:PhoH family protein 509 808 gene locus_tag LOCUS_08860 509 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 938 2185 gene locus_tag LOCUS_08870 938 2185 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194542.1 protein_id gnl|my_center|LOCUS_08870 2305 2529 gene locus_tag LOCUS_08880 2305 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2603 2905 gene locus_tag LOCUS_08890 2603 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3508 2975 gene locus_tag LOCUS_08900 3508 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4467 3619 gene locus_tag LOCUS_08910 4467 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5373 4537 gene locus_tag LOCUS_08920 5373 4537 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888911.1 protein_id gnl|my_center|LOCUS_08920 6233 5370 gene locus_tag LOCUS_08930 6233 5370 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392446.1 protein_id gnl|my_center|LOCUS_08930 7162 6230 gene locus_tag LOCUS_08940 7162 6230 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287342.1 protein_id gnl|my_center|LOCUS_08940 7455 7159 gene locus_tag LOCUS_08950 7455 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7594 8208 gene locus_tag LOCUS_08960 gene mocA 7594 8208 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08960 8205 9254 gene locus_tag LOCUS_08970 8205 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9289 10278 gene locus_tag LOCUS_08980 9289 10278 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence072 1523 810 gene locus_tag LOCUS_08990 1523 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1848 2450 gene locus_tag LOCUS_09000 1848 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2447 2878 gene locus_tag LOCUS_09010 2447 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3722 2943 gene locus_tag LOCUS_09020 3722 2943 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_09020 4516 3719 gene locus_tag LOCUS_09030 4516 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4995 4537 gene locus_tag LOCUS_09040 4995 4537 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_09040 6191 4998 gene locus_tag LOCUS_09050 6191 4998 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_09050 7351 6203 gene locus_tag LOCUS_09060 7351 6203 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256144.1 protein_id gnl|my_center|LOCUS_09060 7690 7358 gene locus_tag LOCUS_09070 7690 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 8763 7726 gene locus_tag LOCUS_09080 8763 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 8956 9516 gene locus_tag LOCUS_09090 8956 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 9813 9625 gene locus_tag LOCUS_09100 9813 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10167 9955 gene locus_tag LOCUS_09110 10167 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence073 422 1420 gene locus_tag LOCUS_09120 422 1420 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_09120 2211 1486 gene locus_tag LOCUS_09130 2211 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681839.1 protein_id gnl|my_center|LOCUS_09130 2314 5736 gene locus_tag LOCUS_09140 2314 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5879 5806 gene locus_tag LOCUS_t00100 5879 5806 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6136 6765 gene locus_tag LOCUS_09150 6136 6765 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680767.1 protein_id gnl|my_center|LOCUS_09150 7894 7067 gene locus_tag LOCUS_09160 7894 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 8028 8699 gene locus_tag LOCUS_09170 8028 8699 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679167.1 protein_id gnl|my_center|LOCUS_09170 8901 8686 gene locus_tag LOCUS_09180 8901 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9144 10202 gene locus_tag LOCUS_09190 gene trpS 9144 10202 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889658.1 protein_id gnl|my_center|LOCUS_09190 10384 10692 gene locus_tag LOCUS_09200 10384 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence074 <1 800 gene locus_tag LOCUS_09210 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681112.1:tetratricopeptide repeat protein 813 1871 gene locus_tag LOCUS_09220 813 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1957 2808 gene locus_tag LOCUS_09230 1957 2808 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675533.1 protein_id gnl|my_center|LOCUS_09230 3013 4071 gene locus_tag LOCUS_09240 gene gcvT 3013 4071 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_09240 4129 4512 gene locus_tag LOCUS_09250 gene gcvH 4129 4512 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_09250 4516 5835 gene locus_tag LOCUS_09260 gene gcvPA 4516 5835 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_09260 5832 7265 gene locus_tag LOCUS_09270 gene gcvPB 5832 7265 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259338.1 protein_id gnl|my_center|LOCUS_09270 7727 7380 gene locus_tag LOCUS_09280 7727 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 8608 7871 gene locus_tag LOCUS_09290 8608 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 8699 9376 gene locus_tag LOCUS_09300 8699 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 <10645 9373 gene locus_tag LOCUS_09310 <10645 9373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876458.1:PAS domain S-box protein >Feature sequence075 2791 3282 gene locus_tag LOCUS_09320 2791 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3984 3433 gene locus_tag LOCUS_09330 3984 3433 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667237.1 protein_id gnl|my_center|LOCUS_09330 6519 3997 gene locus_tag LOCUS_09340 gene bamA 6519 3997 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889821.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence076 <1 2114 gene locus_tag LOCUS_09350 <1 2114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681054.1:AAA family ATPase 2305 5358 gene locus_tag LOCUS_09360 2305 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 5582 5409 gene locus_tag LOCUS_09370 5582 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5545 6636 gene locus_tag LOCUS_09380 5545 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6647 7297 gene locus_tag LOCUS_09390 6647 7297 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943846.1 protein_id gnl|my_center|LOCUS_09390 7694 9277 gene locus_tag LOCUS_09400 7694 9277 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656717.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence077 252 1205 gene locus_tag LOCUS_09410 gene rbsK 252 1205 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077610.1 protein_id gnl|my_center|LOCUS_09410 1404 3539 gene locus_tag LOCUS_09420 1404 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3606 6443 gene locus_tag LOCUS_09430 gene uvrA 3606 6443 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_09430 6541 10062 gene locus_tag LOCUS_09440 6541 10062 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682325.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence078 1980 2525 gene locus_tag LOCUS_09450 gene nusG 1980 2525 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 protein_id gnl|my_center|LOCUS_09450 2512 4002 gene locus_tag LOCUS_09460 2512 4002 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681937.1 protein_id gnl|my_center|LOCUS_09460 3986 5191 gene locus_tag LOCUS_09470 3986 5191 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681964.1 protein_id gnl|my_center|LOCUS_09470 5196 7319 gene locus_tag LOCUS_09480 5196 7319 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681965.1 protein_id gnl|my_center|LOCUS_09480 7316 7804 gene locus_tag LOCUS_09490 7316 7804 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669971.1 protein_id gnl|my_center|LOCUS_09490 7791 8618 gene locus_tag LOCUS_09500 7791 8618 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681967.1 protein_id gnl|my_center|LOCUS_09500 8623 9426 gene locus_tag LOCUS_09510 8623 9426 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_09510 9405 10184 gene locus_tag LOCUS_09520 9405 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence079 1900 893 gene locus_tag LOCUS_09530 gene aroC 1900 893 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_09530 3051 1897 gene locus_tag LOCUS_09540 gene aroB 3051 1897 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_09540 3952 3053 gene locus_tag LOCUS_09550 3952 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4413 5600 gene locus_tag LOCUS_09560 4413 5600 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926030.1 protein_id gnl|my_center|LOCUS_09560 6229 5687 gene locus_tag LOCUS_09570 6229 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 8257 6308 gene locus_tag LOCUS_09580 8257 6308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989900.1 protein_id gnl|my_center|LOCUS_09580 9014 8244 gene locus_tag LOCUS_09590 9014 8244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963549.1 protein_id gnl|my_center|LOCUS_09590 10170 9148 gene locus_tag LOCUS_09600 10170 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence080 1252 53 gene locus_tag LOCUS_09610 1252 53 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_09610 2099 1362 gene locus_tag LOCUS_09620 2099 1362 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 protein_id gnl|my_center|LOCUS_09620 3147 2122 gene locus_tag LOCUS_09630 3147 2122 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583306.1 protein_id gnl|my_center|LOCUS_09630 3399 4568 gene locus_tag LOCUS_09640 3399 4568 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888272.1 protein_id gnl|my_center|LOCUS_09640 4578 5588 gene locus_tag LOCUS_09650 4578 5588 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_09650 5616 6923 gene locus_tag LOCUS_09660 5616 6923 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_09660 7075 7899 gene locus_tag LOCUS_09670 7075 7899 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682279.1 protein_id gnl|my_center|LOCUS_09670 7896 8642 gene locus_tag LOCUS_09680 7896 8642 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_09680 9045 8644 gene locus_tag LOCUS_09690 9045 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 10330 9035 gene locus_tag LOCUS_09700 10330 9035 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence081 98 556 gene locus_tag LOCUS_09710 98 556 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210791.1 protein_id gnl|my_center|LOCUS_09710 2118 682 gene locus_tag LOCUS_09720 2118 682 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_09720 2838 3212 gene locus_tag LOCUS_09730 2838 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4563 3226 gene locus_tag LOCUS_09740 4563 3226 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_09740 5006 4560 gene locus_tag LOCUS_09750 5006 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5370 5011 gene locus_tag LOCUS_09760 5370 5011 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_09760 5727 6587 gene locus_tag LOCUS_09770 5727 6587 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670454.1 protein_id gnl|my_center|LOCUS_09770 6756 8867 gene locus_tag LOCUS_09780 6756 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 9497 8910 gene locus_tag LOCUS_09790 gene recR 9497 8910 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_09790 9847 9494 gene locus_tag LOCUS_09800 9847 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence082 2142 1210 gene locus_tag LOCUS_09810 2142 1210 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017181.1 protein_id gnl|my_center|LOCUS_09810 2393 3691 gene locus_tag LOCUS_09820 2393 3691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 protein_id gnl|my_center|LOCUS_09820 3774 4691 gene locus_tag LOCUS_09830 3774 4691 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_09830 4704 5534 gene locus_tag LOCUS_09840 4704 5534 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880516.1 protein_id gnl|my_center|LOCUS_09840 5608 6285 gene locus_tag LOCUS_09850 5608 6285 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_09850 6439 7938 gene locus_tag LOCUS_09860 6439 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 8404 8314 gene locus_tag LOCUS_t00110 8404 8314 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9470 8808 gene locus_tag LOCUS_09870 9470 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10049 9471 gene locus_tag LOCUS_09880 10049 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09880 >Feature sequence083 178 1860 gene locus_tag LOCUS_09890 178 1860 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_09890 2006 2275 gene locus_tag LOCUS_09900 2006 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146930.1 protein_id gnl|my_center|LOCUS_09900 2289 3221 gene locus_tag LOCUS_09910 2289 3221 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 protein_id gnl|my_center|LOCUS_09910 3218 3862 gene locus_tag LOCUS_09920 3218 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249947.1 protein_id gnl|my_center|LOCUS_09920 3865 4143 gene locus_tag LOCUS_09930 3865 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4819 4262 gene locus_tag LOCUS_09940 4819 4262 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_09940 6693 4888 gene locus_tag LOCUS_09950 gene sulP 6693 4888 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_09950 7243 6707 gene locus_tag LOCUS_09960 7243 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 8621 7269 gene locus_tag LOCUS_09970 8621 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 <10340 8784 gene locus_tag LOCUS_09980 <10340 8784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870178.1:glycyl radical protein >Feature sequence084 1529 552 gene locus_tag LOCUS_09990 1529 552 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_09990 1873 1526 gene locus_tag LOCUS_10000 1873 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1754 1969 gene locus_tag LOCUS_10010 1754 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2313 3035 gene locus_tag LOCUS_10020 2313 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3032 3967 gene locus_tag LOCUS_10030 3032 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 5057 4095 gene locus_tag LOCUS_10040 5057 4095 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389652.1 protein_id gnl|my_center|LOCUS_10040 6641 5109 gene locus_tag LOCUS_10050 6641 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8820 6742 gene locus_tag LOCUS_10060 8820 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 <10203 8976 gene locus_tag LOCUS_10070 <10203 8976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680482.1:DNA repair protein RadA >Feature sequence085 1116 2030 gene locus_tag LOCUS_10080 1116 2030 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286009.1 protein_id gnl|my_center|LOCUS_10080 2027 2929 gene locus_tag LOCUS_10090 2027 2929 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_10090 2939 4354 gene locus_tag LOCUS_10100 2939 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4447 6576 gene locus_tag LOCUS_10110 4447 6576 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_10110 6573 7769 gene locus_tag LOCUS_10120 6573 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7771 9330 gene locus_tag LOCUS_10130 gene citF 7771 9330 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence086 <1 1511 gene locus_tag LOCUS_10140 <1 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272331.1:DEAD/DEAH box helicase 1526 4063 gene locus_tag LOCUS_10150 1526 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4576 4136 gene locus_tag LOCUS_10160 4576 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6579 4930 gene locus_tag LOCUS_10170 6579 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 8588 6597 gene locus_tag LOCUS_10180 8588 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 8937 8578 gene locus_tag LOCUS_10190 gene queD 8937 8578 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020994.1 protein_id gnl|my_center|LOCUS_10190 9052 9588 gene locus_tag LOCUS_10200 9052 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence087 200 970 gene locus_tag LOCUS_10210 200 970 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_10210 1136 1357 gene locus_tag LOCUS_10220 1136 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3337 1409 gene locus_tag LOCUS_10230 3337 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3721 4128 gene locus_tag LOCUS_10240 3721 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4336 4971 gene locus_tag LOCUS_10250 4336 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_10250 4964 5821 gene locus_tag LOCUS_10260 4964 5821 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_10260 6881 5910 gene locus_tag LOCUS_10270 6881 5910 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_10270 7005 7514 gene locus_tag LOCUS_10280 7005 7514 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966733.1 protein_id gnl|my_center|LOCUS_10280 7578 8411 gene locus_tag LOCUS_10290 7578 8411 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_10290 8408 9070 gene locus_tag LOCUS_10300 8408 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence088 336 1064 gene locus_tag LOCUS_10310 336 1064 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941950.1 protein_id gnl|my_center|LOCUS_10310 1061 2446 gene locus_tag LOCUS_10320 1061 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2548 4311 gene locus_tag LOCUS_10330 gene argS 2548 4311 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_10330 4409 4717 gene locus_tag LOCUS_10340 gene rplU 4409 4717 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669481.1 protein_id gnl|my_center|LOCUS_10340 4743 5084 gene locus_tag LOCUS_10350 4743 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5086 5343 gene locus_tag LOCUS_10360 gene rpmA 5086 5343 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669471.1 protein_id gnl|my_center|LOCUS_10360 5472 6689 gene locus_tag LOCUS_10370 gene obgE 5472 6689 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_10370 6686 7258 gene locus_tag LOCUS_10380 gene nadD 6686 7258 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656094.1 protein_id gnl|my_center|LOCUS_10380 7245 7847 gene locus_tag LOCUS_10390 7245 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 7844 9022 gene locus_tag LOCUS_10400 7844 9022 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669467.1 protein_id gnl|my_center|LOCUS_10400 9012 9401 gene locus_tag LOCUS_10410 gene rsfS 9012 9401 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679464.1 protein_id gnl|my_center|LOCUS_10410 9816 9505 gene locus_tag LOCUS_10420 9816 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence089 3796 608 gene locus_tag LOCUS_10430 3796 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4041 5918 gene locus_tag LOCUS_10440 4041 5918 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791517.1 protein_id gnl|my_center|LOCUS_10440 5983 9066 gene locus_tag LOCUS_10450 5983 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence090 <1 681 gene locus_tag LOCUS_10460 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107667.1:bifunctional metallophosphatase/5'-nucleotidase 957 1502 gene locus_tag LOCUS_10470 957 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3416 1599 gene locus_tag LOCUS_10480 3416 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4035 3550 gene locus_tag LOCUS_10490 4035 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4594 4025 gene locus_tag LOCUS_10500 4594 4025 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 protein_id gnl|my_center|LOCUS_10500 4929 4591 gene locus_tag LOCUS_10510 4929 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5506 5099 gene locus_tag LOCUS_10520 5506 5099 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081696.1 protein_id gnl|my_center|LOCUS_10520 6772 5516 gene locus_tag LOCUS_10530 6772 5516 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_10530 8208 6769 gene locus_tag LOCUS_10540 8208 6769 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_10540 8435 9703 gene locus_tag LOCUS_10550 8435 9703 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence091 850 2232 gene locus_tag LOCUS_10560 850 2232 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_10560 2267 2767 gene locus_tag LOCUS_10570 2267 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4103 2886 gene locus_tag LOCUS_10580 4103 2886 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227992.1 protein_id gnl|my_center|LOCUS_10580 4325 4864 gene locus_tag LOCUS_10590 gene greB 4325 4864 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_10590 4981 6621 gene locus_tag LOCUS_10600 4981 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6675 9179 gene locus_tag LOCUS_10610 6675 9179 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_10610 9176 9385 gene locus_tag LOCUS_10620 9176 9385 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855276.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence092 <1 3613 gene locus_tag LOCUS_10630 <1 3613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939430.1:host specificity factor TipJ family phage tail protein 3623 3889 gene locus_tag LOCUS_10640 3623 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3886 4119 gene locus_tag LOCUS_10650 3886 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4147 4758 gene locus_tag LOCUS_10660 4147 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4768 5028 gene locus_tag LOCUS_10670 4768 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5029 5493 gene locus_tag LOCUS_10680 5029 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5890 5498 gene locus_tag LOCUS_10690 5890 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6167 5907 gene locus_tag LOCUS_10700 6167 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7034 6231 gene locus_tag LOCUS_10710 7034 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7234 7410 gene locus_tag LOCUS_10720 7234 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 7627 9804 gene locus_tag LOCUS_10730 7627 9804 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681835.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence093 253 969 gene locus_tag LOCUS_10740 253 969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_10740 975 2534 gene locus_tag LOCUS_10750 975 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2544 3503 gene locus_tag LOCUS_10760 2544 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3500 6688 gene locus_tag LOCUS_10770 3500 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6685 7332 gene locus_tag LOCUS_10780 6685 7332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_10780 7419 8489 gene locus_tag LOCUS_10790 gene citC 7419 8489 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870396.1 protein_id gnl|my_center|LOCUS_10790 8513 8830 gene locus_tag LOCUS_10800 8513 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 8827 9723 gene locus_tag LOCUS_10810 gene citE 8827 9723 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence094 <1 2602 gene locus_tag LOCUS_10820 <1 2602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401912.1:LuxR family transcriptional regulator 2630 3265 gene locus_tag LOCUS_10830 2630 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3277 3471 gene locus_tag LOCUS_10840 3277 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3573 4586 gene locus_tag LOCUS_10850 3573 4586 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_10850 4596 6290 gene locus_tag LOCUS_10860 gene malL 4596 6290 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_10860 6352 7608 gene locus_tag LOCUS_10870 6352 7608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_10870 7759 8646 gene locus_tag LOCUS_10880 7759 8646 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_10880 8643 9503 gene locus_tag LOCUS_10890 8643 9503 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence095 1008 133 gene locus_tag LOCUS_10900 1008 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1446 1036 gene locus_tag LOCUS_10910 1446 1036 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462837.1 protein_id gnl|my_center|LOCUS_10910 2941 1604 gene locus_tag LOCUS_10920 2941 1604 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_10920 3080 3583 gene locus_tag LOCUS_10930 3080 3583 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447334.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10930 3589 3963 gene locus_tag LOCUS_10940 3589 3963 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986720.1 protein_id gnl|my_center|LOCUS_10940 5514 4117 gene locus_tag LOCUS_10950 5514 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5671 6417 gene locus_tag LOCUS_10960 5671 6417 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_10960 6420 7589 gene locus_tag LOCUS_10970 6420 7589 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_10970 8841 7573 gene locus_tag LOCUS_10980 8841 7573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence096 143 1627 gene locus_tag LOCUS_10990 143 1627 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_10990 2927 1767 gene locus_tag LOCUS_11000 2927 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3359 3048 gene locus_tag LOCUS_11010 3359 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3994 3581 gene locus_tag LOCUS_11020 3994 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5987 3999 gene locus_tag LOCUS_11030 gene uvrB 5987 3999 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_11030 7269 5989 gene locus_tag LOCUS_11040 7269 5989 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_11040 7426 8622 gene locus_tag LOCUS_11050 7426 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence097 1585 698 gene locus_tag LOCUS_11060 1585 698 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667865.1 protein_id gnl|my_center|LOCUS_11060 1963 1592 gene locus_tag LOCUS_11070 1963 1592 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_11070 2922 1960 gene locus_tag LOCUS_11080 2922 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3715 2912 gene locus_tag LOCUS_11090 gene cdaA 3715 2912 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_11090 4613 3735 gene locus_tag LOCUS_11100 4613 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6517 4610 gene locus_tag LOCUS_11110 gene dxs 6517 4610 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957098.1 protein_id gnl|my_center|LOCUS_11110 6632 7318 gene locus_tag LOCUS_11120 6632 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9282 7315 gene locus_tag LOCUS_11130 9282 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence098 1683 3257 gene locus_tag LOCUS_11140 1683 3257 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_11140 3267 5594 gene locus_tag LOCUS_11150 3267 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5642 6409 gene locus_tag LOCUS_11160 5642 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6471 7019 gene locus_tag LOCUS_11170 6471 7019 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_11170 7126 8502 gene locus_tag LOCUS_11180 7126 8502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_11180 8557 9528 gene locus_tag LOCUS_11190 8557 9528 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966854.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence099 822 1700 gene locus_tag LOCUS_11200 822 1700 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667127.1 protein_id gnl|my_center|LOCUS_11200 1700 2815 gene locus_tag LOCUS_11210 1700 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5000 2946 gene locus_tag LOCUS_11220 5000 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5573 5025 gene locus_tag LOCUS_11230 5573 5025 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082364.1 protein_id gnl|my_center|LOCUS_11230 6136 5561 gene locus_tag LOCUS_11240 6136 5561 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082365.1 protein_id gnl|my_center|LOCUS_11240 7835 6186 gene locus_tag LOCUS_11250 7835 6186 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_11250 <9535 7832 gene locus_tag LOCUS_11260 <9535 7832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680941.1:UvrD-helicase domain-containing protein >Feature sequence100 467 1084 gene locus_tag LOCUS_11270 467 1084 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603095.1 protein_id gnl|my_center|LOCUS_11270 1081 1893 gene locus_tag LOCUS_11280 1081 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1890 2708 gene locus_tag LOCUS_11290 1890 2708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020896.1 protein_id gnl|my_center|LOCUS_11290 3261 3827 gene locus_tag LOCUS_11300 3261 3827 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700597.1 protein_id gnl|my_center|LOCUS_11300 4903 4178 gene locus_tag LOCUS_11310 gene rlmB 4903 4178 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_11310 5844 5023 gene locus_tag LOCUS_11320 5844 5023 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_11320 5895 6872 gene locus_tag LOCUS_11330 5895 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 8740 6869 gene locus_tag LOCUS_11340 8740 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence101 1067 435 gene locus_tag LOCUS_11350 1067 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3927 1078 gene locus_tag LOCUS_11360 gene polA 3927 1078 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940283.1 protein_id gnl|my_center|LOCUS_11360 4410 3940 gene locus_tag LOCUS_11370 4410 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680977.1 protein_id gnl|my_center|LOCUS_11370 4858 4424 gene locus_tag LOCUS_11380 gene fliS 4858 4424 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666704.1 protein_id gnl|my_center|LOCUS_11380 5469 4993 gene locus_tag LOCUS_11390 5469 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 5752 6735 gene locus_tag LOCUS_11400 5752 6735 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_11400 6728 7657 gene locus_tag LOCUS_11410 6728 7657 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence102 1416 178 gene locus_tag LOCUS_11420 1416 178 CDS product UPF0164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679928.1 protein_id gnl|my_center|LOCUS_11420 1597 4746 gene locus_tag LOCUS_11430 1597 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence103 1647 1183 gene locus_tag LOCUS_11440 gene rplO 1647 1183 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682039.1 protein_id gnl|my_center|LOCUS_11440 1832 1647 gene locus_tag LOCUS_11450 gene rpmD 1832 1647 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670028.1 protein_id gnl|my_center|LOCUS_11450 2351 1836 gene locus_tag LOCUS_11460 gene rpsE 2351 1836 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670027.1 protein_id gnl|my_center|LOCUS_11460 2726 2361 gene locus_tag LOCUS_11470 gene rplR 2726 2361 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670026.1 protein_id gnl|my_center|LOCUS_11470 3280 2738 gene locus_tag LOCUS_11480 gene rplF 3280 2738 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670023.1 protein_id gnl|my_center|LOCUS_11480 3694 3296 gene locus_tag LOCUS_11490 gene rpsH 3694 3296 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670022.1 protein_id gnl|my_center|LOCUS_11490 3889 3704 gene locus_tag LOCUS_11500 3889 3704 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_11500 4462 3902 gene locus_tag LOCUS_11510 gene rplE 4462 3902 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670018.1 protein_id gnl|my_center|LOCUS_11510 4781 4464 gene locus_tag LOCUS_11520 gene rplX 4781 4464 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670017.1 protein_id gnl|my_center|LOCUS_11520 5161 4793 gene locus_tag LOCUS_11530 gene rplN 5161 4793 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670011.1 protein_id gnl|my_center|LOCUS_11530 5445 5179 gene locus_tag LOCUS_11540 gene rpsQ 5445 5179 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670009.1 protein_id gnl|my_center|LOCUS_11540 5661 5464 gene locus_tag LOCUS_11550 gene rpmC 5661 5464 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670007.1 protein_id gnl|my_center|LOCUS_11550 6083 5667 gene locus_tag LOCUS_11560 gene rplP 6083 5667 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_11560 6872 6087 gene locus_tag LOCUS_11570 gene rpsC 6872 6087 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670002.1 protein_id gnl|my_center|LOCUS_11570 7240 6875 gene locus_tag LOCUS_11580 gene rplV 7240 6875 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670000.1 protein_id gnl|my_center|LOCUS_11580 7533 7252 gene locus_tag LOCUS_11590 gene rpsS 7533 7252 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669999.1 protein_id gnl|my_center|LOCUS_11590 8378 7548 gene locus_tag LOCUS_11600 gene rplB 8378 7548 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669998.1 protein_id gnl|my_center|LOCUS_11600 8678 8394 gene locus_tag LOCUS_11610 8678 8394 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672216.1 protein_id gnl|my_center|LOCUS_11610 9305 8691 gene locus_tag LOCUS_11620 gene rplD 9305 8691 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669996.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence104 3194 1374 gene locus_tag LOCUS_11630 3194 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 4053 3598 gene locus_tag LOCUS_11640 4053 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4164 4514 gene locus_tag LOCUS_11650 4164 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5088 4480 gene locus_tag LOCUS_11660 5088 4480 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038060574.1 protein_id gnl|my_center|LOCUS_11660 5641 5213 gene locus_tag LOCUS_11670 5641 5213 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984660.1 protein_id gnl|my_center|LOCUS_11670 5795 6622 gene locus_tag LOCUS_11680 5795 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6728 7276 gene locus_tag LOCUS_11690 6728 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7360 8241 gene locus_tag LOCUS_11700 7360 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence105 77 376 gene locus_tag LOCUS_11710 77 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 401 1123 gene locus_tag LOCUS_11720 401 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1130 2902 gene locus_tag LOCUS_11730 gene dnaK 1130 2902 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_11730 2899 3546 gene locus_tag LOCUS_11740 2899 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4396 3566 gene locus_tag LOCUS_11750 4396 3566 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073618.1 protein_id gnl|my_center|LOCUS_11750 5097 4423 gene locus_tag LOCUS_11760 5097 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6002 5319 gene locus_tag LOCUS_11770 gene sdaAB 6002 5319 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733097.1 protein_id gnl|my_center|LOCUS_11770 7507 6137 gene locus_tag LOCUS_11780 7507 6137 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_11780 8697 7510 gene locus_tag LOCUS_11790 8697 7510 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence106 596 1393 gene locus_tag LOCUS_11800 gene uppP 596 1393 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_11800 1433 4270 gene locus_tag LOCUS_11810 1433 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4380 6176 gene locus_tag LOCUS_11820 4380 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6349 7539 gene locus_tag LOCUS_11830 gene purK 6349 7539 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_11830 8528 7536 gene locus_tag LOCUS_11840 8528 7536 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940211.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence107 1432 41 gene locus_tag LOCUS_11850 gene asnS 1432 41 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682293.1 protein_id gnl|my_center|LOCUS_11850 1566 2066 gene locus_tag LOCUS_11860 1566 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2067 2576 gene locus_tag LOCUS_11870 2067 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3518 2610 gene locus_tag LOCUS_11880 3518 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3985 3515 gene locus_tag LOCUS_11890 3985 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4180 4626 gene locus_tag LOCUS_11900 4180 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4623 6230 gene locus_tag LOCUS_11910 4623 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6244 7401 gene locus_tag LOCUS_11920 6244 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 8846 7491 gene locus_tag LOCUS_11930 8846 7491 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682395.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence108 1858 581 gene locus_tag LOCUS_11940 1858 581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535741.1 protein_id gnl|my_center|LOCUS_11940 2587 1862 gene locus_tag LOCUS_11950 2587 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_11950 3296 2763 gene locus_tag LOCUS_11960 3296 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5608 3518 gene locus_tag LOCUS_11970 5608 3518 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_11970 6518 5751 gene locus_tag LOCUS_11980 6518 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6507 6785 gene locus_tag LOCUS_11990 6507 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6776 7054 gene locus_tag LOCUS_12000 6776 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12000 7854 7051 gene locus_tag LOCUS_12010 7854 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 <8926 7851 gene locus_tag LOCUS_12020 <8926 7851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104112.1:DNA polymerase II >Feature sequence109 <1 711 gene locus_tag LOCUS_12030 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555756.1:deoxyguanosinetriphosphate triphosphohydrolase 782 2233 gene locus_tag LOCUS_12040 782 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3591 2395 gene locus_tag LOCUS_12050 gene ygeW 3591 2395 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_12050 6515 3648 gene locus_tag LOCUS_12060 6515 3648 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817476.1 protein_id gnl|my_center|LOCUS_12060 7324 6512 gene locus_tag LOCUS_12070 7324 6512 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223811.1 protein_id gnl|my_center|LOCUS_12070 8686 7325 gene locus_tag LOCUS_12080 8686 7325 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence110 89 1714 gene locus_tag LOCUS_12090 89 1714 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_12090 1707 2750 gene locus_tag LOCUS_12100 1707 2750 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_12100 2747 3865 gene locus_tag LOCUS_12110 2747 3865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_12110 3862 4389 gene locus_tag LOCUS_12120 3862 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4594 7038 gene locus_tag LOCUS_12130 gene leuS 4594 7038 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence111 <1 1719 gene locus_tag LOCUS_12140 <1 1719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155030721.1:Ig-like domain-containing protein 1757 2530 gene locus_tag LOCUS_12150 1757 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2721 3617 gene locus_tag LOCUS_12160 gene rarD 2721 3617 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814542.1 protein_id gnl|my_center|LOCUS_12160 5265 3643 gene locus_tag LOCUS_12170 5265 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6591 5329 gene locus_tag LOCUS_12180 gene hutI 6591 5329 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203599.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence112 119 1453 gene locus_tag LOCUS_12190 119 1453 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704387.1 protein_id gnl|my_center|LOCUS_12190 1723 2547 gene locus_tag LOCUS_12200 1723 2547 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 protein_id gnl|my_center|LOCUS_12200 2669 3970 gene locus_tag LOCUS_12210 gene ugpB 2669 3970 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 protein_id gnl|my_center|LOCUS_12210 4130 5014 gene locus_tag LOCUS_12220 gene ugpA 4130 5014 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 protein_id gnl|my_center|LOCUS_12220 5025 5870 gene locus_tag LOCUS_12230 gene ugpE 5025 5870 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_12230 5882 6205 gene locus_tag LOCUS_12240 5882 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6409 7917 gene locus_tag LOCUS_12250 6409 7917 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973344.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence113 2 1015 gene locus_tag LOCUS_12260 2 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1018 1467 gene locus_tag LOCUS_12270 gene dtd 1018 1467 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_12270 4466 1554 gene locus_tag LOCUS_12280 gene ppdK 4466 1554 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679160.1 protein_id gnl|my_center|LOCUS_12280 5830 4670 gene locus_tag LOCUS_12290 5830 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670701.1 protein_id gnl|my_center|LOCUS_12290 5927 8356 gene locus_tag LOCUS_12300 5927 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence114 1508 171 gene locus_tag LOCUS_12310 gene uraA 1508 171 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435928.1 protein_id gnl|my_center|LOCUS_12310 1882 3378 gene locus_tag LOCUS_12320 1882 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4257 3385 gene locus_tag LOCUS_12330 4257 3385 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932815.1 protein_id gnl|my_center|LOCUS_12330 4438 5073 gene locus_tag LOCUS_12340 4438 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 6243 5119 gene locus_tag LOCUS_12350 6243 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 6653 6240 gene locus_tag LOCUS_12360 6653 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7361 6708 gene locus_tag LOCUS_12370 7361 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence115 1406 2614 gene locus_tag LOCUS_12380 1406 2614 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_12380 2664 3347 gene locus_tag LOCUS_12390 2664 3347 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044977646.1 protein_id gnl|my_center|LOCUS_12390 3412 3612 gene locus_tag LOCUS_12400 3412 3612 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061934.1 protein_id gnl|my_center|LOCUS_12400 3609 4919 gene locus_tag LOCUS_12410 3609 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4916 5332 gene locus_tag LOCUS_12420 gene arfB 4916 5332 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329166.1 protein_id gnl|my_center|LOCUS_12420 5384 6091 gene locus_tag LOCUS_12430 5384 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 6202 7131 gene locus_tag LOCUS_12440 6202 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 7248 8513 gene locus_tag LOCUS_12450 7248 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12450 >Feature sequence116 806 297 gene locus_tag LOCUS_12460 806 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1580 825 gene locus_tag LOCUS_12470 1580 825 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758837.1 protein_id gnl|my_center|LOCUS_12470 1768 3048 gene locus_tag LOCUS_12480 gene galK 1768 3048 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_12480 3137 4441 gene locus_tag LOCUS_12490 3137 4441 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682053.1 protein_id gnl|my_center|LOCUS_12490 4443 5348 gene locus_tag LOCUS_12500 4443 5348 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_12500 7037 5355 gene locus_tag LOCUS_12510 7037 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 7161 7313 gene locus_tag LOCUS_12520 7161 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7983 7390 gene locus_tag LOCUS_12530 gene cheD 7983 7390 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence117 4456 2162 gene locus_tag LOCUS_12540 4456 2162 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681835.1 protein_id gnl|my_center|LOCUS_12540 4665 5690 gene locus_tag LOCUS_12550 gene tdh 4665 5690 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646007.1 protein_id gnl|my_center|LOCUS_12550 6309 8402 gene locus_tag LOCUS_12560 6309 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8447 8522 gene locus_tag LOCUS_t00120 8447 8522 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 <1 622 gene locus_tag LOCUS_12570 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680625.1:PHP domain-containing protein 2066 927 gene locus_tag LOCUS_12580 2066 927 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681303.1 protein_id gnl|my_center|LOCUS_12580 2509 2081 gene locus_tag LOCUS_12590 2509 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2659 3339 gene locus_tag LOCUS_12600 gene rsmI 2659 3339 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_12600 3390 3674 gene locus_tag LOCUS_12610 3390 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3785 4945 gene locus_tag LOCUS_12620 3785 4945 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676322.1 protein_id gnl|my_center|LOCUS_12620 4948 5853 gene locus_tag LOCUS_12630 4948 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6192 7313 gene locus_tag LOCUS_12640 gene ugpC 6192 7313 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence119 1394 972 gene locus_tag LOCUS_12650 1394 972 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_12650 3497 1395 gene locus_tag LOCUS_12660 3497 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4531 3494 gene locus_tag LOCUS_12670 gene rbsB 4531 3494 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419502.1 protein_id gnl|my_center|LOCUS_12670 4756 5418 gene locus_tag LOCUS_12680 4756 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6882 5335 gene locus_tag LOCUS_12690 6882 5335 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_12690 8403 6973 gene locus_tag LOCUS_12700 8403 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8293 8496 gene locus_tag LOCUS_12710 8293 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence120 3099 2374 gene locus_tag LOCUS_12720 3099 2374 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_12720 4790 3195 gene locus_tag LOCUS_12730 gene malQ 4790 3195 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_12730 5014 6534 gene locus_tag LOCUS_12740 5014 6534 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_12740 6801 8429 gene locus_tag LOCUS_12750 6801 8429 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869193.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence121 <1 2259 gene locus_tag LOCUS_12760 <1 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein 4145 2256 gene locus_tag LOCUS_12770 4145 2256 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704579.1 protein_id gnl|my_center|LOCUS_12770 5199 4189 gene locus_tag LOCUS_12780 5199 4189 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_12780 6476 5307 gene locus_tag LOCUS_12790 6476 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 7773 6511 gene locus_tag LOCUS_12800 7773 6511 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_12800 8466 7846 gene locus_tag LOCUS_12810 8466 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence122 627 1640 gene locus_tag LOCUS_12820 627 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1906 4626 gene locus_tag LOCUS_12830 1906 4626 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_12830 4901 5632 gene locus_tag LOCUS_12840 gene hypB 4901 5632 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_12840 5661 8363 gene locus_tag LOCUS_12850 5661 8363 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence123 205 2106 gene locus_tag LOCUS_12860 gene urdA 205 2106 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 protein_id gnl|my_center|LOCUS_12860 3737 2229 gene locus_tag LOCUS_12870 3737 2229 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_12870 3918 7286 gene locus_tag LOCUS_12880 3918 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8177 7389 gene locus_tag LOCUS_12890 8177 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence124 <1 1139 gene locus_tag LOCUS_12900 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682292.1:D-alanyl-D-alanine carboxypeptidase family protein 2144 1230 gene locus_tag LOCUS_12910 2144 1230 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_12910 4414 2153 gene locus_tag LOCUS_12920 4414 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4965 4522 gene locus_tag LOCUS_12930 4965 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5471 4968 gene locus_tag LOCUS_12940 5471 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5653 6285 gene locus_tag LOCUS_12950 5653 6285 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680263.1 protein_id gnl|my_center|LOCUS_12950 6468 7334 gene locus_tag LOCUS_12960 gene rpsB 6468 7334 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_12960 7363 8214 gene locus_tag LOCUS_12970 gene tsf 7363 8214 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence125 2365 377 gene locus_tag LOCUS_12980 2365 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2629 3105 gene locus_tag LOCUS_12990 gene nuoE 2629 3105 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583281.1 protein_id gnl|my_center|LOCUS_12990 3133 3687 gene locus_tag LOCUS_13000 3133 3687 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865378.1 protein_id gnl|my_center|LOCUS_13000 3737 4132 gene locus_tag LOCUS_13010 3737 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_13010 4150 5940 gene locus_tag LOCUS_13020 gene nuoF 4150 5940 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_13020 5963 7717 gene locus_tag LOCUS_13030 5963 7717 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence126 1232 789 gene locus_tag LOCUS_13040 gene rnhA 1232 789 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770770.1 protein_id gnl|my_center|LOCUS_13040 3297 1303 gene locus_tag LOCUS_13050 3297 1303 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682335.1 protein_id gnl|my_center|LOCUS_13050 4308 3304 gene locus_tag LOCUS_13060 4308 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5333 4305 gene locus_tag LOCUS_13070 5333 4305 CDS product TRAP transporter TatT component family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_13070 5429 7180 gene locus_tag LOCUS_13080 5429 7180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence127 1650 271 gene locus_tag LOCUS_13090 1650 271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_13090 3165 1741 gene locus_tag LOCUS_13100 3165 1741 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_13100 4174 3173 gene locus_tag LOCUS_13110 4174 3173 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437556.1 protein_id gnl|my_center|LOCUS_13110 5022 4171 gene locus_tag LOCUS_13120 5022 4171 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_13120 5176 6423 gene locus_tag LOCUS_13130 5176 6423 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385218.1 protein_id gnl|my_center|LOCUS_13130 6514 7428 gene locus_tag LOCUS_13140 6514 7428 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525206.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence128 285 1013 gene locus_tag LOCUS_13150 285 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 992 1708 gene locus_tag LOCUS_13160 gene trmB 992 1708 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_13160 2015 2704 gene locus_tag LOCUS_13170 2015 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3867 2779 gene locus_tag LOCUS_13180 3867 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4697 3864 gene locus_tag LOCUS_13190 4697 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6464 4806 gene locus_tag LOCUS_13200 6464 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7368 6607 gene locus_tag LOCUS_13210 7368 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8150 7368 gene locus_tag LOCUS_13220 8150 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence129 23 439 gene locus_tag LOCUS_13230 23 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1542 460 gene locus_tag LOCUS_13240 1542 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3434 1704 gene locus_tag LOCUS_13250 3434 1704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971835.1 protein_id gnl|my_center|LOCUS_13250 3633 5483 gene locus_tag LOCUS_13260 3633 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7971 5539 gene locus_tag LOCUS_13270 7971 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence130 75 899 gene locus_tag LOCUS_13280 75 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1138 1887 gene locus_tag LOCUS_13290 1138 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1915 2229 gene locus_tag LOCUS_13300 1915 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3397 2537 gene locus_tag LOCUS_13310 3397 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3758 4423 gene locus_tag LOCUS_13320 3758 4423 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_13320 4803 5024 gene locus_tag LOCUS_13330 4803 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 5160 5456 gene locus_tag LOCUS_13340 5160 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence131 369 977 gene locus_tag LOCUS_13350 gene clpP 369 977 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679367.1 protein_id gnl|my_center|LOCUS_13350 955 2202 gene locus_tag LOCUS_13360 gene clpX 955 2202 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965927.1 protein_id gnl|my_center|LOCUS_13360 2199 4685 gene locus_tag LOCUS_13370 gene lon 2199 4685 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_13370 5034 6050 gene locus_tag LOCUS_13380 gene thiB 5034 6050 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067314.1 protein_id gnl|my_center|LOCUS_13380 6047 7786 gene locus_tag LOCUS_13390 6047 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence132 489 37 gene locus_tag LOCUS_13400 489 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1279 431 gene locus_tag LOCUS_13410 1279 431 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679190.1 protein_id gnl|my_center|LOCUS_13410 3013 1448 gene locus_tag LOCUS_13420 3013 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5217 3073 gene locus_tag LOCUS_13430 5217 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6960 5473 gene locus_tag LOCUS_13440 6960 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 <8073 6950 gene locus_tag LOCUS_13450 <8073 6950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068650.1:MFS transporter >Feature sequence133 <1 1135 gene locus_tag LOCUS_13460 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669313.1:replicative DNA helicase 1176 1472 gene locus_tag LOCUS_13470 1176 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2493 1606 gene locus_tag LOCUS_13480 2493 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3648 2551 gene locus_tag LOCUS_13490 gene arsB 3648 2551 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107122.1 protein_id gnl|my_center|LOCUS_13490 3781 4137 gene locus_tag LOCUS_13500 3781 4137 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_13500 5806 4196 gene locus_tag LOCUS_13510 5806 4196 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932499.1 protein_id gnl|my_center|LOCUS_13510 6325 5987 gene locus_tag LOCUS_13520 gene hgcB 6325 5987 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_13520 7444 6338 gene locus_tag LOCUS_13530 gene hgcA 7444 6338 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_13530 <8052 7520 gene locus_tag LOCUS_13540 <8052 7520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870216.1:permease >Feature sequence134 2386 770 gene locus_tag LOCUS_13550 2386 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3192 2455 gene locus_tag LOCUS_13560 3192 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5639 3291 gene locus_tag LOCUS_13570 gene lon 5639 3291 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681876.1 protein_id gnl|my_center|LOCUS_13570 6729 5761 gene locus_tag LOCUS_13580 6729 5761 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_13580 6938 7801 gene locus_tag LOCUS_13590 6938 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 7865 7938 gene locus_tag LOCUS_t00130 7865 7938 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 60 395 gene locus_tag LOCUS_13600 60 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1069 536 gene locus_tag LOCUS_13610 1069 536 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942504.1 protein_id gnl|my_center|LOCUS_13610 1824 1066 gene locus_tag LOCUS_13620 1824 1066 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_13620 2908 1841 gene locus_tag LOCUS_13630 2908 1841 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_13630 3137 2922 gene locus_tag LOCUS_13640 3137 2922 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_13640 4053 3127 gene locus_tag LOCUS_13650 gene ptb 4053 3127 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_13650 5138 4071 gene locus_tag LOCUS_13660 gene buk 5138 4071 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_13660 7350 5413 gene locus_tag LOCUS_13670 7350 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681756.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence136 404 2401 gene locus_tag LOCUS_13680 404 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2398 2862 gene locus_tag LOCUS_13690 2398 2862 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_13690 4517 2859 gene locus_tag LOCUS_13700 4517 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4611 5723 gene locus_tag LOCUS_13710 4611 5723 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557312.1 protein_id gnl|my_center|LOCUS_13710 6454 5798 gene locus_tag LOCUS_13720 6454 5798 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136889.1 protein_id gnl|my_center|LOCUS_13720 6562 7926 gene locus_tag LOCUS_13730 6562 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence137 3087 1606 gene locus_tag LOCUS_13740 3087 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3201 3761 gene locus_tag LOCUS_13750 gene rpoE 3201 3761 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_13750 3758 4384 gene locus_tag LOCUS_13760 3758 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4458 4946 gene locus_tag LOCUS_13770 4458 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 4946 5638 gene locus_tag LOCUS_13780 4946 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5635 6525 gene locus_tag LOCUS_13790 5635 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 6840 6541 gene locus_tag LOCUS_13800 6840 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 <7961 6837 gene locus_tag LOCUS_13810 <7961 6837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902121.1:DUF58 domain-containing protein >Feature sequence138 <1 623 gene locus_tag LOCUS_13820 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930803.1:IGHMBP2 family helicase 620 2182 gene locus_tag LOCUS_13830 620 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2179 6156 gene locus_tag LOCUS_13840 2179 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6143 7597 gene locus_tag LOCUS_13850 6143 7597 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence139 372 2408 gene locus_tag LOCUS_13860 372 2408 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_13860 2536 3069 gene locus_tag LOCUS_13870 2536 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3167 3754 gene locus_tag LOCUS_13880 3167 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3816 4379 gene locus_tag LOCUS_13890 3816 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 5274 4399 gene locus_tag LOCUS_13900 5274 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6038 5271 gene locus_tag LOCUS_13910 gene cobB 6038 5271 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191856.1 protein_id gnl|my_center|LOCUS_13910 6891 6049 gene locus_tag LOCUS_13920 6891 6049 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_13920 7651 6965 gene locus_tag LOCUS_13930 7651 6965 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence140 214 1194 gene locus_tag LOCUS_13940 214 1194 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681111.1 protein_id gnl|my_center|LOCUS_13940 1244 2029 gene locus_tag LOCUS_13950 1244 2029 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948970.1 protein_id gnl|my_center|LOCUS_13950 2019 2744 gene locus_tag LOCUS_13960 2019 2744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_13960 4779 2854 gene locus_tag LOCUS_13970 4779 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5183 4779 gene locus_tag LOCUS_13980 5183 4779 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_13980 7206 5215 gene locus_tag LOCUS_13990 7206 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7865 7203 gene locus_tag LOCUS_14000 7865 7203 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence141 1250 1897 gene locus_tag LOCUS_14010 1250 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2003 2671 gene locus_tag LOCUS_14020 2003 2671 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_14020 2787 4112 gene locus_tag LOCUS_14030 2787 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4174 4887 gene locus_tag LOCUS_14040 gene fkpA 4174 4887 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_14040 4986 7031 gene locus_tag LOCUS_14050 4986 7031 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680717.1 protein_id gnl|my_center|LOCUS_14050 <7901 7072 gene locus_tag LOCUS_14060 <7901 7072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068174089.1:formimidoylglutamase >Feature sequence142 3416 708 gene locus_tag LOCUS_14070 3416 708 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682238.1 protein_id gnl|my_center|LOCUS_14070 3505 3963 gene locus_tag LOCUS_14080 3505 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3960 5315 gene locus_tag LOCUS_14090 3960 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5326 6099 gene locus_tag LOCUS_14100 5326 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6117 7556 gene locus_tag LOCUS_14110 6117 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence143 2571 1339 gene locus_tag LOCUS_14120 2571 1339 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_14120 2795 3667 gene locus_tag LOCUS_14130 2795 3667 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_14130 3769 4329 gene locus_tag LOCUS_14140 3769 4329 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_14140 4462 5589 gene locus_tag LOCUS_14150 4462 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 <7839 5689 gene locus_tag LOCUS_14160 <7839 5689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681041.1:FlgD immunoglobulin-like domain containing protein >Feature sequence144 519 118 gene locus_tag LOCUS_14170 519 118 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_14170 1425 640 gene locus_tag LOCUS_14180 1425 640 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071890.1 protein_id gnl|my_center|LOCUS_14180 2464 1454 gene locus_tag LOCUS_14190 gene ricT 2464 1454 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680971.1 protein_id gnl|my_center|LOCUS_14190 2317 2411 gene locus_tag LOCUS_t00140 2317 2411 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2982 2476 gene locus_tag LOCUS_14200 2982 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3491 2985 gene locus_tag LOCUS_14210 3491 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4544 3504 gene locus_tag LOCUS_14220 4544 3504 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666722.1 protein_id gnl|my_center|LOCUS_14220 4782 5660 gene locus_tag LOCUS_14230 4782 5660 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_14230 5802 7727 gene locus_tag LOCUS_14240 gene htpG 5802 7727 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence145 <1 551 gene locus_tag LOCUS_14250 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919894.1:S41 family peptidase 985 548 gene locus_tag LOCUS_14260 985 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1833 964 gene locus_tag LOCUS_14270 1833 964 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107775.1 protein_id gnl|my_center|LOCUS_14270 2580 1954 gene locus_tag LOCUS_14280 2580 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4623 2809 gene locus_tag LOCUS_14290 4623 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5210 4788 gene locus_tag LOCUS_14300 5210 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5471 6451 gene locus_tag LOCUS_14310 5471 6451 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920994.1 protein_id gnl|my_center|LOCUS_14310 6458 7393 gene locus_tag LOCUS_14320 gene pstC 6458 7393 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence146 1353 442 gene locus_tag LOCUS_14330 1353 442 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546228.1 protein_id gnl|my_center|LOCUS_14330 2660 1416 gene locus_tag LOCUS_14340 2660 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3860 2670 gene locus_tag LOCUS_14350 3860 2670 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_14350 4822 3857 gene locus_tag LOCUS_14360 4822 3857 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_14360 4921 5865 gene locus_tag LOCUS_14370 4921 5865 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721549.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence147 1489 374 gene locus_tag LOCUS_14380 1489 374 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682269.1 protein_id gnl|my_center|LOCUS_14380 1574 1816 gene locus_tag LOCUS_14390 1574 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2116 2853 gene locus_tag LOCUS_14400 2116 2853 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_14400 2942 3418 gene locus_tag LOCUS_14410 gene ruvC 2942 3418 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_14410 3490 4098 gene locus_tag LOCUS_14420 gene ruvA 3490 4098 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_14420 4102 5334 gene locus_tag LOCUS_14430 gene ruvB 4102 5334 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_14430 5309 6361 gene locus_tag LOCUS_14440 gene queA 5309 6361 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence148 3595 185 gene locus_tag LOCUS_14450 3595 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4392 3592 gene locus_tag LOCUS_14460 4392 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4769 4410 gene locus_tag LOCUS_14470 4769 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5701 4766 gene locus_tag LOCUS_14480 5701 4766 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_14480 5769 7058 gene locus_tag LOCUS_14490 5769 7058 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence149 422 1384 gene locus_tag LOCUS_14500 422 1384 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_14500 1384 2358 gene locus_tag LOCUS_14510 1384 2358 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_14510 2355 3335 gene locus_tag LOCUS_14520 2355 3335 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_14520 3394 4386 gene locus_tag LOCUS_14530 3394 4386 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815606.1 protein_id gnl|my_center|LOCUS_14530 4516 5055 gene locus_tag LOCUS_14540 4516 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5067 6572 gene locus_tag LOCUS_14550 5067 6572 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence150 156 644 gene locus_tag LOCUS_14560 156 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175168236.1 protein_id gnl|my_center|LOCUS_14560 641 1030 gene locus_tag LOCUS_14570 641 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1023 1514 gene locus_tag LOCUS_14580 1023 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931438.1 protein_id gnl|my_center|LOCUS_14580 1487 1939 gene locus_tag LOCUS_14590 1487 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2043 2945 gene locus_tag LOCUS_14600 2043 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2955 3353 gene locus_tag LOCUS_14610 2955 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3425 3709 gene locus_tag LOCUS_14620 3425 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3714 5771 gene locus_tag LOCUS_14630 3714 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5773 6123 gene locus_tag LOCUS_14640 5773 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6120 6611 gene locus_tag LOCUS_14650 6120 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6611 6997 gene locus_tag LOCUS_14660 6611 6997 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939431.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence151 1184 3187 gene locus_tag LOCUS_14670 1184 3187 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_14670 3263 3667 gene locus_tag LOCUS_14680 3263 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3690 4400 gene locus_tag LOCUS_14690 3690 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5189 4521 gene locus_tag LOCUS_14700 gene rnhB 5189 4521 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_14700 5323 6261 gene locus_tag LOCUS_14710 5323 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7301 6273 gene locus_tag LOCUS_14720 7301 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence152 2732 2061 gene locus_tag LOCUS_14730 2732 2061 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680480.1 protein_id gnl|my_center|LOCUS_14730 3704 2739 gene locus_tag LOCUS_14740 3704 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702854.1 protein_id gnl|my_center|LOCUS_14740 4933 3701 gene locus_tag LOCUS_14750 4933 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7431 4984 gene locus_tag LOCUS_14760 7431 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence153 3214 1895 gene locus_tag LOCUS_14770 3214 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5514 3292 gene locus_tag LOCUS_14780 5514 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6694 5519 gene locus_tag LOCUS_14790 gene iadA 6694 5519 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868956.1 protein_id gnl|my_center|LOCUS_14790 <7583 6857 gene locus_tag LOCUS_14800 <7583 6857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433878.1:sodium:solute symporter family protein >Feature sequence154 563 2011 gene locus_tag LOCUS_14810 563 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427771.1 protein_id gnl|my_center|LOCUS_14810 2017 2925 gene locus_tag LOCUS_14820 2017 2925 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_14820 4062 2998 gene locus_tag LOCUS_14830 4062 2998 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_14830 5303 4065 gene locus_tag LOCUS_14840 5303 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 5539 6204 gene locus_tag LOCUS_14850 5539 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 6240 6791 gene locus_tag LOCUS_14860 gene aac(6') 6240 6791 CDS product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 protein_id gnl|my_center|LOCUS_14860 6870 7469 gene locus_tag LOCUS_14870 6870 7469 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence155 711 1295 gene locus_tag LOCUS_14880 711 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1416 2036 gene locus_tag LOCUS_14890 gene udk 1416 2036 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655979.1 protein_id gnl|my_center|LOCUS_14890 2136 4118 gene locus_tag LOCUS_14900 2136 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4121 5281 gene locus_tag LOCUS_14910 4121 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5622 5278 gene locus_tag LOCUS_14920 5622 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5506 6660 gene locus_tag LOCUS_14930 5506 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 6657 7331 gene locus_tag LOCUS_14940 6657 7331 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939943.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence156 1249 2118 gene locus_tag LOCUS_14950 1249 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4007 2115 gene locus_tag LOCUS_14960 4007 2115 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_14960 5676 4114 gene locus_tag LOCUS_14970 5676 4114 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680223.1 protein_id gnl|my_center|LOCUS_14970 6026 6736 gene locus_tag LOCUS_14980 6026 6736 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence157 385 750 gene locus_tag LOCUS_14990 385 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 851 2581 gene locus_tag LOCUS_15000 gene secD 851 2581 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_15000 2581 3855 gene locus_tag LOCUS_15010 gene secF 2581 3855 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681892.1 protein_id gnl|my_center|LOCUS_15010 4188 4259 gene locus_tag LOCUS_t00150 4188 4259 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5010 4495 gene locus_tag LOCUS_15020 5010 4495 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083201.1 protein_id gnl|my_center|LOCUS_15020 5984 5034 gene locus_tag LOCUS_15030 gene glsA 5984 5034 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869543.1 protein_id gnl|my_center|LOCUS_15030 6221 6042 gene locus_tag LOCUS_15040 6221 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6353 6973 gene locus_tag LOCUS_15050 6353 6973 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence158 109 1305 gene locus_tag LOCUS_15060 109 1305 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_15060 1318 2487 gene locus_tag LOCUS_15070 1318 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3241 2498 gene locus_tag LOCUS_15080 3241 2498 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811624.1 protein_id gnl|my_center|LOCUS_15080 3435 4406 gene locus_tag LOCUS_15090 3435 4406 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248630.1 protein_id gnl|my_center|LOCUS_15090 5195 4425 gene locus_tag LOCUS_15100 5195 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6210 5224 gene locus_tag LOCUS_15110 6210 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7224 6379 gene locus_tag LOCUS_15120 7224 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence159 3182 198 gene locus_tag LOCUS_15130 3182 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3236 3856 gene locus_tag LOCUS_15140 3236 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3853 4188 gene locus_tag LOCUS_15150 3853 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4328 6271 gene locus_tag LOCUS_15160 4328 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 6293 6631 gene locus_tag LOCUS_15170 6293 6631 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670686.1 protein_id gnl|my_center|LOCUS_15170 6637 7209 gene locus_tag LOCUS_15180 6637 7209 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670683.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence160 2942 363 gene locus_tag LOCUS_15190 gene clpB 2942 363 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680241.1 protein_id gnl|my_center|LOCUS_15190 3068 3277 gene locus_tag LOCUS_15200 3068 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3950 3432 gene locus_tag LOCUS_15210 3950 3432 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_15210 4120 5634 gene locus_tag LOCUS_15220 4120 5634 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870047.1 protein_id gnl|my_center|LOCUS_15220 5714 6169 gene locus_tag LOCUS_15230 5714 6169 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_15230 6176 7231 gene locus_tag LOCUS_15240 6176 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence161 1545 85 gene locus_tag LOCUS_15250 1545 85 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922333.1 protein_id gnl|my_center|LOCUS_15250 2135 1542 gene locus_tag LOCUS_15260 2135 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3886 2504 gene locus_tag LOCUS_15270 3886 2504 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971004.1 protein_id gnl|my_center|LOCUS_15270 6930 4393 gene locus_tag LOCUS_15280 6930 4393 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682327.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence162 699 7 gene locus_tag LOCUS_15290 699 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1933 770 gene locus_tag LOCUS_15300 1933 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2430 1930 gene locus_tag LOCUS_15310 2430 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3488 2430 gene locus_tag LOCUS_15320 3488 2430 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_15320 4531 3527 gene locus_tag LOCUS_15330 4531 3527 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_15330 5547 4528 gene locus_tag LOCUS_15340 5547 4528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_15340 6392 5556 gene locus_tag LOCUS_15350 6392 5556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_15350 7358 6396 gene locus_tag LOCUS_15360 7358 6396 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence163 751 8 gene locus_tag LOCUS_15370 751 8 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_15370 2377 764 gene locus_tag LOCUS_15380 2377 764 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_15380 4143 2374 gene locus_tag LOCUS_15390 4143 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5128 4136 gene locus_tag LOCUS_15400 5128 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 6490 5156 gene locus_tag LOCUS_15410 gene ablA 6490 5156 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_15410 7325 6501 gene locus_tag LOCUS_15420 7325 6501 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence164 <1 1155 gene locus_tag LOCUS_15430 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546569.1:sigma-54 dependent transcriptional regulator 2517 1600 gene locus_tag LOCUS_15440 2517 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2699 4444 gene locus_tag LOCUS_15450 2699 4444 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_15450 5884 4625 gene locus_tag LOCUS_15460 5884 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6049 7260 gene locus_tag LOCUS_15470 6049 7260 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence165 1599 391 gene locus_tag LOCUS_15480 1599 391 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301172.1 protein_id gnl|my_center|LOCUS_15480 2984 1602 gene locus_tag LOCUS_15490 gene ssnA 2984 1602 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706028.1 protein_id gnl|my_center|LOCUS_15490 6139 2981 gene locus_tag LOCUS_15500 gene ygfK 6139 2981 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393447.1 protein_id gnl|my_center|LOCUS_15500 7272 6136 gene locus_tag LOCUS_15510 7272 6136 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence166 284 1189 gene locus_tag LOCUS_15520 284 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1917 1201 gene locus_tag LOCUS_15530 gene rgbR 1917 1201 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_15530 1953 3275 gene locus_tag LOCUS_15540 1953 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3350 4789 gene locus_tag LOCUS_15550 3350 4789 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680340.1 protein_id gnl|my_center|LOCUS_15550 4786 6126 gene locus_tag LOCUS_15560 4786 6126 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680338.1 protein_id gnl|my_center|LOCUS_15560 6982 6224 gene locus_tag LOCUS_15570 6982 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence167 <1 1136 gene locus_tag LOCUS_15580 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930145.1:alcohol acetyltransferase 1123 2475 gene locus_tag LOCUS_15590 1123 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_15590 2476 3186 gene locus_tag LOCUS_15600 2476 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3330 3402 gene locus_tag LOCUS_t00160 3330 3402 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3641 4870 gene locus_tag LOCUS_15610 3641 4870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_15610 6700 4874 gene locus_tag LOCUS_15620 6700 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936280.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence168 3625 2675 gene locus_tag LOCUS_15630 3625 2675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_15630 4853 3627 gene locus_tag LOCUS_15640 4853 3627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_15640 6375 4846 gene locus_tag LOCUS_15650 6375 4846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_15650 <7222 6382 gene locus_tag LOCUS_15660 <7222 6382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970219.1:BMP family protein >Feature sequence169 1594 2631 gene locus_tag LOCUS_15670 1594 2631 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798984.1 protein_id gnl|my_center|LOCUS_15670 4350 2644 gene locus_tag LOCUS_15680 4350 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4634 6613 gene locus_tag LOCUS_15690 4634 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence170 2971 2312 gene locus_tag LOCUS_15700 2971 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3310 3053 gene locus_tag LOCUS_15710 3310 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4566 3619 gene locus_tag LOCUS_15720 4566 3619 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_15720 4683 5282 gene locus_tag LOCUS_15730 4683 5282 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_15730 5889 5404 gene locus_tag LOCUS_15740 5889 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence171 399 3044 gene locus_tag LOCUS_15750 399 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3644 3132 gene locus_tag LOCUS_15760 3644 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4106 4897 gene locus_tag LOCUS_15770 4106 4897 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_15770 4910 6103 gene locus_tag LOCUS_15780 gene hadC 4910 6103 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence172 1047 2459 gene locus_tag LOCUS_15790 1047 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679186.1 protein_id gnl|my_center|LOCUS_15790 2538 4841 gene locus_tag LOCUS_15800 2538 4841 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681580.1 protein_id gnl|my_center|LOCUS_15800 4841 5650 gene locus_tag LOCUS_15810 4841 5650 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_15810 5647 6657 gene locus_tag LOCUS_15820 5647 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence173 617 1093 gene locus_tag LOCUS_15830 617 1093 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392929.1 protein_id gnl|my_center|LOCUS_15830 1090 1485 gene locus_tag LOCUS_15840 1090 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2390 1482 gene locus_tag LOCUS_15850 2390 1482 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673213.1 protein_id gnl|my_center|LOCUS_15850 3027 2395 gene locus_tag LOCUS_15860 3027 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3581 3243 gene locus_tag LOCUS_15870 3581 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3905 3585 gene locus_tag LOCUS_15880 3905 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 4822 3902 gene locus_tag LOCUS_15890 4822 3902 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_15890 5703 4819 gene locus_tag LOCUS_15900 5703 4819 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939381.1 protein_id gnl|my_center|LOCUS_15900 5921 5700 gene locus_tag LOCUS_15910 5921 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6148 5819 gene locus_tag LOCUS_15920 6148 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 6753 6307 gene locus_tag LOCUS_15930 6753 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence174 1 1155 gene locus_tag LOCUS_15940 1 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1158 2456 gene locus_tag LOCUS_15950 1158 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2465 3241 gene locus_tag LOCUS_15960 2465 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3238 4509 gene locus_tag LOCUS_15970 3238 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4541 5401 gene locus_tag LOCUS_15980 4541 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5523 6341 gene locus_tag LOCUS_15990 5523 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence175 3435 4025 gene locus_tag LOCUS_16000 3435 4025 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941388.1 protein_id gnl|my_center|LOCUS_16000 4241 5968 gene locus_tag LOCUS_16010 4241 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence176 2177 546 gene locus_tag LOCUS_16020 2177 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3742 2183 gene locus_tag LOCUS_16030 3742 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6088 3911 gene locus_tag LOCUS_16040 6088 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 6825 6085 gene locus_tag LOCUS_16050 6825 6085 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence177 1528 824 gene locus_tag LOCUS_16060 1528 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3062 1641 gene locus_tag LOCUS_16070 3062 1641 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_16070 3290 3550 gene locus_tag LOCUS_16080 3290 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3950 3537 gene locus_tag LOCUS_16090 3950 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5345 4086 gene locus_tag LOCUS_16100 5345 4086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_16100 5440 6663 gene locus_tag LOCUS_16110 5440 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence178 265 972 gene locus_tag LOCUS_16120 gene radC 265 972 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_16120 2695 1004 gene locus_tag LOCUS_16130 2695 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4498 2888 gene locus_tag LOCUS_16140 4498 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 5873 4695 gene locus_tag LOCUS_16150 5873 4695 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_16150 6922 6185 gene locus_tag LOCUS_16160 6922 6185 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681234.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence179 669 2123 gene locus_tag LOCUS_16170 669 2123 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926807.1 protein_id gnl|my_center|LOCUS_16170 2120 2959 gene locus_tag LOCUS_16180 2120 2959 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460408.1 protein_id gnl|my_center|LOCUS_16180 3104 3979 gene locus_tag LOCUS_16190 3104 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4719 4054 gene locus_tag LOCUS_16200 4719 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 6561 5005 gene locus_tag LOCUS_16210 6561 5005 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146661.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence180 715 1062 gene locus_tag LOCUS_16220 715 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2441 1206 gene locus_tag LOCUS_16230 2441 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668541.1 protein_id gnl|my_center|LOCUS_16230 3499 2438 gene locus_tag LOCUS_16240 gene ispG 3499 2438 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 protein_id gnl|my_center|LOCUS_16240 4015 3593 gene locus_tag LOCUS_16250 4015 3593 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_16250 5942 4032 gene locus_tag LOCUS_16260 5942 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6568 5939 gene locus_tag LOCUS_16270 6568 5939 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence181 <1 1297 gene locus_tag LOCUS_16280 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681501.1:RecQ family ATP-dependent DNA helicase 2508 1255 gene locus_tag LOCUS_16290 2508 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2693 4288 gene locus_tag LOCUS_16300 2693 4288 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_16300 4292 5425 gene locus_tag LOCUS_16310 gene murG 4292 5425 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957113.1 protein_id gnl|my_center|LOCUS_16310 5422 6003 gene locus_tag LOCUS_16320 5422 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence182 493 1614 gene locus_tag LOCUS_16330 493 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2008 1607 gene locus_tag LOCUS_16340 2008 1607 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_16340 2177 4621 gene locus_tag LOCUS_16350 2177 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence183 789 139 gene locus_tag LOCUS_16360 789 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1481 786 gene locus_tag LOCUS_16370 1481 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3084 1468 gene locus_tag LOCUS_16380 3084 1468 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462257.1 protein_id gnl|my_center|LOCUS_16380 3165 3623 gene locus_tag LOCUS_16390 3165 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680884.1 protein_id gnl|my_center|LOCUS_16390 4832 3651 gene locus_tag LOCUS_16400 4832 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5126 5983 gene locus_tag LOCUS_16410 gene flgF 5126 5983 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_16410 6005 6799 gene locus_tag LOCUS_16420 gene flgG 6005 6799 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670463.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence184 2803 968 gene locus_tag LOCUS_16430 2803 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3590 2808 gene locus_tag LOCUS_16440 gene aat 3590 2808 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_16440 4618 3587 gene locus_tag LOCUS_16450 4618 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 <6747 4747 gene locus_tag LOCUS_16460 <6747 4747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000971183.1:ATP-dependent protease ATP-binding subunit ClpC >Feature sequence185 3046 569 gene locus_tag LOCUS_16470 gene mrfA 3046 569 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_16470 3112 4386 gene locus_tag LOCUS_16480 3112 4386 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_16480 6219 4399 gene locus_tag LOCUS_16490 6219 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence186 <1 576 gene locus_tag LOCUS_16500 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681841.1:LPS export ABC transporter ATP-binding protein 800 1573 gene locus_tag LOCUS_16510 800 1573 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_16510 1772 2767 gene locus_tag LOCUS_16520 gene dusB 1772 2767 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_16520 3462 2857 gene locus_tag LOCUS_16530 3462 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4831 3551 gene locus_tag LOCUS_16540 4831 3551 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674509.1 protein_id gnl|my_center|LOCUS_16540 5014 5502 gene locus_tag LOCUS_16550 5014 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5588 5674 gene locus_tag LOCUS_t00170 5588 5674 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5690 5779 gene locus_tag LOCUS_t00180 5690 5779 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5788 5861 gene locus_tag LOCUS_t00190 5788 5861 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5870 5958 gene locus_tag LOCUS_t00200 5870 5958 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5982 6068 gene locus_tag LOCUS_t00210 5982 6068 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence187 <1 4006 gene locus_tag LOCUS_16560 <1 4006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029446868.1:two-component regulator propeller domain-containing protein 4538 5440 gene locus_tag LOCUS_16570 4538 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence188 1610 495 gene locus_tag LOCUS_16580 1610 495 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321517.1 protein_id gnl|my_center|LOCUS_16580 1837 2655 gene locus_tag LOCUS_16590 1837 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3575 2652 gene locus_tag LOCUS_16600 3575 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3766 4725 gene locus_tag LOCUS_16610 3766 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4796 5734 gene locus_tag LOCUS_16620 4796 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence189 2 178 gene locus_tag LOCUS_16630 2 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 182 1372 gene locus_tag LOCUS_16640 182 1372 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_16640 1561 2493 gene locus_tag LOCUS_16650 1561 2493 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365739.1 protein_id gnl|my_center|LOCUS_16650 2490 3836 gene locus_tag LOCUS_16660 2490 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3830 4855 gene locus_tag LOCUS_16670 3830 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4917 5771 gene locus_tag LOCUS_16680 gene yehW 4917 5771 CDS product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783125.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence190 51 473 gene locus_tag LOCUS_16690 51 473 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_16690 513 917 gene locus_tag LOCUS_16700 513 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1067 2521 gene locus_tag LOCUS_16710 gene hemL 1067 2521 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_16710 2518 3246 gene locus_tag LOCUS_16720 2518 3246 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_16720 3243 4898 gene locus_tag LOCUS_16730 3243 4898 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_16730 4895 6103 gene locus_tag LOCUS_16740 gene gudP 4895 6103 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097069.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence191 162 1355 gene locus_tag LOCUS_16750 162 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2236 1352 gene locus_tag LOCUS_16760 2236 1352 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_16760 2345 3523 gene locus_tag LOCUS_16770 2345 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4494 3520 gene locus_tag LOCUS_16780 4494 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5144 4539 gene locus_tag LOCUS_16790 5144 4539 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194061.1 protein_id gnl|my_center|LOCUS_16790 5880 5233 gene locus_tag LOCUS_16800 5880 5233 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence192 21 755 gene locus_tag LOCUS_16810 21 755 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_16810 893 1375 gene locus_tag LOCUS_16820 893 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1490 3325 gene locus_tag LOCUS_16830 1490 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3375 4298 gene locus_tag LOCUS_16840 3375 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4295 5266 gene locus_tag LOCUS_16850 4295 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6025 5375 gene locus_tag LOCUS_16860 gene plsY 6025 5375 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence193 1031 234 gene locus_tag LOCUS_16870 1031 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2278 1031 gene locus_tag LOCUS_16880 2278 1031 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390559.1 protein_id gnl|my_center|LOCUS_16880 3549 2290 gene locus_tag LOCUS_16890 3549 2290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975247.1 protein_id gnl|my_center|LOCUS_16890 4239 3553 gene locus_tag LOCUS_16900 4239 3553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_16900 4590 4240 gene locus_tag LOCUS_16910 4590 4240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_16910 5246 4587 gene locus_tag LOCUS_16920 5246 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5357 6262 gene locus_tag LOCUS_16930 5357 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence194 1370 213 gene locus_tag LOCUS_16940 1370 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1927 1688 gene locus_tag LOCUS_16950 1927 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2929 2408 gene locus_tag LOCUS_16960 2929 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4131 3418 gene locus_tag LOCUS_16970 4131 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5017 4214 gene locus_tag LOCUS_16980 5017 4214 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804599.1 protein_id gnl|my_center|LOCUS_16980 5874 5020 gene locus_tag LOCUS_16990 5874 5020 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804600.1 protein_id gnl|my_center|LOCUS_16990 <6575 5871 gene locus_tag LOCUS_17000 <6575 5871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000843667.1:ATP-binding cassette domain-containing protein >Feature sequence195 100 2214 gene locus_tag LOCUS_17010 gene yihQ 100 2214 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380857.1 protein_id gnl|my_center|LOCUS_17010 2690 2313 gene locus_tag LOCUS_17020 2690 2313 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_17020 5241 2758 gene locus_tag LOCUS_17030 5241 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence196 1330 5 gene locus_tag LOCUS_17040 1330 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2780 1347 gene locus_tag LOCUS_17050 2780 1347 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679548.1 protein_id gnl|my_center|LOCUS_17050 3478 2783 gene locus_tag LOCUS_17060 3478 2783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669611.1 protein_id gnl|my_center|LOCUS_17060 4038 3475 gene locus_tag LOCUS_17070 4038 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5205 4138 gene locus_tag LOCUS_17080 5205 4138 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_17080 5947 5459 gene locus_tag LOCUS_17090 5947 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6227 5856 gene locus_tag LOCUS_17100 6227 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence197 2290 836 gene locus_tag LOCUS_17110 2290 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3408 2287 gene locus_tag LOCUS_17120 3408 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 3593 5659 gene locus_tag LOCUS_17130 3593 5659 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681061.1 protein_id gnl|my_center|LOCUS_17130 <6493 5754 gene locus_tag LOCUS_17140 <6493 5754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640169.1:ATP-dependent helicase HrpB >Feature sequence198 169 1443 gene locus_tag LOCUS_17150 169 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3391 1487 gene locus_tag LOCUS_17160 3391 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3617 4849 gene locus_tag LOCUS_17170 3617 4849 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_17170 5231 4941 gene locus_tag LOCUS_17180 5231 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656076.1 protein_id gnl|my_center|LOCUS_17180 5530 5372 gene locus_tag LOCUS_17190 5530 5372 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_17190 5978 5604 gene locus_tag LOCUS_17200 5978 5604 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence199 <1 1152 gene locus_tag LOCUS_17210 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956874.1:ABC transporter substrate-binding protein 1283 2323 gene locus_tag LOCUS_17220 1283 2323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670594.1 protein_id gnl|my_center|LOCUS_17220 2320 3729 gene locus_tag LOCUS_17230 2320 3729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682384.1 protein_id gnl|my_center|LOCUS_17230 3736 4707 gene locus_tag LOCUS_17240 3736 4707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670599.1 protein_id gnl|my_center|LOCUS_17240 4718 5728 gene locus_tag LOCUS_17250 4718 5728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677558.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence200 2139 3593 gene locus_tag LOCUS_17260 2139 3593 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_17260 3583 4548 gene locus_tag LOCUS_17270 3583 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4556 5155 gene locus_tag LOCUS_17280 4556 5155 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_17280 5161 6096 gene locus_tag LOCUS_17290 5161 6096 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877602.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence201 <1 1104 gene locus_tag LOCUS_17300 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671463.1:penicillin-binding protein 2 1101 2414 gene locus_tag LOCUS_17310 gene rodA 1101 2414 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677908.1 protein_id gnl|my_center|LOCUS_17310 2411 5002 gene locus_tag LOCUS_17320 2411 5002 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_17320 5876 5217 gene locus_tag LOCUS_17330 5876 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence202 165 965 gene locus_tag LOCUS_17340 165 965 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280291.1 protein_id gnl|my_center|LOCUS_17340 2250 994 gene locus_tag LOCUS_17350 2250 994 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_17350 3445 2411 gene locus_tag LOCUS_17360 3445 2411 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680378.1 protein_id gnl|my_center|LOCUS_17360 3575 4600 gene locus_tag LOCUS_17370 3575 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4618 4941 gene locus_tag LOCUS_17380 4618 4941 CDS product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895429.1 protein_id gnl|my_center|LOCUS_17380 <6391 5017 gene locus_tag LOCUS_17390 <6391 5017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109265.1:VWA domain-containing protein >Feature sequence203 2822 966 gene locus_tag LOCUS_17400 2822 966 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_17400 4114 3041 gene locus_tag LOCUS_17410 4114 3041 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598049.1 protein_id gnl|my_center|LOCUS_17410 4302 4928 gene locus_tag LOCUS_17420 4302 4928 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_17420 5294 4962 gene locus_tag LOCUS_17430 5294 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5430 6254 gene locus_tag LOCUS_17440 5430 6254 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence204 <1 864 gene locus_tag LOCUS_17450 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583299.1:branched-chain amino acid ABC transporter permease 861 1631 gene locus_tag LOCUS_17460 861 1631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_17460 1631 2335 gene locus_tag LOCUS_17470 1631 2335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_17470 2593 4524 gene locus_tag LOCUS_17480 2593 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4521 5189 gene locus_tag LOCUS_17490 4521 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence205 <1 2191 gene locus_tag LOCUS_17500 <1 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257770.1:PBP1A family penicillin-binding protein 3522 2215 gene locus_tag LOCUS_17510 3522 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3553 4524 gene locus_tag LOCUS_17520 3553 4524 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_17520 5519 4641 gene locus_tag LOCUS_17530 5519 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5683 6210 gene locus_tag LOCUS_17540 5683 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760478.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence206 823 401 gene locus_tag LOCUS_17550 823 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 708 1184 gene locus_tag LOCUS_17560 708 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1218 1667 gene locus_tag LOCUS_17570 1218 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1739 2566 gene locus_tag LOCUS_17580 1739 2566 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_17580 2572 3840 gene locus_tag LOCUS_17590 2572 3840 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence207 3224 1062 gene locus_tag LOCUS_17600 3224 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3507 3845 gene locus_tag LOCUS_17610 3507 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3850 5061 gene locus_tag LOCUS_17620 3850 5061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_17620 5187 5612 gene locus_tag LOCUS_17630 5187 5612 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_17630 6183 5590 gene locus_tag LOCUS_17640 6183 5590 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence208 <1 1706 gene locus_tag LOCUS_17650 <1 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:ATP-binding protein 2464 1703 gene locus_tag LOCUS_17660 2464 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2743 4158 gene locus_tag LOCUS_17670 2743 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679821.1 protein_id gnl|my_center|LOCUS_17670 4241 5881 gene locus_tag LOCUS_17680 4241 5881 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957136.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence209 <1 513 gene locus_tag LOCUS_17690 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583454.1:RnfABCDGE type electron transport complex subunit D 516 1055 gene locus_tag LOCUS_17700 516 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1058 1663 gene locus_tag LOCUS_17710 1058 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1690 2244 gene locus_tag LOCUS_17720 gene rsxA 1690 2244 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_17720 2249 3058 gene locus_tag LOCUS_17730 2249 3058 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_17730 3126 5048 gene locus_tag LOCUS_17740 3126 5048 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence210 4584 271 gene locus_tag LOCUS_17750 4584 271 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_17750 4676 5773 gene locus_tag LOCUS_17760 4676 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence211 114 836 gene locus_tag LOCUS_17770 114 836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681678.1 protein_id gnl|my_center|LOCUS_17770 833 2020 gene locus_tag LOCUS_17780 833 2020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_17780 2488 2051 gene locus_tag LOCUS_17790 2488 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2556 4436 gene locus_tag LOCUS_17800 2556 4436 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_17800 4770 4546 gene locus_tag LOCUS_17810 4770 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <6207 4767 gene locus_tag LOCUS_17820 <6207 4767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931750.1:ferrous iron transport protein B >Feature sequence212 <1 805 gene locus_tag LOCUS_17830 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262779.1:multidrug efflux MFS transporter 865 1365 gene locus_tag LOCUS_17840 865 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2119 1418 gene locus_tag LOCUS_17850 2119 1418 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_17850 2299 3585 gene locus_tag LOCUS_17860 gene pepT 2299 3585 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_17860 5779 3779 gene locus_tag LOCUS_17870 5779 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence213 1198 3324 gene locus_tag LOCUS_17880 1198 3324 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681429.1 protein_id gnl|my_center|LOCUS_17880 3392 4207 gene locus_tag LOCUS_17890 3392 4207 CDS product E3 ubiquitin ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056507.1 protein_id gnl|my_center|LOCUS_17890 5305 4232 gene locus_tag LOCUS_17900 5305 4232 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence214 <1 504 gene locus_tag LOCUS_17910 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966841.1:ketoacyl-ACP synthase III 518 1888 gene locus_tag LOCUS_17920 gene fabF 518 1888 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_17920 1888 2454 gene locus_tag LOCUS_17930 gene fabZ 1888 2454 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_17930 2451 3713 gene locus_tag LOCUS_17940 2451 3713 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_17940 4117 3710 gene locus_tag LOCUS_17950 4117 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4185 5048 gene locus_tag LOCUS_17960 4185 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 5772 5059 gene locus_tag LOCUS_17970 5772 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence215 842 279 gene locus_tag LOCUS_17980 842 279 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_17980 1272 1793 gene locus_tag LOCUS_17990 1272 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1972 2889 gene locus_tag LOCUS_18000 1972 2889 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_18000 3024 4781 gene locus_tag LOCUS_18010 3024 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5509 4766 gene locus_tag LOCUS_18020 5509 4766 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence216 84 1085 gene locus_tag LOCUS_18030 84 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1156 1920 gene locus_tag LOCUS_18040 1156 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1910 2968 gene locus_tag LOCUS_18050 1910 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2965 5169 gene locus_tag LOCUS_18060 gene topA 2965 5169 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678704.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence217 142 1479 gene locus_tag LOCUS_18070 142 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1549 1671 gene locus_tag LOCUS_18080 1549 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2045 2887 gene locus_tag LOCUS_18090 2045 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2936 4018 gene locus_tag LOCUS_18100 2936 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3999 5012 gene locus_tag LOCUS_18110 gene tsaD 3999 5012 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_18110 5074 6123 gene locus_tag LOCUS_18120 5074 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence218 2451 997 gene locus_tag LOCUS_18130 2451 997 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957021.1 protein_id gnl|my_center|LOCUS_18130 3295 2462 gene locus_tag LOCUS_18140 3295 2462 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_18140 4175 3288 gene locus_tag LOCUS_18150 4175 3288 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_18150 5650 4337 gene locus_tag LOCUS_18160 5650 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence219 395 1390 gene locus_tag LOCUS_18170 395 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence220 <1 579 gene locus_tag LOCUS_18180 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545922.1:MASE3 domain-containing protein 1203 637 gene locus_tag LOCUS_18190 1203 637 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_18190 3110 1209 gene locus_tag LOCUS_18200 gene iorA 3110 1209 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_18200 3251 5098 gene locus_tag LOCUS_18210 3251 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5102 5908 gene locus_tag LOCUS_18220 gene mazG 5102 5908 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680184.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence221 <1 945 gene locus_tag LOCUS_18230 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002674333.1:Do family serine endopeptidase 1101 1715 gene locus_tag LOCUS_18240 1101 1715 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679200.1 protein_id gnl|my_center|LOCUS_18240 1720 5013 gene locus_tag LOCUS_18250 1720 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence222 <1 2224 gene locus_tag LOCUS_18260 <1 2224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091201.1:type I DNA topoisomerase note possible pseudo, internal stop codon 2556 2299 gene locus_tag LOCUS_18270 2556 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4185 2662 gene locus_tag LOCUS_18280 4185 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 <6049 4275 gene locus_tag LOCUS_18290 <6049 4275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152945460.1:efflux RND transporter permease subunit >Feature sequence223 <1 515 gene locus_tag LOCUS_18300 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932758.1:DUF3298 and DUF4163 domain-containing protein 537 944 gene locus_tag LOCUS_18310 537 944 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249062.1 protein_id gnl|my_center|LOCUS_18310 2222 1005 gene locus_tag LOCUS_18320 2222 1005 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_18320 2221 2409 gene locus_tag LOCUS_18330 2221 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5621 2406 gene locus_tag LOCUS_18340 gene ileS 5621 2406 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence224 1748 378 gene locus_tag LOCUS_18350 1748 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2101 2994 gene locus_tag LOCUS_18360 2101 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3005 4183 gene locus_tag LOCUS_18370 3005 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4180 5331 gene locus_tag LOCUS_18380 gene pepQ 4180 5331 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 protein_id gnl|my_center|LOCUS_18380 <6029 5444 gene locus_tag LOCUS_18390 <6029 5444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258604.1:dihydroorotase >Feature sequence225 199 1422 gene locus_tag LOCUS_18400 199 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2413 1772 gene locus_tag LOCUS_18410 2413 1772 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_18410 2742 4112 gene locus_tag LOCUS_18420 2742 4112 CDS product alcohol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930145.1 protein_id gnl|my_center|LOCUS_18420 4204 4650 gene locus_tag LOCUS_18430 gene aroQ 4204 4650 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence226 569 2215 gene locus_tag LOCUS_18440 569 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3096 2281 gene locus_tag LOCUS_18450 3096 2281 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 protein_id gnl|my_center|LOCUS_18450 4749 3109 gene locus_tag LOCUS_18460 4749 3109 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_18460 5869 4862 gene locus_tag LOCUS_18470 5869 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence227 <1 1265 gene locus_tag LOCUS_18480 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682087.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1262 2371 gene locus_tag LOCUS_18490 1262 2371 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680316.1 protein_id gnl|my_center|LOCUS_18490 2576 3778 gene locus_tag LOCUS_18500 gene rocD 2576 3778 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868785.1 protein_id gnl|my_center|LOCUS_18500 4025 4846 gene locus_tag LOCUS_18510 4025 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4833 5645 gene locus_tag LOCUS_18520 4833 5645 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence228 <1 1226 gene locus_tag LOCUS_18530 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680359.1:DNA-directed RNA polymerase subunit beta' 1508 1897 gene locus_tag LOCUS_18540 1508 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2042 2416 gene locus_tag LOCUS_18550 gene rpsL 2042 2416 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_18550 2428 2898 gene locus_tag LOCUS_18560 gene rpsG 2428 2898 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670537.1 protein_id gnl|my_center|LOCUS_18560 3105 3644 gene locus_tag LOCUS_18570 3105 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18570 3660 5249 gene locus_tag LOCUS_18580 3660 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18580 >Feature sequence229 <1 1548 gene locus_tag LOCUS_18590 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706882.1:ABC transporter substrate-binding protein 1889 2869 gene locus_tag LOCUS_18600 1889 2869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_18600 2866 3843 gene locus_tag LOCUS_18610 2866 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18610 3846 4832 gene locus_tag LOCUS_18620 3846 4832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461267.1 protein_id gnl|my_center|LOCUS_18620 4829 5800 gene locus_tag LOCUS_18630 4829 5800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence230 250 2664 gene locus_tag LOCUS_18640 250 2664 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461246.1 protein_id gnl|my_center|LOCUS_18640 2897 4138 gene locus_tag LOCUS_18650 2897 4138 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 protein_id gnl|my_center|LOCUS_18650 4259 5152 gene locus_tag LOCUS_18660 gene folD 4259 5152 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence231 <1 1087 gene locus_tag LOCUS_18670 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933651.1:aminotransferase class V-fold PLP-dependent enzyme 1136 1738 gene locus_tag LOCUS_18680 1136 1738 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_18680 1810 1883 gene locus_tag LOCUS_t00220 1810 1883 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2841 2218 gene locus_tag LOCUS_18690 gene cobC 2841 2218 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812873.1 protein_id gnl|my_center|LOCUS_18690 3003 4415 gene locus_tag LOCUS_18700 gene trkA 3003 4415 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence232 459 2093 gene locus_tag LOCUS_18710 459 2093 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669145.1 protein_id gnl|my_center|LOCUS_18710 2301 3410 gene locus_tag LOCUS_18720 2301 3410 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725771.1 protein_id gnl|my_center|LOCUS_18720 3528 5084 gene locus_tag LOCUS_18730 3528 5084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence233 45 1355 gene locus_tag LOCUS_18740 45 1355 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530310.1 protein_id gnl|my_center|LOCUS_18740 1535 2443 gene locus_tag LOCUS_18750 1535 2443 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_18750 2449 3312 gene locus_tag LOCUS_18760 2449 3312 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_18760 3320 4675 gene locus_tag LOCUS_18770 3320 4675 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence234 2980 374 gene locus_tag LOCUS_18780 2980 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5322 3007 gene locus_tag LOCUS_18790 5322 3007 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957228.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence235 991 1836 gene locus_tag LOCUS_18800 gene zupT 991 1836 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_18800 2799 1849 gene locus_tag LOCUS_18810 2799 1849 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_18810 2999 3448 gene locus_tag LOCUS_18820 2999 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 3764 3477 gene locus_tag LOCUS_18830 3764 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence236 129 881 gene locus_tag LOCUS_18840 129 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_18840 878 1918 gene locus_tag LOCUS_18850 878 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1958 2680 gene locus_tag LOCUS_18860 1958 2680 CDS product CTP--phosphocholine cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860673.1 protein_id gnl|my_center|LOCUS_18860 2761 3072 gene locus_tag LOCUS_18870 2761 3072 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087690.1 protein_id gnl|my_center|LOCUS_18870 3184 4599 gene locus_tag LOCUS_18880 3184 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4647 5363 gene locus_tag LOCUS_18890 4647 5363 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666040.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence237 930 1517 gene locus_tag LOCUS_18900 930 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667574.1 protein_id gnl|my_center|LOCUS_18900 2452 1514 gene locus_tag LOCUS_18910 2452 1514 CDS product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937897.1 protein_id gnl|my_center|LOCUS_18910 2594 4174 gene locus_tag LOCUS_18920 gene hutH 2594 4174 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence238 940 1488 gene locus_tag LOCUS_18930 940 1488 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406868.1 protein_id gnl|my_center|LOCUS_18930 1511 1879 gene locus_tag LOCUS_18940 1511 1879 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015709088.1 protein_id gnl|my_center|LOCUS_18940 1851 2456 gene locus_tag LOCUS_18950 1851 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2449 3141 gene locus_tag LOCUS_18960 2449 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 3138 5258 gene locus_tag LOCUS_18970 3138 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence239 2779 2003 gene locus_tag LOCUS_18980 2779 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3070 3933 gene locus_tag LOCUS_18990 3070 3933 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 protein_id gnl|my_center|LOCUS_18990 4993 4058 gene locus_tag LOCUS_19000 4993 4058 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964643.1 protein_id gnl|my_center|LOCUS_19000 5627 5256 gene locus_tag LOCUS_19010 5627 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence240 789 1664 gene locus_tag LOCUS_19020 789 1664 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_19020 2955 1669 gene locus_tag LOCUS_19030 2955 1669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_19030 3113 4291 gene locus_tag LOCUS_19040 3113 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 <5603 4359 gene locus_tag LOCUS_19050 <5603 4359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680048.1:FAD-dependent oxidoreductase >Feature sequence241 <1 797 gene locus_tag LOCUS_19060 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002673498.1:transcription elongation factor GreA 812 2908 gene locus_tag LOCUS_19070 812 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4539 3136 gene locus_tag LOCUS_19080 4539 3136 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681511.1 protein_id gnl|my_center|LOCUS_19080 5078 4536 gene locus_tag LOCUS_19090 5078 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 <5594 5080 gene locus_tag LOCUS_19100 <5594 5080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681512.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence242 1605 1045 gene locus_tag LOCUS_19110 1605 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1658 2791 gene locus_tag LOCUS_19120 1658 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668143.1 protein_id gnl|my_center|LOCUS_19120 2788 4260 gene locus_tag LOCUS_19130 2788 4260 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679986.1 protein_id gnl|my_center|LOCUS_19130 4265 5137 gene locus_tag LOCUS_19140 4265 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence243 1477 545 gene locus_tag LOCUS_19150 1477 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1918 2607 gene locus_tag LOCUS_19160 1918 2607 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070247.1 protein_id gnl|my_center|LOCUS_19160 2626 4749 gene locus_tag LOCUS_19170 2626 4749 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273518.1 protein_id gnl|my_center|LOCUS_19170 4830 5417 gene locus_tag LOCUS_19180 4830 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence244 1623 304 gene locus_tag LOCUS_19190 1623 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2650 1736 gene locus_tag LOCUS_19200 2650 1736 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_19200 3465 2911 gene locus_tag LOCUS_19210 3465 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 4399 3500 gene locus_tag LOCUS_19220 4399 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 5073 4444 gene locus_tag LOCUS_19230 5073 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence245 451 1602 gene locus_tag LOCUS_19240 451 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2671 1670 gene locus_tag LOCUS_19250 2671 1670 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079950.1 protein_id gnl|my_center|LOCUS_19250 4437 2713 gene locus_tag LOCUS_19260 4437 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4560 4790 gene locus_tag LOCUS_19270 4560 4790 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence246 2802 1081 gene locus_tag LOCUS_19280 2802 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 3896 2799 gene locus_tag LOCUS_19290 3896 2799 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938013.1 protein_id gnl|my_center|LOCUS_19290 4027 4290 gene locus_tag LOCUS_19300 4027 4290 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813217.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence247 475 1278 gene locus_tag LOCUS_19310 475 1278 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_19310 1288 1443 gene locus_tag LOCUS_19320 1288 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1446 2168 gene locus_tag LOCUS_19330 1446 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 5075 2394 gene locus_tag LOCUS_19340 5075 2394 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence248 64 1119 gene locus_tag LOCUS_19350 64 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682102.1 protein_id gnl|my_center|LOCUS_19350 1150 3795 gene locus_tag LOCUS_19360 1150 3795 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682103.1 protein_id gnl|my_center|LOCUS_19360 4554 3994 gene locus_tag LOCUS_19370 4554 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669773.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence249 840 235 gene locus_tag LOCUS_19380 840 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1853 837 gene locus_tag LOCUS_19390 1853 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2195 1875 gene locus_tag LOCUS_19400 2195 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2760 2215 gene locus_tag LOCUS_19410 gene ssb 2760 2215 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_19410 3073 2792 gene locus_tag LOCUS_19420 gene rpsF 3073 2792 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669351.1 protein_id gnl|my_center|LOCUS_19420 3295 3735 gene locus_tag LOCUS_19430 3295 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4550 3789 gene locus_tag LOCUS_19440 4550 3789 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence250 326 2563 gene locus_tag LOCUS_19450 326 2563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681930.1 protein_id gnl|my_center|LOCUS_19450 2621 3262 gene locus_tag LOCUS_19460 2621 3262 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869002.1 protein_id gnl|my_center|LOCUS_19460 4455 3259 gene locus_tag LOCUS_19470 4455 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 5496 4597 gene locus_tag LOCUS_19480 5496 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence251 1410 379 gene locus_tag LOCUS_19490 1410 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2367 1549 gene locus_tag LOCUS_19500 2367 1549 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679454.1 protein_id gnl|my_center|LOCUS_19500 2784 2371 gene locus_tag LOCUS_19510 2784 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3308 2826 gene locus_tag LOCUS_19520 3308 2826 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_19520 3937 3305 gene locus_tag LOCUS_19530 3937 3305 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869276.1 protein_id gnl|my_center|LOCUS_19530 <5475 3940 gene locus_tag LOCUS_19540 <5475 3940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147353.1:ATP synthase subunit B >Feature sequence252 1029 4 gene locus_tag LOCUS_19550 1029 4 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_19550 1199 1708 gene locus_tag LOCUS_19560 1199 1708 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_19560 1750 2514 gene locus_tag LOCUS_19570 1750 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2709 4721 gene locus_tag LOCUS_19580 2709 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 4725 5189 gene locus_tag LOCUS_19590 4725 5189 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_19590 5186 5443 gene locus_tag LOCUS_19600 5186 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence253 <1 734 gene locus_tag LOCUS_19610 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:PAS domain S-box protein 1812 736 gene locus_tag LOCUS_19620 1812 736 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_19620 2707 1892 gene locus_tag LOCUS_19630 2707 1892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_19630 3612 2704 gene locus_tag LOCUS_19640 3612 2704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_19640 4838 3609 gene locus_tag LOCUS_19650 4838 3609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence254 1158 334 gene locus_tag LOCUS_19660 1158 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1279 1566 gene locus_tag LOCUS_19670 1279 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1825 2238 gene locus_tag LOCUS_19680 1825 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2472 3140 gene locus_tag LOCUS_19690 2472 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3240 4430 gene locus_tag LOCUS_19700 3240 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4506 4670 gene locus_tag LOCUS_19710 4506 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4687 4923 gene locus_tag LOCUS_19720 4687 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence255 1281 457 gene locus_tag LOCUS_19730 1281 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1463 2041 gene locus_tag LOCUS_19740 1463 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2631 2092 gene locus_tag LOCUS_19750 2631 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3538 2813 gene locus_tag LOCUS_19760 3538 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence256 537 866 gene locus_tag LOCUS_19770 537 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 881 3037 gene locus_tag LOCUS_19780 881 3037 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_19780 3034 3912 gene locus_tag LOCUS_19790 3034 3912 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_19790 3935 5080 gene locus_tag LOCUS_19800 3935 5080 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938887.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence257 845 111 gene locus_tag LOCUS_19810 845 111 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_19810 1061 2851 gene locus_tag LOCUS_19820 1061 2851 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727588.1 protein_id gnl|my_center|LOCUS_19820 2997 4382 gene locus_tag LOCUS_19830 gene arcD 2997 4382 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192541.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence258 1059 148 gene locus_tag LOCUS_19840 1059 148 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_19840 2256 1129 gene locus_tag LOCUS_19850 2256 1129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_19850 2619 3338 gene locus_tag LOCUS_19860 2619 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4580 3474 gene locus_tag LOCUS_19870 4580 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence259 3 269 gene locus_tag LOCUS_19880 3 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 326 1216 gene locus_tag LOCUS_19890 326 1216 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396180.1 protein_id gnl|my_center|LOCUS_19890 1209 2063 gene locus_tag LOCUS_19900 1209 2063 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396183.1 protein_id gnl|my_center|LOCUS_19900 2060 3055 gene locus_tag LOCUS_19910 2060 3055 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225279.1 protein_id gnl|my_center|LOCUS_19910 3848 3105 gene locus_tag LOCUS_19920 3848 3105 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_19920 4530 3835 gene locus_tag LOCUS_19930 4530 3835 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_19930 5356 4544 gene locus_tag LOCUS_19940 5356 4544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence260 128 844 gene locus_tag LOCUS_19950 128 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2790 1051 gene locus_tag LOCUS_19960 2790 1051 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272522.1 protein_id gnl|my_center|LOCUS_19960 2960 3559 gene locus_tag LOCUS_19970 2960 3559 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495993.1 protein_id gnl|my_center|LOCUS_19970 3778 4527 gene locus_tag LOCUS_19980 gene tpiA 3778 4527 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678731.1 protein_id gnl|my_center|LOCUS_19980 4853 5248 gene locus_tag LOCUS_19990 4853 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence261 461 757 gene locus_tag LOCUS_20000 461 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 748 1872 gene locus_tag LOCUS_20010 748 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_20010 3091 1988 gene locus_tag LOCUS_20020 3091 1988 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679131.1 protein_id gnl|my_center|LOCUS_20020 3819 3118 gene locus_tag LOCUS_20030 3819 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 4205 3816 gene locus_tag LOCUS_20040 gene tsaE 4205 3816 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_20040 4513 4253 gene locus_tag LOCUS_20050 4513 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence262 1865 3301 gene locus_tag LOCUS_20060 1865 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3294 4340 gene locus_tag LOCUS_20070 3294 4340 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680886.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence263 681 2558 gene locus_tag LOCUS_20080 681 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2705 3448 gene locus_tag LOCUS_20090 2705 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 5004 3670 gene locus_tag LOCUS_20100 5004 3670 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence264 1970 423 gene locus_tag LOCUS_20110 1970 423 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_20110 2366 2067 gene locus_tag LOCUS_20120 2366 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2456 3298 gene locus_tag LOCUS_20130 gene speE 2456 3298 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_20130 5216 3393 gene locus_tag LOCUS_20140 5216 3393 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence265 1 73 gene locus_tag LOCUS_t00230 1 73 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 443 1489 gene locus_tag LOCUS_20150 443 1489 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_20150 3337 1535 gene locus_tag LOCUS_20160 3337 1535 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876107.1 protein_id gnl|my_center|LOCUS_20160 3531 5177 gene locus_tag LOCUS_20170 3531 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence266 2632 1154 gene locus_tag LOCUS_20180 gene glgA 2632 1154 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_20180 2811 3932 gene locus_tag LOCUS_20190 2811 3932 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_20190 <5239 3964 gene locus_tag LOCUS_20200 <5239 3964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193365330.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence267 865 635 gene locus_tag LOCUS_20210 gene xseB 865 635 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674672.1 protein_id gnl|my_center|LOCUS_20210 2106 862 gene locus_tag LOCUS_20220 gene xseA 2106 862 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_20220 3463 2171 gene locus_tag LOCUS_20230 3463 2171 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255992.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence268 373 741 gene locus_tag LOCUS_20240 gene rpsM 373 741 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670034.1 protein_id gnl|my_center|LOCUS_20240 757 1137 gene locus_tag LOCUS_20250 gene rpsK 757 1137 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670039.1 protein_id gnl|my_center|LOCUS_20250 1159 1794 gene locus_tag LOCUS_20260 gene rpsD 1159 1794 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_20260 1804 2859 gene locus_tag LOCUS_20270 1804 2859 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682041.1 protein_id gnl|my_center|LOCUS_20270 2849 3280 gene locus_tag LOCUS_20280 2849 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3302 3472 gene locus_tag LOCUS_20290 3302 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672198.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence269 74 1408 gene locus_tag LOCUS_20300 gene hflX 74 1408 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_20300 3085 1517 gene locus_tag LOCUS_20310 3085 1517 CDS product DUF5312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680918.1 protein_id gnl|my_center|LOCUS_20310 3899 3090 gene locus_tag LOCUS_20320 3899 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence270 334 522 gene locus_tag LOCUS_20330 334 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 600 1970 gene locus_tag LOCUS_20340 600 1970 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438661.1 protein_id gnl|my_center|LOCUS_20340 2196 4436 gene locus_tag LOCUS_20350 2196 4436 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681835.1 protein_id gnl|my_center|LOCUS_20350 <5173 4525 gene locus_tag LOCUS_20360 <5173 4525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941950.1:transporter substrate-binding domain-containing protein >Feature sequence271 2835 70 gene locus_tag LOCUS_20370 gene secA 2835 70 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_20370 3047 2832 gene locus_tag LOCUS_20380 3047 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2938 4206 gene locus_tag LOCUS_20390 2938 4206 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682130.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence272 1053 2855 gene locus_tag LOCUS_20400 1053 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3906 2890 gene locus_tag LOCUS_20410 3906 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 <5119 4104 gene locus_tag LOCUS_20420 <5119 4104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000869002.1:cyclic nucleotide-binding domain-containing protein >Feature sequence273 <1 685 gene locus_tag LOCUS_20430 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943338.1:substrate-binding domain-containing protein 695 1369 gene locus_tag LOCUS_20440 695 1369 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_20440 1366 2091 gene locus_tag LOCUS_20450 1366 2091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943340.1 protein_id gnl|my_center|LOCUS_20450 2093 3319 gene locus_tag LOCUS_20460 2093 3319 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_20460 3297 4094 gene locus_tag LOCUS_20470 gene moaA 3297 4094 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_20470 4097 4555 gene locus_tag LOCUS_20480 gene moaC 4097 4555 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_20480 4552 5064 gene locus_tag LOCUS_20490 4552 5064 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545911.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence274 1146 1664 gene locus_tag LOCUS_20500 1146 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1661 3553 gene locus_tag LOCUS_20510 1661 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 <5072 3726 gene locus_tag LOCUS_20520 <5072 3726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940714.1:CapA family protein >Feature sequence275 1501 347 gene locus_tag LOCUS_20530 1501 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1755 3689 gene locus_tag LOCUS_20540 gene ligA 1755 3689 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679195.1 protein_id gnl|my_center|LOCUS_20540 3686 4435 gene locus_tag LOCUS_20550 3686 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence276 17 889 gene locus_tag LOCUS_20560 17 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2531 915 gene locus_tag LOCUS_20570 2531 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 4109 2817 gene locus_tag LOCUS_20580 4109 2817 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence277 203 1114 gene locus_tag LOCUS_20590 203 1114 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351059.1 protein_id gnl|my_center|LOCUS_20590 2540 1254 gene locus_tag LOCUS_20600 2540 1254 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841575.1 protein_id gnl|my_center|LOCUS_20600 2687 3118 gene locus_tag LOCUS_20610 2687 3118 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655500.1 protein_id gnl|my_center|LOCUS_20610 4915 3113 gene locus_tag LOCUS_20620 4915 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence278 195 938 gene locus_tag LOCUS_20630 gene atpB 195 938 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_20630 947 1171 gene locus_tag LOCUS_20640 947 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1221 1712 gene locus_tag LOCUS_20650 1221 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1702 2349 gene locus_tag LOCUS_20660 1702 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2361 3872 gene locus_tag LOCUS_20670 gene atpA 2361 3872 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_20670 3875 4747 gene locus_tag LOCUS_20680 gene atpG 3875 4747 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence279 1643 738 gene locus_tag LOCUS_20690 1643 738 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678797.1 protein_id gnl|my_center|LOCUS_20690 3595 1796 gene locus_tag LOCUS_20700 3595 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4532 3696 gene locus_tag LOCUS_20710 4532 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence280 1571 372 gene locus_tag LOCUS_20720 1571 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678862.1 protein_id gnl|my_center|LOCUS_20720 2629 1583 gene locus_tag LOCUS_20730 2629 1583 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678853.1 protein_id gnl|my_center|LOCUS_20730 2718 3545 gene locus_tag LOCUS_20740 2718 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3624 3989 gene locus_tag LOCUS_20750 3624 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3991 4731 gene locus_tag LOCUS_20760 3991 4731 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667426.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence281 479 57 gene locus_tag LOCUS_20770 479 57 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 protein_id gnl|my_center|LOCUS_20770 1824 472 gene locus_tag LOCUS_20780 1824 472 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680998.1 protein_id gnl|my_center|LOCUS_20780 3566 1821 gene locus_tag LOCUS_20790 3566 1821 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_20790 4327 3563 gene locus_tag LOCUS_20800 4327 3563 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_20800 4521 4910 gene locus_tag LOCUS_20810 gene ssb 4521 4910 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence282 833 126 gene locus_tag LOCUS_20820 gene deoD 833 126 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681557.1 protein_id gnl|my_center|LOCUS_20820 2006 1050 gene locus_tag LOCUS_20830 2006 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2287 4185 gene locus_tag LOCUS_20840 2287 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4778 4182 gene locus_tag LOCUS_20850 4778 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence283 <1 1479 gene locus_tag LOCUS_20860 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868698.1:glyceraldehyde-3-phosphate:ferredoxin oxidoreductase 1547 2284 gene locus_tag LOCUS_20870 1547 2284 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_20870 2443 2916 gene locus_tag LOCUS_20880 2443 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2944 3327 gene locus_tag LOCUS_20890 2944 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3350 3883 gene locus_tag LOCUS_20900 3350 3883 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence284 <1 2306 gene locus_tag LOCUS_20910 <1 2306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha 2470 2291 gene locus_tag LOCUS_20920 2470 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2718 2647 gene locus_tag LOCUS_t00240 2718 2647 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3056 2871 gene locus_tag LOCUS_20930 3056 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3282 4031 gene locus_tag LOCUS_20940 3282 4031 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938152.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence285 1879 890 gene locus_tag LOCUS_20950 1879 890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_20950 3063 1876 gene locus_tag LOCUS_20960 3063 1876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_20960 4474 3056 gene locus_tag LOCUS_20970 4474 3056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence286 235 615 gene locus_tag LOCUS_20980 235 615 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_20980 901 1587 gene locus_tag LOCUS_20990 gene rsmG 901 1587 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957250.1 protein_id gnl|my_center|LOCUS_20990 1684 1914 gene locus_tag LOCUS_21000 1684 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2379 1996 gene locus_tag LOCUS_21010 2379 1996 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_21010 3978 2599 gene locus_tag LOCUS_21020 3978 2599 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667136.1 protein_id gnl|my_center|LOCUS_21020 4529 4011 gene locus_tag LOCUS_21030 4529 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence287 <1 700 gene locus_tag LOCUS_21040 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678983.1:FapA family protein 725 1753 gene locus_tag LOCUS_21050 gene lgt 725 1753 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013967724.1 protein_id gnl|my_center|LOCUS_21050 1837 2601 gene locus_tag LOCUS_21060 1837 2601 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 protein_id gnl|my_center|LOCUS_21060 2617 3147 gene locus_tag LOCUS_21070 2617 3147 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366443.1 protein_id gnl|my_center|LOCUS_21070 4290 3190 gene locus_tag LOCUS_21080 4290 3190 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence288 814 3327 gene locus_tag LOCUS_21090 gene clpC 814 3327 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_21090 3981 3391 gene locus_tag LOCUS_21100 3981 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 <4840 4025 gene locus_tag LOCUS_21110 <4840 4025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679249.1:NFACT family protein >Feature sequence289 <1 911 gene locus_tag LOCUS_21120 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015951.1:DEAD/DEAH box helicase 1509 985 gene locus_tag LOCUS_21130 1509 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1745 3424 gene locus_tag LOCUS_21140 1745 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3490 4152 gene locus_tag LOCUS_21150 3490 4152 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053690.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence290 1270 338 gene locus_tag LOCUS_21160 1270 338 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681114.1 protein_id gnl|my_center|LOCUS_21160 2134 1358 gene locus_tag LOCUS_21170 2134 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2264 3442 gene locus_tag LOCUS_21180 2264 3442 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022687.1 protein_id gnl|my_center|LOCUS_21180 4352 3591 gene locus_tag LOCUS_21190 4352 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence291 237 1187 gene locus_tag LOCUS_21200 237 1187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534167.1 protein_id gnl|my_center|LOCUS_21200 1190 2122 gene locus_tag LOCUS_21210 1190 2122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103704.1 protein_id gnl|my_center|LOCUS_21210 2119 3213 gene locus_tag LOCUS_21220 2119 3213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902455.1 protein_id gnl|my_center|LOCUS_21220 3210 4133 gene locus_tag LOCUS_21230 3210 4133 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291304.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence292 3291 2026 gene locus_tag LOCUS_21240 3291 2026 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667421.1 protein_id gnl|my_center|LOCUS_21240 4620 3295 gene locus_tag LOCUS_21250 4620 3295 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence293 765 1442 gene locus_tag LOCUS_21260 765 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21260 1617 1973 gene locus_tag LOCUS_21270 1617 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21270 2080 3699 gene locus_tag LOCUS_21280 2080 3699 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_21280 3701 4744 gene locus_tag LOCUS_21290 3701 4744 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence294 1912 491 gene locus_tag LOCUS_21300 1912 491 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_21300 2641 2114 gene locus_tag LOCUS_21310 2641 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4020 2890 gene locus_tag LOCUS_21320 4020 2890 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657215.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence295 <1 990 gene locus_tag LOCUS_21330 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808433.1:DUF362 domain-containing protein 1002 2663 gene locus_tag LOCUS_21340 1002 2663 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894366.1 protein_id gnl|my_center|LOCUS_21340 3939 2731 gene locus_tag LOCUS_21350 3939 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4632 4006 gene locus_tag LOCUS_21360 4632 4006 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence296 1403 822 gene locus_tag LOCUS_21370 1403 822 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_21370 1651 2001 gene locus_tag LOCUS_21380 1651 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2013 2549 gene locus_tag LOCUS_21390 2013 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3246 2656 gene locus_tag LOCUS_21400 3246 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3923 3258 gene locus_tag LOCUS_21410 3923 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4042 4554 gene locus_tag LOCUS_21420 4042 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence297 1429 443 gene locus_tag LOCUS_21430 1429 443 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582482.1 protein_id gnl|my_center|LOCUS_21430 1604 2854 gene locus_tag LOCUS_21440 1604 2854 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence298 1564 899 gene locus_tag LOCUS_21450 1564 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1756 2928 gene locus_tag LOCUS_21460 1756 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3083 3634 gene locus_tag LOCUS_21470 3083 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3631 4539 gene locus_tag LOCUS_21480 3631 4539 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence299 58 672 gene locus_tag LOCUS_21490 58 672 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_21490 1848 691 gene locus_tag LOCUS_21500 gene aar 1848 691 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_21500 3289 2159 gene locus_tag LOCUS_21510 gene dnaJ 3289 2159 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_21510 <4597 3428 gene locus_tag LOCUS_21520 <4597 3428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681815.1:molecular chaperone DnaK >Feature sequence300 427 1296 gene locus_tag LOCUS_21530 427 1296 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_21530 1309 1845 gene locus_tag LOCUS_21540 1309 1845 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_21540 2137 2961 gene locus_tag LOCUS_21550 2137 2961 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_21550 2974 4035 gene locus_tag LOCUS_21560 2974 4035 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085990.1 protein_id gnl|my_center|LOCUS_21560 4501 4067 gene locus_tag LOCUS_21570 4501 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence301 <1 771 gene locus_tag LOCUS_21580 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224030.1:GntR family transcriptional regulator 802 2301 gene locus_tag LOCUS_21590 gene xdhA 802 2301 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence302 141 1286 gene locus_tag LOCUS_21600 141 1286 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_21600 1379 2407 gene locus_tag LOCUS_21610 1379 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_21610 3425 2526 gene locus_tag LOCUS_21620 3425 2526 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080516.1 protein_id gnl|my_center|LOCUS_21620 <4572 3434 gene locus_tag LOCUS_21630 <4572 3434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681807.1:MATE family efflux transporter >Feature sequence303 18 124 gene locus_tag LOCUS_r00010 18 124 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 365 844 gene locus_tag LOCUS_21640 365 844 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669135.1 protein_id gnl|my_center|LOCUS_21640 858 1892 gene locus_tag LOCUS_21650 858 1892 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679269.1 protein_id gnl|my_center|LOCUS_21650 1902 2753 gene locus_tag LOCUS_21660 1902 2753 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_21660 2746 4449 gene locus_tag LOCUS_21670 gene recN 2746 4449 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence304 <1 1267 gene locus_tag LOCUS_21680 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528130.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme 1270 2163 gene locus_tag LOCUS_21690 1270 2163 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_21690 2160 3167 gene locus_tag LOCUS_21700 2160 3167 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_21700 3170 3976 gene locus_tag LOCUS_21710 3170 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3986 4516 gene locus_tag LOCUS_21720 3986 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence305 930 133 gene locus_tag LOCUS_21730 930 133 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_21730 1023 2966 gene locus_tag LOCUS_21740 1023 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3792 2971 gene locus_tag LOCUS_21750 3792 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence306 <1 1195 gene locus_tag LOCUS_21760 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804146.1:alpha-glucosidase/alpha-galactosidase <4540 1305 gene locus_tag LOCUS_21770 <4540 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532020.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence307 499 1476 gene locus_tag LOCUS_21780 499 1476 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678909.1 protein_id gnl|my_center|LOCUS_21780 1500 2543 gene locus_tag LOCUS_21790 1500 2543 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668696.1 protein_id gnl|my_center|LOCUS_21790 2550 3458 gene locus_tag LOCUS_21800 gene mreC 2550 3458 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668697.1 protein_id gnl|my_center|LOCUS_21800 3455 3961 gene locus_tag LOCUS_21810 3455 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence308 100 1374 gene locus_tag LOCUS_21820 100 1374 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_21820 1712 2461 gene locus_tag LOCUS_21830 1712 2461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669611.1 protein_id gnl|my_center|LOCUS_21830 2463 3965 gene locus_tag LOCUS_21840 2463 3965 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679548.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence309 497 1285 gene locus_tag LOCUS_21850 497 1285 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668794.1 protein_id gnl|my_center|LOCUS_21850 1298 2089 gene locus_tag LOCUS_21860 1298 2089 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668795.1 protein_id gnl|my_center|LOCUS_21860 2143 3330 gene locus_tag LOCUS_21870 2143 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3430 3960 gene locus_tag LOCUS_21880 3430 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 <4503 3950 gene locus_tag LOCUS_21890 <4503 3950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091117.1:TatD family hydrolase >Feature sequence310 93 452 gene locus_tag LOCUS_21900 gene rplT 93 452 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192938.1 protein_id gnl|my_center|LOCUS_21900 460 1083 gene locus_tag LOCUS_21910 460 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1099 1473 gene locus_tag LOCUS_21920 1099 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1608 1799 gene locus_tag LOCUS_21930 1608 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1921 2781 gene locus_tag LOCUS_21940 gene miaA 1921 2781 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_21940 3653 2844 gene locus_tag LOCUS_21950 3653 2844 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455196.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence311 <1 2181 gene locus_tag LOCUS_21960 <1 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680753.1:Ig-like domain-containing protein 3214 2300 gene locus_tag LOCUS_21970 3214 2300 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_21970 4392 3211 gene locus_tag LOCUS_21980 4392 3211 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence312 2885 1452 gene locus_tag LOCUS_21990 2885 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679545.1 protein_id gnl|my_center|LOCUS_21990 3660 2899 gene locus_tag LOCUS_22000 3660 2899 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679546.1 protein_id gnl|my_center|LOCUS_22000 <4469 3684 gene locus_tag LOCUS_22010 <4469 3684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669609.1:FtsX-like permease family protein >Feature sequence313 1793 813 gene locus_tag LOCUS_22020 1793 813 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_22020 2479 1790 gene locus_tag LOCUS_22030 2479 1790 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870180.1 protein_id gnl|my_center|LOCUS_22030 4204 2576 gene locus_tag LOCUS_22040 gene hcp 4204 2576 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence314 281 1501 gene locus_tag LOCUS_22050 281 1501 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670666.1 protein_id gnl|my_center|LOCUS_22050 1561 2007 gene locus_tag LOCUS_22060 1561 2007 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_22060 2435 2169 gene locus_tag LOCUS_22070 2435 2169 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_22070 4355 2514 gene locus_tag LOCUS_22080 4355 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence315 1256 528 gene locus_tag LOCUS_22090 1256 528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_22090 2032 1250 gene locus_tag LOCUS_22100 2032 1250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583300.1 protein_id gnl|my_center|LOCUS_22100 3000 2029 gene locus_tag LOCUS_22110 3000 2029 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_22110 3888 3010 gene locus_tag LOCUS_22120 3888 3010 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869438.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence316 718 1623 gene locus_tag LOCUS_22130 718 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1635 2810 gene locus_tag LOCUS_22140 1635 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2807 3889 gene locus_tag LOCUS_22150 2807 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence317 <1 1061 gene locus_tag LOCUS_22160 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939633.1:FAD/NAD-binding family oxidoreductase 1077 1589 gene locus_tag LOCUS_22170 gene ybaK 1077 1589 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868926.1 protein_id gnl|my_center|LOCUS_22170 2932 1586 gene locus_tag LOCUS_22180 gene lpdA 2932 1586 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence318 62 2356 gene locus_tag LOCUS_22190 62 2356 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_22190 3603 2308 gene locus_tag LOCUS_22200 3603 2308 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_22200 <4373 3597 gene locus_tag LOCUS_22210 <4373 3597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027122.1:HAD family hydrolase >Feature sequence319 586 1698 gene locus_tag LOCUS_22220 586 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3701 1695 gene locus_tag LOCUS_22230 3701 1695 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480694.1 protein_id gnl|my_center|LOCUS_22230 <4373 3753 gene locus_tag LOCUS_22240 <4373 3753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001097653.1:PAS domain S-box protein >Feature sequence320 494 6 gene locus_tag LOCUS_22250 gene rpiB 494 6 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 protein_id gnl|my_center|LOCUS_22250 1441 509 gene locus_tag LOCUS_22260 1441 509 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_22260 2306 1461 gene locus_tag LOCUS_22270 2306 1461 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098118.1 protein_id gnl|my_center|LOCUS_22270 3711 2395 gene locus_tag LOCUS_22280 3711 2395 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_22280 <4353 3794 gene locus_tag LOCUS_22290 <4353 3794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942346.1:ROK family protein >Feature sequence321 1799 207 gene locus_tag LOCUS_22300 1799 207 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_22300 2512 1808 gene locus_tag LOCUS_22310 2512 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4121 2595 gene locus_tag LOCUS_22320 4121 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence322 <1 865 gene locus_tag LOCUS_22330 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791443.1:phosphoribosylaminoimidazolecarboxamide formyltransferase 1013 1426 gene locus_tag LOCUS_22340 1013 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1495 2841 gene locus_tag LOCUS_22350 gene miaB 1495 2841 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_22350 2838 4214 gene locus_tag LOCUS_22360 2838 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence323 531 124 gene locus_tag LOCUS_22370 531 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1322 732 gene locus_tag LOCUS_22380 1322 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1407 3647 gene locus_tag LOCUS_22390 1407 3647 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_22390 <4305 3693 gene locus_tag LOCUS_22400 <4305 3693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681058.1:pyroglutamyl-peptidase I >Feature sequence324 1671 790 gene locus_tag LOCUS_22410 gene ftsY 1671 790 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_22410 3259 1685 gene locus_tag LOCUS_22420 3259 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 <4299 3263 gene locus_tag LOCUS_22430 <4299 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014540570.1:peptide chain release factor 2 >Feature sequence325 987 157 gene locus_tag LOCUS_22440 987 157 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_22440 3296 1212 gene locus_tag LOCUS_22450 3296 1212 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680923.1 protein_id gnl|my_center|LOCUS_22450 <4298 3539 gene locus_tag LOCUS_22460 <4298 3539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018647871.1:nucleotidyl transferase AbiEii/AbiGii toxin family protein >Feature sequence326 666 2168 gene locus_tag LOCUS_22470 666 2168 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_22470 2168 3370 gene locus_tag LOCUS_22480 2168 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence327 1083 754 gene locus_tag LOCUS_22490 1083 754 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704688.1 protein_id gnl|my_center|LOCUS_22490 1869 1243 gene locus_tag LOCUS_22500 1869 1243 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_22500 3526 1871 gene locus_tag LOCUS_22510 3526 1871 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_22510 <4292 3608 gene locus_tag LOCUS_22520 <4292 3608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001201677.1:alpha-galactosidase >Feature sequence328 241 777 gene locus_tag LOCUS_22530 241 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 807 1718 gene locus_tag LOCUS_22540 807 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2064 1976 gene locus_tag LOCUS_t00250 2064 1976 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2517 3827 gene locus_tag LOCUS_22550 2517 3827 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680036.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence329 1013 150 gene locus_tag LOCUS_22560 1013 150 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_22560 2788 1064 gene locus_tag LOCUS_22570 gene rpoD 2788 1064 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678907.1 protein_id gnl|my_center|LOCUS_22570 <4273 2775 gene locus_tag LOCUS_22580 <4273 2775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678905.1:DNA primase >Feature sequence330 1152 34 gene locus_tag LOCUS_22590 1152 34 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_22590 2429 1251 gene locus_tag LOCUS_22600 2429 1251 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679888.1 protein_id gnl|my_center|LOCUS_22600 <4271 2422 gene locus_tag LOCUS_22610 <4271 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679753.1:M3 family oligoendopeptidase >Feature sequence331 873 337 gene locus_tag LOCUS_22620 873 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1787 870 gene locus_tag LOCUS_22630 1787 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2691 1873 gene locus_tag LOCUS_22640 gene nagB 2691 1873 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556751.1 protein_id gnl|my_center|LOCUS_22640 3875 2706 gene locus_tag LOCUS_22650 gene nagA 3875 2706 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889694.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence332 3288 70 gene locus_tag LOCUS_22660 3288 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22660 4244 3369 gene locus_tag LOCUS_22670 4244 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence333 1237 1812 gene locus_tag LOCUS_22680 gene pth 1237 1812 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_22680 2226 1909 gene locus_tag LOCUS_22690 2226 1909 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_22690 2825 2277 gene locus_tag LOCUS_22700 2825 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3493 2939 gene locus_tag LOCUS_22710 3493 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3776 3561 gene locus_tag LOCUS_22720 3776 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence334 1520 627 gene locus_tag LOCUS_22730 1520 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2416 1517 gene locus_tag LOCUS_22740 2416 1517 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_22740 3405 2428 gene locus_tag LOCUS_22750 3405 2428 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666315.1 protein_id gnl|my_center|LOCUS_22750 3675 4046 gene locus_tag LOCUS_22760 3675 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence335 2546 2070 gene locus_tag LOCUS_22770 gene nrdR 2546 2070 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_22770 3693 2776 gene locus_tag LOCUS_22780 3693 2776 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869449.1 protein_id gnl|my_center|LOCUS_22780 3800 4150 gene locus_tag LOCUS_22790 3800 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence336 <1 1166 gene locus_tag LOCUS_22800 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141145.1:glycerol acyltransferase 1159 2571 gene locus_tag LOCUS_22810 1159 2571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_22810 2616 3578 gene locus_tag LOCUS_22820 2616 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 <4216 3666 gene locus_tag LOCUS_22830 <4216 3666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945991.1:diguanylate cyclase >Feature sequence337 1235 2722 gene locus_tag LOCUS_22840 gene mnmE 1235 2722 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence338 <1 730 gene locus_tag LOCUS_22850 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044971578.1:ATP-dependent RNA helicase 941 2518 gene locus_tag LOCUS_22860 gene lysS 941 2518 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence339 <1 1938 gene locus_tag LOCUS_22870 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001049207.1:ABC-F family ATP-binding cassette domain-containing protein 1958 2989 gene locus_tag LOCUS_22880 1958 2989 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_22880 3677 3099 gene locus_tag LOCUS_22890 3677 3099 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence340 1711 74 gene locus_tag LOCUS_22900 1711 74 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258419.1 protein_id gnl|my_center|LOCUS_22900 2061 2555 gene locus_tag LOCUS_22910 gene cobU 2061 2555 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404268.1 protein_id gnl|my_center|LOCUS_22910 2565 3341 gene locus_tag LOCUS_22920 2565 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3338 4132 gene locus_tag LOCUS_22930 3338 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence341 1851 457 gene locus_tag LOCUS_22940 1851 457 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672386.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence342 530 219 gene locus_tag LOCUS_22950 gene clpS 530 219 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_22950 1260 2996 gene locus_tag LOCUS_22960 gene thrS 1260 2996 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665762.1 protein_id gnl|my_center|LOCUS_22960 3027 3743 gene locus_tag LOCUS_22970 3027 3743 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence343 803 96 gene locus_tag LOCUS_22980 803 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 1200 817 gene locus_tag LOCUS_22990 1200 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1542 1216 gene locus_tag LOCUS_23000 1542 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1764 1546 gene locus_tag LOCUS_23010 1764 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23010 3582 1837 gene locus_tag LOCUS_23020 3582 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence344 339 854 gene locus_tag LOCUS_23030 339 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 866 1507 gene locus_tag LOCUS_23040 866 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1654 2598 gene locus_tag LOCUS_23050 1654 2598 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_23050 2595 3200 gene locus_tag LOCUS_23060 2595 3200 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_23060 3193 3948 gene locus_tag LOCUS_23070 3193 3948 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence345 966 881 gene locus_tag LOCUS_t00260 966 881 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1123 1728 gene locus_tag LOCUS_23080 1123 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 1787 2935 gene locus_tag LOCUS_23090 gene nagA 1787 2935 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_23090 3582 2932 gene locus_tag LOCUS_23100 3582 2932 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_23100 4082 3585 gene locus_tag LOCUS_23110 4082 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence346 710 1654 gene locus_tag LOCUS_23120 710 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1644 2642 gene locus_tag LOCUS_23130 1644 2642 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence347 260 1699 gene locus_tag LOCUS_23140 gene guaB 260 1699 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_23140 1800 3029 gene locus_tag LOCUS_23150 1800 3029 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143270.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence348 <1 847 gene locus_tag LOCUS_23160 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259373.1:PAS domain S-box protein 907 3942 gene locus_tag LOCUS_23170 907 3942 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679389.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence349 665 105 gene locus_tag LOCUS_23180 665 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1478 696 gene locus_tag LOCUS_23190 1478 696 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679455.1 protein_id gnl|my_center|LOCUS_23190 2583 1567 gene locus_tag LOCUS_23200 2583 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3584 2580 gene locus_tag LOCUS_23210 3584 2580 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679456.1 protein_id gnl|my_center|LOCUS_23210 3874 3581 gene locus_tag LOCUS_23220 3874 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence350 2 313 gene locus_tag LOCUS_23230 2 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 463 1005 gene locus_tag LOCUS_23240 463 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1002 1811 gene locus_tag LOCUS_23250 1002 1811 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682054.1 protein_id gnl|my_center|LOCUS_23250 3391 1910 gene locus_tag LOCUS_23260 3391 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence351 914 42 gene locus_tag LOCUS_23270 914 42 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_23270 1807 911 gene locus_tag LOCUS_23280 1807 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2988 1807 gene locus_tag LOCUS_23290 2988 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3093 3494 gene locus_tag LOCUS_23300 3093 3494 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674983.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence352 1288 473 gene locus_tag LOCUS_23310 1288 473 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_23310 1899 1285 gene locus_tag LOCUS_23320 1899 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2007 2807 gene locus_tag LOCUS_23330 2007 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2849 3487 gene locus_tag LOCUS_23340 2849 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence353 1082 69 gene locus_tag LOCUS_23350 1082 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1224 2174 gene locus_tag LOCUS_23360 1224 2174 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966219.1 protein_id gnl|my_center|LOCUS_23360 <4033 2258 gene locus_tag LOCUS_23370 <4033 2258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:EAL domain-containing protein >Feature sequence354 1972 1391 gene locus_tag LOCUS_23380 1972 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2361 1969 gene locus_tag LOCUS_23390 2361 1969 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_23390 2593 2372 gene locus_tag LOCUS_23400 2593 2372 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622506.1 protein_id gnl|my_center|LOCUS_23400 3313 2621 gene locus_tag LOCUS_23410 3313 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 <4023 3393 gene locus_tag LOCUS_23420 <4023 3393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679415.1:apolipoprotein N-acyltransferase >Feature sequence355 1107 2033 gene locus_tag LOCUS_23430 1107 2033 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810616.1 protein_id gnl|my_center|LOCUS_23430 3882 2050 gene locus_tag LOCUS_23440 gene typA 3882 2050 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence356 1470 439 gene locus_tag LOCUS_23450 1470 439 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_23450 1602 2228 gene locus_tag LOCUS_23460 gene msrA 1602 2228 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229167.1 protein_id gnl|my_center|LOCUS_23460 2355 2972 gene locus_tag LOCUS_23470 2355 2972 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_23470 3085 3576 gene locus_tag LOCUS_23480 3085 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 3593 3991 gene locus_tag LOCUS_23490 3593 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence357 1718 1056 gene locus_tag LOCUS_23500 1718 1056 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_23500 2400 1729 gene locus_tag LOCUS_23510 2400 1729 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_23510 2639 3955 gene locus_tag LOCUS_23520 2639 3955 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence358 196 987 gene locus_tag LOCUS_23530 196 987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877600.1 protein_id gnl|my_center|LOCUS_23530 3284 1077 gene locus_tag LOCUS_23540 3284 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3424 3594 gene locus_tag LOCUS_23550 3424 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence359 127 2139 gene locus_tag LOCUS_23560 127 2139 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_23560 2451 3119 gene locus_tag LOCUS_23570 2451 3119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943846.1 protein_id gnl|my_center|LOCUS_23570 3727 3083 gene locus_tag LOCUS_23580 3727 3083 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393553.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence360 154 1668 gene locus_tag LOCUS_23590 154 1668 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183192023.1 protein_id gnl|my_center|LOCUS_23590 2424 1843 gene locus_tag LOCUS_23600 2424 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 <3939 2436 gene locus_tag LOCUS_23610 <3939 2436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355996.1:citrate lyase subunit alpha >Feature sequence361 567 2708 gene locus_tag LOCUS_23620 gene glgX 567 2708 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680950.1 protein_id gnl|my_center|LOCUS_23620 2961 3524 gene locus_tag LOCUS_23630 2961 3524 CDS product DUF6305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868890.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence362 2366 693 gene locus_tag LOCUS_23640 2366 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3554 2574 gene locus_tag LOCUS_23650 gene hflC 3554 2574 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence363 <1 941 gene locus_tag LOCUS_23660 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869551.1:aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein 1467 1030 gene locus_tag LOCUS_23670 1467 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1547 1963 gene locus_tag LOCUS_23680 1547 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2800 1979 gene locus_tag LOCUS_23690 2800 1979 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125007115.1 protein_id gnl|my_center|LOCUS_23690 <3904 2820 gene locus_tag LOCUS_23700 <3904 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence364 765 1616 gene locus_tag LOCUS_23710 765 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1629 2891 gene locus_tag LOCUS_23720 1629 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence365 1188 256 gene locus_tag LOCUS_23730 1188 256 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291304.1 protein_id gnl|my_center|LOCUS_23730 3228 2242 gene locus_tag LOCUS_23740 3228 2242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_23740 <3887 3229 gene locus_tag LOCUS_23750 <3887 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002902452.1:ABC transporter permease >Feature sequence366 978 268 gene locus_tag LOCUS_23760 978 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1575 1081 gene locus_tag LOCUS_23770 1575 1081 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389735.1 protein_id gnl|my_center|LOCUS_23770 1755 2360 gene locus_tag LOCUS_23780 1755 2360 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023903.1 protein_id gnl|my_center|LOCUS_23780 3245 2589 gene locus_tag LOCUS_23790 3245 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3513 3253 gene locus_tag LOCUS_23800 3513 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence367 568 984 gene locus_tag LOCUS_23810 568 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 902 2050 gene locus_tag LOCUS_23820 902 2050 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679870.1 protein_id gnl|my_center|LOCUS_23820 2052 3074 gene locus_tag LOCUS_23830 gene rlmN 2052 3074 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_23830 <3854 3082 gene locus_tag LOCUS_23840 <3854 3082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398813.1:metal-dependent exonucleaseMrfB >Feature sequence368 919 44 gene locus_tag LOCUS_23850 919 44 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_23850 2010 919 gene locus_tag LOCUS_23860 2010 919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583515.1 protein_id gnl|my_center|LOCUS_23860 3590 2007 gene locus_tag LOCUS_23870 3590 2007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence369 1061 567 gene locus_tag LOCUS_23880 1061 567 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_23880 2893 1214 gene locus_tag LOCUS_23890 2893 1214 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868953.1 protein_id gnl|my_center|LOCUS_23890 <3844 3119 gene locus_tag LOCUS_23900 <3844 3119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390978.1:GGDEF domain-containing protein >Feature sequence370 <1 564 gene locus_tag LOCUS_23910 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970459.1:MFS transporter 561 1475 gene locus_tag LOCUS_23920 561 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1495 1815 gene locus_tag LOCUS_23930 1495 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1976 1812 gene locus_tag LOCUS_23940 1976 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2602 1973 gene locus_tag LOCUS_23950 2602 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 <3822 2608 gene locus_tag LOCUS_23960 <3822 2608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015670.1:ATP/GTP-binding protein >Feature sequence371 <1 2120 gene locus_tag LOCUS_23970 <1 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682412.1:translation initiation factor IF-2 2101 2520 gene locus_tag LOCUS_23980 gene rbfA 2101 2520 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657228.1 protein_id gnl|my_center|LOCUS_23980 2517 3416 gene locus_tag LOCUS_23990 2517 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence372 1631 474 gene locus_tag LOCUS_24000 1631 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2024 1698 gene locus_tag LOCUS_24010 2024 1698 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_24010 2527 2102 gene locus_tag LOCUS_24020 2527 2102 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_24020 <3795 2535 gene locus_tag LOCUS_24030 <3795 2535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679079.1:MBL fold metallo-hydrolase >Feature sequence373 2136 409 gene locus_tag LOCUS_24040 2136 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3030 2161 gene locus_tag LOCUS_24050 gene ispH 3030 2161 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682405.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence374 68 1036 gene locus_tag LOCUS_24060 68 1036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479770.1 protein_id gnl|my_center|LOCUS_24060 1056 2162 gene locus_tag LOCUS_24070 1056 2162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889467.1 protein_id gnl|my_center|LOCUS_24070 2164 3210 gene locus_tag LOCUS_24080 2164 3210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence375 488 2446 gene locus_tag LOCUS_24090 488 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence376 <1 511 gene locus_tag LOCUS_24100 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002675802.1:ribosome recycling factor 524 1222 gene locus_tag LOCUS_24110 gene uppS 524 1222 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_24110 1219 2079 gene locus_tag LOCUS_24120 1219 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2084 3226 gene locus_tag LOCUS_24130 2084 3226 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence377 370 1458 gene locus_tag LOCUS_24140 gene fliG 370 1458 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668469.1 protein_id gnl|my_center|LOCUS_24140 1468 2391 gene locus_tag LOCUS_24150 gene fliH 1468 2391 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence378 1152 58 gene locus_tag LOCUS_24160 1152 58 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_24160 1781 1149 gene locus_tag LOCUS_24170 1781 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2263 2190 gene locus_tag LOCUS_t00270 2263 2190 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence379 343 1440 gene locus_tag LOCUS_24180 343 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1433 1654 gene locus_tag LOCUS_24190 gene rpsU 1433 1654 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_24190 1892 2407 gene locus_tag LOCUS_24200 1892 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2481 2969 gene locus_tag LOCUS_24210 gene def 2481 2969 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669259.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence380 346 1518 gene locus_tag LOCUS_24220 346 1518 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_24220 1774 3078 gene locus_tag LOCUS_24230 1774 3078 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975844.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence381 484 2067 gene locus_tag LOCUS_24240 484 2067 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence382 >Feature sequence383 <1 602 gene locus_tag LOCUS_24250 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878183.1:amino acid ABC transporter ATP-binding protein 635 1492 gene locus_tag LOCUS_24260 635 1492 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804394.1 protein_id gnl|my_center|LOCUS_24260 3276 1549 gene locus_tag LOCUS_24270 3276 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence384 <1 1791 gene locus_tag LOCUS_24280 <1 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680035.1:single-stranded-DNA-specific exonuclease RecJ 2006 2076 gene locus_tag LOCUS_t00280 2006 2076 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2110 2181 gene locus_tag LOCUS_t00290 2110 2181 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3526 2579 gene locus_tag LOCUS_24290 3526 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence385 782 2251 gene locus_tag LOCUS_24300 782 2251 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_24300 2244 3314 gene locus_tag LOCUS_24310 2244 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence386 652 251 gene locus_tag LOCUS_24320 652 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115856.1 protein_id gnl|my_center|LOCUS_24320 1118 786 gene locus_tag LOCUS_24330 1118 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1375 1115 gene locus_tag LOCUS_24340 1375 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1773 1372 gene locus_tag LOCUS_24350 1773 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2066 1770 gene locus_tag LOCUS_24360 2066 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2726 2067 gene locus_tag LOCUS_24370 2726 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3174 2719 gene locus_tag LOCUS_24380 3174 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence387 1542 529 gene locus_tag LOCUS_24390 1542 529 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_24390 2522 1539 gene locus_tag LOCUS_24400 2522 1539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_24400 3618 2548 gene locus_tag LOCUS_24410 3618 2548 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556930.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence388 1816 224 gene locus_tag LOCUS_24420 1816 224 CDS product bifunctional aspartate carbamoyltransferase catalytic subunit/aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082131.1 protein_id gnl|my_center|LOCUS_24420 3588 1867 gene locus_tag LOCUS_24430 3588 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence389 1837 1490 gene locus_tag LOCUS_24440 1837 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2296 1841 gene locus_tag LOCUS_24450 gene flgC 2296 1841 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657104.1 protein_id gnl|my_center|LOCUS_24450 2728 2309 gene locus_tag LOCUS_24460 gene flgB 2728 2309 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668460.1 protein_id gnl|my_center|LOCUS_24460 <3703 2825 gene locus_tag LOCUS_24470 <3703 2825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002677705.1:ATP-dependent protease ATPase subunit HslU >Feature sequence390 446 282 gene locus_tag LOCUS_24480 446 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1609 431 gene locus_tag LOCUS_24490 1609 431 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_24490 2124 1669 gene locus_tag LOCUS_24500 2124 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 <3703 2144 gene locus_tag LOCUS_24510 <3703 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680939.1:ribosome biogenesis GTPase Der >Feature sequence391 831 73 gene locus_tag LOCUS_24520 831 73 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_24520 1640 828 gene locus_tag LOCUS_24530 1640 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2759 1674 gene locus_tag LOCUS_24540 2759 1674 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence392 2454 790 gene locus_tag LOCUS_24550 2454 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 3541 2459 gene locus_tag LOCUS_24560 3541 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence393 1908 43 gene locus_tag LOCUS_24570 1908 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2699 1905 gene locus_tag LOCUS_24580 2699 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence394 211 1617 gene locus_tag LOCUS_24590 211 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2990 1743 gene locus_tag LOCUS_24600 2990 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence395 79 1548 gene locus_tag LOCUS_24610 79 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3392 1674 gene locus_tag LOCUS_24620 3392 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence396 925 224 gene locus_tag LOCUS_24630 925 224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_24630 1646 918 gene locus_tag LOCUS_24640 1646 918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_24640 2581 1643 gene locus_tag LOCUS_24650 2581 1643 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_24650 3501 2578 gene locus_tag LOCUS_24660 3501 2578 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence397 283 1302 gene locus_tag LOCUS_24670 283 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1295 1792 gene locus_tag LOCUS_24680 1295 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1802 2542 gene locus_tag LOCUS_24690 1802 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence398 <1 1233 gene locus_tag LOCUS_24700 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680609.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence399 <1 785 gene locus_tag LOCUS_24710 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190298.1:triphosphoribosyl-dephospho-CoA synthase 1447 869 gene locus_tag LOCUS_24720 1447 869 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_24720 1943 1868 gene locus_tag LOCUS_t00300 1943 1868 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2657 2049 gene locus_tag LOCUS_24730 2657 2049 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence400 809 1747 gene locus_tag LOCUS_24740 809 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667094.1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence401 2122 392 gene locus_tag LOCUS_24750 2122 392 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_24750 <3584 2150 gene locus_tag LOCUS_24760 <3584 2150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109491.1:FGGY-family carbohydrate kinase >Feature sequence402 2346 862 gene locus_tag LOCUS_24770 2346 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence403 <1 1383 gene locus_tag LOCUS_24780 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251097.1:methyl-accepting chemotaxis protein 1852 1421 gene locus_tag LOCUS_24790 1852 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2157 3023 gene locus_tag LOCUS_24800 gene pdxY 2157 3023 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_24800 3570 3040 gene locus_tag LOCUS_24810 3570 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence404 577 1692 gene locus_tag LOCUS_24820 577 1692 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_24820 1717 2505 gene locus_tag LOCUS_24830 1717 2505 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 protein_id gnl|my_center|LOCUS_24830 2611 3081 gene locus_tag LOCUS_24840 2611 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 <3579 3059 gene locus_tag LOCUS_24850 <3579 3059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933364.1:4Fe-4S binding protein >Feature sequence405 2769 1000 gene locus_tag LOCUS_24860 2769 1000 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_24860 3344 2766 gene locus_tag LOCUS_24870 3344 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence406 1333 1896 gene locus_tag LOCUS_24880 1333 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1906 3402 gene locus_tag LOCUS_24890 1906 3402 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence407 >Feature sequence408 <1 639 gene locus_tag LOCUS_24900 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963447.1:methyl-accepting chemotaxis protein 650 1183 gene locus_tag LOCUS_24910 650 1183 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_24910 1199 2038 gene locus_tag LOCUS_24920 1199 2038 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665509.1 protein_id gnl|my_center|LOCUS_24920 2040 2834 gene locus_tag LOCUS_24930 2040 2834 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257306.1 protein_id gnl|my_center|LOCUS_24930 2824 3366 gene locus_tag LOCUS_24940 2824 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence409 185 1039 gene locus_tag LOCUS_24950 185 1039 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768273.1 protein_id gnl|my_center|LOCUS_24950 1103 1642 gene locus_tag LOCUS_24960 1103 1642 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_24960 1644 2510 gene locus_tag LOCUS_24970 1644 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 <3509 2550 gene locus_tag LOCUS_24980 <3509 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963508.1:GNAT family N-acetyltransferase >Feature sequence410 790 5 gene locus_tag LOCUS_24990 790 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2872 794 gene locus_tag LOCUS_25000 2872 794 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066544.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence411 1561 302 gene locus_tag LOCUS_25010 1561 302 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263449.1 protein_id gnl|my_center|LOCUS_25010 1947 3299 gene locus_tag LOCUS_25020 1947 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence412 742 146 gene locus_tag LOCUS_25030 742 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1401 739 gene locus_tag LOCUS_25040 1401 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1958 1398 gene locus_tag LOCUS_25050 1958 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2710 2129 gene locus_tag LOCUS_25060 2710 2129 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_25060 2738 3388 gene locus_tag LOCUS_25070 2738 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence413 <1 752 gene locus_tag LOCUS_25080 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001973414.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 825 1397 gene locus_tag LOCUS_25090 gene cyaB 825 1397 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_25090 1531 2016 gene locus_tag LOCUS_25100 1531 2016 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 protein_id gnl|my_center|LOCUS_25100 2146 3198 gene locus_tag LOCUS_25110 2146 3198 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence414 <1 730 gene locus_tag LOCUS_25120 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813861.1:tRNA-dihydrouridine synthase family protein 1682 780 gene locus_tag LOCUS_25130 1682 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3044 1854 gene locus_tag LOCUS_25140 3044 1854 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868440.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence415 <1 999 gene locus_tag LOCUS_25150 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027559.1:sensor histidine kinase 1106 1387 gene locus_tag LOCUS_25160 1106 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1927 1556 gene locus_tag LOCUS_25170 1927 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2333 1986 gene locus_tag LOCUS_25180 2333 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2422 3120 gene locus_tag LOCUS_25190 2422 3120 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence416 212 1123 gene locus_tag LOCUS_25200 212 1123 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_25200 1190 2158 gene locus_tag LOCUS_25210 1190 2158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_25210 2155 2877 gene locus_tag LOCUS_25220 2155 2877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102804.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence417 468 1229 gene locus_tag LOCUS_25230 gene deoD 468 1229 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_25230 2745 1378 gene locus_tag LOCUS_25240 2745 1378 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_25240 <3370 2771 gene locus_tag LOCUS_25250 <3370 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925959.1:MBL fold metallo-hydrolase >Feature sequence418 1304 414 gene locus_tag LOCUS_25260 1304 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 <3370 1332 gene locus_tag LOCUS_25270 <3370 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679139.1:flagellar filament capping protein FliD >Feature sequence419 1239 154 gene locus_tag LOCUS_25280 1239 154 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682352.1 protein_id gnl|my_center|LOCUS_25280 2611 1250 gene locus_tag LOCUS_25290 2611 1250 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670521.1 protein_id gnl|my_center|LOCUS_25290 3057 2614 gene locus_tag LOCUS_25300 gene dut 3057 2614 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882709.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence420 1316 222 gene locus_tag LOCUS_25310 1316 222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_25310 2432 1437 gene locus_tag LOCUS_25320 2432 1437 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971999.1 protein_id gnl|my_center|LOCUS_25320 <3344 2648 gene locus_tag LOCUS_25330 <3344 2648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030258.1:response regulator transcription factor >Feature sequence421 76 711 gene locus_tag LOCUS_25340 76 711 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_25340 841 1431 gene locus_tag LOCUS_25350 841 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2431 1472 gene locus_tag LOCUS_25360 2431 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence422 3 473 gene locus_tag LOCUS_25370 3 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1951 464 gene locus_tag LOCUS_25380 1951 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence423 863 3148 gene locus_tag LOCUS_25390 863 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence424 5 1633 gene locus_tag LOCUS_25400 5 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1630 1956 gene locus_tag LOCUS_25410 1630 1956 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681819.1 protein_id gnl|my_center|LOCUS_25410 1956 2450 gene locus_tag LOCUS_25420 1956 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2821 3207 gene locus_tag LOCUS_25430 2821 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence425 1281 292 gene locus_tag LOCUS_25440 1281 292 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 protein_id gnl|my_center|LOCUS_25440 1430 2137 gene locus_tag LOCUS_25450 1430 2137 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_25450 2134 3261 gene locus_tag LOCUS_25460 2134 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence426 110 1777 gene locus_tag LOCUS_25470 110 1777 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_25470 2345 1941 gene locus_tag LOCUS_25480 2345 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2478 3254 gene locus_tag LOCUS_25490 2478 3254 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence427 42 449 gene locus_tag LOCUS_25500 42 449 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_25500 457 1623 gene locus_tag LOCUS_25510 457 1623 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_25510 2420 1620 gene locus_tag LOCUS_25520 2420 1620 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964706.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence428 2387 852 gene locus_tag LOCUS_25530 2387 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2961 2482 gene locus_tag LOCUS_25540 2961 2482 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678972.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence429 806 96 gene locus_tag LOCUS_25550 806 96 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_25550 1477 818 gene locus_tag LOCUS_25560 gene phoU 1477 818 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_25560 2380 1493 gene locus_tag LOCUS_25570 gene pstB 2380 1493 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_25570 <3258 2386 gene locus_tag LOCUS_25580 <3258 2386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256173.1:phosphate ABC transporter permease PstA >Feature sequence430 1880 618 gene locus_tag LOCUS_25590 1880 618 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_25590 2700 1927 gene locus_tag LOCUS_25600 2700 1927 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259466.1 protein_id gnl|my_center|LOCUS_25600 3246 2710 gene locus_tag LOCUS_25610 3246 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence431 <1 643 gene locus_tag LOCUS_25620 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148264.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase 640 1230 gene locus_tag LOCUS_25630 640 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1314 1823 gene locus_tag LOCUS_25640 1314 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 1826 2209 gene locus_tag LOCUS_25650 gene mutT 1826 2209 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_25650 <3248 2433 gene locus_tag LOCUS_25660 <3248 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036683.1:DUF2807 domain-containing protein >Feature sequence432 2008 476 gene locus_tag LOCUS_25670 2008 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2597 2151 gene locus_tag LOCUS_25680 2597 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 <3225 2594 gene locus_tag LOCUS_25690 <3225 2594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929927.1:thiolase family protein >Feature sequence433 1299 1 gene locus_tag LOCUS_25700 1299 1 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_25700 2476 1391 gene locus_tag LOCUS_25710 2476 1391 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670927.1 protein_id gnl|my_center|LOCUS_25710 3163 2555 gene locus_tag LOCUS_25720 3163 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence434 1200 352 gene locus_tag LOCUS_25730 1200 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 <3208 1277 gene locus_tag LOCUS_25740 <3208 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044858.1:ATP-binding protein >Feature sequence435 1706 558 gene locus_tag LOCUS_25750 1706 558 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808159.1 protein_id gnl|my_center|LOCUS_25750 3156 1714 gene locus_tag LOCUS_25760 3156 1714 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence436 551 378 gene locus_tag LOCUS_25770 551 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 573 3041 gene locus_tag LOCUS_25780 573 3041 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671244.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence437 2 502 gene locus_tag LOCUS_25790 2 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2629 638 gene locus_tag LOCUS_25800 2629 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence438 187 1377 gene locus_tag LOCUS_25810 187 1377 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_25810 1367 2269 gene locus_tag LOCUS_25820 1367 2269 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393421.1 protein_id gnl|my_center|LOCUS_25820 2397 2472 gene locus_tag LOCUS_t00310 2397 2472 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence439 260 27 gene locus_tag LOCUS_25830 260 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1145 885 gene locus_tag LOCUS_25840 1145 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2014 1226 gene locus_tag LOCUS_25850 2014 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2379 2011 gene locus_tag LOCUS_25860 2379 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2549 2376 gene locus_tag LOCUS_25870 2549 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2857 2546 gene locus_tag LOCUS_25880 2857 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence440 1765 356 gene locus_tag LOCUS_25890 1765 356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682384.1 protein_id gnl|my_center|LOCUS_25890 2802 1762 gene locus_tag LOCUS_25900 2802 1762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670594.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence441 284 1162 gene locus_tag LOCUS_25910 284 1162 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_25910 1159 1746 gene locus_tag LOCUS_25920 1159 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 <3104 1855 gene locus_tag LOCUS_25930 <3104 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein >Feature sequence442 774 235 gene locus_tag LOCUS_25940 774 235 CDS product DUF6512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083042.1 protein_id gnl|my_center|LOCUS_25940 998 2059 gene locus_tag LOCUS_25950 998 2059 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926948.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence443 <1 1125 gene locus_tag LOCUS_25960 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681086.1:VWA domain-containing protein 1211 2149 gene locus_tag LOCUS_25970 1211 2149 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667792.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence444 855 1289 gene locus_tag LOCUS_25980 gene flgD 855 1289 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666981.1 protein_id gnl|my_center|LOCUS_25980 1304 2698 gene locus_tag LOCUS_25990 gene flgE 1304 2698 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_25990 2774 2971 gene locus_tag LOCUS_26000 2774 2971 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680829.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence445 142 393 gene locus_tag LOCUS_26010 142 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 390 1127 gene locus_tag LOCUS_26020 390 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1124 1522 gene locus_tag LOCUS_26030 1124 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1519 2445 gene locus_tag LOCUS_26040 1519 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2451 2636 gene locus_tag LOCUS_26050 2451 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence446 156 1025 gene locus_tag LOCUS_26060 156 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_26060 1105 2862 gene locus_tag LOCUS_26070 gene ptsP 1105 2862 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence447 1564 269 gene locus_tag LOCUS_26080 1564 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1733 2500 gene locus_tag LOCUS_26090 1733 2500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669374.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence448 <1 751 gene locus_tag LOCUS_26100 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082059.1:F0F1 ATP synthase subunit beta 761 1177 gene locus_tag LOCUS_26110 761 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1496 1302 gene locus_tag LOCUS_26120 1496 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670390.1 protein_id gnl|my_center|LOCUS_26120 2063 1542 gene locus_tag LOCUS_26130 2063 1542 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021158.1 protein_id gnl|my_center|LOCUS_26130 2969 2172 gene locus_tag LOCUS_26140 2969 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence449 <1 927 gene locus_tag LOCUS_26150 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000575935.1:beta-galactosidase 1013 1768 gene locus_tag LOCUS_26160 1013 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence450 540 1508 gene locus_tag LOCUS_26170 540 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2404 1727 gene locus_tag LOCUS_26180 2404 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 <3044 2471 gene locus_tag LOCUS_26190 <3044 2471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679113.1:diguanylate cyclase >Feature sequence451 2345 882 gene locus_tag LOCUS_26200 gene nusA 2345 882 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_26200 2800 2351 gene locus_tag LOCUS_26210 2800 2351 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880117.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence452 1484 1086 gene locus_tag LOCUS_26220 1484 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2143 1481 gene locus_tag LOCUS_26230 2143 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence453 1503 871 gene locus_tag LOCUS_26240 1503 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1676 2938 gene locus_tag LOCUS_26250 1676 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence454 838 1653 gene locus_tag LOCUS_26260 838 1653 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250428.1 protein_id gnl|my_center|LOCUS_26260 <2993 1650 gene locus_tag LOCUS_26270 <2993 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956725.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence455 496 194 gene locus_tag LOCUS_26280 496 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 660 1718 gene locus_tag LOCUS_26290 660 1718 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091679.1 protein_id gnl|my_center|LOCUS_26290 2161 1796 gene locus_tag LOCUS_26300 2161 1796 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671005.1 protein_id gnl|my_center|LOCUS_26300 2572 2291 gene locus_tag LOCUS_26310 2572 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence456 632 135 gene locus_tag LOCUS_26320 632 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1276 851 gene locus_tag LOCUS_26330 1276 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1808 1443 gene locus_tag LOCUS_26340 1808 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence457 <1 1412 gene locus_tag LOCUS_26350 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000346255.1:serine hydrolase 2782 1463 gene locus_tag LOCUS_26360 2782 1463 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence458 <1 633 gene locus_tag LOCUS_26370 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107821.1:tryptophanase 731 1147 gene locus_tag LOCUS_26380 731 1147 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence459 >Feature sequence460 1659 2261 gene locus_tag LOCUS_26390 1659 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 <2929 2336 gene locus_tag LOCUS_26400 <2929 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869356.1:urocanate hydratase >Feature sequence461 2857 878 gene locus_tag LOCUS_26410 gene ftsH 2857 878 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666001.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence462 >Feature sequence463 582 25 gene locus_tag LOCUS_26420 582 25 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393424.1 protein_id gnl|my_center|LOCUS_26420 2257 893 gene locus_tag LOCUS_26430 2257 893 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250239.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence464 <1 970 gene locus_tag LOCUS_26440 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337405.1:NAD+ synthase >Feature sequence465 995 1897 gene locus_tag LOCUS_26450 995 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence466 45 944 gene locus_tag LOCUS_26460 gene ispE 45 944 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_26460 990 1274 gene locus_tag LOCUS_26470 gene spoVG 990 1274 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_26470 1305 1376 gene locus_tag LOCUS_t00320 1305 1376 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1417 2061 gene locus_tag LOCUS_26480 1417 2061 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence467 678 181 gene locus_tag LOCUS_26490 678 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1731 754 gene locus_tag LOCUS_26500 1731 754 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943425.1 protein_id gnl|my_center|LOCUS_26500 2642 1779 gene locus_tag LOCUS_26510 2642 1779 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence468 1557 913 gene locus_tag LOCUS_26520 1557 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 <2893 1554 gene locus_tag LOCUS_26530 <2893 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667047.1:ribose-phosphate pyrophosphokinase >Feature sequence469 346 1419 gene locus_tag LOCUS_26540 gene gap 346 1419 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_26540 1532 2794 gene locus_tag LOCUS_26550 1532 2794 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679428.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence470 1424 516 gene locus_tag LOCUS_26560 1424 516 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818441.1 protein_id gnl|my_center|LOCUS_26560 2032 1481 gene locus_tag LOCUS_26570 2032 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 <2888 2381 gene locus_tag LOCUS_26580 <2888 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679737.1:OmpA family protein >Feature sequence471 4 489 gene locus_tag LOCUS_26590 4 489 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_26590 473 1837 gene locus_tag LOCUS_26600 gene aroA 473 1837 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_26600 2719 1919 gene locus_tag LOCUS_26610 2719 1919 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence472 <1 639 gene locus_tag LOCUS_26620 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868853.1:PAS domain S-box protein 2413 650 gene locus_tag LOCUS_26630 2413 650 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence473 396 2366 gene locus_tag LOCUS_26640 gene tkt 396 2366 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678841.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence474 1351 2112 gene locus_tag LOCUS_26650 gene map 1351 2112 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence475 1643 852 gene locus_tag LOCUS_26660 1643 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2578 1640 gene locus_tag LOCUS_26670 2578 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence476 2363 186 gene locus_tag LOCUS_26680 2363 186 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence477 1307 2731 gene locus_tag LOCUS_26690 1307 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence478 >Feature sequence479 1884 208 gene locus_tag LOCUS_26700 1884 208 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_26700 <2800 2082 gene locus_tag LOCUS_26710 <2800 2082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668533.1:HD-GYP domain-containing protein >Feature sequence480 <1 635 gene locus_tag LOCUS_26720 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037985.1:hemolysin III family protein 748 1818 gene locus_tag LOCUS_26730 748 1818 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172726.1 protein_id gnl|my_center|LOCUS_26730 <2773 1836 gene locus_tag LOCUS_26740 <2773 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969582.1:adenosylcobinamide-phosphate synthase CbiB >Feature sequence481 1970 927 gene locus_tag LOCUS_26750 gene glk 1970 927 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence482 379 1011 gene locus_tag LOCUS_26760 gene tmk 379 1011 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_26760 1078 1686 gene locus_tag LOCUS_26770 1078 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680583.1 protein_id gnl|my_center|LOCUS_26770 2044 2322 gene locus_tag LOCUS_26780 2044 2322 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028883.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence483 1411 338 gene locus_tag LOCUS_26790 1411 338 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_26790 <2738 1413 gene locus_tag LOCUS_26800 <2738 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016301.1:iron ABC transporter permease >Feature sequence484 <1 985 gene locus_tag LOCUS_26810 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143435.1:ribosome small subunit-dependent GTPase A <2726 1067 gene locus_tag LOCUS_26820 <2726 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876085.1:response regulator >Feature sequence485 <1 954 gene locus_tag LOCUS_26830 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668604.1:TldD/PmbA family protein 957 2261 gene locus_tag LOCUS_26840 957 2261 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence486 2283 1345 gene locus_tag LOCUS_26850 2283 1345 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence487 >Feature sequence488 1612 896 gene locus_tag LOCUS_26860 1612 896 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence489 <1 2141 gene locus_tag LOCUS_26870 <1 2141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941190.1:DEAD/DEAH box helicase >Feature sequence490 277 1038 gene locus_tag LOCUS_26880 277 1038 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680051.1 protein_id gnl|my_center|LOCUS_26880 1072 1590 gene locus_tag LOCUS_26890 gene lspA 1072 1590 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_26890 1587 1847 gene locus_tag LOCUS_26900 1587 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence491 1638 475 gene locus_tag LOCUS_26910 1638 475 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865127.1 protein_id gnl|my_center|LOCUS_26910 2470 1778 gene locus_tag LOCUS_26920 2470 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence492 >Feature sequence493 <1 1445 gene locus_tag LOCUS_26930 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682356.1:elongation factor G 1666 2370 gene locus_tag LOCUS_26940 1666 2370 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence494 84 677 gene locus_tag LOCUS_26950 84 677 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_26950 1249 779 gene locus_tag LOCUS_26960 gene bfr 1249 779 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_26960 1730 1284 gene locus_tag LOCUS_26970 1730 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 <2618 1809 gene locus_tag LOCUS_26980 <2618 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787371.1:catalase >Feature sequence495 148 915 gene locus_tag LOCUS_26990 148 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 <2617 891 gene locus_tag LOCUS_27000 <2617 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000558138.1:PAS domain-containing protein >Feature sequence496 777 226 gene locus_tag LOCUS_27010 777 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 955 2319 gene locus_tag LOCUS_27020 955 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence497 1444 353 gene locus_tag LOCUS_27030 1444 353 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202472.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence498 187 768 gene locus_tag LOCUS_27040 187 768 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_27040 1029 2438 gene locus_tag LOCUS_27050 1029 2438 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence499 1542 613 gene locus_tag LOCUS_27060 1542 613 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence500 <1 1152 gene locus_tag LOCUS_27070 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393776.1:aminopeptidase 1187 1723 gene locus_tag LOCUS_27080 1187 1723 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459628.1 protein_id gnl|my_center|LOCUS_27080 2137 1850 gene locus_tag LOCUS_27090 2137 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence501 <1 781 gene locus_tag LOCUS_27100 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462256.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein 1340 786 gene locus_tag LOCUS_27110 1340 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2227 1340 gene locus_tag LOCUS_27120 gene amrB 2227 1340 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence502 >Feature sequence503 <1 852 gene locus_tag LOCUS_27130 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263406.1:threonine synthase 849 1766 gene locus_tag LOCUS_27140 gene thrB 849 1766 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_27140 <2573 1797 gene locus_tag LOCUS_27150 <2573 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679589.1:GTPase Era >Feature sequence504 134 319 gene locus_tag LOCUS_27160 134 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 1434 904 gene locus_tag LOCUS_27170 1434 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence505 844 185 gene locus_tag LOCUS_27180 844 185 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_27180 2223 841 gene locus_tag LOCUS_27190 2223 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence506 554 321 gene locus_tag LOCUS_27200 554 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1959 556 gene locus_tag LOCUS_27210 1959 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 <2555 2027 gene locus_tag LOCUS_27220 <2555 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003565079.1:GNAT family N-acetyltransferase >Feature sequence507 1927 1334 gene locus_tag LOCUS_27230 1927 1334 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366516.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence508 1300 536 gene locus_tag LOCUS_27240 1300 536 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_27240 1521 1297 gene locus_tag LOCUS_27250 1521 1297 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_27250 2000 1524 gene locus_tag LOCUS_27260 2000 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223906.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence509 <1 821 gene locus_tag LOCUS_27270 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938391.1:sodium-dependent transporter 1006 818 gene locus_tag LOCUS_27280 1006 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 <2525 1195 gene locus_tag LOCUS_27290 <2525 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678792.1:transcription-repair coupling factor >Feature sequence510 747 475 gene locus_tag LOCUS_27300 747 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2486 888 gene locus_tag LOCUS_27310 2486 888 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence511 149 1033 gene locus_tag LOCUS_27320 149 1033 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730346.1 protein_id gnl|my_center|LOCUS_27320 1030 1890 gene locus_tag LOCUS_27330 1030 1890 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence512 48 1823 gene locus_tag LOCUS_27340 48 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1898 1971 gene locus_tag LOCUS_t00330 1898 1971 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence513 <2472 1523 gene locus_tag LOCUS_27350 <2472 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582759.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence514 1265 1191 gene locus_tag LOCUS_t00340 1265 1191 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1777 1322 gene locus_tag LOCUS_27360 gene bcp 1777 1322 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_27360 <2471 1800 gene locus_tag LOCUS_27370 <2471 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899114.1:M48 family metallopeptidase >Feature sequence515 <1 541 gene locus_tag LOCUS_27380 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439904.1:MurR/RpiR family transcriptional regulator 590 1507 gene locus_tag LOCUS_27390 gene murQ 590 1507 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704387.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence516 <1 668 gene locus_tag LOCUS_27400 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259009.1:L-threonylcarbamoyladenylate synthase 719 1111 gene locus_tag LOCUS_27410 719 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 <2462 1108 gene locus_tag LOCUS_27420 <2462 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680167.1:lytic transglycosylase domain-containing protein >Feature sequence517 949 551 gene locus_tag LOCUS_27430 949 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1498 1052 gene locus_tag LOCUS_27440 1498 1052 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_27440 1655 2275 gene locus_tag LOCUS_27450 1655 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence518 157 75 gene locus_tag LOCUS_t00350 157 75 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 278 2269 gene locus_tag LOCUS_27460 278 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence519 >Feature sequence520 2411 1902 gene locus_tag LOCUS_27470 2411 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence521 >Feature sequence522 186 1253 gene locus_tag LOCUS_27480 186 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1265 2332 gene locus_tag LOCUS_27490 1265 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence523 <1 788 gene locus_tag LOCUS_27500 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072723.1:exodeoxyribonuclease I 1011 2264 gene locus_tag LOCUS_27510 1011 2264 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence524 1537 902 gene locus_tag LOCUS_27520 gene pncA 1537 902 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence525 57 1862 gene locus_tag LOCUS_27530 57 1862 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence526 503 1798 gene locus_tag LOCUS_27540 503 1798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679815.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence527 <1 1017 gene locus_tag LOCUS_27550 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680169.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence528 387 566 gene locus_tag LOCUS_27560 387 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1752 619 gene locus_tag LOCUS_27570 1752 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence529 1176 124 gene locus_tag LOCUS_27580 1176 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1874 1173 gene locus_tag LOCUS_27590 1874 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence530 1575 562 gene locus_tag LOCUS_27600 1575 562 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_27600 <2335 1687 gene locus_tag LOCUS_27610 <2335 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680508.1:SAM-dependent methyltransferase >Feature sequence531 >Feature sequence532 1339 296 gene locus_tag LOCUS_27620 gene mltG 1339 296 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671179.1 protein_id gnl|my_center|LOCUS_27620 1685 1344 gene locus_tag LOCUS_27630 1685 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 <2318 1689 gene locus_tag LOCUS_27640 <2318 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669065.1:MBL fold metallo-hydrolase >Feature sequence533 1 894 gene locus_tag LOCUS_27650 1 894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_27650 887 1789 gene locus_tag LOCUS_27660 887 1789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence534 <1 630 gene locus_tag LOCUS_27670 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037847.1:pirin family protein 1375 806 gene locus_tag LOCUS_27680 gene ymdB 1375 806 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203944.1 protein_id gnl|my_center|LOCUS_27680 <2306 1427 gene locus_tag LOCUS_27690 <2306 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228819.1:ABC transporter ATP-binding protein >Feature sequence535 <1 1261 gene locus_tag LOCUS_27700 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766061.1:AGE family epimerase/isomerase 1258 2295 gene locus_tag LOCUS_27710 gene murQ 1258 2295 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817228.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence536 229 1524 gene locus_tag LOCUS_27720 229 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2237 1650 gene locus_tag LOCUS_27730 2237 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence537 <1 1860 gene locus_tag LOCUS_27740 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272394.1:phage terminase large subunit family protein 1981 2238 gene locus_tag LOCUS_27750 1981 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence538 >Feature sequence539 1803 838 gene locus_tag LOCUS_27760 1803 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence540 247 1269 gene locus_tag LOCUS_27770 247 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2241 1387 gene locus_tag LOCUS_27780 2241 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence541 1421 159 gene locus_tag LOCUS_27790 1421 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679110.1 protein_id gnl|my_center|LOCUS_27790 <2250 1462 gene locus_tag LOCUS_27800 <2250 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529512.1:polysaccharide deacetylase family protein >Feature sequence542 116 1405 gene locus_tag LOCUS_27810 gene lysA 116 1405 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence543 <1 1586 gene locus_tag LOCUS_27820 <1 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001087028.1:alpha-glucosidase >Feature sequence544 945 529 gene locus_tag LOCUS_27830 945 529 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392929.1 protein_id gnl|my_center|LOCUS_27830 1975 1040 gene locus_tag LOCUS_27840 1975 1040 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791727.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence545 1698 1360 gene locus_tag LOCUS_27850 1698 1360 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812158.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence546 <1 683 gene locus_tag LOCUS_27860 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666986.1:motility protein A 696 1430 gene locus_tag LOCUS_27870 gene motB 696 1430 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666988.1 protein_id gnl|my_center|LOCUS_27870 1587 2141 gene locus_tag LOCUS_27880 1587 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence547 1541 936 gene locus_tag LOCUS_27890 1541 936 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_27890 <2198 1616 gene locus_tag LOCUS_27900 <2198 1616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119387.1:ribokinase >Feature sequence548 382 1326 gene locus_tag LOCUS_27910 382 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 <2197 1415 gene locus_tag LOCUS_27920 <2197 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004349090.1:alpha/beta hydrolase >Feature sequence549 >Feature sequence550 1348 809 gene locus_tag LOCUS_27930 1348 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 <2185 1348 gene locus_tag LOCUS_27940 <2185 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328387.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence551 1882 377 gene locus_tag LOCUS_27950 1882 377 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808163.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence552 2177 342 gene locus_tag LOCUS_27960 2177 342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966555.1 protein_id gnl|my_center|LOCUS_27960 >Feature sequence553 <1 2005 gene locus_tag LOCUS_27970 <1 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681868.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence554 <2173 261 gene locus_tag LOCUS_27980 <2173 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203082.1:SpoIIE family protein phosphatase >Feature sequence555 7 1290 gene locus_tag LOCUS_27990 7 1290 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680271.1 protein_id gnl|my_center|LOCUS_27990 1301 1753 gene locus_tag LOCUS_28000 1301 1753 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_28000 1758 1988 gene locus_tag LOCUS_28010 gene csrA 1758 1988 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667708.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence556 >Feature sequence557 705 211 gene locus_tag LOCUS_28020 705 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence558 646 1806 gene locus_tag LOCUS_28030 646 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence559 <2134 1489 gene locus_tag LOCUS_28040 <2134 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868893.1:succinylglutamate desuccinylase/aspartoacylase family protein >Feature sequence560 175 1161 gene locus_tag LOCUS_28050 175 1161 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_28050 2085 1168 gene locus_tag LOCUS_28060 2085 1168 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943315.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence561 1081 1575 gene locus_tag LOCUS_28070 1081 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence562 1568 342 gene locus_tag LOCUS_28080 1568 342 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_28080 <2118 1582 gene locus_tag LOCUS_28090 <2118 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931718.1:UDP-glucose 4-epimerase GalE >Feature sequence563 >Feature sequence564 <1 1310 gene locus_tag LOCUS_28100 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582931.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein >Feature sequence565 348 830 gene locus_tag LOCUS_28110 348 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 1777 791 gene locus_tag LOCUS_28120 1777 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence566 <1 584 gene locus_tag LOCUS_28130 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680552.1:tRNA 4-thiouridine(8) synthase ThiI 1027 671 gene locus_tag LOCUS_28140 1027 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1151 1525 gene locus_tag LOCUS_28150 1151 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2039 1575 gene locus_tag LOCUS_28160 2039 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence567 >Feature sequence568 1108 245 gene locus_tag LOCUS_28170 1108 245 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_28170 2016 1105 gene locus_tag LOCUS_28180 2016 1105 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence569 987 1664 gene locus_tag LOCUS_28190 987 1664 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence570 563 222 gene locus_tag LOCUS_28200 563 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668328.1 protein_id gnl|my_center|LOCUS_28200 621 1913 gene locus_tag LOCUS_28210 621 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence571 1697 525 gene locus_tag LOCUS_28220 1697 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence572 1234 362 gene locus_tag LOCUS_28230 1234 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1508 2005 gene locus_tag LOCUS_28240 1508 2005 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975070.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence573 1692 1171 gene locus_tag LOCUS_28250 1692 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence574 867 583 gene locus_tag LOCUS_28260 867 583 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence575 566 12 gene locus_tag LOCUS_28270 566 12 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence576 <1 1032 gene locus_tag LOCUS_28280 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028898.1:PLP-dependent aminotransferase family protein 1553 1254 gene locus_tag LOCUS_28290 gene yhbY 1553 1254 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016990.1 protein_id gnl|my_center|LOCUS_28290 2054 1626 gene locus_tag LOCUS_28300 2054 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence577 170 1015 gene locus_tag LOCUS_28310 170 1015 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330130.1 protein_id gnl|my_center|LOCUS_28310 1040 1894 gene locus_tag LOCUS_28320 1040 1894 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528865.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence578 929 1002 gene locus_tag LOCUS_t00360 929 1002 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1101 1490 gene locus_tag LOCUS_28330 1101 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence579 1824 37 gene locus_tag LOCUS_28340 1824 37 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence580 <1 635 gene locus_tag LOCUS_28350 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393494.1:threonine synthase >Feature sequence581 1389 106 gene locus_tag LOCUS_28360 1389 106 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence582 163 90 gene locus_tag LOCUS_t00370 163 90 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 817 353 gene locus_tag LOCUS_28370 817 353 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668974.1 protein_id gnl|my_center|LOCUS_28370 <1994 853 gene locus_tag LOCUS_28380 <1994 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671242.1:chemotaxis protein CheW >Feature sequence583 >Feature sequence584 8 1066 gene locus_tag LOCUS_28390 8 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 <1990 1098 gene locus_tag LOCUS_28400 <1990 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971592.1:2-hydroxyacid dehydrogenase >Feature sequence585 >Feature sequence586 <1 1612 gene locus_tag LOCUS_28410 <1 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966556.1:ABC transporter ATP-binding protein >Feature sequence587 622 56 gene locus_tag LOCUS_28420 gene efp 622 56 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 protein_id gnl|my_center|LOCUS_28420 1953 715 gene locus_tag LOCUS_28430 gene earP 1953 715 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707001.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence588 781 1929 gene locus_tag LOCUS_28440 781 1929 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680626.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence589 1331 501 gene locus_tag LOCUS_28450 1331 501 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228978.1 protein_id gnl|my_center|LOCUS_28450 <1938 1340 gene locus_tag LOCUS_28460 <1938 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_186277851.1:isochorismatase family protein >Feature sequence590 >Feature sequence591 1621 524 gene locus_tag LOCUS_28470 1621 524 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868893.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence592 >Feature sequence593 15 1163 gene locus_tag LOCUS_28480 15 1163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_28480 1160 1648 gene locus_tag LOCUS_28490 1160 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence594 <1 829 gene locus_tag LOCUS_28500 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680053.1:ATP-grasp domain-containing protein 826 1464 gene locus_tag LOCUS_28510 826 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28510 >Feature sequence595 1308 661 gene locus_tag LOCUS_28520 1308 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669375.1 protein_id gnl|my_center|LOCUS_28520 <1889 1305 gene locus_tag LOCUS_28530 <1889 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678931.1:valine--tRNA ligase >Feature sequence596 141 725 gene locus_tag LOCUS_28540 141 725 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020556.1 protein_id gnl|my_center|LOCUS_28540 1582 722 gene locus_tag LOCUS_28550 1582 722 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916726.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence597 232 996 gene locus_tag LOCUS_28560 232 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 993 1451 gene locus_tag LOCUS_28570 993 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1448 1762 gene locus_tag LOCUS_28580 1448 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence598 >Feature sequence599 <1 727 gene locus_tag LOCUS_28590 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974156.1:ABC transporter substrate-binding protein 751 1383 gene locus_tag LOCUS_28600 751 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence600 <1 593 gene locus_tag LOCUS_28610 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967875.1:GNAT family N-acetyltransferase 590 1153 gene locus_tag LOCUS_28620 590 1153 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence601 <1 801 gene locus_tag LOCUS_28630 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005693541.1:baseplate J/gp47 family protein 792 1397 gene locus_tag LOCUS_28640 792 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence602 466 1236 gene locus_tag LOCUS_28650 466 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence603 199 990 gene locus_tag LOCUS_28660 199 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence604 185 1774 gene locus_tag LOCUS_28670 gene nagZ 185 1774 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence605 695 231 gene locus_tag LOCUS_28680 695 231 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583626.1 protein_id gnl|my_center|LOCUS_28680 1464 880 gene locus_tag LOCUS_28690 1464 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence606 <1 1185 gene locus_tag LOCUS_28700 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680952.1:cysteine desulfurase family protein >Feature sequence607 1551 487 gene locus_tag LOCUS_28710 1551 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence608 >Feature sequence609 273 923 gene locus_tag LOCUS_28720 273 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 <1782 990 gene locus_tag LOCUS_28730 <1782 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868782.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence610 >Feature sequence611 832 194 gene locus_tag LOCUS_28740 832 194 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_28740 991 1773 gene locus_tag LOCUS_28750 991 1773 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence612 >Feature sequence613 <1 782 gene locus_tag LOCUS_28760 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679546.1:outer membrane lipoprotein-sorting protein >Feature sequence614 259 1023 gene locus_tag LOCUS_28770 259 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 1142 1462 gene locus_tag LOCUS_28780 1142 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence615 <1 693 gene locus_tag LOCUS_28790 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367511.1:GGDEF domain-containing protein 1759 704 gene locus_tag LOCUS_28800 1759 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence616 >Feature sequence617 <1 1737 gene locus_tag LOCUS_28810 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250553.1:ATP synthase subunit A >Feature sequence618 >Feature sequence619 >Feature sequence620 >Feature sequence621 421 1476 gene locus_tag LOCUS_28820 421 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence622 227 1279 gene locus_tag LOCUS_28830 227 1279 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence623 33 1025 gene locus_tag LOCUS_28840 33 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 1081 1545 gene locus_tag LOCUS_28850 gene gspG 1081 1545 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence624 1005 472 gene locus_tag LOCUS_28860 gene purE 1005 472 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_28860 1147 1677 gene locus_tag LOCUS_28870 1147 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence625 684 28 gene locus_tag LOCUS_28880 684 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1364 681 gene locus_tag LOCUS_28890 1364 681 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence626 <1 828 gene locus_tag LOCUS_28900 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337386.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit F 838 1290 gene locus_tag LOCUS_28910 838 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence627 1262 105 gene locus_tag LOCUS_28920 1262 105 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680601.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence628 1527 487 gene locus_tag LOCUS_28930 1527 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence629 <1672 320 gene locus_tag LOCUS_28940 <1672 320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242525.1:bifunctional UDP-sugar hydrolase/5'-nucleotidase >Feature sequence630 327 13 gene locus_tag LOCUS_28950 327 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1238 339 gene locus_tag LOCUS_28960 1238 339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence631 3 266 gene locus_tag LOCUS_28970 3 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1364 480 gene locus_tag LOCUS_28980 1364 480 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680076.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence632 >Feature sequence633 <1 511 gene locus_tag LOCUS_28990 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876792.1:BadF/BadG/BcrA/BcrD ATPase family protein <1632 628 gene locus_tag LOCUS_29000 <1632 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682194.1:UvrD-helicase domain-containing protein >Feature sequence634 1347 238 gene locus_tag LOCUS_29010 gene ychF 1347 238 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence635 379 1581 gene locus_tag LOCUS_29020 379 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence636 1462 545 gene locus_tag LOCUS_29030 1462 545 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045008.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence637 1207 1135 gene locus_tag LOCUS_t00380 1207 1135 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1318 1238 gene locus_tag LOCUS_t00390 1318 1238 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1518 1446 gene locus_tag LOCUS_t00400 1518 1446 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence638 840 319 gene locus_tag LOCUS_29040 840 319 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence639 >Feature sequence640 >Feature sequence641 >Feature sequence642 1533 214 gene locus_tag LOCUS_29050 1533 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence643 615 1373 gene locus_tag LOCUS_29060 615 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence644 142 951 gene locus_tag LOCUS_29070 142 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 <1530 899 gene locus_tag LOCUS_29080 <1530 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545509.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence645 >Feature sequence646 >Feature sequence647 >Feature sequence648 7 855 gene locus_tag LOCUS_29090 7 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence649 954 586 gene locus_tag LOCUS_29100 954 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1195 956 gene locus_tag LOCUS_29110 1195 956 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence650 242 925 gene locus_tag LOCUS_29120 242 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence651 513 343 gene locus_tag LOCUS_29130 513 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 <1510 702 gene locus_tag LOCUS_29140 <1510 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259715.1:DUF4032 domain-containing protein